Citrus Leprosis: a Complex and Multietiologic Disease

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Citrus leprosis: a complex and multietiologic disease Pedro Luis Ramos-González Instituto Biológico de São Paulo [email protected] Citrus leprosis: historical review and distribution Florida, USA Rusty nail head 1907 Citrus leprosis: historical review and distribution Hawaii, USA Mexico Central America Paraguay, Argentina, Brazil Venezuela, Colombia Florida, USA 1907 1920-30 1960 1999 2000 2004 2011 2017 Viral genomes Locali et al. 2006 Viral particles Kitajima et al. 1972 Mites (genus Brevipalpus) Frezzi 1940 & Vergani 1945 Citrus leprosis: serious viral disease . 1990: control of vector mite costs Brazilian growers around US$ 80 million (Bastianel et al., 2010) . 2010: 10-20% cost of consumables 5-10% total expenditures (Fundecitrus, citrus grower, pers. comm.) São Paulo, 2017. Pictures by Daniel Junior de Andrade Citrus leprosis: symptoms . Mite preference . fruits>stems>leaves . Local necrotic or chlorotic lesions Citrus leprosis: two disease types C. sinensis. Enveloped-short bacilliform virions (50-60 nm X 110-120 nm). (Kitajima et al., 1974). C. sinensis. Rodlike virions (40-50 nm x 100-110 nm) in vesicles, in the nucleus and cytoplasm. Membrane-associated virions. (Kitajima et al., 1972). C. volkameriana. Short, bacilliform virions of ≈30 x 50 nm. Cytoplasm of symptomatic leaf tissues (Melzer et al., 2012). Nuclear type Cytoplasmic type Citrus leprosis: viral diversity Citrus leprosis-Nuclear Citrus leprosis-Cytoplasmic • Floating genera Order: Mononegavirales Family: Rhabdoviridae Genus: Cilevirus Genus: Higrevirus Genus: Dichorhavirus (Locali et al., 2012) (Melzer et al., 2013) (Dietzgen et al., 2014) (Afonso et al., 2016) • Single strand • Positive sense RNA • Bipartite genome • Tripartite genome • Single strand • Transmitted by Brevipalpus • Transmission not • Negative sense RNA mites • Bipartite genome confirmed • Transmitted by Brevipalpus • mites Citrus leprosis Nuclear type Country Virus Ref. Mexico OFV-citrus Roy et al., 2013 (orchid fleck virus) Cruz-Jaramillo et al., 2014 Colombia OFV-citrus Roy et al., 2014 Partial sequence Florida, 80% of nt identity Hartung et al., 2015 USA* > 92% aa identity OFV-citrus Panama ? Dominguez et al., 2001 Kitajima et al., 1972., Ramos- Brazil CiLV-N and CiCSV González et al., 2017; Chabi et (citrus leprosis virus N, citrus chlorotic spot virus al., submitted. *Knorr, 1948 Small RNA 61% of the genome fraction Hartung et al., 2015 Citrus leprosis Nuclear type in Brazil * RNA1 CiCSV 6.5 Kb 3´ N P MP M G 5´ RNA2 3´ L 5´ 5.9 Kb 51 < nt < 63 44 < aa < 64 RNA1 6.7 Kb 3´ N P MP M G 5´ RNA2 3´ L 5´ 6.0 Kb CiLV-N Four isolates, one species Ramos-González et al., 2017; Chabi et al., submitted. Citrus leprosis Nuclear type in Brazil • State of Piauí • Two isolates from an urban zone / Teresina • Altitude: 72 m • Average annual temperature: 27.1 °C • Large chlorotic spots • Sweet oranges • State of São Paulo • Four isolates from four counties (20-170 km) • Altitude: > 800 m • Average annual temperature: 18-20 °C, including frost • Small necrotic and chlorotic spots • Sweet oranges Citrus leprosis Nuclear type in Brazil Brevipalpus