Associated Herpesvirus and a Novel Spirorchis Sp. in an Eastern Box Turtle (Terrapene Carolina Carolina)

Coinfection with a Novel Fibropapilloma- Associated Herpesvirus and a Novel Spirorchis sp. in an Eastern Box Turtle (Terrapene Carolina Carolina)

By: Sara Yonkers [email protected] College of Agriculture and Life Sciences University of Florida

April 7, 2014

Advised by: Dr. Jim Wellehan Small Animal Clinical Sciences University of Florida

Thesis submitted to the University of Florida

College of Agriculture and Life Sciences

Honors Program

April 7, 2014

Approved by:

______Jim Wellehan, D.V.M., Ph.D. Stephanie Wohlgemuth, Ph.D. [email protected] [email protected] Faculty Mentor CALS Honors Coordinator

______Joel Yelich, Ph.D. [email protected] Animal Sciences Adviser

Abstract

Herpesviruses in the genus Scutavirus are important pathogens of chelonians, and include

Chelonid Herpesvirus 5, associated with fibropapillomatosis in sea turtles. Spirorchid trematodes are blood flukes that reside within the cardiovascular system of marine turtles and are often associated with severe disease (Jacobson et al., 1991; Tkach et al., 2009; Matushima et al.,

2001). An Eastern box turtle (Terrapene carolina carolina) at the South Florida Wildlife Care

Center in Fort Lauderdale, Florida, presented with papillomatous growths behind both rear legs.

Surgical removal resulted in remission for eight months, but lesions returned so additional surgery and acyclovir therapy was performed. The animal became anorexic and was euthanized due to poor quality of life. Biopsies were taken in October of 2012, and histopathologic examination revealed inflamed cutaneous papillomas and granulomas within the superficial dermis containing fragmented and collapsed brown trematode eggs surrounded by multinucleated giant cells and epithelial macrophages. Pan-herpesviral and Pan-trematode consensus PCR and sequencing were run on tissue samples submitted to the University of

Florida. New combinations of primers for this sample were tested with PCR to obtain sequence regions needed for phylogenetic analysis. The majority of the tested primers were successful in amplifying target herpesviral and spirorchid DNA fragments. DNA product was sequenced from excised bands produced by gel electrophoresis. Comparative sequence analysis revealed a novel alphaherpesvirus in the genus Scutavirus, and a novel trematode in the genus Spirorchis. This represents the second Scutavirus and the first Spirorchis sp. found in Eastern box turtles. While we do not yet have a complete understanding of herpesviruses and trematodes found in Eastern box turtles, the findings thus presented provide initial insights into the disease relationships among these chelonians.

Table of Contents

Abstract……………………………………………………………………………...... 3

Table of Contents…………………………………………………………………………...... ….4

List of Figures and Tables……………………………………………………………….....…....6

Introduction……………………….…………………………………………………...... 8

1.1 Phylogeny…………………………………………………………….……...... 8

1.2 Herpesvirus Detection………………………………………………………………....8

1.3 Fibropapilloma-Associated Herpesvirus………………………………………………9

1.4 Disease Associations………………………………………………………….……...10

1.5 Disease Related Signs………...... 11

1.6 Disease Transmission...... 12

1.7 Disease Impact…...... 12

1.8 Objective Statement…...... 14

Methods………………………………………………………………...... …………15

2.1 Sample Collection…...... 15

2.2 DNA Sample Preparation, PCR, and Sequencing…...... 15

2.3 Phylogenetic Analysis…...... 17

Results………………………………………………………………………...... …...….18

3.1 Histopathology……………………………………………………………………….18

3.2 Nanodrop…………………………………………………………………………..…18

3.3 PCR, Gel Electrophoresis and Sequencing…...... 19

3.3.1 TCC13001(A)...... 20

3.3.2 TCC13001(B)...... ….21

3.3.3 TCC13001(C)...... …..22

3.3.4 TCC13001(D)/CC13010 …...... 22

3.3.5 TCC13001(E)(18S & 28S) …...... 23

3.3.6 TCC13001(F)(18S & 28S)…...... 26

3.4 Phylogenetic Analysis…...... 27

Discussion……………………………………………………………………………...... 31

Acknowledgements……………………………………………………………………….....….36

Literature Cited…………………………………………………………………………...... ….37

List of Figures and Tables

Table 3.1: Data for nanodrop of Herpesvirus and Trematode DNA samples

Figure 3.1: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(A))

with primer combination DIEC/TerHV2R1.

Figure 3.2: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(B))

with primer combination DFA/TerHV2R2.

Figure 3.3: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(C))

with primer combination SIIQ/TerHV2R2.

Figure 3.4: Gel electrophoresis of PCR products for Trematode eggs (CC13010) with primer

combination SPIR1/SPIR2.

Figure 3.5: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(D))

with primer combination (18S):18SE/TerSpirITS2R and (28S):TerSpirITS2F/L1642.

Figure 3.6: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(E))

with primer combination (18S):18SE/WORMB and (28S):U178/L1642.

Figure 3.7: Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(F)) with

primer combination (18S):TerSpi18S1338F/TerSpirITS2R and

(28S):TerSpirITS2F/TerSpi28S461R.

Figure 3.8: Bayesian phylogenetic tree of herpesviral DNA sequences based on MAFFT

sequence alignment.

Figure 3.9: Bayesian phylogenetic tree of Terrapene Spirorchid DNA sequences based on

MAFFT sequence alignment.

Introduction

1.1 Phylogeny

Initially, Herpesviruses were classified based on the host species (Davison, 2010), morphology, and disease signs. However, viruses are now categorized by sequencing and phylogenetic analysis (Ariel, 2011). Herpesviruses are organized phylogenetically based on their genetic makeup, and more specifically, nucleic acid sequence homology (Pinkerton et al., 2008;

Bicknese et al., 2010). The order Herpesvirales consists of three families: Herpesviridae

(containing reptilian, avian, and mammalian viruses), Alloherpesviridae (containing viruses found in frogs and bony fish), and Malacoherpesviridae (consisting of Oyster Herpesvirus Type

1 [OsHV1]) (Ariel, 2011; Davison, 2010). Uniformity among gene complements within the subfamilies of Herpesviridae indicates a shared ancestral herpesvirus species (McGeoch &

Gatherer, 2005), as vindicated by the fact that herpesviruses found within the order

Herpesvirales and family Herpesviridae contain forty four similarly shared ancestral genes

(Davison, 2010). Among reptiles, birds, and mammals (Pinkerton et al., 2008), the family

Herpesviridae is categorized by the International Committee on Taxonomy of Viruses (ICTV) into the subfamilies Alphaherpesvirinae, Betaherpesvirinae, and Gammaherpesvirinae, which are further divided into distinct genera and species (Davison, 2010; Pinkerton et al., 2008).

Hosts in the order Testudines, which consists of turtles and tortoises, are infected with chelonian herpesviruses of the genus Scutavirus (Adams and Carstens, 2012).

