Functional Characterization of Exopolyphosphatase/ Guanosine Pentaphosphate Phosphohydrolase (PPX/GPPA) Enzymes of Campylobacter jejuni
THESIS
Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University
By
Anand Kumar, BVSc&AH, MVSc
Graduate Program in Veterinary Preventive Medicine
The Ohio State University
2012
Master's Examination Committee:
Dr. Gireesh Rajashekara, Advisor Dr. Yehia M. Saif Dr. Daral J. Jackwood Dr. Jordi B. Torrelles
Copyrighted by
Anand kumar
2012
Abstract
Campylobacter are small, curved, flagellated, non-spore forming, Gram-negative rods. Of 17 species within the genus Campylobacter, C. jejuni and C. coli are of most important public health concern. Campylobacter are considered to be most common causative agents of foodborne bacterial gastroenteritis and nearly, 90% of human
Campylobacter infections are attributed to C. jejuni. The high prevalence of C. jejuni and its rare potential fatal sequelaes like Guillain Barre Syndrome, Miller Fisher Syndrome, and Reactive Arthritis have attracted considerable research interest. Efforts to reduce C. jejuni infection in humans are directly linked to the better understanding of its physio- biology which inturn explore the pathogenesis mechanism in host. Despite the availability of genomic information of different strains of C. jejuni and advanced genetic tools, the complete understanding of the virulence mechanism is still an ongoing effort.
Hence, any research diverted towards better understanding of host-microbe interaction is of immense importance.
In-organic polyphosphate (poly-P), homeostasis is known to be essential for the virulence related phenotypic traits in pathogenic bacteria including C. jejuni. Although many enzymes are explored and implicated for their role in poly-P metabolism, the exopolyphosphatases (PPX) that hydrolyze poly-P is a less studied group of enzymes.
More importantly, C. jejuni encodes two dual-function exopolyphosphatases
ii
(PPX1/GPPA and PPX2/GPPA) which in addition to poly-P hydrolysis also hydrolyze guanosine pentaphosphate (pppGpp) to guanosine tetraphosphate (ppGpp), an intracellular signaling molecule or an alarmone in bacteria. Therefore, we hypothesize that PPX/GPPA enzymes might play a key role in poly-P metabolism and thus significantly impact C. jejuni’s ability to persist in both the host and environment.
C. jejuni 81-176 encodes two potential dual-function exopolyphosphatases ppx1/gppa (CJJ81176_0377) and ppx2/gppa (CJJ81176_1251) and we generated deletion mutants (∆ppx1, ∆ppx2 and dkppx) and complement strains (Cppx1, Cppx2) to better understand the PPX/GPPA role in C. jejuni pathophysiology. The mutants (∆ppx1, ∆ppx2 and dkppx) exhibited defect in motility, invasion and intracellular survival, survival under nutrient limited condition. Furthermore they showed increased capacity to accumulate poly-P, however only ∆ppx1 and dkppx showed decreased accumulation of ppGpp compared to wildtype. Strikingly, the deletions of either ppx1 or ppx2 genes did not affect the biofilm formation, survival under osmotic and oxidative stresses; but on contrary deletion of both the genes (dkppx) did affect amount of biofilm formation and osmotic stress tolerance. Bactericidal assay to determine the role of PPX1/GPPA and
PPX2/GPPA for resistant to complement mediated killing indicated that both ∆ppx1, and
∆ppx2 mutant were resistant to human complement mediated killing however, dkppx mutant was sensitive. In contrary, the chicken serum did not have any effect on the survival of ∆ppx1, ∆ppx2, and dkppx mutants. Interestingly, the expression of ppk1 and spoT genes, which are known to be interconnected with poly-P and ppGpp homeostasis were up regulated in the both ∆ppx1 and ∆ppx2 mutants compared to wildtype iii suggesting a compensatory role in poly-P and ppGpp homeostasis. In all the cases complemented strains (Cppx1, Cppx2) restored the phenotypic characters similar to wildtype.
Our future studies will decipher the direct or indirect role of ppx/gppa genes in poly-P metabolism, investigate mechanism behind resistant of ∆ppx1, ∆ppx2 mutants to human complement factors, and study the functional redundancy of ppx/gppa genes in
C. jejuni. In conclusion, we report that C. jejuni PPX1/GPPA protein has bifunctional activity capable of both poly-P and pppGpp hydrolysis, whereas PPX2/GPPA protein has monofunctional activity and mainly involved in poly-P hydrolysis. Thus, theses enzymes play critical role in poly-P metabolism and ppGpp homeostasis. Beside their role in stress related phenotypic traits they do have role in complement mediated resistance in human serum. Our study expands the multi-factorial regulation of poly-P and ppGpp metabolism in C. jejuni, may serve as unique model for other bacteria as well.
iv
Acknowledgments
It’s my pleasure to thank my advisor, Dr. Rajashekara for his kind guidance, valuable criticism and constant motivation throughout my master program. His mentorship has a great value in framing my career and creating interest in science. I am also great full to him for providing an opportunity to continue my PhD in his lab. I would like to thank my advisory committee members, Dr. Saif, Dr. Jackwood, and Dr. Torrelles for their kind hearted guidance and close supervisions during my graduate student.
I would also like extend my thanks to Dr. Rajashekara lab members- Zhe Liu,
Issmat I. Kassem, Mary Drozd, Yasser Sanad, Kshipra Chandrashekhara, Isaac Kashoma,
Ruby Pina Mimbela, Xiulan Xu, and Annamalai Thavamathi for their constant assistance and timely help in my research work. My heart-felt gratitude to office associates Hannah
Gehman, Robin Weimer, Ann Sanders and Graduate Program Coordinator Janelle
Henderson for their kind support in academic issues. I would like to humbly acknowledge all professors, research scientists, post-doctoral researchers, and graduate students at
FAHRP, Wooster, The Ohio State University, for their personal and intellectual support. I would have been all alone without my friend- very special thanks to Dharnesh and family for their emotional support and homely hospitality during their stay at Wooster. I would like to take this opportunity to thank Basavaraj and family for their cordial hospitality.
v
Special thanks to all my friends- Jagadeesh, Amimo, Kang, Daniel Thomas and
Gaochang, who made my stay at Wooster enjoyable.
Reaching this stage in my life would have been impossible for me without the kind blessings of GOD, and unconditional love, support and sacrifice of my parents, brothers and their families. At the last but not the least, my heartfelt thanks and affection to my fiancée Meenakshi for her constant emotional support and for making me to believe in a wonderful saying- “We come (begin) to love not by finding a perfect person, but by learning to see an imperfect person perfectly”.
At last, I would like thank all those other known and unknown persons, who helped me directly or indirectly during my graduate studies.
Anand Kumar
vi
Vita
August 1999 ...... Pre-University College, Gulbarga, India
1999-2004 ...... Bachelor of Veterinary Science & Animal
Husbandry, University of Agricultural
Sciences, Dharwad, India
2004-2006 ...... Master of Veterinary Science in Animal
Biotechnology, GB Pant University of
Agriculture and Technology, Pantnagar, India
2006-2007 ...... Senior Research Fellow, Institute of Animal
Health and Veterinary Biologicals,
Bangalore, India
2007-2010------Veterinary Officer, Department of
Animal Husbandry, Government of
Karnataka, India
2010-present------Graduate Research Associate
Food Animal Health Research Program
Department of Veterinary Preventive Medicine
The Ohio State University vii
Fields of Study
Major Field: Veterinary Preventive Medicine
Molecular Pathogenesis of Campylobacter jejuni
viii
Table of Contents
Abstract ...... ii
Acknowledgments...... v
Vita ...... vii
List of Tables ...... x
List of Figures ...... xi
Chapter 1 Review of Literature ...... 1
Chapter 2 Introduction ...... 20
Chapter 3 Materials and Methods ...... 23
Chapter 4 Results ...... 33
Chapter 5 Discussions ...... 41
Bibliography ...... 66
ix
List of Tables
Table 3.1 List of primers used in this study ...... 48
Table 3.2. Bacterial strains and plasmids used in this study ...... 49
x
List of Figures
Figure 1. Important routes of C. jejuni transmission in humans ...... 2
Figure 2. Inhibitory actions of pppGpp and ppGpp on PPX enzymes ...... 15
Figure 3. Lon protease roles in stringent and stress response ...... 16
Figure 4. Phylogenetic tree of C. jejuni PPX/GPPA enzymes ...... 50
Figure 5. Structure-based sequence alignment of PPX/GPAA domains of C. jejuni and related bacteria ...... 51-52
Figure 6. Predicted three-dimensional structure of C. jejuni PPX/GPPA enzymes ...... 53
Figure 7. Genetic organization of ppx1/gppa and ppx2/gppa genes in C. jejuni genome, and approximate location of antibiotic markers in the deletion mutants ...... 54
Figure 8. Growth kinetics of C. jejuni ppx/gppa mutants ...... 55
Figure 9. Intracellular poly-P levels in C.jejuni ∆ppx mutants...... 56
Figure 10. Intracellular (p)ppGpp levels in C.jejuni ∆ppx mutants ...... 57
Figure 11. Motility of C. jejuni ∆ppx mutants ...... 58
Figure 12. Biofilm formation by C. jejuni ∆ppx/gppa mutants...... 59
Figure 13. Nutrient downshift assay of C. jejuni ∆ppx mutants ...... 60
Figure 14. Sensitivity of ∆ppx/gppa mutants to oxidative stress ...... 61
Figure 15. Sensitivity of ∆ppx/gppa mutants to oxidative stress ...... 62
xi
Figure 16. The ∆ppx mutants’ Intracellular invasion & Intracellular survival assay……63
Figure 17. Complement dependent killing of C. jejuni ∆ppx/gppa mutants……………64
Figure 18. Quantitative RT-PCR analysis of the WT and C. jejuni ∆ppx mutants………65
xii
Chapter 1: Review of Literature
1.1 Overview
The term Campylobacter is coined from a Greek word “Kampylos” means curved. The genus Campylobacter consists of 17 species and 6 subspecies (On, 2005;
Debruyne et al., 2008) with Campylobacter fetus as a type species. Campylobacter species readily colonize in the gut of domestic, feral and wide variety of animals and birds, notably poultry (Allos, 2001). Infection of Campylobacter ‘Campylobacteriosis’, is a food and water-borne, regarded as a leading cause of bacterial induced acute gastroeneteritis worldwide. C. jejuni and C. coli are considered to be the most common species causing human infections and are ubiquitously found in nature; environment, wild birds, and mammals.
C. jejuni is a curved, Gram-negative, motile, non-spore forming bacteria with size ranging from 0.2 to 0.8 μm in width and 0.5 to 5.0 μm in length, belongs to the epsilon class of proteobacteria, in the order Campylobacteriales. C. jejuni is considered to be a commensal organism of avian species especially, chickens. Thermophilic Campylobacter species grows optimally at temperature near 42˚C (Park SF, 2002), the higher metabolic temperature found in poultry species may predispose poultry to be a prominent reservoir for the thermotolerant Campylobacter. Although the experimental infection with C. jejuni in chickens can lead to diarrhea (Ruiz-Palacios et al., 1981; Sanyal, S. C. et al., 1984), 1 this is not typical in natural conditions, and it appears that the human response to C. jejuni infection is more symptomatic than that of the chicken. As a human pathogen, C. jejuni accounts for nearly 90% of the total human Campylobacter infections, while C. coli infections constitute 3-4% of cases (Frost et al., 1999). Reports show that C. jejuni affect approximately 1% of population in the developed countries like, United States,
Australia and United Kingdom (Friedman et al., 2000).
In the developed world, where waterborne infection is less likely, animals are the primary source of human infection. Nearly 90% of the United States poultry flocks are colonized with C. jejuni (Stern et al., 2001) besides, can carry a load >107 CFU per gram of feces of C. jejuni. (Mead et al., 1995). Due to high prevalence and the low infection dose in humans’ i.e.as low as 500 bacteria (Skirrow, 1982; Skirrow, 1990), it is not surprising that the most of human campylobacteriosis are acquired by handling or consumption of contaminated/undercooked poultry and poultry products. However, consumption of unpasteurized milk, contaminated fruits and vegetables, environmental water sources are also frequently attributed in human infections.
2 Figure 1 Important routes of C. jejuni transmission in humans.
Source: Dasti I.J et al., 2009
Following the exposure, C. jejuni withstand the acidity of stomach and can colonize the lower intestinal tract (ileum, jejunum, and colon) without causing any symptoms (Ketley, 1997). The symptomatic cases are often self-limiting, represented with fever, vomiting, headache, watery or bloody diarrhea with abdominal pain. C. jejuni motility and corkscrew shaped morphology aids in successful colonization at the intestinal epithelial cells, subsequently damage caused by invasion and toxin production results in inflammation and diarrhea (Park, 2002).In, extraintestinal manifestations, and post-infection sequelae by Campylobacter are attributed to autoimmune disorders like
Guillian-Barre syndrome (GBS), Miller Fishers syndrome, and reactive arthritis. The most common and obvious answer to autoimmune disorder is the ‘Molecular mimicry’, occurs due to shared terminal molecules of C. jejuni antigens with proteins on human peripheral nerves (Komagamine and Yuki, 2006).
The basic mechanism of the different outcomes of C. jejuni infection in humans versus chickens is not clearly understood. This can be partly attributed to the lack of a good small animal model that reproduces the human disease. Although, ferret model simulates the human symptoms of C. jejuni infection (Fox A.G. et al., 1987), the high cost and lack of good knockout technology to study host factors that are involved in disease limits the usage of this model. As a natural host, chicken is a good model for studying basic aspects of host colonization and is potentially a good target for anti-
Campylobacter strategies. In addition to natural and experimental models of animal
3 infection, human intestinal epithelial cell lines, such as the INT 407 cell line, have also been used in C. jejuni studies.
In contrast to other well know enteropathogens such as Salmonella, Shigella, and
E. coli species, C. jejuni is quite fastidious, with a complex metabolism requiring microaerophilic and capnophilic growth conditions. Furthermore, C. jejuni is asscchrolytic, lacking capacity to both transport and catabolize the most carbohydrates, and instead relies on aminoacids such as serine, glutamine, and aspartate as primary carbon and energy source (Kelly et al., 2008). It also lacks many “classical” virulence factors, such as exotoxins and type III secretions systems that are hallmark of enteropathogens. The “invasiveness” of C. jejuni strains is often used as a measure of
Campylobacter virulence, to date bacterial factors implicated in host cell invasion and disease pathogenesis are capsular polysaccharide (CPS), flagellar apparatus, cytolethal distending toxins (CDT), and post-translational glycosylation. The host factors are nuclear factor (NF)-kB, IL-8, and epithelial β-defensins (Zilbauer M. et al., 2008).
1.2 In-organic polyphosphate (poly-P)
1.2.1 Introduction: In-organic polyphosphate is a linear polymer of ten to hundred phosphate residue linked by high energy phosphoanhydride bonds as found in
ATP. Primitive earth under high pressures and desiccation resulted in phosphate rocks, some of them as poly-P. Yet, indisputably origin of life is a phosphate world, the unique chemical and physical properties of poly-P and its ubiquity must have played key roles in the origin and survival of species (Rao et al., 2009). Poly-P granules in bacteria are also called “Volutin granules” or “Metachromatic granules” due to their tendency to stain pink
4 with basic blue dyes (Pallerla et al., 2005). Over a century ago, the presence of metachromatic granules was used as a diagnostic feature for medically important bacteria such as Corynebacterium diptheriae. Recently, with the advent of electron microscopy, these granules were identified in other nonpathogens like Corynebacterium glutamicum thereby refuting the presence of poly-P granules as characteristic of diagnosis of disease state alone (Pallerla et al., 2005).