n. yothersi • Only association dorsal ventral microplates spermateca (Beard et al. 2015) Brevipalpus phoenicis ss • Confirmed viral transmission to healthy plants Ramos-González et al., 2017; Chabi et al., submitted Citrus leprosis Cytoplasmic type Country Virus Ref. Mexico to CiLV-C Bastianel et al., 2010 Argentina (citrus leprosis virus C) Colombia CiLV-C2 strain Co Roy et al., 2013 CiLV-C 99% Diversity and Brazil variability studies Argentina Panama in Brazil 1967 2006 2015 Locali et al., 2006 Pascon et al., 2006 Small RNA fraction Hartung et al., 2015 Citrus leprosis Cytoplasmic type CiLV-C (Locali, et al., 2006) 51 samples BZ, MX, CO, PA, PY, AR p29 mp cDNA-PCR CiLV-C2 ORF p29 (Roy et al., 2013) OFV-citrus ORF M (Roy et al., 2014) CiLV-C ORF mp (Locali et al., 2003) CiLV-C ORF p29 (Pereira et al. 2012) Clade CRD Clade SJP Citrus leprosis virus C: variability Nucleotide identity C. sinensis RNA1 Complete RNA2 siRNA sequencing genome > 99% strain SJP RNA1 B. yothersi RNA2 A1 isoline A. thaliana Isolate SJP01 Strains SJP-CRD ~ 85% nt identity Putative recombination Ramos-González et al., 2016 Citrus leprosis virus C: strain detection Strain-specific RT-PCR Mixed infections of CiLV-C strains detected. Ramos-González et al., 2016 Relevance: • Support for the putative RNA2 recombination predicted in silico • Reassorment between viral RNA components, synergism, trans- complementation... • New biological treats Citrus leprosis cytoplasmic type B. yothersi variability CiLV-C strain distribution Haplotype diversity: COI sequence Sánchez-Velázquez et al., 2015 CiLV-C / vector relationship adult larva protonymph deutonymph female male Brevipalpus yothersi (ex- B. phoenicis) AAP 4 h IAP 2 h Latent period 7 h Retention period 12 d Viruliferous 25-60% vulgarisPhaseolus mites / colony Ca. Cardinium • Non-transovarial transmission of CiLV-C Tassi et al., 2017 Citrus leprosis / vector relationship Citrus leprosis Cytoplasmic type B. yothersi CiLV-C • No viruses • Detection of inside Viral RNA mite’s cells negative strand ≠ in mites Kitajima & Alberti, 2014 Roy et al., 2015 Circulative non-propagative Citrus leprosis / vector relationship Citrus leprosis Cytoplasmic type Citrus leprosis Nuclear type B. yothersi B. phoenicis B. californicus CiLV-C CiLV-N OFV Roy et al., 2015 • No viruses • Detection of • Viruses inside inside Viral RNA mite’s cells mite’s cells negative strand • Long latent ≠ in mites periods Kitajima & Alberti, 2014 Roy et al., 2015 Circulative non-propagative Circulative propagative CiLV-C / plant interaction - Mite / plant interaction RT-qPCR After 7-10 days B. yothersi A1 isoline A. thaliana Col-0 Arena et al., 2015 Mock Mites Mites + CiLV-C Marker genes: 6 hai 12 hai 24 hai 8 dai SA: ICS1, EDS5, NPR1, TGA3, WRKY70, PR1, PR5 ROS JA/ET: JAR1, ETR1, EIN2, MYC2, VSP2, PDF1,2 production Gene silencing: RDR1, RDR6, DCL2, DCL4, DAB stain AGO1, AGO2, HEN1 ROS and cell death: NHL10, RBOHD Cell Reference genes: F-box and SAND death Trypan blue stain Arena et al., 2016 CiLV-C / plant interaction - Mite / plant interaction Working hypothesis: • Gene silencing • Host manipulation by mites • VOC emission • Metabolite quantity and quality changes • Virus as an effector • Role of each viral ORF Arena et al., 2016 CiLV-C / mite / plant interaction Primarily infested leaves Secondary infested leaves n= 26 plants (13 infested with non-viruliferous and 13 with viruliferous mites). 