1.2 Herpesvirus Detection

Reptilian viruses are diagnosed in a similar manner to viruses found in other species.

Initially, histopathology is performed to determine if a viral disease is present, and then further

molecular tools may be used, including immunological tests and serological surveys may be conducted to determine whether an antiserum is produced in the plasma. Additionally, polymerase chain reaction (PCR) can be utilized in conjunction with general and specific primers for viral detection, and is known to be a more sensitive means for diagnosis than electron microscopy (Ariel, 2011). Quantitative PCR has been used to detect DNA polymerase sequences of fibromas and fibropapillomas induced by fibropapilloma turtle herpesvirus. PCR results have revealed that among the fibromas and fibropapillomas tested in turtles, seventy nine percent contained the associated viral sequences in quantities such that more than one viral copy exists per tumor cell (Greenblatt et al., 2003).

1.3 Fibropapilloma-Associated Herpesvirus

The subfamily Alphaherpesvirinae contains all reptilian herpesviruses (Stacy et al., 2007;

Bicknese et al., 2010), including fibropapilloma-associated turtle herpesvirus (Chelonid

Herpesvirus 5 [ChHV5]) (Greenblatt et al., 2003). This herpes virus has been found in conjunction with fibropapillomatosis in several species of wild sea turtles (Stacy et al., 2007;

Greenblatt et al., 2003), with minor differences between geographical regions such as Florida and Hawaii (Chaloupka et al., 2009). Fibromas and fibropapillomas are known to develop in marine turtles with ChHV5 (Balazs, 1986). Green turtles (Chelonia mydas) found in the Florida

Keys (Jacobson et al., 1991) in 1938 exhibited the first documented cases of fibropapillomatosis

(Lucke, 1938; Smith and Coates, 1938), followed by green turtles in the waters of Hawaii around

1988. Since then, many areas have reported cases of green turtle fibropapillomatosis, including

Australia, Puerto Rico, Belize, Panama, Colombia, Barbados, Venezuela, the Virgin Islands, as well as the Cayman Islands (Jacobson et al., 1991). In Florida, the presence of fibropapillomatosis has been known and relatively stable since the 1930's (Chaloupka et al.,

2009), although during the 1990's, both Hawaii and the Indian River Lagoon System of East

Central Florida reported an increase in the number of cases of green turtle fibropapillomatosis

(Jacobson et al., 1991).

Fibropapillomas are frequently seen in wild green turtles (Chelonia mydas) (Jacobson et al., 1991), and can range in size from a few millimeters up to thirty centimeters in diameter

(Balazs, 1986). Green turtles (Chelonia mydas) infected with fibropapillomatosis are known to contain external fibropapillomas, fibromas, and papillomas, in addition to internal fibromas

(Herbst et al., 1999). Chelonid Herpesvirus 5 is known to be oncogenic, and reported cases have noted fibropapillomas on the epidermis, skin (Ariel, 2011), eyelids, conjunctiva (Matushima et al., 2001), and surfaces of internal organs (Ariel, 2011), with the most frequent occurrences on the eyes, jaw, neck, flippers and tail (Balazs, 1986). Thirty percent of terminal cases of fibropapillomatosis consist of turtles with visceral fibromas, with the numbers exceeding forty percent in the waters of Hawaii, Australia, and Florida (Greenblatt et al., 2003). Optimal environmental and immune system conditions are thought to be a determining factor in the severity of papilloma lesions (Ariel, 2011).

1.4 Disease Associations

The relationship between a herpes-virus and the host organism has co-evolved in such a way that related atypical host species are more strongly impacted by disease than the endemic host species (Bicknese et al., 2010). The endemic host may experience only a mild form of disease, while aberrant hosts more commonly experience a fatal form of disease (Pinkerton et al.,

2008). Among Chelonians such as Mediterranean spur-thighed (Testudo graeca), central Asian

(Testudo horsfieldii), and Herrmann's (Testudo hermanni) tortoises, herpes-viruses are known to

cause tracheitis, stomatitis, pneumonia, and conjunctivitis (Curry et al., 2000). In sea turtles, four distinct herpesviruses have been genetically characterized, including ChHV5, lung-eye-trachea virus (LETV), loggerhead orocutaneous virus (LOCV), and loggerhead genitorespiratory virus

(LGRV) (Stacy et al., 2008; Ariel, 2011). Chelonid Herpesvirus 5 causes fibro-epithelial tumors in a variety of wild sea turtles, and LETV results in pneumonia, pharyngitis, conjunctivitis, and tracheitis (Curry et al., 2000).

1.5 Disease Related Signs

Fibropapillomatosis is an epizootic disease (Herbst et al., 2004) that causes neoplasms to occur (Chaloupka et al., 2009) in cutaneous tissues and visceral connective tissues (Herbst et al.,

2004) in the form of fibro-epithelial tumor growths (Bicknese et al., 2010; Stacy et al., 2007;

Herbst et al., 2004). Infections caused by ChHV5 may start off with minor signs, and in some cases may remain permanently dormant unless stressors induce disease (Ariel, 2011).

Herpesviruses are known to cause neoplastic diseases (Jacobson et al., 1991; Herbst et al., 2004), dermatitis, conjunctivitis, necrotizing hepatitis, rhinitis as well as ulcerative and proliferative stomatitis (Stacy et al., 2007; Stacy et al., 2008; De Voe et al., 2004; Bicknese et al., 2010; Ariel,

2011). Respiratory tract infections (Stacy et al., 2007; Bicknese et al., 2010), central nervous system lesions (Bicknese et al., 2010), eosinophilic intranuclear inclusion bodies (Pinkerton et al., 2008), genital ulcerations, and syncytial cell formation (Stacy et al., 2007) are also seen in association with herpesvirus (Bicknese et al., 2010). Closer examination of affected tissues utilizing electron and light microscopy shows deterioration of basal epidermal cells and the presence of electron dense particles found within cytoplasmic vacuoles (Jacobson et al., 1991).

1.6 Disease Transmission

Transmission may occur through direct contact or by contact with infected viral particles in marine waters (Curry et al., 2000). Some viruses, such as loggerhead orocutaneous herpesvirus (LOCV) and Loggerhead genital-respiratory herpesvirus (LGRV) are thought to be transmissible through marine leeches (Ozobranchus sp.) (Stacy et al., 2007). Scientists have noticed an interesting trend with regard to herpes virus transmission in that fibropapilloma tumor growths sometimes contain spirorchid trematode eggs in the dermal capillaries of green turtles

(Jacobson et al., 1991). This phenomenon has been exhibited by green turtles at the New York

Aquarium in which half of the fibro-epithelial growths contained trematode eggs (Smith &

Coates, 1939). Whether these findings are incidental remains uncertain since loggerhead sea turtles (Caretta caretta), as well as both wild and farmed green turtles, commonly contain trematodes (Spirorchidae) within their cardiovascular system (Matushima et al., 2001).