1.2.2 Poly-P analysis methods: These methods are important to give better understanding of poly-P structure and its role. Below mentioned analysis methods help us to reveal the poly-P chain length specification of enzymes, localization inside the cell, complex structure formed with other proteins etc.
1.2.2.1 Enzymatic method– Requires the action of a yeast exopolypolyphosphatase
(scPPX1) to hydrolyze the Poly P to inorganic phosphate (Pi). The released Pi measured either by thin-layer chromatography (TLC) or by phosphoimager (Rao N et al., 1998).
Another enzymatic assay uses the reverse reaction of Poly-P kinase 1 (PPK1) to measure conversion of ADP to ATP by Poly P, using a specific and sensitive luciferase method
(Ault et al., 1998).Chain-length specificity of these enzymatic assays are below 60 Pi.
1.2.2.2 Ion Exchange Method- Chromatography with an online hydroxide eluent generator was used to analyze Poly-P up to 50 residues (Ohtomo et al., 2004).
Combination of above mentioned methods are used to measure both long- and short- chain Poly-P.
5
1.2.2.3 Metachromatic Staining – Here, Toluidine blue dye is used to determine broad chain-length specificity but is relatively insensitive. This method was used to measure poly-P synthesizing activity in crude extracts (Mullan A. et al., 2002).
1.2.2.4 31P-NMR Spectroscopy -This method is used to measure Poly-P in intact cells, the relative Poly-P content is estimated as the intensity ratio of the “core Poly P” signal to the intracellular Pi (Zakrzewska J et al., 2005 and Zivic M et al., 2007). A bioreactor coupled with 31P NMR spectroscopy was used to analyze both intra- and extracellular Poly- P
(Gonzalez B et al., 2000).
1.2.2.5 Electron Ionization Mass Spectrometry- The high specificity of electron ionization mass spectrometry (ESI-MS) allows the detection of different Poly-P species without prior separation by ion exchange chromatography or capillary electrophoresis and the detection limit ranges from ≈1 to 10 ng/ml.
1.2.2.6 Cryoelectron Tomography and Spectroscopy Imaging -This method is applied for characterizing intact subcellular poly-P granules inside the bacterial cell using combination of techniques. Cryoelectron microscopy and tomography is used to study the biogenesis and morphology of these bodies (resolution >10 nm), whereas spectroscopic imaging provides the direct identification of their chemical composition (Comolli LR et al., 2006). This method can also distinguish between carbon-rich and Pi-rich bodies.
1.2.2.7 In Vivo Protein Affinity Labeling - This method offers visualization of Poly-P in intact cells at the electron microscopy level with much higher specificity and resolution.
Here, the poly P-binding domain (PPBD) of E. coli PPX1 protein is exploited to directly demonstrate the poly- P localization inside the bacterial cell (Saito K et al., 2005). The
6 samples are labeled with epitope-tagged PPBD, followed by the detection of the tag by an immunocytochemical procedure.
1.2.3 Cellular location of Poly-P: (a) Prokaryotes- It has been reported to occur as electron-dense volutin granules in bacteria (Meyer, 1904). Poly-P also exists as poly-(R)-
3-hydroxybutyrate complex in the outer membranes of Hemophilus influenza and E. coli
(Zakharian and Reusch, 2007). Ca2+ -Poly-P rich granules are also seen in Agrobacterium tumefaciens and Rhodospirillum rubrum (Seufferheld et al., 2003).
(b) Eukaryotes - Acidocalcisomes are vacuoles containing poly-P, pyrophosphate and divalent metal ions, commonly documented in the unicellular eukaryotes such as trypanosomatid and apicomplexan parasites, algae and slime molds (Docampo et al.,
1995; Moreno and Zhong, 1996). In alga Chlymydomonas reinhardtii, poly- P is found in the vacuoles along with Ca2+ and Mg2+ (Komine et al., 2000). In Saccharomyces cerevisiae, poly-P is widely distributed in every compartment including cytosol, vacuoles, nuclei and mitochondria (Wurst et al., 1995; Trilisenko et al., 2002; Lichko et al., 2006). Nearly, 80-90% of the total poly-P in S. cerevisiae is found in the cytosol, while 15% occurs in the vacuoles. Poly-P has also been reported in all higher eukaryotes so for investigated (Kumble and Kornberg, 1995), and commonly seen in the tissues like kidney, liver, lungs, brain, and heart, and subcellular compartments such as mitochondria.
1.2.4 Functions of Poly-P: In prokaryotes, poly- P is essential for numerous cellular functions such as ATP and energy source, phosphate reservoir, cations sequestration and storage, buffer against alkali, participation in membrane transport, cell envelope formation and function, regulator of enzyme activities, gene activity control and
7 development, chromatin destabilization, DNA replication and phage production, sporulation and germination, bacterial virulence/pathogenesis, and regulator of stress and survival (Kornberg et al., 1999; Brown and Kornberg, 2004 and 2008; Seufferheld et al.,
2008; Rao et al., 2009).
In eukaryotes beside above mentioned functions, poly -P also mediates cytokinesis and cell division (Zhang et al., 2007), blood clotting (Smith et al., 2006), bone and calcium metabolism (Hacchou et al., 2007; Morimoto et al., 2010), signaling, cell growth, proliferation and apoptosis (Shiba et al., 2003;Wang et al., 2003; Hernandez-
Ruis et al., 2006), mitochondrial ion transport and respiratory chain activity
(Kulakovskaya et al., 2010) and yolk mobilization and embryogenesis (Gomes et al.,
2010).
1.2.5 Industrial applications of Poly-P: Additionally, poly-P has several industrial applications such as microbial remediation of phosphate and toxic metals in waste water treatment, the use of poly-P in the biomining of copper, the use of plants in phytoremediation. Poly-P as a food additive is widely used, especially in the meat and dairy industry to enhance flavor, water binding, color retention, and emulsification, while retarding oxidative rancidity. Poly-P is also used as antimicrobial, and in general Gram positive bacteria are found to be more sensitive than the Gram negative bacteria. The antimicrobial effect is concentration dependent, higher concentration is bactericidal, whereas sublethal concentration retards the cell growth (Maier SK, et al., 1999).
Generally, the ability of poly-P to chelate cations is regarded as the cause of antimicrobial effect, and it was shown that the membrane permeabilizer like poly-P
8 increased the susceptibility to a range of antibiotics (Denny B, et al., 2003). In biotechnology, it is supplied as a cheap source of high-energy phosphate to substitute for costly ATP (Rao N, et al., 2009).
1.2.6 Poly-P homeostasis
1.2.6.1 Polyphosphate kinase 1 (PPK1): PPK1 is the principal enzyme responsible for synthesis of poly-P in most bacteria (Ahn and Kornberg, 1990; Akiyama et al., 1992).
PPK1 catalyzes the polymerization of the terminal phosphate of ATP into a poly-P chain.
This reaction is reversible but favors synthesis of poly-P. PPK1 is highly conserved and
PPK1 homologs have been found in over >100 bacterial species including 20 major pathogens. E. coli PPK1 (EcPPK1) is a homotetramer of 80 KDa subunits attached to the inner cell membrane. The crystal structure of EcPPK1 revealed that its active site is located in a highly conserved structural tunnel with a unique ATP binding pocket (Zhu et al., 2005). The first step in poly-P synthesis is auto-phosphorylation of the enzyme. The recent studies suggest that histidine residue H435 is involved in autophosphorylation
(Rao et al., 2009).
Several investigations in many bacterial species have shown that PPK1 plays an important role in bacterial survival under conditions of stress, virulence, and host colonization. Poly-P is important for growth, motility, biofilm formation, antibiotic resistance, stationary-phase survival, resistance to nutrient, oxidative, osmotic, invasion and intracellular survival and host colonization (Rao and Kornberg, 1996; Rashid and
Kornberg, 2000; Ayraud et al., 2005; Candon et al., 2007; Gangaiah et al., 2009Rao et al., 2009; Tunpiboonsak et al., 2010).
9
1.2.6.2 Polyphosphate kinase 2 (PPK2): PPK2 is another major enzyme, which preferentially mediates poly- P driven generation of GTP (Ishige et al., 2002; Sureka et al., 2009). PPK2 is widely conserved in bacteria including major human pathogens such as Mycobacterium tuberculosis, Pseudomonas aeruginosa and Vibrio cholera (Ishige et al., 2002). PPK2 class of enzymes belong to the large superfamily of P loop kinases, which catalyze the hydrolysis or binding of nucleoside triphosphates (Leipe et al., 2003).
The hallmark of P loop kinases is the presence of Walker A (GXXXXGK), and Walker B
(hhhhD, where h is a hydrophobic residue) motifs as well as a lid module (Rx(2-3)R).
Walker A and Walker B motifs are essential for binding nucleoside triphosphates, and
Mg2+ cation, respectively (Leipe et al., 2003). PPK2 enzymes are classified into 2 groups, those containing 1 or 2-fused PPK2 domains. Proteins with a 1-PPK2 domain can also catalyze poly-P dependent phosphorylation of ADP to ATP, while proteins containing 2- fused PPK2 domains phosphorylate AMP to ADP (Nocek et al. 2008).
PPK2 class of enzymes are distinct from PPK1 in several aspects; PPK2 utilizes poly-P to generate GTP at a rate 75-fold greater than that of poly-P synthesis from GTP or ATP (Ishige et al., 2002). The other feature is the relative selectivity of guanosine and adenosine nucleotides as donors and acceptors; PPK2 uses GTP and ATP equally well in poly-P synthesis, but PPK1 is strictly specific for ATP. For poly-P synthesis activity,
Mn2+ is preferred over the Mg2+ by PPK2, whereas reverse is true for PPK1. In
M.tuberculosis, PPK2 was shown to be important for survival under stress conditions such as heat, acid and hypoxic stresses, regulating intracellular nucleotide pool as well as intracellular survival in macrophages (Sureka et al., 2009).
10
1.2.6.3 Polyphosphatases (PPN/Xs): Poly-P is degraded to inorganic phosphate by two class of enzymes; endo- (PPN) and exopolyphosphatases (PPX) (Rao et al., 2009).
1.2.6.3.1 Endopolyphosphatases (PPN): PPN are the least studied of the poly-P metabolizing enzymes and have been reported in species of Penicillium and Aspergillus and in S. cerevisiae (Krishna P.S. 1952; Mattenheimer, H. et al., 1956). They are widely distributed in animal cells and is more abundant in yeast (Kumble and Kornberg, 1996), however, remarkably little or none detected in E. coli due to abundant exopolyphosphatase activities (Akiyama, M et al., 1993). PPN also called poly-P depolymerases or polyphosphorylases, catalyze the non-processive cleavage of poly-P to release intermediate-size chains during the course of the reaction. An endopolyphosphatase attacks long chain poly-P (P700) internal phosphoanhydride bonds, hydrolyzing poly-P molecules into oligophosphates of smaller size (P60-3), which are further processed by exopolyphosphatases.
In yeast, mutant lacking ppn1 shows limited growth and fails to survive in a minimal medium in the stationary phase. The loss of viability of the yeast ppn1 mutant may be the result of an accumulation of large amounts of poly-P as long chains. The powerful chelating capacity of this poly-P might sequester divalent metal cations like
Ca2+ Mg2+ and Mn2+ that would damage essential cellular functions (Dunn, T et al.,
1994). In yeast, PPN1 enzyme shown to be a homotetramer of a 35-kDa (352 amino acids) subunit, derived from protease action on a 78-kDa polypeptide of vacuolar origin
(674 amino acids) to generate 35-kDa subunit (Kumble K, Kornberg A. 1996; Shi X,
Kornberg A. 2004). For the PPN activity to manifest in yeast, it is necessary that strains
11 should possess vacuolar proteases, indicating a need for proteolytic processing of the pre-
PPN1 enzymes.
1.2.6.3.2 Exopolyphosphatases (PPX): Exopolyphosphatases, PPXs hydrolyze the terminal phosphate from linear long chain Poly-P (P60) to release short chain containing three or more phosphoanhydride bonds. They are classified into two types; (a) the cytoplasmic PPX1 from S. cerevisiae (scPPX1) and PPX from fungi and protozoa belonged DHH phosphoesterase family. The DHH family are named after the characteristic triplet motif, Asp- His-His, that contributes to the active site of each member. Although, these two PPX types have most of things in common but differ in their molecular weight and ATP hydrolyzing ability; scPPX1 cannot hydrolyze ATP
(Kulakovskaya, T. V et al., 1997 and Guranowski, A et al., 1998).
Beside above classification, structurally two PPXs have been characterized: the stringent response-related exopolyphosphatase/ guanosine pentaphosphate phosphohydrolase (PPX/GPPA), a monomeric protein that folds into two domains and is thought to be principally a GPPA; and the PPX related with hydrolysis of linear poly-P particularly,P60-3, a dimer with four domains in each subunit (Kristensen, O et al., 2004).
E. coli contains 2 PPXs, PPX1 and GPPA (PPX2) (Rangarajan et al., 2006). E. coli PPX1 is an enzyme of 513 amino acids with a molecular mass of 58.1 kDa. PPX1 enzyme releases orthophosphate (Pi) from the linear poly-P chain residues in a processive manner and requires Mg2+ and KCl for its maximum activity. The action of PPX is directed towards the ends of poly-P chain, from which it removes orthophosphate processively (Masahiro et al., 1993).The mechanism that enables PPX to distinguish the 12 ends of a long chain poly-P from those of a short one is obscure and intriguing. As for the cellular salvage and disposal of short chains are concerned, they may be used as primers for polyphosphate kinase or degraded by numerous other phosphatases (Ahn et al., 1990).
The crystal structure of E. coli PPX1 revealed four domains (I, II, III and IV) and the putative PPX site is located at the interface between domain I and domain II. PPX1 contains two functional domains, N-terminal catalytic domain and C-terminal domain that is responsible for poly-P binding and processivity. Overproduction of PPX results in several striking phenotypes in E. coli (Crooke et al., 1994; Rao N et al., 1996 and Shiba et al., 1997); decreased long-term survival in stationary phase; increased sensitivity to oxidative, osmotic, and thermal stresses; and defects in adaptive growth in minimal medium after a shift from rich medium. These phenotypes are likely due to the decreased expression of the rpoS gene, which encodes the principal stationary-phase sigma factor, sS, or RpoS (Shiba et al., 1997). Corynebacterium glutamicum contains 2 genes encoding exopolyphosphatases, ppx1 and ppx2 (Lindner et al., 2009). PPX2 was shown to be the primary exopolyphosphatase in C. glutamicum and was shown to be active as monomer requiring Mg2+ and Mn2+ for maximum activity. However, the enzyme was inhibited by higher concentrations of Mg2+, Mn2+ and Ca2+. Furthermore, PPX2 enzymes also shown to be active with short-chain polyphosphates, even accepting pyrophosphates, and was inhibited by nucleoside triphosphates. Interestingly, PPX enzymes have been shown to be important for avoiding complement-mediated killing in Neissariameningitidis (Zhang et al., 2010).