5 mites/leaf p < 0.05 (*) or < 0.01 (**) 3 leaves/plant Mite count: 13 dpi Arena et al., 2016 Citrus leprosis Cytoplasmic type Nuclear type OFV- CiLV-C CiLV-C2 HGSV2 CiLV-N CiCSV citrus B. yothersi B. papayensis B. californicus B. phoenicis B. n. yothersi Sweet oranges, grapefruit, lemon, lime, Sweet oranges, Sweet oranges, mandarin, sour orange, tangerines, Swinglea Hibiscus sp. C.volkameriana, Sweet oranges Sweet oranges sweet or navel lime, and glutinosa, Commelina Swinglea glutinosa, Hibiscus sp. Persian lime benghalensis Dieffenbachia sp. Camila Chabi Gabriela Arena Aline Tassi Elliot W. Kitajima Juliana Freitas- Astúa Collaborators Renato Bassanezi - Fundecitrus Daniel Junior de Andrade - UNESP / Jaboticabal Ricardo Harakava - IB Valdenice Morerira - CCSM Marines Bastianel - CCSM Marcos Machado -CCSM Mariani Rodrigues Mateo Postcam Citrus leprosis management • Reduction of the inoculum source: pruning • Use of mite- and virus-free seedlings • Avoiding the presence of alternative virus hosts in fields • Control of viruliferous mite populations by using acaricides Effect of gene silencing during CiLV-C infection in Arabidopsis Genotype 120 dcl2/4 rdr2/6 wt dcl2/4 rdr2/6 wt ) 100 leaves dpi 80 (10 60 symptomatic leaves of 40 20 Rosette Percentage 0 5 6 7 8 12 dpi ) dpi 2,5 2 * (15 titers n= 15 plants per mutant genotype 1,5 * Non symptoms Three independent experiments viral Inoculated leaves 1 observed neither 5 mites/leaf Systemic leaves leaves viral RNA detected 3 leaves/plant 0,5 by RT-qPCR Relative 0 wild type dcl2/4 rdr2/6 Cauline Citrus leprosis Nuclear type in Brazil N * * N * * I- CiLV-C (MP gene) RACE/ II- CiLV-C2 (p29 gene) NGS/ III-OFV-citrus (N gene) Total Secondary re- IV- OFV (N gene), bioinformatics VI- degenerate primer pair RNA sequencing for the detection of L gene In summary: viruses associated to Citrus leprosis Cytoplasmic type Nuclear type RdRP2 (motif) Protein L Cilevirus Blunervirus Higrevirus Negevirus Virgaviridae Tobamovirus Tobravirus Closteroviridae Dichorhavirus Nucleorhabdovirus Cytorhabdovirus Diagnostic tools: PCR primers VTB Sequência dos iniciadores MP-F: GCGTATTGGCGTTGGATTTCTGAC CiLV-C MP-R: TGTATACCAAGCCGCCTGTGAACT p29-F: CAGAAGGCCGAGGTTGTAAAG CiLV-C CRD p29-R: GTAGTGATCACTGAACTCGAATACC p29-F: GTAARCAAAAGGTCGAGGTTGTCC CiLV-C SJP p29-R: TCTGTTGTCTAGCAGCRAGTAATG p29-F: ATGAGTAACATTGTGTCGTTTTCGTTGT CiLV-C2 p29-R: TCACTCTTCCTGTTCATCAACCTGTT MP-F: CGATATTTGATCAATCCGTT MP-R: CACCTTAAAATTCGAGGGTT PfGSV RpdR-F : CTGTTGTGCCAAATCATCAA RpdR R : TTCATCGCAAGTTCATATACCT RpdR-F: TGTCGAACTTTGGTATGAGTCG SvRSV RpdR R:CCGGTTCGTCAAATAACTCC N-F: ATGGCTAACCCAAGTGAGATCGATTA OFV-citrus N-R: AGTTGCCTTGAGATCATCACATTGGT N-F: TGTCATAGCCGACATAAACACC OFV N-R: TGTAGAGCTTGCGAGATACAG L-F: ATATCACCGTTTAAGCAAGC ClCSV L-R: TCCTTGTTACAACTCCTTGC Cileviruses: diversity Floating genera Cilevirus Blunervirus Higrevirus Negevirus Virgaviridae Tobamovirus Tobravirus Closteroviridae RdRp2 (protein motif) .
Recommended publications
  • PRESENT STATUS of Brevipalpus MITES AS PLANT VIRUS VECTORS