1.7 Disease Impact

Fibropapillomatosis is a neoplastic disease that is a cause of biological concern

(Greenblatt et al., 2003) and a global threat (Chaloupka et al., 2009) to the survival of marine turtles (Greenblatt et al., 2003) such as loggerhead (Caretta, caretta), green (Chelonia mydas), and olive ridley (Lepidochelys olivacea) turtles (Greenblatt et al., 2003; Curry et al., 2000).

Among green turtle populations in the United States, Australia, and Indonesia (Chaloupka et al.,

2009), the occurrence of fibropapillomas has increased since the 1980's (Herbst et al., 2004;

Chaloupka et al., 2009). Out of one hundred green turtles captured in the East Central Coastal

Indian Lagoon System of Florida before 1982, none contained papillomas. However, between

1982 and 1986, thirty of the fifty-three captured turtles contained papillomatious lesions

(Matushima et al., 2001). The presence of fibropapillomas can result in disorientation, impaired vision, blindness, emaciation, difficulty feeding and swimming, higher risks of predation, as well as increased parasitism by marine leeches (Ozobranchus branchiatus) (Balazs, 1986).

Significant effects of fibropapillomatosis in the waters of Florida and Hawaii include chronic neoplastic diseases, stranding, and mortality of green turtles (Ariel, 2011; Jacobson et al., 1991;

Herbst et al., 2004).

The eastern box turtle (Terrapene carolina carolina) (De Voe et al., 2004; Allender et al.,

2011) is a nearly threatened species according to the International Union for Conservation of

Nature, with the population decreasing as a result of nest disturbance, habitat loss, moving vehicles, and sample collection (Allender et al., 2011). Herpesviruses are of significant concern in captive turtles involved with rehabilitation, conservation, and breeding (Stacy et al., 2007), as papillomas initially present in only wild native adult turtles, have been observed in captive grown turtles as well (Matushima et al., 2001). As noted with Hawaiian green turtles, disease associations with fibropapillomas may reduce the ability of depleted turtle populations to recover

(Chaloupka et al., 2009).

While knowledge on acute marine diseases is growing, significantly less information pertaining to chronic neoplastic diseases is available due to the scarcity of long term disease information (Jacobson et al., 1991; Herbst et al., 2004). No marine turtle species have been observed for the long term effects of fibropapilloma, and among green sea turtles, the full range of contributing factors to fibropapilloma is unknown (Chaloupka et al., 2009).

1.8 Objective statement

Eastern box turtles (Terrapene carolina carolina) are North American turtles in the family Emydidae. With low fecundity, low juvenile survival rates, and long adult life spans,

Eastern box turtles have a life-history which predisposes them to impaired population recovery following the loss of adult animals (such as loss by disease) (Heppell, 1998). Known mortality events impacting eastern box turtles include: ranaviral disease (Johnson et al, 2008) and upper respiratory tract disease caused by a Mycoplasma sp. (Feldman et al, 2006). Infectious agents are not fully understood in the eastern box turtle species aside from those previously stated. This research will provide initial insights into the eastern box turtle herpesvirus using newly tested primers in conjunction with herpesviral and spirorchid DNA. PCR product extracted from excised gel bands will be used for sequencing and the results will be combined for use in phylogentic analysis of this novel Scutavirus and Sprirorchis sp. The expected results will provide a better understanding of the relationships of this novel herpesvirus to other herpesviruses and enable predictions using close relatives as models.

Methods

2.1 Sample Collection

An adult box turtle was presented to the South Florida Wildlife Care Center in October

2012 with proliferative masses located behind both rear legs. A biopsy was collected by Dr.

Schneider, placed in 10% neutral buffered formalin, and shipped to Zoo/Exotic Pathology

Service in West Sacramento, California, where histopathologic examination was performed by

Dr. Reavill. For further analysis, the frozen tissue section was placed in a sterile cryo-tube and shipped to the University of Florida for herpesvirus polymerase chain reaction (PCR) testing in support of the present study.

2.2 DNA Sample Preparation, PCR, and Sequencing

DNA was extracted from the sample using the DNeasy Kit (Qiagen, Valencia, California,

91355, USA). Nested PCR amplification of a partial sequence of the viral DNA-dependent-DNA polymerase gene, a significantly more sensitive PCR, was performed on the herpesvirus DNA extract methods described by Van Devanter et al. The product was resolved on 1% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). To obtain additional sequence, two reverse primers, TerHV2R1 (5' - CATAGAGTGGGGTTGGTGGT - 3') and TerHV2R2 (5' -

CTCTTGTAGCCAGGAGCATGT - 3') were designed using the sequence obtained from the initial protocol. Forward primers DIEC (5’ – KNDSNTTYGAYATHGARTG – 3’), DFA (5’ –

GAYTTYGCNAGYYTNTAYCC – 3’) and SIIQ (5’ – AGYATHATHCARGCNCAYAA – 3’) were used in combination with the reverse primers TerHV2R1 and TerHV2R2 for PCR under identical conditions to those used in the first amplification.

To obtain additional product, amplification of the spirorchid ITS2 region was performed using forward primer SPIR1 (5’ - GAGGGTCGGCTTATTATCTATCA - 3’) was used with reverse primer SPIR2 (5’ – TCACATCTGATCCGAGGTCA – 3’). To obtain 18S rRNA gene sequence, forward primer 18SE (5’ – CCGAATTCGTCGACAACCTGGTTGATCCTGCCAGT

– 3’) was used with reverse primers TerSpirITS2R (5’ – GCAGCCGGATACATTAGGAA – 3’) and WORMB (5’ – CTTGTTACGACTTTTACTTCC – 3’). Forward primers 18SE and

TerSpi18S1338F (5’ – CGAGCGAGACTTTAACCTGC – 3’) were used with reverse primer

TerSpirITS2R. To obtain 28S rRNA gene sequence, forward primer TerSpirITS2F (5’ –

GATTTTGGGCTATGGCTTTG – 3’) and U178 (5’ – GCACCCGCTGAAYTTAAG – 3’) was used with reverse primer L1642 (5’ – CCAGCGCCATCCATTTTCA – 3’). Forward primer

TerSpirITS2F was used with reverse primers L1642 and TerSpi28S461R (5’ –

CAAATCGCTGATCCCTGAGC – 3’) under identical conditions to those used in the first amplification. Direct sequencing was performed using the Big-Dye Terminator Kit (Applied

Biosystems, Foster City, California 94404, USA) and analyzed on ABI 3130 automated DNA sequencers. To obtain a larger region of the spirorchid genome, additional sequencing was performed with the reaction between TerSpirITS2F/L1642/U178 and the primers

TerSpi28S1044R (5' - AAGGCAAAGGAAACAGCAGG - 3'), TerSpi28S461R (5' -

CAAACGCTGATCCCTGAGC - 3'), TerSpi28S474F (5' - TCTTCGGAGTGGGAATGCTT -

3') and TerSpi28S1025R (5' - CCTGCTGTTTCCTTTGCCTT - 3'). The product from

18SE/TerSpirITS2R/WORMB and the primers TerSpi18S373F (5' -

AGAAACGGCTACCACATCCA - 3'), TerSpi18S430R (5' - GGGAGTGGGTAATTTTCGCG -

3'), TerSpi18S1537R (5' - CCGGACATCTAAGGGCATCA - 3') and TerSpi18S1338F (5' -

CGAGCGAGACTTTAACCTGC - 3') was also sequenced. Primer sequences were edited out prior to further analysis.