13
PPX2/GPPA is a bifunctional enzyme possessing both exopolyphosphatase and guanosine pentaphosphate phosphohydrolase activities (Kristensen et al., 2004; Rao et al., 2009). E. coli PPX2/GPPA is a bifunctional enzyme, liberates Pi by processively hydrolyzing poly-P chains and also hydrolyzes guanosine pentaphosphate (pppGpp) to generate ppGpp, an intracellular second messenger. PPX2/GPPA enzymes are the members of the sugar kinase/actin/hsp-70 superfamily and are distinct in sequence and structure from the functionally related RelA/SpoT enzymes which modulate stringent response. The poly-P homeostasis and stringent response are closely connected with each other (Kuroda et al., 1997; Kristensen et al., 2008), and it has been shown that pppGpp and ppGpp signaling molecules interconnects the ppGpp and poly-P homeostasis. In amino acids limitation condition, uncharged tRNA binds non-enzymatically to the acceptor site of an elongating ribosome activating the RelA protein to synthesize the pppGpp (Potrykus et al., 2008). Accumulation of pppGpp inhibits the PPX mediated poly-P degradation activity (Kuroda et al., 1997) thereby increased level of poly-P. Poly-
P and pppGpp also induces the expression of RNA polymerase sigma factor, RpoS (Rao
NN et al., 1996 and Shiba T et al., 1997), which inturn directs the transcription of > 50 key genes involved in shifting normal growth and metabolism to persistent state
(Hengge-Aronis R et al., 2002). Hence, both ppGpp and poly-P accumulate in response to nutrient limitation and play essential roles in bacterial survival under diverse stress conditions.
14
Figure 2 Inhibitory actions of ppGpp and pppGpp on PPX enzymes.
Source: Kornber A. et al., 1999 Under amino acid starvation, both general stress response and stringent response are elicited, and the Lon protease degrades unnecessary proteins to salvage amino acids.
Ribosomal proteins are among the commonly degraded proteins under amino acid starvation. Bacteria use these amino acids to synthesize new proteins required for survival in the minimal medium (Yen et al., 1980). Poly-P has been shown to regulate the
Lon protease-mediated protein degradation in E. coli (Kuroda et al., 2001; Nomura et al.,
2004; Kuroda, 2006). Free ribosomal proteins were preferentially degraded by poly-P-
Lon protease complex compared to Lon protease alone. Poly- P was found to facilitate binding of Lon protease and the ribosomal protein. The DNA binding site for Lon protease is the same as that for poly-P and Lon protease has more affinity for poly-P than
DNA. Thus, poly-P not only regulates Lon protease-mediated protein degradation, but also influences Lon protease-DNA binding activities.
15
Figure 3 Lon protease roles in stringent and stress response.
Although different suggestions were presented in these studies concerning the bifunctional aspects of PPX/GPPA; one study suggested two separate active sites
(Rangarajan et al., 2006), and the other was in favor of a common active site (Alvarado et al., 2006). Kristensen O et al., 2004 and 2008 crystallized the PPX/GPPA enzymes of A. aeolicus and E. coli and showed the existence of common active site. A simple hinge movement of domain I and II is sufficient to bring the E. coli PPX enzyme into an “Open
State” that is compatible with both poly-P and pppGpp hydrolysis at a common active site. This revealed a structural flexibility that has previously been described as a
16
"butterfly-like" cleft opening around the active site in other actin-like superfamily proteins. A calcium ion is observed at the center of this region in crystals, substantiating that PPX/GPPA enzymes use metal ions for catalysis (Kristensen et al., 2008).
1.3 Poly-P role in bacterial pathogenesis
Bacterial virulence factors are generally expressed in stationary phase, and poly-P and its metabolizing enzymes are essential for stationary phase survival (Rao and
Kornberg, 1996; Kornberg et al., 1999; Condon et al., 2007; Gangaiah et al., 2009 and
2010). Microarray analysis of ppk1 mutants of stationary phase P. aeruginosa and E. coli revealed up-regulation of over 250 genes and down-regulation of more than 450 genes
(unpublished data quoted in Rao et al., 2009). Genes involved in quorum sensing, iron starvation response system, and type III secretion system were down-regulated, while genes involved in amino acid and polyamine metabolism, nitrogen metabolism and transport, and biogenesis of type IV fimbriae were found to be up-regulated in P. aeruginosa. Similarly, PPK2 was also shown to regulate the expression of over 20 genes in P. aeruginosa. As a component of degradosome, PPK1 might also play a role in posttranscriptional regulation in bacteria (Blum et al., 1997).
In addition, poly-P was shown to be important for competitive fitness of P. fluorescens (Silby et al., 2009), serum resistance of N. meningitidis (Tinsley and
Gotschlich, 1995), invasion and intracellular survival within epithelial cells in Salmonella and Shigella (Kim et al., 2002), and host colonization in P. aeruginosa (Fraley et al.,
2007). The Salmonella ppk1 mutant exhibited defects in long term survival (Kim et al.,
2002). Mutants of ppk1 in other bacteria have revealed defects in growth, motility,
17 biofilm formation, quorum sensing, stress resistance, stationary phase fitness and resistance to antibiotics (Ogawa et al., 2000; Rashid et al., 2000; Rashid and Kornberg,
2000; Fraley et al., 2007; Schurig-Briccio et al., 2009; Gangaiah et al., 2009 and 2010).
Poly-P also plays a role in structure and function of bacterial chromosome and a ppk1 mutant exhibited compaction of nucleoid from 46% of the cell area to 26% in P. aeruginosa (Fraley et al., 2007). Nucleoid compaction is believed to have contributed to defect in motility, biofilm formation, quorum sensing, and virulence in P. aeruginosa ppk1 mutant. Histone-like (HU) proteins were found to bind poly-P more strongly than the linear double-stranded DNA and poly-P could displace HUs bound to DNA in vitro.
This contribute to bending and alteration of DNA at specific sites, are believed to be involved in nucleoid stability and integrity (Rao et al., 2009).These findings suggest a role for poly-P in regulation of gene expression possibly by displacing HUs from DNA.
1.4 ppGpp role in bacterial pathogenesis
Stringent response is a global stress response that alters bacterial gene expression to enable survival under diverse stress conditions such as nutrient limitation, phosphate limitation, oxidation, heat, desiccation and hyper-osmolarity (Cashel et al., 1996).
Stringent response is mediated by ppGpp which is synthesized from pppGpp by RelA or
SpoT. ppGpp is thought to bind to RNA polymerase and alter the gene expression by affecting promoter specificity, transcription initiation and elongation (Cashel et al., 1996;
Chatterji and Ojha, 2001). Both pppGpp and ppGpp repress many genes including those involved in ribosome synthesis and activate 50 or more genes responsible for coping with stress and starvation. ppGpp plays multiple roles in bacterial physiology and pathogenesis
18 including long term persistence, symbiosis, quorum sensing, production of antibiotics, biofilm formation, virulence, and sporulation (Dalebroux et al., 2010). ppGpp is also a positive effector of RpoS and RpoS-dependent genes and thus ppGpp regulates the induction of RpoS-dependent general stress response (Jishage et al., 2002).
It has been shown that both pppGpp and ppGpp affect poly P accumulation in E. coli in response to amino acid starvation (Kuroda et al., 1997; Rao et al., 1998). Mutants of E. coli and Salmonella deficient in synthesis of stringent factors relA and spoT were not only defective in (p)ppGpp synthesis but also poly-P accumulation (Kuroda and Ohtake,
2000). The stringent response nucleotides (pppGpp and ppGpp) had no effect on the activities of poly-P synthesizing enzyme PPK1. However, (p)ppGpp was inhibitory to
PPX and thus affecting the dynamic balance between poly P synthesis by PPK1 and poly
P degradation by PPX, accounting for elevated levels of poly P. The poly-P utilizing enzyme PPK2 also has been associated with ppGpp accumulation as PPK2 contributes to
GTP synthesis and GTP is a precursor for ppGpp synthesis (Kim et al., 1998).
19
Chapter 2: Introduction
Campylobacter jejuni is a microaerophilic Gram- negative curved and non-spore forming bacterium that persistently colonize in the intestinal microflora of various livestock especially, poultry (Berry et al., 1998). However, it can infect humans and infection by C. jejuni is considered to be a prevalent cause of bacterial mediated diarrheal disease worldwide (Adk et al., 2005). Campylobacteriosis is often a self-limiting disease condition characterized by fever, abdominal pain, vomiting and sometimes bloody diarrhea in healthy persons. In addition, seldom post-infectious fatal complications like
Guillian-Barre Syndrome, Miller Fisher Syndrome and reactive arthritis can also occur in
1 in 1000 cases (van Koningsveld et al., 2001). Efforts to reduce campylobacteriosis in humans are directly linked to a better understanding of the pathobiology of C. jejuni, however the molecular bases of such virulence mechanisms are not fully elucidated yet.
In-organic polyphosphate (poly-P), a polymer of ten to hundred phosphate residues, linked by high energy phosphoanhydride bonds, is conserved in every cell in nature: bacterial, fungal, plant and animal (Kulaev et al., 1983). It can serve as a source of energy for synthesis of sugars, nucleosides, and proteins; and activating precursor for fatty acids, phospholipids, polypeptides, and nucleic acids. Poly-P is also a key regulator of bacterial survival, stress response, host colonization and virulence in many pathogenic 20 bacteria including C. jejuni (Kornberg et al., 1999; Rao et al., 2009; Candon et al., 2007).
Poly-P metabolism is governed by several specialized enzymes. Polyphosphate kinase-1
(PPK1) is responsible for the synthesis of long chain poly-P from ATP, although the reaction is reversible but it favors the synthesis of most of poly-P in the cell (Kornberg et al., 1999; Tan et al., 2005; Gangaiah et al., 2010); polyphosphate kinase-2 (PPK2), which utilizes poly-P to generate GTP at rate 75-fold greater than that of the poly-P synthesis from GTP (Ishige et al., 2002; Sureka et al., 2009); and the exopolyphosphatases (PPXs) that degrade poly-P into a smaller branch of inorganic phosphate. Exopolyphosphatases have been classified into two kinds (1) classical PPX enzymes: primarily monofunctional and have exopolyphosphatase activity. Besides, PPX’s essential role in poly-P homeostasis (Akiyama et al., 1993; Bolesch and Keasling, 2000; Rangarajan et al., 2006;
Lindner et al., 2009), it has been shown to be required for motility, biofilm formation, and sporulation in Bacillus cereus (Shi et al., 2004) and also shown to be critical for resistance to complement-mediated killing in Neisseria meningitidis (Zhang et al., 2010).
(2) PPX/GPPA enzymes: have both exopolyphosphatase and guanosine pentaphosphate
(pppGpp) phosphohydrolase activities (Kristensen et al., 2004; Rangarajan et al., 2006;
Rao et al., 2009) to generate Guanosine tetraphosphate (ppGpp). The ppGpp is an alarmone molecule synthesized under stringent response in plants and bacteria to initiate a global physiological change; the expression and activity of many virulence regulators are directly or indirectly regulated by ppGpp mediated global response (Dalebroux et al.,
2010). The bacterial intracellular level of ppGpp is modulated by two classes of enzymes: monofunctional synthatase (Rel-A) and bifunctional synthatase/hydrolase (SpoT). In
21 addition, PPX2/GPPA enzymes also play an essential role in ppGpp metabolism thereby involved in bacterial stringent response induced by starvation (Keasling et al., 1993;
Reizer et al., 1993; Kuroda et al., 1997; Kristensen et al., 2004 and 2008; Rao et al.,
2009). In C. jejuni, SpoT is involved in stringent response, lack of SpoT function shown to affect several specific stresses, transmission and antibiotic resistnace related phenotypes (Gaynor et al., 2005). Taken together, the complex metabolic network of the ppGpp and poly-P are very critical for pathogenic bacteria survival, replication, and transmission.
C. jejuni 81-176 encodes two potential dual-function exopolyphosphatases ppx1/gppa (CJJ81176_0377) and ppx2/gppa (CJJ81176_1251).The dual function
PPX/GPPA enzymes have been shown in addition to poly-P hydrolysis, they can also generate guanosine tetraphosphate (ppGpp) (Rangarajan et al., 2006). However, to date no studies describe the role of these enzymes in poly-P hydrolysis, ppGpp synthesis as well as their pathophysiology in C. jejuni. Since poly-P homeostasis is critical, and the
PPX/GPPA enzymes are involved in poly-P metabolism and possibly in ppGpp
(alarmone molecule) synthesis, we hypothesize that PPX/GPPA enzymes may have an important role in C. jejuni’s pathobiology and persistence in the different environmental conditions. To test our hypothesis, we generated deletion mutants of ppx1 and ppx2
(∆ppx1, and ∆ppx2) as well as double knock out (dkppx) and assessed their role in virulence and stress related phenotypic characters. Here, we report the key role of C. jejuni PPX/GPPA proteins and their role in transmission related phenotypic traits like, motility, osmotic stress survival, intracellular invasion and survival.
22
Chapter 3: Materials and Methods
3.1 Bacterial strains and growth conditions
All studies were performed with the highly invasive Campylobacter jejuni strain
81-176 originally isolated from a diarrheic patient (Korlath et al., 1985). The C. jejuni cultures were routinely grown on Muellers-Hinton (MH; Becton Dickinson and
Company) medium under microaerobic conditions (85% N2, 10% CO2 and 5% O2) in a
DG250 Microaerphilic Workstation (Microbiology International). For the growth curve and stress survival assays, C. jejuni and generated strains were cultured on MH broth with specific antibiotics at 42o C with shaking at 200 g. All the bacterial strains were enumerated (CFU/ml) on MH agar plates by serial 10-fold dilutions. For the purpose of cloning and plasmid propagation, E. coli DH5α cells were used and routinely cultured on
Luria-Bertani (LB; Becton Dickinson and Company) agar or broth at 37o C. The growth mediums were supplemented with specific antibiotics concentration, chloramphenicol (20
µg/ml for E. coli, 10 µg/ml for C. jejini), zeocin (50 µg/ml) and kanamycin (30 µg/ml) wherever required.
3.2 Cloning techniques
Primers were designed using Vector NTI® software (Invitrogen) and commercially synthesized by Integrated DNA Technologies. All the primes used in the 23 present study are listed in the Table (3.1). QIAquick®PCR purification kit and spin mini prep kit for plasmid isolation were purchased from Qiagen. Masterpure® DNA purification kit and Fast-Link DNA ligation kit were purchased from Epicenter.
Restriction enzymes were purchased from Promega. pZEro-1, the zero background cloning vector and E. coli DH5α competent cells were purchased from the Invitrogen.
Cloning and other molecular biological techniques were performed according to
Sambrook and Russel (2001).
3.3 Construction of C. jejuni 81-176 deletion mutants and complemented strains
The BLAST search using ppx/gppa gene as a reference sequence from Aquifex aeolicus showed that C. jejuni posessess two exopolyphosphatases ppx1/gppa
(CJJ81176_0377) and ppx2/gppa (CJJ81176_1251) encoding 486 and 324 amino acids.
In this study, we generated deletion mutants (∆ppx1, ∆ppx2, and dkppx) by double crossover homologous recombination as described previously (Rajashekara et al., 2009).
Briefly, to construct the mutant, the target gene was amplified from C. jejuni 81-176 genomic DNA with designated primers. The PCR product was cloned into pZErO-1 plasmid, the resulting construct was amplified by inverse PCR ensuring that most of the ppx1 and ppx2 coding sequence were deleted. The inverse PCR product was ligated to a kanamycin gene from pUC4K and the final suicide vector was introduced into C. jejuni
81-176 by electroporation as described (Wilson et al., 2003). To generate a double knockout (dkppx) mutant, ppx2/gppa suicide vector containing the chloramphenicol gene was electroporated into ∆ppx1 mutant. The MH agar plate containing kanamycin and
24 chloramphenicol resistant colonies were selected for the double knockout mutants. The deletion of target gene was confirmed by PCR.