    PRESENT STATUS of Brevipalpus MITES AS PLANT VIRUS VECTORS

    PRESENT STATUS OF Brevipalpus MITES AS PLANT VIRUS VECTORS A.D. Tassi1, M.A. Nunes2, V.M. Novelli2, J. Freitas-Astúa3,4 & E.W. Kitajima1 1LFN, ESALQ, Universidade de São Paulo (USP), Piracicaba, SP, Brazil; 2Instituto Agronômico – Centro de Citricultura Sylvio Moreira, Cordeirópolis, SP, Brazil; 3Instituto Biológico, São Paulo, SP, Brazil; 4Embrapa Mandioca e Fruticultura, Cruz das Almas, BA, Brazil. First report of Brevipalpus (Acari: Trombidiformes: Tenuipalpidae) mites involved in virus transmission was made by Frezzi, in 1940, who found evidences of association of B. obovatus Donnadieu with citrus leprosis. Later, Musumeci & Rossetti in 1963 found that in Brazil this disease, caused by CiLV-C, is transmitted by B. phoenicis s.l. The same species was reported as the vector of CoRSV by Chagas in 1978, and PFGSV by Kitajima et al., in 1998. Maeda et al. in 1998 found that B. californicus (Banks) is the vector of OFV. Since then, several other cases of Brevipalpus transmitted viruses (BTV) have been described. However, introduction of new morphological and molecular criteria for the identification of some Brevipalpus species, particularly within the B. phoenicis group, resulted in significant changes in species determination. The situation became more complex when surveys revealed that Brevipalpus populations present in a given BTV-infected host plant may be composed by two or more species, making it difficult to determine the vector species. A reassessment of the previous description became necessary. In summary the present situation is: for the genus Cilevirus: B. obovatus, B. phoenicis s.l., B. yothersi Baker and B. papayensis Baker are reported as vectors; for the genus Higrevirus just association with Brevipalpus is known; and for the genus Dichorhavirus: B.
  • Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses

    Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses

    viruses Article Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses Thanuja Thekke-Veetil 1, Doris Lagos-Kutz 2 , Nancy K. McCoppin 2, Glen L. Hartman 2 , Hye-Kyoung Ju 3, Hyoun-Sub Lim 3 and Leslie. L. Domier 2,* 1 Department of Crop Sciences, University of Illinois, Urbana, IL 61801, USA; [email protected] 2 Soybean/Maize Germplasm, Pathology, and Genetics Research Unit, United States Department of Agriculture-Agricultural Research Service, Urbana, IL 61801, USA; [email protected] (D.L.-K.); [email protected] (N.K.M.); [email protected] (G.L.H.) 3 Department of Applied Biology, College of Agriculture and Life Sciences, Chungnam National University, Daejeon 300-010, Korea; [email protected] (H.-K.J.); [email protected] (H.-S.L.) * Correspondence: [email protected]; Tel.: +1-217-333-0510 Academic Editor: Eugene V. Ryabov and Robert L. Harrison Received: 5 November 2020; Accepted: 29 November 2020; Published: 1 December 2020 Abstract: Soybean thrips (Neohydatothrips variabilis) are one of the most efficient vectors of soybean vein necrosis virus, which can cause severe necrotic symptoms in sensitive soybean plants. To determine which other viruses are associated with soybean thrips, the metatranscriptome of soybean thrips, collected by the Midwest Suction Trap Network during 2018, was analyzed. Contigs assembled from the data revealed a remarkable diversity of virus-like sequences. Of the 181 virus-like sequences identified, 155 were novel and associated primarily with taxa of arthropod-infecting viruses, but sequences similar to plant and fungus-infecting viruses were also identified.
  • Genetic Characterization, Molecular Epidemiology, and Phylogenetic MARK Relationships of Insect-Specific Viruses in the Taxon Negevirus

    Genetic Characterization, Molecular Epidemiology, and Phylogenetic MARK Relationships of Insect-Specific Viruses in the Taxon Negevirus