2.3 Phylogenetic Analysis

The resulting amino acid sequences from the herpesviral DNA-dependent-DNA polymerase gene were aligned using MAFFT (Katoh and Toh, 2008). Partial homologous amino acid sequences for which full-length sequence was not available were included, with ambiguities added for unknown amino acids, for Gerrhosaurid herpesvirus 1 (59 amino acids), Gerrhosaurid herpesvirus 2 (59 amino acids), Gerrhosaurid herpesvirus 3 (60 amino acids), Varanid herpesvirus 1 (58 amino acids), Lacertid herpesvirus 1 (59 amino acids), Tortoise herpesvirus 1

(60 amino acids), Tortoise herpesvirus 2 (60 amino acids), Tortoise herpesvirus 4 (141 amino acids), Indotestudo herpesvirus (60 amino acids), Cooter herpesvirus (60 amino acids), and Red eared slider herpesvirus (60 amino acids). Cooter herpesvirus and Red eared slider herpesvirus are not in GenBank due to the recent requirement of a minimum of 200 nucleotides for submission. Iguanid herpesvirus 2 (GenBank accession no. AY236869) was designated as the outgroup due to its early divergence from other herpesviruses (Wellehan et al., 2003; McGeoch and Gatherer, 2005). Bayesian analyses of amino acid alignments were performed using

MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003) on the CIPRES server (Miller et al, 2010), with gamma distributed rate variation and a proportion of invariant sites. Amino acid substitution models were selected using Prottest (Abascal et al., 2005). The first 25% of 1,000,000 iterations were discarded as a burn in. Maximum likelihood (ML) bootstrap analyses of each alignment were performed using RAxML on the CIPRES server (Stamatakis et al, 2008), with gamma distributed rate variation and a proportion of invariant sites. Bootstrap analysis was used to test the strength of the tree topology, with 1000 subsets (Felsenstein, 1985).

Results

3.1 Histopathology

Histopathologic examination of the eastern box turtle sample revealed variable epithelial hyperplasia with inflamed fibrous connective tissue of hyperplastic stratified squamous epithelium and keratin. Inflammation consisted of lymphocytes, plasma cells and heterophils.

Adjacent epithelium was variably hyperplastic and hyperkeratotic as well as inflamed. The superficial dermis contained occasional granulomas consisting of fragmented and collapsed brown trematode eggs surrounded by multinucleated giant cells and epithelial macrophages.

3.2 Nanodrop

Nanodrop spectrophotometric analysis of 100-fold dilutions of DNA is shown in Table

3.1. The stated values for the 260/280 ratios are indicative of the removal of most contaminants from DNA of the excised gel product. The nanodrop ratios shown in Table 3.1 were used for determination of sequencing concentrations.

Table 3.1 Data for nanodrop of Herpesvirus and Trematode DNA samples.

Sample Well 260/280 Ratio DNA Concentration (ng/µL)

TCC13001 A 1.81 27.20

TCC13001 B 2.26 27.66

TCC13001(A) A 1.77 14.43

TCC13001(A) B 2.05 15.23

TCC13001(B) A 2.10 9.753

TCC13001(B) B 2.32 9.010

Negative Control (B) C 2.33 5.306

Negative Control (B) D 1.51 4.368

TCC13001(C) A 2.05 11.59

TCC13001(C) B 1.91 11.08

TCC13001(D) A 1.65 8.366

TCC13001(D) B 2.02 9.67

CC13010 A 2.27 11.37

CC13010 B 1.88 13.98

TCC13001(E)(18S,R2) A 2.14 11.08

TCC13001(E)(18S,R2) B 3.81 9.054

TCC13001(E)(28S,R1) A 4.03 8.444

TCC13001(E)(28S,R1) B 2.10 7.872

TCC13001(E)(28S,R2) A 2.48 20.59

TCC13001(E)(28S,R2) B 2.24 19.97

TCC13001(F)(28S,R2) A 2.09 19.48

TCC13001(F)(28S,R2) B 2.12 18.94

3.3 PCR, Gel Electrophoresis and Sequencing

“(A)” through “(F)” lettering has been assigned to the TCC13001 DNA samples for identification purposes only; these samples are from identical eastern box turtle DNA.

3.3.1 TCC13001(A):

Figure 3.1 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(A)) for round one amplification with forward primer DIEC and reverse primer

TerHV2R1. PCR amplification of partial sequence of the DNA-dependent-DNA-polymerase gene yielded a 481 base pair (bp) product after editing out primers. No product was observed in the negative control column, which contained the indicated primers and none of the sample

DNA. Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of

DNA. Sequencing results for the DIEC primer failed to confirm the presence of Terrapene herpesvirus 2 DNA, likely due to insufficient sample size or contamination. Sequencing results for the TerHV2R1 primer failed to confirm the presence of Terrapene herpesvirus 2 DNA due to contamination.

Figure 3.1 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(A)) with primer combination DIEC/TerHV2R1. A 100bp ladder is in the left most column, followed by the Box Turtle Herpesvirus sample and the negative control. The target band in the sample column is 481bp.

3.3.2 TCC13001(B):

Figure 3.2 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(B)) for round two amplification with forward primer DFA and reverse primer

TerHV2R2. PCR amplification of partial sequence of the DNA-dependent-DNA-polymerase gene yielded a 481 base pair (bp) product after editing out primers. A faint band was observed in the negative control column, which contained the indicated primers and none of the sample

DNA. Sequencing results indicated contamination of the negative control sample with Terrapene herpesvirus 2 DNA. The band was likely due to contamination and thus was excised and sequenced. Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of

DNA. Sequencing results for the DFA primer confirmed the presence of Terrapene herpesvirus 2

DNA. Sequencing results for the TerHV2R2 primer failed to confirm the presence of Terrapene herpesvirus 2 DNA, likely due to insufficient sample size or contamination.

Figure 3.2 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(B)) with primer combination DFA/TerHV2R2. A 100bp ladder is in the left most column, followed by the Box Turtle Herpesvirus sample and the negative control. The target band in the sample column is 481bp.

3.3.3 TCC13001(C):

Figure 3.3 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(C)) for round two amplification with forward primer SIIQ and reverse primer

TerHV2R2. PCR amplification of partial sequence of the DNA-dependent-DNA-polymerase gene yielded a 481 base pair (bp) product after editing out primers. No product was observed in the negative control column, which contained the indicated primers and none of the sample

DNA. Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of

DNA. Sequencing confirmed the presence of Terrapene herpesvirus 2.