For complementation, the target genes along the potential promoter regions were amplified from genomic DNA with a specific set of primers; the products were cloned into pRY111, an E. coli-Campylobacter shuttle vector (Yao et al., 1993). The resulting constructs were introduced into the respective mutant by triparental conjugation. The complement strain for the dkppx mutant was not generated due to limited availability of replicating plasmids as well as antibiotic markers choice for use in C. jejuni. The complemented strains (Cppx1 and Cppx2) were also confirmed by PCR. The list of all the bacterial stains and plasmids used in the study are listed in Table (3.2)
3.4 Growth curve assay
The growth curve assay was done as described previously (Gangaiah et al., 2010).
Cultures were to grown mid-log phase on MH plates and were washed, resuspended in
MH broth to adjust to 0.05 OD600. The MH broth cultures were incubated microaerobically at 42oC for 60 h with shaking at 200 g. For assessing the growth, CFU was determined at different time points by plating 10-fold serially diluted cultures on MH agar.
3.5.1 Extraction and Quantification of poly-P
The extraction of poly-P from C. jejuni strains were performed using Glassmilk method as previously described (Candon et al., 2007; Gangaiah et al., 2010). Briefly, C. jejuni cultures were grown in MH broth to mid-stationary phase to reach OD600 of 0.3, cells were harvested followed by lysis with buffer (guanidine isothiocynate-GITC 4 mM,
25
500 mM Tris-HCl pH 7.0). The 10 ul of samples were removed for the total cellular protein estimation and the remaining samples were subjected for washing with buffer (5 mM Tris-HCl (pH-7.5), 50 mM NaCl, 5 mM EDTA, 50% ethanol). The washed pellets were suspended in resuspension buffer (50 mM Tris-HCl pH (7.4), 10 mM MgCl2, and
20 ug each of DNase and RNase per ml). Finally poly-P was eluted by brief centrifugation at 10,000 g with elution buffer (50 mM Tris-HCl pH 8.0).
3.5.2 Quantification of poly-P by a TBO assay: Briefly, standard curve was determined by using known concentrations (128nM, 64nM, 32nM, 16nM, 8nM, 4nM) of phosphorus standard (Sigma) with toluidine blue O dye (TBO 6 mg/liter in 40mm acetic acid) (Sigma-Aldrich). The unknown poly-P samples of C. jejuni were incubated with
TBO at room temperature followed by assessing absorbance at 630nm and 530 nm. The poly-P binding to TBO results in a shift in TBO absorbance from 630 nm to 530nm, hence the ratio of 530nm/630nm reflects the amount of poly-P in a given sample. The levels of poly-P in samples were determined by direct comparison with standard curve and were expressed as nmol/mg of total cellular protein. The total cellular protein was measured by Bradford analysis (BCA kit- Pierce Scientific).
3.6 ppGpp isolation and detection
ppGpp isolation and detection was assayed as described previously (Gaynor et al.,
2005; Gangaiah et al., 2010). Briefly, the bacterial strains were grown in MH agar for 16-
18 h. Cultures were diluted to adjust OD600 of 0.25; cells were pelleted, washed twice in
MOPS-MGS (50 mM MOPS,55 mM mannitol, 1 mM MgSO4, 0.25 mM CaCl2, 19 mM glutamic acid, and 0.004 mM biotin) (Mendrygal and Gonzalez, 2000) and resuspended
26 in 250 μl MOPS-MGS. The 32P at 100 μCi ml-1 (3.7 × 1012 Bq) was added to cells and incubated for 3, 6, and 24 h at 37°C microaerobically. Labeled cells were harvested, washed and treated with lysozyme in 10 mM Tris (pH 8.0) for 20 min. ppGpp was extracted with equal volume of 2 M formic acid and placed on ice for 15 min. Samples were spun for 5 min at 10,000 g, and 3 μl of supernatant was spotted directly onto cellulose TLC plates, dried, and developed in 1.5 M KH2 PO4 and visualized by autoradiography.
3.7 Motility assay
The motility assay was performed as described previously (Rajaskekara et al.,
2009). Briefly, C. jejuni cells were grown overnight on MH plate microaerobilically at
o 42 C. The cells were washed with MH broth and OD600 was adjusted to 0.05. The 2ul of the culture (≈ 5 x 107 cells) was stabbed onto 0.4% semi-solid agar and incubated microaerobically at 42oC. After 24 hrs of incubation, the swarming zone around the stabbed area was measured (cm).
3.8 Biofilm assay
The static biofilm formation was assayed as described previously (Candon et al.,
2007; Gangaiah et al., 2010). Briefly, cells were grown overnight microaerobically on
o MH plate at 42 C. The cells were harvested in MH broth and OD600 was adjusted to 0.05.
One hundred ul of OD adjusted culture was inoculated to 2 ml MH broth in borosilicate tubes and incubated at 42oC microaerobically for 48 h without shaking. The static biofilm formations were visualized by staining with 250 ul of 1% (w/v) crystal violet for 15 min.
To quantify amount of biofilm formation, 2ml of dimethyl sulfoxide (DMSO) was added
27 and incubated at room temperature for 24 h. The absorbance was measured at 570 nm to quantify the amount of biofilm stained by crystal violet dye.
3.9 Nutrient down shift assay
Nutrient down shift assay was performed as described previously (Candon et al.,
2007; Gangaiah et al., 2009). Briefly, C. jejuni cultures were grown on MH plate microaerobically at 42oC for 16-18 h. The cultures were washed twice by centrifuging at
10,000 g for 2 min with minimum essential media (MEM). Bacteria were resuspended in
o MEM to adjust OD600 of 0.05 and placed under microaerobic conditions at 42 C with shaking at 200 rpm. CFU was determined by plating on MH agar at different time point intervals.
3.10 Osmotic stress assay
The ability of C. jejuni’s ppx mutants to tolerate osmotic stress was determined as described previously (Candon et al., 2007). Briefly, mid log-phase grown bacterial cultures were suspended in MH agar containing 0.17 M NaCl and OD600 adjusted to 0.05.
OD adjusted cultures were serially diluted (10-fold) and a 10 μl of cultures were spotted on MH agar containing 0.17 M NaCl. After incubation microaerobically at 42oC for 2 days, the growth of C. jejuni strains on MH agar containing 0.17 M NaCl was assessed.
To test survivability of ppx/gppa mutants to osmotic stress in a liquid media, cultures OD were adjusted to 0.05 in MH broth containing 0.25 M NaCl and incubated under microaerobic conditions at 42oC for 60 h with shaking at 200 g. The CFU was assessed at different time points by plating on MH agar.
3.11 Oxidative stress assay
28
The ability of C. jejuni ppx mutants to survive under oxidative stress was assessed as previously described (Tunpiboonsak et al., 2010). Briefly, the bacterial strains (≈ 5 x
107 cells) were spread for confluent growth on MH agar. At the center of MH agar, 6 mm diameter hole was made and well bottom was sealed with 50 ul of molten MH agar. The wells were filled with the 30 ul 0.3% H2O2 or 20 mM paraquat and the plates were incubated under microaerobic conditions at 42oC for 24 hours, the clear zones of sensitivity surrounding the wells were measured (mm).
3.12 Tissue culture infection model (INT407 cell invasion and intracellular survival assay)
The infection model for invasion and intracellular survival with INT407 cells were performed as mentioned previously (Gaynor et al., 2005; Svensson et al., 2009).
INT407 cells (≈1.4 x 105) in MEM with 10% (v/v) fetal bovine serum (FBS) were seeded
o to 24-well tissue culture plate and incubated at 37 C with 5% CO2 for 18 h. The MH broth grown mid-log phase C. jejuni cultures were pelleted by centrifuging at 6000 g for
10 min and washed twice with MEM containing 1% (v/v) FBS, adjusted OD600 of 0.02 was adjusted in MEM, and cultures were subsequently used to infect INT407 cells.
Different multiplicities of infection (MOI) were followed to infect the cells in duplicate wells, for invasion 0.1:1, 1:1, 10:1, 100:1 MOIs were used and 100:1 MOI was used for intracellular survival assay. To assess invasion, INT407 cells were incubated with bacteria for 3 h and treated with gentamicin (150 ug/ml), incubated for additional 2 h.
The infected cells were washed with MEM two times and lysed with 0.1% (v/v) Triton-x
29
100. One hundred ul of aliquot from each well was serially 10-fold diluted in MEM and plated on MH agar plate in duplicate to determine CFU.
In order to determine intracellular survival, all the above mentioned steps were followed till 2 h of gentamicin treatment. After that, the infected cells were washed two times with MEM and added with fresh MEM containing gentamicin (10 ug/ml) and incubated for additional 24 h. Following incubation, the infected cells were washed with
MEM two times and lysed with 0.1% (v/v) Triton-x 100. 100 ul of aliquot from each well was serially 10-fold diluted in MEM and plated on MH agar plate in duplicate to determine CFU.
3.13 Serum bactericidal assay
This assay was performed as described previously (Blaser et al., 1984; Thormika et al., 2011). The commercially available pooled normal human serum (NHS) and pooled normal chicken serum (NCS) (Innovative Research) were used. Briefly, C. jejuni strains were harvested after 16-18 h of growth on MH plates, washed and resuspended to
106cells/ml in Medium 199 with Hank’s balanced salt solution (with 0.01% glutamine).
From each dilution, 150 ul of cultures were transferred in duplicate to 96 well microtiter plates. To each well, 50 ul of either 100% NH/CS in Medium 199, 100% heat – inactivated (56oC for 30 min) NH/CS (HINH/CS) or Medium 199 alone was added to obtain final concentration of NH/CS and HINH/CS to 25% and the plate was incubated for 60 min under microaerobic conditions at 37oC for human serum, and 42˚C for chicken serum. The 100 ul of aliquots from the each well was 10-fold serially diluted and plated to assess CFU. Log10 killing was determined by subtracting the difference between the
30 numbers of CFU at HINHS/HINCS to NHS/NCS. Percent of cell survival was also calculated by dividing the number of cells in control (NH/CS) to number of cell in heat inactivated (HI-NH/CS).
3.14 Quantitative RT-PCR
Quantitative RT-PCR (qRT-PCR) was performed targeting key genes involved in poly-P homeostasis; stringent response (spoT) (Gaynor et al., 2005), and poly-P metabolism
(ppk1and ppk2) (Candon et al., 2007; Gangaiah et al., 2009 and 2010). The mid stationary phase grown bacterial cultures were used for total RNA extraction using
RNeasy Mini Kit (Qiagen). The RNA concentration and purity was determined using
NanoDrop ND-1000 spectrophotometer and gel electrophoresis. Two hundred ng of
DNAse treated RNA was used for cDNA synthesis using SuperScript® III First-Strand
Synthesis SuperMix kit (Invitrogen). Following cDNA synthesis, cDNA concentration was normalized to 200 ng and gene specific primers were used to amplify the spoT, ppk1 and ppk2 genes along with 16S-rRNA as internal control. The qRT-PCR was performed using SensiMixPlus® SYBR RT-PCR Kit (Quantace) in a realplex2 mastercycler
(Eppendorf). The relative levels of expression of genes were normalized with 16S-rRNA amplified from the corresponding sample. The difference in expression of the genes was calculated using the comparative threshold cycle (∆∆Ct) method to yield fold-difference in transcript levels.
3.15 Statistical analysis method
In this study, statistical significance of data was determined by using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test or Student
31 t-test (paired 2-tailed). A P value of P≤0.05 or 0.001 (α level) was considered statistically significant for all the experiments. The error bar represents the mean ±SE from 3 or 2 independent experiments with duplicate sample.
32
Chapter 4: Results
4.1 The ppx/gppa genes of C. jejuni
The phylogenetic analysis using MEGA-5 (Center for Evolutionary Medicine and
Informatics, Arizona, USA) showed that the PPX/GPPA domains of C. jejuni , A. aeolicus, H. pylori, S. epidermidis, C. glutamicum, A. butzleri JV22, Streptomyces spp
AA4, S. erythraea NRRL2338 and E. coli PPX/GPPA proteins belong to same family of exopolyphosphatases as all share common evolutionary branch (Figure- 4). In addition,
C. jejuni ppx1/gppa clustered is with Helicobacter and Acrobacter where as ppx2/gppa with Corynebacterium species. ClustalW2, structure based sequence alignment also showed that the C. jejuni ppx1/gppa sequence has both the catalytic residue (E119) required for PPX activity and arginine residues (R22 and R267) necessary for ppGpp specificity, suggesting this enzyme might mediate both poly P and (p)ppGpp hydrolysis
(bifunctional activity). On the contrary, C. jejuni PPX2/GPPA domain possess the catalytic residue (E119) and R22 but not R267 (Figure-5), indicating this enzyme is less likely a primary mediator of (p)ppGpp hydrolysis. In addition, predicted three dimensional structural arrangement of PPX1/GPPA domain of C. jejuni using A. aeolicus
PPX/GPPA as reference sequence exhibited more alignment with the reference sequence
33 compared to PPX2/GPPA of C. jejuni further support the above mentioned speculation
(Figure-6A, 6B) that PPX2/GPPA is less likely to encode pppGpp hydrolytic function
The genetic organizations of ppx1/gppa and ppx2/gppa genes are conserved across the different strains of C. jejuni (Figure-7) with amino acid sequence identity ranging from 97% to 100%. In addition, PPX/GPPA enzymes are also conserved among other sequenced Campylobacter species. (PPX1/GPPA sequence identity 35% to 97%;
PPX2/GPPA sequence identity 46% to 99%)
4.2 PPX/GPPA proteins have exopolyphosphatase activity
In order to verify that the deletion of ppx/gppa genes did not affect the overall growth properties of the mutants’ we assessed the ∆ppx mutants growth curve by determining CFU at different time interval in MH broth. There was no significant difference between CFU forming ability of ∆ppx mutants (∆ppx1, ∆ppx2, dkppx) and wildtype (Figure-8).
To investigate C. jejuni PPX/GPPA annoted protein’s exopolyphosphatase activity, we measured the intracellular poly-P levels in ∆ppx mutants (∆ppx1, ∆ppx2 and dkppx). Poly-P was extracted by glass milk method and quantified by toluidine blue O dye as described in materials and methods. Our results indicated that the deletion of ppx genes alter the intracellular poly-P levels compared to wild type. The ∆ppx1, and dkppx mutants showed significant ( p≤0.05, p≤0.001) increase in the poly-P level (45.5 nM and
48.5 nM/mg of total cellular protein (TCP), respectively) compared to wildtype (35 nM/mg TCP), however, the ∆ppx2 mutant also exhibited increased poly-P level (39.5 nM/mg TCP) but it was not significant ( p>0.05) (Figure-9). The complemented strains 34
(Cppx1 and Cppx2) displayed level of poly-P (37 nM/mg TCP) similar to that of wildtype. Above findings confirm that the ppx1/gppa and ppx2/gppa genes of C. jejuni have exopolyphosphatase activity, this findings is consistent with previous published report showing accumulation of poly-P in ∆ppx mutants (Shin et al., 2004; Lindner et al.,
2009). Furthermore, these data indicate that ppx1/gppa proteins have major function in poly-P degradation and both the genes may function synergistically in hydrolysis of poly-
P as shown with dkppx mutant.