Figure 3.3 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(C)) with primer combination SIIQ/TerHV2R2. A 100bp ladder is in the left most column, followed by the Box Turtle Herpesvirus sample and the negative control. The target band in the sample column is 481bp.

3.3.4 TCC13001(D)/CC13010:

Figure 3.4 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(D)) for round one amplification with forward primer SPIR1 and reverse primer

SPIR2. The PCR product in the TCC13001(D) sample column revealed a positive band at approximately 350bp. The PCR product in the CC13010 sample column revealed a positive band

at approximately 300bp. The positive control column for CC13010, containing previously sequenced trematode egg DNA from a loggerhead turtle, has a positive band at approximately

300bp. No product was observed in the negative control column, which contained the indicated primers and none of the sample DNA. Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of DNA. Sequencing confirmed the presence of Terrapene spirorchid DNA.

Figure 3.4 Gel electrophoresis of PCR products for Trematode eggs (CC13010) with primer combination

SPIR1/SPIR2. A 100bp ladder is in the left most column, followed by the Box Turtle Herpesvirus sample

(TCC13001(D)), the Trematode sample (CC13010), the positive and the negative control. The sample band is 350bp and the trematode band is 300bp.

3.3.5 TCC13001(E)(18S & 28S):

Figure 3.5 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(E)) for round one amplification with forward primer 18SE and reverse primer

TerSpirITS2R for the 18S region, and forward primer TerSpirITS2F and reverse primer L1642 for the 28S region. The PCR product in the sample column revealed a positive band at approximately 400bp. No product was observed in the 18S sample column. No product was

observed in the negative control column, which contained the indicated primers and none of the sample DNA. Predicted bands should be at 2100bp for 18S TCC13001(E) and 1300bp for 28S

TCC13001(E). The 400bp band for the 28S TCC13001(E) sample was cut out and sequenced with the primers TerSpirITS2F/L1642. Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of DNA. Sequencing results confirmed the presence of Terrapene

DNA.

R1: 18SE/TerSpirITS2R R1: TerSpirITS2F/L1642

Figure 3.5 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(E)) with primer combination (18S):18SE/TerSpirITS2R and (28S):TerSpirITS2F/L1642. A 100bp ladder is in the left most column, followed by the 18S Box Turtle Herpesvirus sample (TCC13001(E)), negative control, 28S Box Turtle Herpesvirus sample (TCC13001(E)), negative control, 100bp ladder and 1kbp ladder. The brightest band in the sample column for 28S TCC13001(E) is 400bp.

Figure 3.6 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(E)) for round two amplification with forward primer 18SE and reverse primer

WORMB for the 18S region, and forward primer U178 and reverse primer L1642 for the 28S region. The PCR products in the 18S and 28S sample columns revealed positive bands at

approximately 1600bp and 1400bp, respectively. No product was observed in the negative control column, which contained the indicated primers and none of the sample DNA. Predicted bands should be at 1800bp for 18S TCC13001(E) and 1200bp for 28S TCC13001(E). Table 3.1 displays the nanodrop spectrophotometric analysis of 100-fold dilutions of DNA. To confirm full sequence, additional primers were sequenced with the 18S and 28S TCC13001(E) products.

Spirorchid amplification yielded 1,905 bp of the 18S rRNA gene and 2,046 bp of the ITS2/28S rRNA gene after primers were edited out. Sequencing results confirmed the presence of

Terrapene spirorchid DNA.

R1: 18SE/TerSpirITS2R R1: TerSpirITS2F/L1642 R2: 18SE/WORMB R2: U178/L1642

Figure 3.6 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(E)) with primer combination (18S):18SE/WORMB and (28S):U178/L1642. A 100bp ladder is in the left most column, followed by the 18S Box Turtle Herpesvirus sample (TCC13001(E)), negative control, 28S Box Turtle Herpesvirus sample

(TCC13001(E)), negative control, 100bp ladder and 1kbp ladder. The target band ( indicated by “>”) in the sample column for the 18S TCC13001(E) sample is 1600 bp and for the 28S TCC13001(E) sample is 1400 bp.

3.3.6 TCC13001(F)(18S & 28S):

Figure 3.7 shows the gel electrophoresis of PCR products for Terrapene Herpesvirus 2

(TCC13001(F)) for round two amplification with forward primer TerSpi18S1338F and reverse primer TerSpirITS2R for the 18S region, and forward primer TerSpiITS2F and reverse primer

TerSpi28S461R for the 28S region. The PCR product in the 28S sample column revealed a positive band at approximately 600bp. No product was observed in the 18S sample column. No product was observed in the negative control column, which contained the indicated primers and none of the sample DNA. Table 3.1 displays the nanodrop spectrophotometric analysis of 100- fold dilutions of DNA. Sequencing results confirmed the presence of Terrapene spirorchid DNA.

TCC13001 neg TCC13001 neg

R1: 18SE/TerSpirITS2R R1: TerSpirITS2F/L1642 R2: TerSpi18S1338F/TerSpirITS2R R2: TerSpirITS2F/TerSpi28S461R R1: TerSpirITS2F/L1642

R2: U178/L Figure 3.7 Gel electrophoresis of PCR products for Terrapene Herpesvirus (TCC13001(F)) with primer combination (18S):TerSpi18S1338F/TerSpirITS2R and (28S):TerSpirITS2F/TerSpi28S461R. A 100bp ladder is in the left most column, followed by the 18S Box Turtle Herpesvirus sample (TCC13001(F)), negative control, 28S

Box Turtle Herpesvirus sample (TCC13001(F)), negative control, 100bp ladder and 1kbp ladder. The target band in the sample column for the 8S TCC13001 sample is 600bp.

3.4 Phylogenetic Analysis

The Bayesian phylogenetic tree produced using a MAFFT sequence alignment of fifty- seven herpesviral sequences is displayed in Figure 3.8. Branches contain Bayesian posterior probabilities and maximum likelihood bootstrap values as percentages, displayed in the following manner: “Bayesian posterior probability %/Maximum likelihood Bootstrap %.”

Bayesian posterior probability is a method of assessing clade and branch support for specific phylogenetic relationships. The maximum likelihood bootstrap values are a measure of self- consistency and confidence. The phylogenetic analysis shows that TerrapeneHV2, indicated by the arrow in Figure 3.8, is most closely related to IndotestudoHV, with a Bayesian posterior probability of 98% and a maximum likelihood bootstrap value of 90%. TerrapeneHV2 branches closely with LoggerheadOCV, with a Bayesian posterior probability of 91% and a maximum likelihood bootstrap value of 73%. TerrapeneHV2 has close genetic relationships with various chelonian herpesviruses including: TerrapeneHV1, TortoiseHV1, TortoiseHV2, TortoiseHV3,

TortoiseHV4, CooterHV, and Red-eared SliderHV, with a a Bayesian posterior probability of

100% and a maximum likelihood bootstrap value of 75%.

The phylogenetic analysis supports classification of TerrapeneHV2 within the family

Herpesviridae (Ariel, 2011; Davison, 2010), subfamily Alphaherpesvirinae (Stacy et al., 2007;

Bicknese et al., 2010), and the genus Scutavirus. Branching lengths show genetic distances in support of the classification of THV as a novel herpesviral species.

Figure 3.8 Bayesian phylogenetic tree of herpesviral DNA sequences based on MAFFT sequence alignment.

Branches contain Bayesian posterior probabilities and maximum likelihood bootstrap values as percentages, displayed in the following manner: “Bayesian posterior probability %/Maximum likelihood Bootstrap %.” The target Terrapene Herpesvirus 2 DNA is indicated by the arrow.

Figure 3.9 Bayesian phylogenetic tree of Terrapene Spirorchid DNA sequences based on MAFFT sequence alignment. Branches contain Bayesian posterior probabilities and maximum likelihood bootstrap values as percentages, displayed in the following manner: “Bayesian posterior probability %/Maximum likelihood Bootstrap

%.” The target Terrapene Spirorchid DNA is indicated by the arrow.

The Bayesian phylogenetic tree produced using a MAFFT sequence alignment of eighteen sequences is displayed in Figure 3.9. Branches contain Bayesian posterior probabilities and maximum likelihood bootstrap values as percentages, displayed in the following manner:

“Bayesian posterior probability %/Maximum likelihood Bootstrap %.” The phylogenetic analysis shows that Terrapene Spirorchid DNA, indicated by the arrow in Figure 3.9, is most closely related to that of Spirorchis artericola, Spirorchis scripta and Spirorchis haematobius, with a

Bayesian posterior probability of 100% and a maximum likelihood bootstrap value of 100%.

Additionally, Terrapene Spirorchid is shown to be the most basal of the previously described

species and the group Spirorchidae appears to be paraphyletic. The phylogenetic analysis supports classification of Terrapene Spirorchid within the genus Spirorchiidae.

Discussion

The box turtle presented to the South Florida Wildlife Care Center in October of 2012 contained inflamed cutaneous papillomas characteristic of fibropapilloma-associated herpesviral infections. Unusual for box turtles, several granulomas were found in the superficial dermis, typically associated with collapsed trematode eggs and more specifically, spirorchid fluke eggs.

Reptilian viruses are diagnosed through histopathology and further molecular diagnostics (Ariel

2011). Biopsy testing performed at the Zoo/Exotic Pathology service in West Sacramento,

California and Polymerase Chain Reaction experiments and DNA sequencing at the University of Florida in Gainesville, Florida confirmed the presence of papillomatous lesions containing herpesviral DNA and spirorchid fluke DNA.

This study identified Terrapene HV2, a novel herpesvirus. Further, ova of a novel spirorchid trematode were characterized. Therefore, this is the first report on clinical infection with these agents. Co-infection of herpesvirus concurrent with spirorchid flukes may have played a significant role in the clinical presentation in this box turtle. These amplification and sequencing results reveal successful primer combinations when working with box turtle herpesviral and spirorchid DNA, and further studies can be performed using these protocols.

The phylogenetic tree in Figure 3.8 shows that TerrapeneHV2 clusters with other

Herpesviruses in the family Herpesviridae, subfamily Alphaherpesvirinae and the genus

Scutavirus (Figure 3.4). Based on the similar structure of this phylogenetic tree to that from larger data sets containing more mammalian and avian Herpesviruses (McGeoch and Gatherer,

2005) and the fact that mammals are the only known hosts of the subfamilies Betaherpesviruses and Gammaherpesviruses, TerrapeneHV2 has support for classification within the subfamily

Alphaherpesvirinae (Quesada et al., 2011). The Bayesian posterior probability in our analysis of the scutaviruses clustering together is 99% with a maximum likelihood bootstrap value (a more conservative method of estimation) (Stacy et al., 2007) of 72%. This, in addition to the statistical data that displays the close phylogenetic relationship between TerrepeneHV2 and

IndotestudoHV (Bayesian posterior probability of 98% and a maximum likelihood bootstrap value of 90%), supports the classification of TerrapeneHV2 within the genus Scutavirus. Based on branching patterns between herpesviruses and their host species, previous phylogenetic analyses imply a host-virus coevolution (McGeoch and Davison, 1999; Pinkerton et al., 2008).

Future research, including additional data sets and longer sequences for comparison, will provide further phylogenetic information on relationships between this novel herpesviral species and others (Quesada et al., 2011).

Chelonians have the best studied herpesvirus flora of any non-avian reptile clade, although this primarily speaks to the paucity of information on non-mammalian herpesviruses

(Stacy et al., 2008). Herpesviruses are known to cause neoplastic diseases and papillomas among vertebrates (Jacobson et al., 1991; Herbst et al., 2004). Common sites of fibropapilloma growth include the flippers, tail, jaw, neck, eyes and mouth (Balazs, 1986; Ariel, 2011). The box turtle used for this research displayed papillomatous growths on the rear legs, which had grown and spread for several months prior to sampling. In addition to fibropapillomas, chelonians with herpesviruses may be afflicted with dermatitis, conjunctivitis, necrotizing hepatitis, stomatitis and respiratory tract infections (Stacy et al., 2008; De Voe et al., 2004; Ariel, 2011). The transmission of herpesvirus infections within marine environments if not fully understood and may be caused by vectors, direct contact or by contact with contaminated particles in seawater

(Curry et al., 2000). Green turtles afflicted with fibropapillomas are typically afflicted with

vision problems, disorientation, predation, reduced breeding, impaired swimming, feeding problems and susceptibility to parasitism by marine leeches (Ozobranchus branchiatus) (Balazs,

1986). Infectious agents are not fully understood in the eastern box turtle species and with a predisposition to impaired population recovery (Heppell, 1998), the physical impairments caused to box turtles by herpesviral infections may pose a threat to box turtle populations.

The phylogenetic tree in Figure 3.9 shows that Terrapene Spirorchid DNA clusters within the genus Spirorchiidae. Spirorchiidae and Schistomatidae vary with respect to reproduction, morphology and hosts (Snyder et al., 2004). Spirorchids reside basally on the phylogenetic tree, with Schistomatids as a more recently derived species. Thus, the group Spirorchiidae is paraphyletic. The presented study finds strong support from both Bayesian posterior probabilities and bootstrapping for the basal position of the Spirorchiidae clade (Bayesian posterior probability of 100% with a maximum likelihood bootstrap value of 100%).

The majority of flukes found in turtles are nonpathogenic with the exception of intravascular blood flukes. Cardiovascular blood flukes were first noted in turtles in 1861 when a trematode egg was found within the conjunctiva of an ordinary turtle (Johnson et al., 1998).