4.3 PPX/GPPA enzymes have binfunctional activity
Since, C. jejuni ppx/gppa domains have structural and conserved amino acid residue required for the bifunctional activity as seen in A. aeolicus, our obvious anticipation is, they may have role in ppGpp metabolism. To address our hypothesis, we determined the level of ppGpp in the ∆ppx mutants compared to wildtype using Thin
Layer Chromatography (TLC) and the results were analyzed with densitometry. There was no difference in ppGpp accumulations at 3 h but difference was observed at 6 and 24 h (Figure-10A). The ∆ppx1, and dkppx mutant display decreased level of ppGpp (4% and
14% respectively), contrary, the level of ppGpp in ∆ppx2 mutant was slightly higher
(2%) than the wildtype (Figure-10B). Surprisingly, the level of ppGpp accumulation in dkppx mutant showed 3.5 fold higher than the ∆ppx1 mutant suggesting complex network pathways are involved ppGpp metabolism. These results indicates that PPX1/GPPA has both poly-P and pppGpp hydrolysis activity whereas PPX2/GPPA has only poly-P
35 hydrolytic activity. This is consistent with the predicted 3-dimenssional structure arrangement (Figure-6A, 6B).
4.4 PPX/GPPA enzymes are essential for motility and biofilm formation in C. jejuni
In addition to motility, the C. jejuni flagellum is also known to serve as a specialized secretion system for many non-flagellar proteins, some of which are crucial for pathogenesis (Konkel et al., 2004; Guerry et al., 2007). The ∆ppx mutant of Bacillus cereus displayed the phenotypic defect in motility and here we asked whether C. jejuni ppx/gppa genes have role in motility related phenotype. C. jejuni ∆ppx mutants motility was determined on semi-solid agar; the ∆ppx mutants displayed significant (p≤0.05, p≤0.001) defect in motility. The motility zone for ∆ppx1, ∆ppx2, and dkppx were 1.7 cm,
2.3 cm, and1.5 cm respectively compared to wild type (3.3 cm). The motility defects were partially restored in complemented strains Cppx1 (2.5 cm) and Cppx2 (2.7 cm)
(Figure-11A, 11B).
Biofilms play an essential role in C. jejuni survival, virulence and host colonization (Hanning et al., 2009; Reuter et al., 2010; Rajashekara et al., 2009) and several factors have been identified to contribute to C. jejuni biofilm formation. Biofilm formation is important for survival and persistence of C. jejuni in the environment and plays important role in the transmission of C. jejuni between host and environment. In this study we investigated the role of PPX/GPPA enzymes in C. jejuni biofilm formation in borosilicate glass tubes and quantified by staining with 1% (w/v) crystal violet dye.
The ∆ppx1, ∆ppx2 mutants showed no impairment in biofilm formation. The amount of biofilm formation was quantified by measuring the absorbance at OD 570nm. The ∆ppx1
36
(0.154), and ∆ppx2 (0.119) had no significant defect compared to wildtype (0.145).
However, the deletion of both the genes, (dkppx) did significantly (p≤0.001) affect the amount of biofilm formation (OD 570nm = 0.033) (Figure-12A, 12B). Taken together, these findings indicate that ppx/gppa genes role in transmission related phenotypes like motility and biofilm formation in C. jejuni.
4.5 Deletion of ppx/gppa genes affected C. jejuni survival during nutritional downshift
Previous research has shown that poly-P is essential for the ability of C. jejuni to survive under low nutrient stress (Gangaiah et al., 2009,). In C. jejuni ∆ppx mutants the poly-P homeostasis is imbalanced, this led us to investigate the mutants’ ability to survive under nutrient limitation. To assess the ability of C. jejuni to withstand nutrient limitation stress, we monitored the survival of the ∆ppx mutants’ in minimum essential media
(MEM) (without glutamine) at different time points. The ∆ppx1, ∆ppx2 and dkppx mutants were significantly (p≤0.05) defective in survival after 36 h. Trans- complementation of ppx1 and ppx2 restored the nutrient stress tolerant ability of mutants’ comparable to wildtype (Figure-13). These data demonstrate that, C. jejuni PPX/GPPA enzymes play an important role in nutrient starvation stress.
4.6 Impaired osmotic stress tolerance in C. jejuni dkppx mutant
Ability of C. jejuni’s ppx mutants to osmotic stress tolerance was determined in solid and liquid media using NaCl as osmotic stressor. In solid media, (MH agar containing 0.17M NaCl) osmotic stress response was determined by monitoring the
37 growth after spotting 10-fold serially diluted cultures of C. jejuni strains. There was no significant difference in the osmotic stress tolerance response in the ∆ppx1 and ∆ppx2 mutants compared to wildtype. On contrary, dkppx mutant at 104cells/ml dilution did exhibit significant (p≤0.05) sensitivity to osmotic stress in comparison to wildtype
(Figure-14A, 14B). Furthermore, survivability of dkppx mutant under liquid (MH broth containing 0.25M NaCl) osmotic stress was significantly (p≤0.05) affected at 48 and 60 h time points as assessed by determining CFU at different time points. Since, the ∆ppx1 and ∆ppx2 mutant did not show defect in osmotic stress tolerance on solid media we did not test these strains under liquid condition. These results indicate that the ppx/gppa genes may have role in C. jejuni osmotic stress tolerance mechanism.
4.7 PPX/GPPA enzymes do not affect the oxidative stress response
The ∆ppx mutants were also assessed for their ability to resist oxidative stress. 0.3%
H2O2 or 20 mM paraquat was used as oxidative stressors to determine oxidative stress sensitivity of the mutants. The ∆ppx mutants including dkppx showed no significant difference between zones of sensitivity to oxidative stress compared to wildtype (Figure-
15A, 15B).
4.8 The ∆ppx mutants’ exhibit dose-dependent defect for invasion and intracellular survival
To assay the virulence associated phenotypes of invasion and intracellular survival, C. jejuni ∆ppx mutants and wildtype strains were allowed to infect INT407
38 human intestinal epithelial cells at different MOIs. The invasion profile of the ∆ppx mutants and wildtype were similar except at 1:1 and 0.1:1 MOIs. The ∆ppx2 and dkppx mutant exhibited invasion defect compared to wildtype at1:1 and 0.1:1 MOIs. The intracellular survival was assessed using 100:1 MOI, although both ∆ppx2 and dkppx mutant were defective in intracellular survival but only dkppx mutant was significantly
(p≤0.05) defective in comparison to wildtype (Figure-16A, 16B). These data suggest that both PPX/GPPA enzymes are critical for the invasion and intracellular survival.
4.9 The ∆ppx mutants were resistant to complemented mediated killing
The bactericidal activity of complement present in serum is an innate defense mechanism against intruding pathogenic bacteria. Since the lack of PPX, an exopolyphosphatase activity, in N. meningitidis increased its resistance to complement mediated killing (Zhang et al., 2010), we asked whether PPX/GPPA deletion may have similar role in C. jejuni. To assess the complement mediated killing we compared the growth and survival of mutant and wildtype strains in pooled normal human/chicken serum (NH/CS) and respective heat inactivated serum (HINH/CS). The ∆ppx1 and ∆ppx2 mutants showed significant (p≤0.05) resistance to complement mediated killing surprisingly, the deletion of both the genes (dkppx) in C. jejuni significantly (p≤0.05) increased the sensitivity to complement mediated killing (Figure-17A). Trans- complementation of ppx1 and ppx2 genes were restored the complement mediated killing compared to wildtype. Further, complement mediated killing at 37˚C and 42˚C was similar however, the killing efficiency was slightly pronounced at 37˚C (data not shown).
39
Contrast to human serum, chicken serum had no effect on the killing of ∆ppx mutants
(Figure-17B).
4.10 Up-regulation of spoT and ppk1 in ∆ppx mutants
We performed the real time quantitative PCR (qRT-PCR) targeting key known genes involved in poly-P homeostasis to better understand the mechanistic aspects of poly-P homeostasis in C. jejuni ∆ppx mutants. We targeted the spoT, ppk1 and ppk2 genes as they have a role in poly-P and ppGpp metabolism; spoT has a bifunctional synthatase/hydrolase activity for pppGpp; PPK1is responsible for the synthesis of long chain poly-P from ATP; and PPK2- utilizes poly-P to generate GTP. The differential expression of genes were expressed as fold change as calculated by (∆∆Ct) method using
16S-rRNA as internal control. The spoT and ppk1 genes were up-regulated 2 fold or more in ∆ppx1, ∆ppx2, dkppx mutants but the expression of ppk2 gene remained similar in all the mutants’ in comparison to wildtype. However, only spoT expression found to be significantly (p≤0.05) up-regulated in ∆ppx1 mutant (Figure-18). These data suggest that the expression of ppk1 and spoT genes enhance the production of ppGpp to avoid the accumulation of poly-P, hence may have a compensatory role in poly-P homeostasis.
40
Chapter 5: Discussion
In contrast to other better understood enteric pathogens like Salmonella, Shigella, and E. coli species, C. jejuni lacks most of the classical virulence factors such as toxins and type III secretion system; even the recent sequencing of additional strains, including one known to be highly virulent and invasive (C. jejuni 81-176) did not uncover any of the classical virulence factors (Fout et al., 2005; Hofreuter et al., 2006 and Pearson et al.,
2007). In addition, it’s relatively small size genome (1.64 Mb), C. jejuni has to exploit most of its genes to meet great challenge to survive and transmit between hosts. Hence, better understanding of the host-microbe interactions that affect the pathogenesis of C. jejuni is of an immense importance.
Previous studies have shown that the poly-P plays critical role in virulence related phenotypic traits in pathogenic bacteria including C. jejuni (Candon et al., 2007;
Gangaiah et al., 2009 and 2010). In this work, we focused to expand our understanding of Poly-P homeostasis. Poly-P molecule has multiple diverse functions like, phosphate reservoir, source of energy, pH modulator, metal chelator, and structural component of membrane transport channels (Brown et al., 2004; Korneberg et al., 1999). Furthermore, the dynamic balance between poly-P synthesis and its breakdown is essential for normal functioning of bacterial cell (Kornberg et al., 1999). Perturbance in poly-P synthesizing 41 mechanism (PPKs) in C. jejuni has shown to be a novel determinant of stress response and pathogenesis (Gangaiah et al., 2009 and 2010). PPXs breakdown the linear poly-P containing three or more phosphoanhydride bonds to release the Pi. In M. tuberculosis deficiency of PPX lead to increased accumulation of poly-P and restricted the growth in auxenic cultures and in human macrophages (Mc Dermott W, 1959). In A. aeolicus,
PPX/GPPA enzymes in addition to poly-P degradation, they also breakdown the pppGpp to ppGpp (Kristensen O et al., 2004 an 2006) thereby playing an important role in starvation induced stringent response. Hence, we hypothesized that PPX/GPPA proteins might play critical role poly-P breakdown and might also govern unique characteristics of
C. jejuni pathobiology.
To explore the role of PPX/GPPA proteins in poly-P metabolism, we compared the intracellular poly-P level accumulation in ∆ppx to wild type. Our results suggests that
PPX/GPPA proteins have a role in poly-P hydrolysis as increased accumulation of poly-
P in ∆ppx mutants were seen and both enzymes act synergistically in poly-P degradation as shown with dkppx mutant (Figure-9). The ppx1/gppa and ppx2/gppa genes of C. jejuni have additive but not redundant effect in poly-P degradation. Furthermore, PPX1/GPPA has the major exopolyphosphatase activity compared to PPX2/GPPA. Our findings are in accordance with previous published data in C. glutamicum (Linder et al., 2009) except interchange in the role of PPX1 and PPX2 gene. In C. glutamicum, PPX1 and PPX2 share only 25% amino acids identity and deletion of ppx1 and ppx2 genes resulted in increase poly-P accumulation but less when either ppx1 or ppx2 was over-expressed. C. glutamicum, growth experiments, exopolyphosphatase activities and intracellular poly-P
42 concentration determination revealed that PPX2 is a major exopolyphosphatase, which is shown active with short chain poly-P. Hence, our obvious speculation was that
PPX1/GPPA and PPX2/GPPA may have substrate specificity in C. jejuni. However, whether the PPX1 and PPX2 encoded by C. glutamicum are indeed differing with respect to substrate specificity remains to be studied. The occurrence of 2 or more exopolyphosphatase within a species is not restricted to C. jejuni but is also seen in E. coli, V. cholera, and C. glutamicum. Non-overlapping substrate specificity may be the reason for occurrence of two or more exopolyphosphatase within one species (Linder et al., 2009).
We next addressed whether predicted PPX/GPPA proteins have bifunctional activity. Previous investigations of PPX/GPPA proteins in A. aeolicus, and E. coli have shown to possess the bifunctional activity (Kristensen O et al., 2004). Except in the above mentioned study in bacteria no other study has proved the PPX /GGPA bifunctional enzyme activity. To our knowledge this is the first study in C. jejuni depicting its PPX/GPPA bifunctional role and its significance in numerous transmission and virulence related phenotypes. Densitometry data analysis for ppGpp indicates that
∆ppx1 and dkppx mutant shows 4%, and 14% decreased in the level ppGpp, respectively.
The ∆ppx2 mutant showed 2% increase in the level of ppGpp in compared to wildtype
(Figure-10). The 3-fold increased level of ppGpp in dkppx mutant in comparison to
∆ppx1 signifies ppGpp metabolism in C. jejuni is also regulated by some other factors other than PPXs. Gaynor et al., 2005 showed that C. jejuni stringent response is mediated by a single enzyme SpoT and this enzyme is thought to mediate both pppGpp synthesis
43 and hydrolysis. Beside, our quantitative RT-PCR data support the up-regulation of SpoT as a compensatory mechanism in poly-P and ppGpp homeostasis (Figure-18). This can be explained by considering indirect effect of ppx2/gppa gene on mediators like SpoT in ppGpp metabolism. However, this is mere speculation yet needs to be experimentally supported.
C. jejuni’s ability to withstand the nutrient limited conditions in environment is critical for waterborne transmission. Poly-P homeostasis in C. jejuni is important for the low nutrient stress survival, osmotic stress tolerance, biofilm formation, VBNC state
(Candon et al., 2007; Gangaiah et al., 2009). C. jejuni flagellar motility and biofilms play an essential role in many aspects of its biology such as host colonization, secretion of virulence proteins, and host-cell adherence and invasion (Ferrero and Lee, 1988; Hanning et al., 2009; Reuter et al., 2010; Rajashekara et al., 2009). Besides PPKs, PPXs also have been shown to be essential for the transmission related phenotype traits like biofilm formation, motility and sporulation (Shin et al., 2004). Our data indicate that PPX/GPPA enzymes are required for the motility and biofilm formation. Although the motility was affected in the mutants, pronounced effect was seen in dkppx, suggesting that ppx1/gppa and ppx2/gppa genes have synergistic action in motility. Contrary, the amount of biofilm formation was only affected in dkppx mutant indicating a complex interconnected network of gene regulation of biofilm formation in C. jejuni (Figure-11A, 11B and 12A,
12B. These findings are in agreement with the previous published report (Shi et al.,
2004). In B. cereus, deletion of ppx gene was shown to affect motility, biofilm formation and sporulation. In addition, the ∆ppx mutant also displayed defective survival under
44 nutrient limited conditions, invasion and intracellular survival, and osmotic stresses
(Figure- 13, 14A, 14B and 16A, 16B).
The above described stress responses might also affect the ability of C. jejuni to cause disease in the host. In addition to stresses imposed by the environment, C. jejuni is also exposed to multiple stresses in vivo (like GIT mucosal barrier, local innate immune response during adherence, invasion and inside the host cell) as well as during interaction with other bacteria. Thus, PPX/GPPA-mediated stress response might also affect the virulence of C. jejuni.
Complement-mediated bacterial killing is a key component of the humoral arm of innate immunity necessary to control systemic infection from mucosal sources.