Spirorchid flukes in turtles are similar to schistosomes in birds and mammals (Snyder, 2004).

Trematodes within the family Spirorchidae inlcude sixteen recognized genera (Reavill et al.,

2004), some of which include Squaroacetabulum, Hapalotrema, Laeredius, Haemoxenicon,

Amphiorchis, Monticellius, Carettacola and Neospirorchis (Jacobson et al., 1991). Spirorchid trematodes (blood flukes) reside within the cardiovascular system of marine turtles (Jacobson et al., 1991; Tkach et al., 2009; Matushima et al., 2001). The circulatory system transports eggs

(deposited by adults) and causes blockages within blood vessels and organs, which in turn cause inflammation and microgranulomas. Eggs migrate through the endothelium and blood vessel

wall, escaping the vessel lumen and entering nearby tissues. Enteritis, bacteremia and necrosis may result if eggs flow into the lumen of the intestines (Johnson et al., 1998; Tkach et al., 2009;

Matushima et al., 2001). While the freshwater pulmonate snail is known to be the intermediate trematode host among freshwater turtles (Snyder, 2004), the life cycle for marine Spirorchids is not fully understood (Stacy et al., 2010). In a previous study, the marine spirorchid, L. learedi, was detected within a potential intermediate host, the limpet, F. nodosa (Stacy et al., 2010). In green turtles (Chelonia mydas) the presence of the cardiovascular fluke Learedius learedi is known to cause epithelloid macrophages surrounded by fibrosis (Balazs, 1986). At the New

York aquarium, half of all green turtle fibro-epithelial growths contained trematode eggs (Smith and Coates, 1939). In the case of the box turtle sample used for this research, several granulomas were found beneath the superficial dermis, a finding typical of collapsed brown trematode eggs.

Although they may be diagnosed together, Spirorchid fluke eggs are not known to be the cause of green turtle fibropapillomas, and further studies need to be performed to establish a clear association (Jacobson et al., 1991). Flukes have been previously found within loggerhead sea turtles (Caretta caretta) and green turtles (Chelonia mydas) (Jacobson et al., 1991). Common chelonians that carry spirorchid eggs have been known to be hosts for novel species of blood flukes. Spirhaplum elongatum is known to utilize the Malayan box turtle (C. amboinensis) as a host (Tkach et al., 2009). Spirorchid fluke eggs have not previously been reported from box turtles, and with secondary infections potentially leading to death (Johnson et al., 1998), this holds clinical significance for box turtle health, species' survival and future population recovery.

With an estimated 15-20% of turtle species examined for spirorchid blood flukes thus far, much of the knowledge on spirorchids in turtles is yet to be discovered (Tkach et al., 2009). Currently,

insufficient data is present to support a phylogenetic analysis on the trematode DNA presented in this study.

For successful population management, it is important to identify the disease type present and the pathogenicity for a given host species. When testing for the presence of target DNA, any bands generated by PCR should be sequenced to confirm the presence of a positive sample, without which, non-target DNA may serve as a false positive (Bicknese et al., 2010). Results from this study display new primer combinations for successful amplification of herpesviral and spirorchid DNA, and thus may serve as a starting point for additional research. Sequencing and phylogenetic analysis results reveal the close associations between Terrapene herpesvirus 2 and other herpesviral sequences, in addition to relationships among Terrapene spirorchid sp. and other related trematodes. The study findings represent the second Scutavirus and the first

Spirorchis sp. found in Eastern box turtles, and thus this research provides initial insights into these disease relationships. Coinfection of the novel Scutavirus and Sprirorchis sp. is rare and therefore these results may reveal valuable information on endemic areas of disease, insight into disease characteristics and reasons for minimizing the mixing of certain species. Intermediate spirorchid hosts are not fully identified, and thus warrants further studies. With fibropapilloma- associated herpesvirus and spirorchid trematode infection routes and relationships not fully understood in eastern box turtles, preventative measures such as isolation of infected individuals and quarantine of new turtles should be taken by animal handlers to eliminate potential disease transmission to healthy animals.

Acknowledgements

I would like to thank Dr. Wellehan for his mentoring and guidance throughout this research project, in addition to his insight on phylogenetic analysis and PCR.

I would also like to thank Linda Archer for her advice and assistance with PCR, gel electrophoresis and sample sequencing.

I am grateful for the use of the University of Florida Aquatic Pathobiology Laboratory and resources supplied by the University.

I would like to thank Dr. Schneider of the SPCA Wildlife Care Center, Fort Lauderdale,

Florida for specimens collected in support of this work.

I am thankful to Dr. Drury Reavill of the Zoo/Exotic Pathology Service in West

Sacramento, California for histological examinations used for this work.

Literature Cited

Abascal, F., Zardoya R., Posada, D. 2005, ProTest: Selection of Best-Fit Models of Protein

Evolution. Bioinformatics 21: 2104-2105.

Adams, M. J., Carstens, E. B. 2012. Ratification Vote on Taxonomic Proposals to the

International Committee on Taxonomy of Viruses. Arch Virol 157:1411-1422.

Ariel, E. 2011. Viruses in Reptiles. Veterinary Research 42: 100.

Balazs, G. H. 1986. Fibropapillomas in Hawaiian Green Turtles. Marine Turtle Newsletter 39: 1-

Bicknese, E. J., Childress, A. L., Wellehan, J. F. X. 2010. A Novel Herpesvirus of the Proposed

Genus Chelonivirus from an Asymptomatic Bowsprit Tortoise (Chersina angulata).

Journal of Zoo and Wildlife Medicine 41: 353-358.

Chaloupka, M., Balazs, G. H., Work, T. M. 2009. Rise and Fall Over 26 Years of a Marine

Epizootic in Hawaiian Green Sea Turtles. Journal of Wildlife Diseases 45(4): 1138-1142.

Curry, S. S., Brown, D. R., Gaskin, J. M., Jacobson, E. R., Ehrhart, L.M., Blahak, S., Herbst, L.

H., Klein, P. A. 2000. Persistent Infectivity of a Disease-Associated Herpesvirus in Green

Turtles after Exposure to Seawater. Journal of Wildlife Diseases 36.4: 792-797.

Davison, A. J. 2010. Herpesvirus Systematics. Vet Microbiology 143: 52-69.

De Voe, R., Geissler, K., Elmore, S., Rotstein, D., Lewbart, G., Guy, J. 2004. Ranavirus-

Associated Morbidity and Mortality in a Group of Captive Eastern Box Turtles

(Terrapene carolina carolina). Journal of Zoo and Wildlife Medicine 35(4): 534-543.

Feldman, S. H., Wimsatt, J., Marchang, R.E., Johnson, A. J., Brown, W., Mitchell, J. C.,

Sleeman, J. M. 2006. A Novel Mycoplasma Detected in Association with Upper

Respiratory Disease Syndrome in Free-ranging Eastern Box Turtles (Terrapene carolina

carolina) in Virginia. Journal of Wildlife Diseases 42: 279-289.

Greenblatt, R. J., Work, T. M., Balazs, G. H., Sutton, C. A., Casey, R. N., Casey, J. W. 2004.

The Ozobranchus Leech is a Candidate Mechanical Vector for the Fibro-papilloma-

Associated turtle Herpesvirus Found Latently Infecting Skin Tumors on Hawaiian Green

Turtles (Chelona mydas). Virology 321: 101-110.

Heppell, S. S. 1998. Application of Life-history Theory and Population Model Analysis to Turtle

Conservation. Copeia 2: 367–75.

Herbst, L., Ene, A., Su, M., Desalle, R., Lenz, J. 2004. Tumor Outbreaks in Marine Turtles are

Not Due to Recent Herpesvirus Mutations. Current Biology 14(17): 1-3.

Herbst, L. H., Jacobson, E. R., Klein, P. A., Balazs, G. H., Moretti, R., Brown, T., Sundberg, J.

P. 1999. Comparative Pathology and Pathogenesis of Spontaneous and Experimentally

Induced Fibropapillomas of Green Turtles (Chelonia mydas). Veterinary Pathology 36:

551-562.

Jacobson, E. R., Buergelt, C., Williams, B., Harris, R. K. 1991. Herpesvirus in Cutaneous

Fibropapillomas of the Green Turtle Chelonia mydas. Diseases of Aquatic Organisms

12:1-6.

Jacobson, E. R., Gaskin, J. M., Roelke, M., Greiner, E. C., Allen, J. 1986. Conjunctivitis,

Tracheitis, and Pneumonia Associated with Herpesvirus Infection in Green Sea Turtles.

Journal of the American Veterinary Medical Association 189(9): 1020-1023.

Johnson, A. J., Morafka, D. J., Jacobson, E. R. 2006. Seroprevalence of Mycoplasma agassizii

and Tortoise Herpesvirus in Captive desert Tortoises (Gopherus agassizii) from the

Greater Barstow Area, Mojave Desert, California. Journal of Arid Environments 67: 192-

201.

Johnson, A. J., Pessier, A. P., Wellehan, J. F. X., Childress, A., Norton, T.M., Stedman, N.L.,

Bloom, D. C., Belzer, W., Titus, V. R., Wagner, R., Brooks, J. W., Spratt, J., Jacobson, E.

R. 2008. Ranavirus Infection of Free-ranging and Captive Box Turtles and Tortoises in

the United States. Journal of Wildlife Diseases 44: 851-863.

Johnson, C. A., Griffith, J. W., Tenorio, P., et al. 1998. Fatal Trematodiasis in Research Turtles.

Laboratory Animal Science 48.4: 340-343.

Lucke, B. 1938. Studies on Tumors in Cold-Blooded Vertebrates. Annual Report of the Tortugas

Laboratory of the Carnegie Institure of Washington 38: 92-94.

Matushima, E. R., Longatto Filho, A., Di Loretto, C., Kanamura, C. T., Sinhorini, I. L., Gallo,

B., Baptistolle, C. 2001. Cutaneous Papillomas of Green Turtles: a Morphological, Ultra-

structural and Immunohistochemical Study in Brazilian Specimens. Brazilian Journal of

Veterinary Research Animal Science 38(2): 51-54.

McGeoch, D. J., and Davison, A. J. 1999. The Molecular Evolutionary History of the

Herpesviruses. In Origin and Evolution of Viruses, E. Domingo, R. Webster and J.

Holland (eds.). Academic Press, San Diego: 441-465.

McGeoch, D. J., and Gatherer, D.2005. Integrating Reptilian Herpesviruses into the Family

Herpesviridae. Journal of Virology 79(2): 725-731.

Pinkerton, M. E., Wellehan, J. F. X., Johnson, A., Childress, A. L., Fitzgerald, S. D., Kinsel, M.

J. 2008. Columbid Herpesvirus-1 in Two Cooper’s Hawks (Accipiter cooperii) with Fatal

Inclusion Body Disease. Journal of Wildlife Diseases 44: 622-628.

Quesada, R. J., Heard, D. J., Aitken-Palmer, C., Hall, N., Conley, K. J., Childress, A. L.,

Wellehan, J. F. X. 2011. Detection and Phylogenetic Characterization of a Novel

Herpesvirus from the Trachea of Two Stranded Common Loons (Gavia immer). Journal

of Wildlife Disaeases 47.1: 233-239.

Reavill, D. R., Schmidt, R. E., Stevenson, R. 2004. Review of Spirorchid Flukes (Dignea:

Spirorchidae) and Three Cases in Freshwater Turtles. Proceedings Association of

Reptilian and Amphibian Veterinarians: 139-142.

Smith, G. M., Coates, C. W. 1938. Fibroepithelial Growths of the Skin in Large Marine Turtles,

Chelonia mydas (Linnaeus). Zoologica 23: 93-96.

Smith, G. M., Coates, C. W. 1939. The Occurrence of Trematode Ova (Hapalotrema

constrictum) (Leared) in Fibroepithelial Tumors of the Marine Turtle Chelonia mydas

(Linneaus). Zoologica, N.Y. 24: 379-382.

Snyder, S. D. 2004. Phylogeny and Paraphyly among Tetrapod Blood Flukes (Digenea:

Schistosomatidae and Spirorchiidae). International Journal for Parisitology 34: 1385-

1392.

Stacy, B. A., Frankovich, T., Greiner, E., Alleman, A. R., Herbst, L. H., Klein, P., Bolten, A.,

McIntosh, A., Jacobson, E. R. 2010. Detection of Spriorchid Trematodes in Gastropod

Tissues by Polymerase Chain Reaction: Preliminary Identificaiton of an Intermediate

Host of Learedius Learedi. Journal of Parisitology 96(4):752-757.

Stacy, B. A., Wellehan, J. F. X., Foley, A. M., Coberley, S. S., Herbst, L. H., Manire, C. A.,

Garner, M. M., Brookins, M. D., Childress, A. L., Jacobson, E. R. 2008. Two

Herpesviruses Associated with Disease in Wild Atlantic Loggerhead Sea Turtles (Caretta

caretta). Veterinary Microbiology 126: 63-73.

Tkach, V. V., Snyder, S. D., Vaughan, J. A. 2009. A New Species of Blood Fluke (Digenea:

Spirorchiidae) from the Malayan Box Turtle, Cuora amboinensis (Cryptodira:

Geomydidae) in Thailand. Journal of Parasitology 95(3): 743-746.

Van Devanter, D. R., Warrener, P., Bennett, L., Shultz, E. R., Coulter, S., Garber, R. L. and

Rose, T. M. 1996. Detection and Analysis of Diverse Herpesviral Species by Consensus

Primer PCR. Journal of Clinical Microbiology 34: 1666 – 1671.