Encapsulated bacteria counterattack the antibacterial effect of complement by preventing deposition of the membrane attack complex on bacterial membranes (Moffitt MC, Frank
MM., 1994). Zhang et al., work in N. meningitidis showed that lack of PPX functions increased the resistance to complement-mediated killings by means of biochemical interactions with the complement. They also showed that the relative resistance of ppx mutant does not result from changes in structures such as capsule, lipopolysaccharides, and factor-H-binding protein, instead in modification of alternative pathway of complement activation. These findings made us to determine the contribution of
PPX/GPPA genes in complement mediated killing. Our findings are in agreement with previous work of Zhang et al. (2010), as the deletion of genes (∆ppx1 and ∆ppx2) did confer the resistance to complement mediated killing. Strikingly, deletion of both the genes (dkppx) results in sensitivity to complement mediated killing (Figure-17A). We
45 speculate that the PPX genes may affect surface structures such as capsule and lipopolysaccharides hence, our future studies are focused on comparing the capsule and lipopolysacchride profiles in ∆ppx mutants.
Our investigation was further expanded to assess the chicken serum mediated killings. Surprisingly, there was no effect of chicken complement factors on ppx mutant killing (Figure-17B). This result poses numerous questions to address , may be ppx genes functions is affected by number of factors; temperature dependent, or host restricted expression of ppx genes, or host immune system tolerance etc. To our knowledge, this is the first study to report that ppx genes deletion confirms the resistant against complement mediated killing in human serum but not in chicken serum.
Deinococcus radiodurans, Clostridium acetobutylicum, and Vibrio cholerae seem to be relicts of the coexistence of two putative ppx genes. If we take into account that poly-P confers improved fitness under environmental stress (Rao N. N et al., 1996), then the selective maintenance of ppx genes may be strongly associated with changing environments, while an immovable environment, such as a cell host, could cause gene loss, as suggested by the lack of ppx genes in Mycoplasma spp (Cardona ST et al., 2002).
Our future studies will be focused on deciphering the direct or indirect role of ppx/gppa genes in poly-P metabolism, investigating mechanism behind resistance to human serum complement, and studying the relative importance of ppx/gppa genes in C. jejuni.
In conclusion, we report that C. jejuni PPX/GPPA proteins have exopolyphosphatase activity, PPX1/GPPA has bifunctional enzyme functions and plays critical role in poly-P metabolism and ppGpp homeostasis. Beside their role in stress
46 related phenotypic traits they do have role in complement mediated resistance in human serum. Our study expands the multi-factorial regulation of poly-P metabolism in C. jejuni, which may serve as unique model for other bacteria as well.
47
Table 3.1 List of primers used in this study
Name Sequence (5’-3’) Description
PPX1/GPPA_F AAATTAGGTACCATATGAGTGTAGCGGAGCTT Used for ppx1/gppa gene amplification along with 1Kb up PPX1/GPPA_R AAATTACTGCAGGGTTATCAAACCGATTCTTC and downstream. PPX1/INV_F TTAATTGGATCCTCTCTATGTTTGAGTTTTAA Used for ppx1/gppa gene deletion by inverse PCR. PPX1/INV_R AATTAAGGATCCCTCTATAAGATTTTGAATTC PPX1C_F TTAATTGGATCCTCTCTATGTTTGAGTTTTAA Used for ppx1/gppa gene amplification for PPX1C_R GATATGGATCCGAAGCTATTTATGAAAATAG complementation. PPX2/GPPA_F AAATTAGGTACCAAACAAGTTGATCCTTTGGA Used for ppx2/gppa gene amplification along with 1Kb up PPX2/GPPA_R AAATTACTCGAGGTAAGCTTTCGTGGATAAAA and downstream. PPX2/INV_F TAATAAGGATCCAGTATTTGAACCAAGATCTA Used for ppx2/gppa gene deletion by inverse PCR. PPX2/INV_R AATTAAGGATCCACTTTCGTAAGTTTTAATGT PPX2C_F ATGCGGTACCCTTGCTTTAATGGATTTTGG Used for ppx2/gppa gene amplification for PPX2C_R ATAAAGGATCCCCGTGTTTAGCTGCTATAAA complementation. SpoT F GTAACCACTCGCACAATATC Used for quantitative RT-PCR. SpoT R GATGTCGCAGTTTATTCTCC PPK1 F TGAAGCAAGTATGGAAGGAG Used for quantitative RT-PCR. PPK1 R ATATAGGAGTCATAAGTTCTAAGC PPK2 F ATCTAATACTCCAACTTGTC Used for quantitative RT-PCR. PPK2 R TTCTTCTTCTCCACTACG 16s RNA_F GTCTCTTGTGAAATCTAATG Used as quantitative RT-PCR internal control. 16s RNA_R GTATTCTTGGTGATATCTAC
Underline sequence indicates the restriction enzymes site
48
Table 3.2 Bacterial strains and plasmids used in this study
Strain/Plasmid Relevant description Source Bacterial Strains
C. jejuni 81-176 Used as wild type strain of Campylobacter jejuni Dr. Qijing Zhang E. coli DH5α E. coli strain used for cloning Invitrogen ∆ppx1 C. jejuni 81-176 derivative with deletion in ppx1/gppa gene; ppx1/gppa::Kan This study ∆ppx2 C. jejuni 81-176 derivative with deletion in ppx2/gppa gene; ppx2/gppa::Kan This study Dkppx C. jejuni 81-176 derivative with deletion of ppx1/gppa and This study ppx2/gppa; ppx1/gppa::Kan, ppx2/gppa::Cm Cppx1 ∆ppx1 with pRY111- containing ppx1coding region and the This study upstream promoter sequence for complementation; Cm Cppx2 ∆ppx2 with pRY111- containing ppx2 coding region and the This study upstream promoter sequence for complementation; Cm Plasmids pRY111 E. coli-Campylobacter shuttle vector for complementation 129 pRK2013 Helper plasmid for conjugation, Kan 3 pZErO-1 Cloning vector for making suicide vector; Zeo Invitrogen pUC4K Source for kanamycin gene Amersham pZErO-1-ppx1 pZErO-1 containing ppx1/gppa region plus 1 kb upstream This study and downstream sequences from 81-176; Zeo ppx1-suicide Suicide vector with ppx1/gppa replaced by kanamycin This study vector- resistance region from pUC4K in; Zeo, Kan pZErO-1-ppx2 pZErO-1 containing ppx2/gppa region plus 1 kb upstream This study and downstream sequences from 81-176; Zeo ppx2-suicide Suicide vector with ppx2/gppa replaced by kanamycin This study vector- resistance region from pUC4K in; Zeo, Kan pRY111-ppx1 pRY111 containing ppx1 coding and upstream sequence for This study complementation. pRY111-ppx2 pRY111 containing ppx2 coding and upstream sequence for This study complementation.
Kan, kanamycin; Zeo, zeocin; Cm, cholramphenicol
49
Figure 4. Phylogenetic tree of C. jejuni PPX/GPPA enzymes. MEGA-5 software tool was used to construct phylogenetic tree. Branch lengths are indicated next to the protein name and are proportional to the predicted evolutionary change. HPG27_257- H. pylori
PPX/GPPA family phosphatase; ZP_07891646-A. butzleri JV22 PPX/GPPA family phosphatase; CJJ81176_0377- C. jejuni PPX1/GPPA family phosphatase; ECS88_4200-
E. coli Guanosine pentaphosphate hydrolase; ZP_07282576- Streptomyces spp AA4
PPX/GPPA family phosphatase; YP_001103109-S. erythraea NRRL2338 PPX/GPPA family phosphatase; aq_891- A. aeolicus exopolyphosphatase; SE2033- S. epidermidis
PPX/GPPA family phosphatase; CJJ81176_1251- C. jejuni PPX2/GPPA phosphatase and cg0488- C. glutamicum exopolyphosphatase.
50
Figure 5. Structure-based sequence alignment of PPX/GPAA domains of C. jejuni and related bacteria. Sequence alignment was performed using ClustalW2
(www.ebi.ac.uk/Tools/clustalw2/index.html). Where “ * ” indicates positions of characters which have a single, fully conserved residue. “▲” the column is strongly conserved, “◘” the column is weakly conserved. Catalytic residue required for phosphatase activity is highlighted by black letter on sky-blue background and the residues required for guanosine pentaphosphate specificity are highlighted by black letters on yellow background. CJJ81176_0377- C. jejuni PPX1/GPPA family phosphatase; ZP_07891646-A. butzleri JV22 PPX/GPPA family phosphatase;
HPG27_257- H. pylori PPX/GPPA family phosphatase; ZP_07282576- Streptomyces spp
AA4 PPX/GPPA family phosphatase; YP_001103109-S. erythraea NRRL2338
PPX/GPPA family phosphatase; aq_891- A. aeolicus exopolyphosphatase; SE2033- S. epidermidis PPX/GPPA family phosphatase; ECS88_4200- E. coli Guanosine pentaphosphate hydrolase; cg0488- C. glutamicum exopolyphosphatase and
CJJ81176_1251- C. jejuni PPX2/GPPA phosphatase .
51
52
Figure 6. Predicted three-dimensional structure of C. jejuni PPX/GPPA enzymes. Three- dimensional structure was identified with CBLAST, 3-dimensional structure alignment search tool using A. aeolicus PPX/GPPA as reference
(www.ncbi.nlm.nih.gov/Structure/CBLAST). The region in pink or red indicates C. jejuni PPX/GPPA residues identical to A. aeolicus PPX/GPPA, while the region with no homology is indicated in blue. The region in grey indicates unaligned sequences of C. jejuni PPX/GPPA. (A) Structural alignment of C. jejuni PPX1/GPPA. (B) Structural alignment of C. jejuni PPX2/GPPA.
53
Figure 7. Genetic organization of ppx1/gppa and ppx2/gppa genes in C. jejuni genome.
(A) Location of ppx/gppa genes are conserved among different sequenced C. jejuni strains. (B) Schematic representation of approximate location of kanamycin, and chloramphenicol antibiotic markers in deletion ∆ppx mutants of C. jejuni strain 81-176.
The fdxB encodes for ferredoxin, pdxJ encodes for pyridoxine 5’-phosphate synthase and the pdxA encodes for 4-hydroxythreonine-4-phosphate dehydrogenase.
54
1.010 10 Wt ppx1 ppx2 1.010 09 dkppx
1.010 08
CFU/ml 10 Log
1.010 07 t0 t12 t24 t36 t48 t60 Hours
Figure 8. Growth kinetics of C. jejuni ppx/gppa mutants. Mid-log phase grown cultures were used to adjust an OD600 of 0.05 in 5 ml of MH broth and incubated microaerobically at 42 ºC with shaking at 200 g. The growth was assessed by CFU determination at different time points.
55
Figure 9. Intracellular poly-P levels in C.jejuni ∆ppx mutants. Poly P was extracted using glass milk and quantified by toluidine blue O method. Each data point is the mean± SE of
3 independent experiments. * P ≤ 0.05 and ** P≤ 0.001.
56
Figure 10. Intracellular (p)ppGpp levels in the C.jejuni ∆ppx mutants .The amount of ppGpp accumulation was assessed using early log phase culture and labeling with 32P .
(A) Nucleotides were resolved at 3, 6 and 24 h by TLC and visualized using autoradiography. (B) Densitometry quantification of ppGpp and pppGpp at 24 h. Each bar represents the average from 2 independent experiments with duplicate sample.
57
Figure 11. Motility of C. jejuni ∆ppx mutants (A) Motility assay: The 2 µl of 0.05 OD600 cultures were stabbed onto 0.4% soft agar and incubated under microaerobic conditions at 42 °C. The results were recorded at 24 h. (B) Quantification of motility defects:
Motility was quantified by measuring the swarming zone (radius in cm) surrounding the stabbed area. Each bar represents the average from 3 independent experiments. * P ≤ 0.05
** P ≤ 0.001.
58
Figure 12. (A) Biofilm formation by C. jejuni ∆ppx/gppa mutants. The biofilm formation was visualized by staining with 1% crystal violet for 15 mints. (B) Quantification of biofilm in ∆ppx/gppa mutants. The amount of biofilm was quantified by measuring the absorbance at 570 nm after dissolving in 2 ml DMSO for 48 h. Each image and bar represents the mean ± SE of 3 independent experiments with triplicate samples. . ** P ≤
0.001. 59
Figure 13. Nutrient downshift assay of C. jejuni ∆ppx mutants. Sensitivity of C. jejuni
∆ppx mutants to nutrient stress was assessed by monitoring their survival in minimal essential media without glutamine at different time points. Each data point represents the mean ± SE of 2 independent experiments with duplicate sample. * P ≤ 0.05.
60
Figure 14. Osmotic stress assay. The dkppx mutant shows decreased osmotic stress tolerance in (A) solid (MH agar with 0.17mM NaCl) as well as (B) liquid media (MH broth with 0.25 mM NaCl). In liquid media osmotic stress was determined by monitoring cells survival at different time points. The dotted line indicates the limit of detection.
Each bar represents the mean ±SE from 3 independent experiments with duplicate sample. *P≤ 0.05
61
Figure 15. Sensitivity of ∆ppx/gppa mutants to oxidative stress. (A) Sensitivity to oxidative stress was determined by disc diffusion assay using 0.3% hydrogen peroxide or
20 mM paraquat. (B) Quantification of oxidative stress, the zone of inhibition diameter was measured after 24 hours of incubation and expressed in cm. Each bar represents the mean ±SE from 3 independent experiments with triplicate sample.
62
Figure 16. The ppx mutants display a dose dependent invasion defect (MOIs1:1, 0.1:1 and 100:1) and intracellular survival defect (MOI 100:1) in INT 407 human intestinal epithelial cells. (A) Invasion assay (B) Intracellular survival assay. The dotted line indicates the limit of detection. Each bar represents the mean ±SE from 2 independent experiments with duplicate sample. *P≤ 0.05
63
Figure 17. Complement dependent killing of C. jejuni ∆ppx/gppa mutants to (A) human and (B) chicken seum.Log10 killing was determined by subtracting the difference between number of CFU in heat inactivated serum (HINHS or HINCS) to normal serum (NHS or
NCS). Bars represent the mean± SE of 3 independent experiments with duplicate sample.
* P ≤ 0.05 ** P ≤ 0.001.
64
Figure 18. Quantitative RT-PCR analysis of the wildtype and C. jejuni ∆ppx mutants.
Fold difference in transcript level was assessed from ∆∆CT after normalizing to 16sRNA.
Each bar represents the mean ±SE of the relative fold change in expression from 3 independent experiments with duplicate sample. *P≤ 0.05
65
Bibliography
1. Adak, G. K., Meakins, S. M., Yip, H., Lopman, B. A., and O'Brien, S. J. 2005. Disease risks from foods, England and Wales, 1996-2000. Emerg. Infect. Dis. 11: 365-372. 2. Ahn, K., and Kornberg, A. 1990. Polyphosphate kinase from Escherichia coli. Purification and demonstration of a phosphoenzyme intermediate. J. Biol. Chem. 265: 11734-11739. 3. Akiba, M., Lin, J., Barton, Y. W., and Zhang, Q. 2006. Interaction of CmeABC and CmeDEF in conferring antimicrobial resistance and maintaining cell viability in Campylobacter jejuni. J. Antimicrob. Chemother. 57: 52-60. 4. Akiyama, M., Crooke, E., and Kornberg, A. 1992. The polyphosphate kinase gene of Escherichia coli. Isolation and sequence of the ppk gene and membrane location of the protein. J. Biol. Chem. 267: 22556-22561. 5. Akiyama, M., Crooke, E., and Kornberg, A. 1993. An exopolyphosphatase of Escherichia coli. The enzyme and its ppx gene in a polyphosphate operon. J. Biol. Chem. 268: 633-639. 6. Allos, B. M. 2001. Campylobacter jejuni Infections: update on emerging issues and trends. Clin. Infect. Dis. 32: 1201-1206. 7. Alvarado, J., Ghosh, A., Janovitz, T., Jauregui, A., Hasson, M.S., Sanders, D.A. 2006. Origin of exopolyphosphatase processivity: fusion of an ASKHA phosphotransferase and a cyclic nucleotide phosphodiesterase homolog. Structure 14:1263–72. 8. Ault-Riché, D., Fraley, C. D., Tzeng, C. M., and Kornberg, A. 1998. Novel assay reveals multiple pathways regulating stress-induced accumulations of inorganic polyphosphate in Escherichia coli. J. Bacteriol. 180: 1841-1847. 9. Ayraud, S., Janvier, B., Labigne, A., Ecobichon, C., Burucoa, C., and Fauchere, J. L. 2005. Polyphosphate kinase: a new colonization factor of Helicobacter pylori. FEMS Microbiol. Lett. 243: 45-50. 10. Beery, J. T., Hugdahl, M. B., and Doyle, M. P. 1988. Colonization of gastrointestinal tracts of chicks by Campylobacter jejuni. Appl. Environ. Microbiol. 54: 2365-2370. 66
11. Blaser, M.J., and Duncan, D.J. 1984. Human serum antibody response to Campylobacter jejuni infection as measured in an enzyme-linked immunosorbent assay. Infect Immun. 44:292-8. 12. Blum, E., Py, B., Carpousis, A. J., and Higgins, C. F. 1997. Polyphosphate kinase is a component of the E. coli RNA degradosome. Mol. Microbiol. 26: 387- 398. 13. Bolesch, D. G., and Keasling, J. D. 2000. Polyphosphate binding and chain length recognition of Escherichia coli exopolyphosphatase. J. Biol. Chem. 275: 33814-33819. 14. Brown, M. R. and Kornberg, A. 2008. The long and short of it-polyphosphate, PPK and bacterial survival. Trends. Biochem. Sci. 33: 284-290. 15. Brown, M. R. W., and Kornberg, A. 2004. Inorganic polyphosphate in the origin and survival of species. Proc. Natl. Acad. Sci. USA. 101: 16085-16087. 16. Candon, H.L., Allan, B.J., Fraley, C.D., and Gaynor, E.C. 2007. Polyphosphate kinase 1 is a pathogenesis determinant in Campylobacter jejuni. J. Bacteriol. 189: 8099-8108. 17. Cardona. S.T., Chavez. F.P., and Jerez. C.A. 2002. The exopolyphosphatase gene from Sulfolobus solfataricus: Characterization of the first gene found to be involved in polyphosphate metabolism in Archaea Appl. Environ. Microbiol., 68: 4812-4819. 18. Cashel, M., Gentry, D. R., Hernandez, V. J., and Vinella, D. 1996. The stringent response. In: Escherichia coli and Salmonella; Cellular and Molecular Biology. Washington, DC: American Society for Microbiology. 19. Chatterji, D., and Ojha, A. K. 2001. Revisiting the stringent response, ppGpp and starvation signaling. Curr. Opin. Microbiol. 4: 160-165. 20. Comolli LR, Kundmann M, Downing KH. 2006. Characterization of intact subcellular bodies in whole bacteria by cryo-electron tomography and spectroscopic imaging. J. Microsc. 223:40–52. 21. Crooke, E., Akiyama, M., Rao, N. N., and Kornberg, A. 1994. Genetically altered levels of inorganic polyphosphate in Escherichia coli. J. Biol. Chem. 269: 6290-6295. 22. Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., and Swanson, M. S. 2010. ppGpp conjures bacterial virulence. Microbiol Mol Biol Rev. 74: 171-99.
67
23. Debruyne, L., Gevers, D., and Vandamme, P. 2008. Taxonomy of the family Campylobacteraceae. In: Campylobacter. Ed: I. Nachamkin, C. M. Szymanski and M. J. Blaser. ASM Press, Washington DC. p3-25. 24. Denny, B., West, P., and Panigrahi, D. 2003. Effects of permeabilizers on antimicrobial susceptibility of Stenotrophomonas maltophilia and Acinetobacter spp. J. Microbiol. Immunol. Infect. 36:72–77. 25. Docampo, R., Scott, D. A., Vercesi, A. E., and Moreno, S. N. 1995. Intracellular Ca2+ storage in acidocalcisomes of Trypanosoma cruzi. Biochem. J. 310: 1005- 1012. 26. Dunn, T., Gable, K. and Beeler, T. 1994. Regulation of cellular Ca2+ by yeast vacuoles J. Biol. Chem. 269, 7273–7278. 27. Ferrero, R. L., and Lee, A. 1988. Motility of Campylobacter jejuni in a viscous environment: comparison with conventional rod-shaped bacteria. J. Gen. Microbiol. 134: 53-59. 28. Fouts, D. E., E. F. Mongodin, R. E. Mandrell, W. G. Miller, D. A. Rasko, J. Ravel, L. M. Brinkac, R. T. DeBoy, C. T. Parker, S. C. Daugherty, R. J. Dodson, A. S. Durkin, R. Madupu, S. A. Sullivan, J. U. Shetty, M. A. Ayodeji, A. Shvartsbeyn, M. C. Schatz, J. H. Badger, C. M. Fraser, and K. E. Nelson. 2005. Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biol. 3: e15. 29. Fox, J. G., Ackerman, J. I., Taylor, N., Claps, M. and Murphy, J. C. 1987. Campylobacter jejuni infection in the ferret: an animal model of human campylobacteriosis. Am. J. Vet. Res. 48, 85–90. 30. Fraley, C. D., Rashid, M. H., Lee, S. S., Gottschalk, R., Harrison, J., Wood, P. J., Brown, M. R., and Kornberg, A. 2007. A polyphosphate kinase 1 (ppk1) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects. Proc. Natl. Acad. Sci. USA. 104: 3526-3531. 31. Friedman, C., Neimann, J., Wegener, H., and Tauxe, R.V. 2000. Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations, in: Nachamkin, I., Blaser, M.J. (Eds), Campylobacter. Washington, DC, ASM Press, pp.121—138. 32. Frost, J. A., Kramer, J. M., and Gillanders, S. A. 1999. Phage typing of Campylobacter jejuni and Campylobacter coli and its use as an adjunct to serotyping. Epidemiol. Infect. 123: 47-55. 33. Gangaiah, D., Kassem, I. I., Liu, Z., and Rajashekara, G. 2009. Importance of Polyphosphate Kinase 1 for Campylobacter jejuni iable-but-nonculturable cell
68
formation, natural transformation and antimicrobial resistance. Appl. Environ. Microbiol. 75: 7838-7849. 34. Gangaiah, D., Liu, Z., Arcos, J., Kassem, I.I., Sanad, Y., Torrelles, J., and Rajashekara, G. 2010. Polyphosphate Kinase 2: A Novel Determinant of Stress Responses and Pathogenesis in Campylobacter jejuni. PLoS ONE 5(8): e12142. 35. Gaynor, E. C., Wells, D. H., MacKichan, J. K., and Falkow, S. 2005. The Campylobacter jejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol. Microbiol. 56: 8-27. 36. Gomes, F. M., Oliveira, D. M., Motta, L. S., Ramos, I. B., Miranda, K. M., and Machado, E. A. 2010. Inorganic polyphosphate inhibits an aspartic protease-like activity in the eggs of Rhodnius prolixus (Stahl) and impairs yolk mobilization in vitro. J. Cell Physiol. 222: 606-11. 37. Gonzalez, B., de Graaf, A., Renaud, M., and Sahm, H. 2000. Dynamic in vivo 31P nuclear magnetic resonance study of Saccharomyces cerevisiae in glucose- limited chemostat culture during the aerobic-anaerobic shift. Yeast. 16:483–97. 38. Guerry, P. 2007. Campylobacter flagella: not just for motility. Trends Microbiol. 15: 456-461. 39. Guranowski, A., Starzynska, E., Barnes, L. D., Robinson, A. K. and Liu, S. 1998. Adenosine 5′- tetraphosphate phosphohydrolase activity is an inherent property of soluble exopolyphosphatase from yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta, 1380: 232–238. 40. Hacchou, Y., Uematsu, T., Ueda, O., Usui, Y., Uematsu, S., Takahashi, M., Uchihashi, T., Kawazoe, Y., Shiba, T., Kurihara, S., Yamaoka, M., and Furusawa, K. 2007. Inorganic polyphosphate: a possible stimulant of bone formation. J. Dent. Res. 86: 893-7. 41. Hanning, I., Donoghue, D. J., Jarquin, R., Kumar, G. S., Aguiar, V. F., Metcalf, J. H., Reyes-Herrera, I., and Slavik, M. 2009. Campylobacter biofilm phenotype exhibits reduced colonization potential in young chickens and altered in vitro virulence. Poult. Sci. 88: 1102-7. 42. Hengge-Aronis, R. 2002. Signal transduction and regulatory mechanisms involved in control of sigma(S) (RpoS) subunit of RNA polymerase. Microbiol. Mol. Biol. Rev. 66: 373-395. 43. Hernandez-Ruiz, L., González-García, I., Castro, C., Brieva, J. A., and Ruiz, F. A. 2006. Inorganic polyphosphate and specific induction of apoptosis in human plasma cells. Haematologica. 91: 1180-6.
69
44. Hofreuter, D., Tsai, J., Watson, R. O., Novik, V., Altman, B., Benitez, M., Clark, C., Perbost, C., Jarvie, T., Du, L., and Galan, J. E. 2006. Unique features of a highly pathogenic Campylobacter jejuni strain. Infect. Immun. 74: 4694-4707. 45. Ishige, K., Zhang, H., and Kornberg, A. 2002. Polyphosphate kinase (PPK2), a potent polyphosphate-driven generator of GTP. Proc. Natl. Acad. Sci. USA. 99: 16684-16688. 46. Jishage, M., Kvint, K., Shingler, V., and Nystrom, T. 2002. Regulation of sigma factor competition by the alarmone ppGpp. Genes Dev. 16: 1260-1270. 47. Katarzyna Potrykus and Michael Cashel 2008. (p)ppGpp: Still magical? Annu. Rev. Microbiol. 62:35–51. 48. Keasling, J. D., Bertsch, L., and Kornberg, A. 1993. Guanosine pentaphosphate phosphohydrolase of Escherichia coli is a long-chain exopolyphosphatase. Proc. Natl. Acad. Sci. USA. 90: 7029-7033. 49. Keo. T., Collins. J., Kunwar. P., Blaser. M.J. and Lovine. M.N. 2011. Campylobacter capsule and lipooligosaccharide confer resistance to serum and cationic antimicrobials. Virulence. 2:30-40. 50. Ketley, J. M. 1997. Pathogenesis of enteric infection by Campylobacter. Microbiology. 143: 5-21. 51. Kim, H-Y., Schlictman, D., Shankar, S., Xie, Z., Chakrabarty, A. M., and Kornberg, A. 1998. Alginate, inorganic polyphosphate, GTP and ppGpp synthesis co-regulated in Pseudomonas aeruginosa: Implications for stationary phase survival and synthesis of RNA/DNA precursors. Mol. Microbiol. 27: 717-725. 52. Kim, K. S., Rao, N. N., Fraley, C. D., and Kornberg, A. 2002. Inorganic polyphosphate is essential for long-term survival and virulence factors in Shigella and Salmonella spp. Proc. Natl. Acad. Sci. USA. 99: 7675-7680. 53. Komagamine, T., and Yuki, N. 2006. Ganglioside mimicry as a cause of Guillain-Barre syndrome. CNS Neurol. Disord. Drug Targets 5: 91-400. 54. Komine, Y., Eggink, L. L., Park, H., and Hoober, J. K. 2000. Vacuolar granules in Chlamydomonas reinhardtii: polyphosphate and a 70-kDa polypeptide as major components. Planta. 210: 897-905. 55. Konkel, M. E., Klena, J. D., Rivera-Amill, V., Monteville, M. R., Biswas, D., Raphael, B., and Mickelson, J. 2004. Secretion of virulence proteins from Campylobacter jejuni is dependent on a functional flagellar export apparatus. J. Bacteriol. 186: 3296-3303.
70
56. Korlath, J. A., Osterholm, M. T., Judy, L. A., Forfang, J. C., and Robinson, R. A. 1985. A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J. Infect. Dis. 152: 592-596. 57. Kornberg, A., Rao, N. N., and Ault-Riche, D. 1999. Inorganic polyphosphate: a molecule of many functions. Annu. Rev. Biochem. 68: 89-125. 58. Krishnan, P. S. 1952. Apyrase, pyrophosphatase and metaphosphatase of Penicillium chrysogenum Arch. Biochem. Biophys. 37: 224–234. 59. Kristensen, O., Laurberg, M., Liljas, A., Kastrup, J. S., and Gajhede, M. 2004. Structural characterization of the stringent response related exopolyphosphatase/guanosine pentaphosphate phosphohydrolase protein family. Biochemistry. 43: 8894-900. 60. Kristensen, O., Ross, B., and Gajhede, M. 2008. Structure of the PPX/GPPA phosphatase from Aquifex aeolicus in complex with the alarmone ppGpp. J. Mol. Biol. 375: 1469-76. 61. Kulaev, I. S., and Vegabov, V. M. 1983. Polyphosphate metabolism in microorganisms. Adv. Microbiol. Physiol. 24: 83-171. 62. Kulakovskaya, T. V., Andreeva, N. A. and Kulaev, I. S. 1997. Adenosine-5′- tetraphosphate and guanosine- 5′-tetraphosphate: new substrates of the cytosolic exopolyphosphatase of the yeast Saccharomyces cerevisiae. Biochemistry (Mosc), 62: 1051–1052. 63. Kulakovskaya, T. V., Lichko, L. P., Vagabov, V. M., and Kulaev, I. S. 2010. Inorganic polyphosphates in mitochondria. 75: 825-31. 64. Kumble, K. D., and Kornberg, A. 1995. Inorganic polyphosphate in mammalian cells and tissues. J. Biol. Chem. 270: 5818-5822. 65. Kumble, K. D., and Kornberg, A. 1996. Exopolyphosphatases for long chain inorganic polyphosphate in yeast and mammals. J. Biol. Chem. 271: 27146-27151. 66. Kuroda, A. 2006. A polyphosphate-Lon protease complex in the adaptation of Escherichia coli to amino acid starvation. Biosci. Biotechnol. Biochem. 70: 325- 331. 67. Kuroda, A., and Ohtake, H. 2000. Molecular analysis of polyphosphate accumulation in bacteria. Biochemistry (Moscow) 65: 304-308. 68. Kuroda, A., Murphy, H. Cashel, M., and Kornberg, A. 1997. Guanosine tetra and pentaphosphate promote accumulation of inorganic polyphosphate in Escherichia coli. J. Biol. Chem. 272: 21240-21243.
71
69. Kuroda, A., Murphy, H. Cashel, M., and Kornberg, A. 1997. Guanosine tetra and pentaphosphate promote accumulation of inorganic polyphosphate in Escherichia coli. J. Biol. Chem. 272: 21240-21243. 70. Kuroda, A., Nomura, K., Ohtomo, R., Kato, J., Ikeda, T., Takiguchi, N., Ohtake, H., and Kornberg, A. 2001. Role of inorganic polyphosphate in promoting ribosomal protein degradation by the Lon protease in E. coli. Science. 293: 705-708. 71. Lee, R. M., Hartmann, P. A., Stahr, H. M., Olson, D. G. and Williams, F. D. 1994. Antibacterial Mechanism of Long-Chain Polyphosphates in Staphylococcus aureus. J. Food Protect. 57: 289–294. 72. Leipe, D. D., Koonin, E. V., and Aravind, L. 2003. Evolution and classification of P-loop kinases and related proteins. J. Mol. Biol. 333: 781-815. 73. Lichko, L., Kulakovskaya, T., Pestov, N., and Kulaev, I. 2006. Inorganic polyphosphates and exopolyphosphatases in cell compartments of the yeast Saccharomyces cerevisiae under inactivation of PPX1 and PPN1 genes. Biosci. Rep. 26: 45-54. 74. Lindner, S. N., Knebel, S., Wesseling, H., Schoberth, S. M., and Wendisch, V. F. 2009. Exopolyphosphatases PPX1 and PPX2 from Corynebacterium glutamicum. Appl. Environ. Microbiol. 75: 3161-70. 75. Lindner, S. N., Knebel, S., Wesseling, H., Schoberth, S. M., and Wendisch, V. F. 2009. Exopolyphosphatases PPX1 and PPX2 from Corynebacterium glutamicum. Appl. Environ. Microbiol. 75: 3161-70. 76. Maier, S.K., Scherer, S., and Loessner, M.J. 1999. Long-chain polyphosphate causes cell lysis and inhibits Bacilluscereus septum formation, which is dependent on divalent cations. Appl. Environ. Microbiol. 65:3942–49. 77. Mattenheimer, H. 1956. Substrate specificity of inorganic poly and metaphosphatases. II. Separation of enzymes. Hoppe-Seyler Z. Physiol. Chem. 303: 11–14. 78. McDermott, W. 1959. Inapparent infection: relation of latent and dormant infections to microbial persistence. Public Health Rep 74: 485–499. 79. Mead, G. C., Hudson, W. R., and Hinton, M. H. 1995. Effect of changes in processing to improve hygiene control on contamination of poultry carcasses with Campylobacter. Epidemiol. Infect. 115: 495-500. 80. Meyer, A. 1904. Orientierende Untersuchungen ueber Verbreitung Morphologie, und Chemie des Volutins. Bot. Z. 62: 113-152.
72
81. Moffitt, M. C., and M. M. Frank. 1994. Complement resistance in microbes. Springer Semin. Immunopathol. 15: 327–344. 82. Moreno, S. N., and Zhong, L. 1996. Acidocalcisomes in Toxoplasma gondii tachyzoites. Biochem. J. 313: 655-59. 83. Morimoto, D., Tomita, T., Kuroda, S., Higuchi, C., Kato, S., Shiba, T., Nakagami, H., Morishita, R., and Yoshikawa, H. 2010. Inorganic polyphosphate differentiates human mesenchymal stem cells into osteoblastic cells. J. Bone Miner. Metab. 28: 418-23. 84. Mullan, A., Quinn, J.P., and McGrath, J.W. 2002. A nonradioactive method for the assay of polyphosphate kinase activity and its application in the study of polyphosphate metabolism in Burkholderia cepacia. Anal. Biochem. 308:294–99. 85. Nocek, B., Kochinyan, S., Proudfoot, M., Brown, G., Evdokimova, E., Osipiuk, J., Edwards, A. M., Savchenko, A., Joachimiak, A., and Yakunin, A. F. 2008. Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria. Proc. Natl. Acad. Sci. USA. 105: 17730-17735. 86. Nomura, K., Kato, J., Takiguchi, N., Ohtake, H., and Kuroda, A. 2004. Effects of inorganic polyphosphate on the proteolytic and DNA-binding activities of Lon in Escherichia coli. J. Biol. Chem. 279: 34406-34410. 87. Ogawa, N., Tzeng, C. M., Fraley, C. D., and Kornberg A. 2000. Inorganic polyphosphate in Vibrio cholerae: genetic, biochemical, and physiologic features. J. Bacteriol. 182: 6687-6693. 88. Ohtomo, R., Sekiguchi, Y., Mimura, T., Saito, M., and Ezawa, T. 2004. Quantification of polyphosphate: different sensitivities to short-chain polyphosphate using enzymatic and colorimetric methods as revealed by ion chromatography. Anal. Biochem. 328:139–46. 89. On, S. L. W. 2005. Taxonomy, Phylogeny, and methods for the identification of Campylobacter species. In: Campylobacter: Molecular and Cellular Biology. Eds J. M. Ketley, and Konkel, M. E., Wymondham: Horizon Bioscience UK: 13-42. 90. Pallerla, S. R., Knebel, S., Polen, T., Klauth, P., Hollender, J., Wendisch, and S. M. Schoberth. 2005. Formation of volutin granules in Corynebacterium glutamicum. FEMS Microbiol. Lett. 243: 133-140. 91. Park, S. F. 2002. The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International Journal of Food Microbiology. 74: 177-188.
73
92. Pearson. B.M., Gaskin. D.J., Segers. R.P., Wells. J.M., Nuijten. P.J., van Vliet. A.H. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 (NCTC11828). J Bacteriol, 189:8402–3. 93. Rajashekara, G., Drozd, M., Gangaiah, D., Jeon, B., Liu, Z., and Zhang, Q. 2009. Functional characterization of the twin-arginine translocation system in Campylobacter jejuni. Foodborne Pathog. Dis. 6: 935-945. 94. Rangarajan, E. S., Nadeau, G., Li, Y., Wagner, J., Hung, M. N., Schrag, J. D., Cygler, M., and Matte, A. 2006. The structure of the exopolyphosphatase (PPX) from Escherichia coli O157:H7 suggests a binding mode for long polyphosphate chains. J. Mol. Biol. 359: 1249-60. 95. Rao, N. N., and Kornberg, A. 1996. Inorganic polyphosphate supports resistance and survival of stationary-phase Escherichia coli. J. Bacteriol. 178: 1394-1. 96. Rao, N. N., Gómez-García, M. R., and Kornberg, A. 2009. Inorganic polyphosphate: essential for growth and survival. Annu. Rev. Biochem. 78: 605- 647. 97. Rao, N. N., Liu, S. J., and Kornberg, A. 1998. Inorganic polyphosphate in Escherichia coli: the phosphate regulon and the stringent response. J. Bacteriol. 180: 2186-2193. 98. Rashid, M. H., and Kornberg, A. 2000. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA. 97: 4885-4890. 99. Rashid, M. H., Rumbaugh, K., Passador, L., Davies, D. G., Hamood, A. N., Iglewski, B. H., and Kornberg, A. 2000. Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA. 97: 9636-9641. 100. Reizer, J., Reizer, A., Saier Jr, M. H., Bork, P., and Sander, C. 1993. Exopolyphos-phate phosphatase and guanosine pentaphosphate phosphatase belong to the sugar kinase/actin/hsp 70 superfamily. Trends Biochem. Sci. 18: 247- 248. 101. Reuter, M., Mallet, A., Pearson, B. M., and van Vliet, A. H. 2010. Biofilm formation by Campylobacter jejuni is increased under aerobic conditions. Appl. Environ. Microbiol. 76: 2122-8. 102. Ruiz-Palacios, G. M., E. Escamilla, and N. Torres. 1981. Experimental Campylobacter diarrhea in chickens. Infect. Immun. 34:250–255. 103. Saito, K., Ohtomo, R., Kuga-Vetake, Y., Aono, T., and Saito, M. 2005. Direct labeling of polyphosphate at the ultrastructural level in Saccharomyces cerevisiae 74
by using the affinity of the polyphosphate binding domain of Escherichia coli exopolyphosphatase. Appl. Environ. Microbiol. 71:5692–701. 104. Sambrook, J., and Russell, D. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 105. Sanyal, S. C., K. M. Islam, P. K. Neogy, M. Islam, P. Speelman, and M. I. Huq. 1984. Campylobacter jejuni diarrhea model in infant chickens. Infect. Immun. 43:931–936. 106. Schurig-Briccio, L. A., Farías, R. N., Rintoul, M. R., and Rapisarda, V. A. 2009. Phosphate-enhanced stationary-phase fitness of Escherichia coli is related to inorganic polyphosphate level. J. Bacteriol. 191: 4478-81. 107. Seufferheld, M. J., Alvarez, H. M., and Farias, M. E. 2008. Role of polyphosphates in microbial adaptation to extreme environments. Appl. Environ. Microbiol. 74: 5867-5874. 108. Seufferheld, M., Vieira, M. C., Ruiz, F. A., Rodrigues, C. O., Moreno, S. N., and Docampo, R. 2003. Identification of organelles in bacteria similar to acidocalcisomes of unicellular eukaryotes. J. Biol. Chem. 279: 29971-78. 109. Shi, X. B., Rao, N. N., and Kornberg, A. 2004. Inorganic polyphosphate in Bacillus cereus: motility, biofilm formation, and sporulation. Proc. Natl. Acad. Sci. USA. 101: 17061-17065. 110. Shi, X.B., Kornberg, A. 2005. Endopolyphosphatase in Saccharomyces cerevisiae undergoes post-translationalactivations to produce short-chain polyphosphates. FEBS Lett. 579:2014–48. 111. Shiba, T., Nishimura, D., Kawazoe, Y., Onodera, Y., Tsutsumi, K., Nakamura, R., and Ohshiro, M. 2003. Modulation of mitogenic activity of fibroblast growth factors by inorganic polyphosphate. J. Biol. Chem. 278: 26788- 92. 112. Shiba, T., Tsutsumi, K., Yano, H., Ihara, Y., Kameda, A., Tanaka, K., Takahashi, H., Munekata, M., Rao, N. N., and Kornberg, A. 1997. Inorganic polyphosphate and the induction of rpoS expression. Proc. Natl. Acad. Sci. USA. 94: 11210-11215. 113. Silby, M. W., Nicoll, J. S., and Levy, S. B. 2009. Requirement of polyphosphate by Pseudomonas fluorescens Pf0-1 for competitive fitness and heat tolerance in laboratory media and sterile soil. Appl. Environ. Microbiol. 75: 3872-81. 114. Skirrow, M. B. 1982. Campylobacter enteritis - the first five years. J. Hyg. (Lond) 89: 175-184.
75
115. Skirrow, M. B. 1990. Foodborne illness: Campylobacter. Lancet. 336: 921-3. 116. Smith, S. A., Mutch, N. J., Baskar, D., Rohloff, P., Docampo, R., and Morrissey, J. H. 2006. Polyphosphate modulates blood coagulation and fibrinolysis. Proc. Natl. Acad. Sci. USA. 103: 903-908. 117. Stern, N. J., Fedorka-Cray, P., Bailey, J. S., Cox, N. A., Craven, S. E., Hiett, K. L., Musgrove, M. T., Ladely, S., Cosby, D., and Mead, G. C. 2001. Distribution of Campylobacter spp. in selected U.S. poultry production and processing operations. J. Food Prot. 64: 1705-1710. 118. Sureka, K., Sanyal, S., Basu, J., and Kundu, M. 2009. Polyphosphate Kinase 2: a modulator of nucleoside diphosphate kinase activity in mycobacteria. Mol. Microbiol. 74: 1187-1197. 119. Svensson, S. L., Davis, L. M., MacKichan, J. K., Allan, B. J., Pajaniappan, M., Thompson, S. A., and Gaynor, E. C. 2009. The CprS sensor kinase of the zoonotic pathogen Campylobacter jejuni influences biofilm formation and is required for optimal chick colonization. Mol. Microbiol. 71: 253-272. 120. Tan, S., Fraley, C. D., Zhang, M., Dailidiene, D., Kornberg, A., and Berg, D. E. 2005. Diverse phenotypes resulting from polyphosphate kinase gene (ppk1) inactivation in different strains of Helicobacter pylori. J. Bacteriol. 187: 7687- 7695. 121. Tinsley, C. R., and Gotschlich, E. C. 1995. Cloning and characterization of the meningococcal polyphosphate kinase gene: production of polyphosphate synthesis mutants. Infect. Immun. 63: 1624-30. 122. Trilisenko, L. V., Vegabov, V. M., and Kulaev, I. S. 2002. The content and chain length of polyphosphates from vacuoles of Saccharomyces cerevisiae VKM Y-1173. Biochemistry. 67: 592-96. 123. Tunpiboonsak, S., Mongkolrob, R., Kitudomsub, K., Thanwatanaying, P., Kiettipirodom, W., Tungboontina, Y., and Tungpradabkul, S. 2010. Role of a Burkholderia pseudomallei polyphosphate kinase in an oxidative stress response, motilities, and biofilm formation. J. Microbiol. 48: 63-70. 124. van Koningsveld, R., Rico, R., Gerstenbluth, I., Scmitz, I., Ang, C.W., Mercies, I. S., Jacobs, B.C., Halabi, Y., Endtz, H.P., van der Meche, F.G. and van Doorn, P.A. 2001. Gastroenetritis-associated Gullian-Barres syndrome on the Caribbean island Curacao. Neurology 56: 1467-1472. 125. Wang, L., Fraley, C. D., Faridi, J., Kornberg, A., and Roth, R. A. 2003. Inorganic polyphosphate stimulates mammalian TOR, a kinase involved in the proliferation of mammary cancer cells. Proc. Natl. Acad. Sci. USA. 100: 11249-54.
76
126. Wilson, D. L., Bell, J. A., Young, V. B., Wilder, S. R., Mansfield, L. S., and Linz, J. E. 2003. Variation of the natural transformation frequency of Campylobacter jejuni in liquid shake culture. Microbiology. 149: 3603-3615. 127. Wurst, H., Shiba, T., and Kornberg, A. 1995. The gene for a major exopolyphosphatase of Saccharomyces cerevisiae. J. Bacteriol. 177: 898-906. 128. Yao, R., Alm, R. A., Trust, T. J., and Guerry, P. 1993. Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene. 130: 127- 130. 129. Yao, R., Alm, R. A., Trust, T. J., and Guerry, P. 1993. Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene. 130: 127- 130. 130. Yen, C., Green, L., and Miller, C. G. 1980. Degradation of intracellular protein in Salmonella typhimurium peptidase mutants. J. Mol. Biol. 143: 21-33. 131. Zakharian, E., and Reusch, R. N. 2007. Hemophilus influenza outer membrane protein P5 is associated with inorganic polyphosphate and polyhydroxybutyrate. Biophys. J. 92: 588-593. 132. Zakrzewska, J., Zizi´c, M., and Zivi´c, M. 2005. The effect of anoxia on PolyP content of Phycomyces blakesleeanus mycelium studied by 31P NMR spectroscopy. Ann. NY Acad. Sci. 1048:482–86. 133. Zhang, H., Gómez-García, M. R., Shi, X. B., Rao, N. N., and Kornberg, A. 2007. Polyphosphate kinase 1, a conserved bacterial enzyme, in a eukaryote, Dictyostelium discoideum, with a role in cytokinesis. Proc. Natl. Acad. Sci. USA. 104: 16486-91. 134. Zhang, Q., Li, Y., and Tang, C. M. 2010. The role of the exopolyphosphatase PPX in avoidance by Neisseria meningitidis of complement-mediated killing. J. Biol. Chem. 285: 34259-68. 135. Zhu, Y., Huang, W., Lee, S. S., and Xu, W. 2005. Crystal structure of a polyphosphate kinase and its implications for polyphosphate synthesis. EMBO Rep. 6: 681-87. 136. Zilbauer, M., Dorrell, N., Wren, B. W., and Bajaj-Elliott, M. 2008. Campylobacter jejuni-mediated disease pathogenesis: an update. Trans. R. Soc. Trop. Med. Hyg. 102: 123-129.
77
Zivi´cM, Zakrzewska, J., Zizi´cM, Baci´cG. 2007. 31PNMRstudy of polyphosphate levels during different growth phases of Phycomyces blakesleeanus. Antonie van
Leeuwenhoek. 91:169–77.
78