    Virology 504 (2017) 152–167 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Genetic characterization, molecular epidemiology, and phylogenetic MARK relationships of insect-specific viruses in the taxon Negevirus Marcio R.T. Nunesa, María Angélica Contreras-Gutierrezb,c, Hilda Guzmand,e,f, Livia C. Martinsf, Mayla Feitoza Barbiratog, Chelsea Savith, Victoria Baltai, Sandra Uribec, Rafael Viverob,c, Juan David Suazab,c, Hamilton Oliveiraf, Joaquin P. Nunes Netof, Valeria L. Carvalhog, Sandro Patroca da Silvaa, Jedson F. Cardosoa, Rodrigo Santo de Oliveiraa, Poliana da Silva Lemosf, Thomas G. Woodj, Steven G. Widenj, Pedro F.C. Vasconcelosf, Durland Fishk, ⁎ ⁎ Nikos Vasilakisd,e,f, , Robert B. Teshd,e,f, a Center for Technological Innovation, Evandro Chagas Institute, Ministry of Health, Ananindeua, Para, Brazil b Programa de Estudio y Control de Enfermedades Tropicales – PECET - SIU-Sede de Investigación Universitaria – Universidad de Antioquia, Medellín, Colombia c Grupo de Investigación en Sistemática Molecular-GSM, Facultad de Ciencias,Ciencias, Universidad Nacional de Colombia, sede Medellín, Medellín, Colombia d Department of Pathology and Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0609, United States e Center for Tropical Diseases, University of Texas Medical Branch, Galveston, TX 77555-0609, United States f Department of Arbovirology and Hemorrhagic Fevers, Evandro Chagas Institute, Ministry of Health, Ananindeua,
  • Small Hydrophobic Viral Proteins Involved in Intercellular Movement of Diverse Plant Virus Genomes Sergey Y

    Small Hydrophobic Viral Proteins Involved in Intercellular Movement of Diverse Plant Virus Genomes Sergey Y

    AIMS Microbiology, 6(3): 305–329. DOI: 10.3934/microbiol.2020019 Received: 23 July 2020 Accepted: 13 September 2020 Published: 21 September 2020 http://www.aimspress.com/journal/microbiology Review Small hydrophobic viral proteins involved in intercellular movement of diverse plant virus genomes Sergey Y. Morozov1,2,* and Andrey G. Solovyev1,2,3 1 A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia 2 Department of Virology, Biological Faculty, Moscow State University, Moscow, Russia 3 Institute of Molecular Medicine, Sechenov First Moscow State Medical University, Moscow, Russia * Correspondence: E-mail: [email protected]; Tel: +74959393198. Abstract: Most plant viruses code for movement proteins (MPs) targeting plasmodesmata to enable cell-to-cell and systemic spread in infected plants. Small membrane-embedded MPs have been first identified in two viral transport gene modules, triple gene block (TGB) coding for an RNA-binding helicase TGB1 and two small hydrophobic proteins TGB2 and TGB3 and double gene block (DGB) encoding two small polypeptides representing an RNA-binding protein and a membrane protein. These findings indicated that movement gene modules composed of two or more cistrons may encode the nucleic acid-binding protein and at least one membrane-bound movement protein. The same rule was revealed for small DNA-containing plant viruses, namely, viruses belonging to genus Mastrevirus (family Geminiviridae) and the family Nanoviridae. In multi-component transport modules the nucleic acid-binding MP can be viral capsid protein(s), as in RNA-containing viruses of the families Closteroviridae and Potyviridae. However, membrane proteins are always found among MPs of these multicomponent viral transport systems.
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo

    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. November 2020 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Paul Allison, Faculty of Dentistry, McGill University Raphael Freitas de Souza, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University November 30th, 2020 1 Contents Page Introduction 3 Project goal and specific objectives 3 Methods used to identify and include relevant literature 4 Report structure 5 Summary of update report 5 Report results a) Which patients are at greater risk of the consequences of COVID-19 and so 7 consideration should be given to delaying elective in-person oral health care? b) What are the signs and symptoms of COVID-19 that oral health professionals 9 should screen for prior to providing in-person health care? c) What evidence exists to support patient scheduling, waiting and other non- treatment management measures for in-person oral health care? 10 d) What evidence exists to support the use of various forms of personal protective equipment (PPE) while providing in-person oral health care? 13 e) What evidence exists to support the decontamination and re-use of PPE? 15 f) What evidence exists concerning the provision of aerosol-generating 16 procedures (AGP) as part of in-person
  • Factors That May Affect Irradiation Efficacy

    Factors That May Affect Irradiation Efficacy

    Factors that may affect irradiation efficacy Oxygen atmosphere potentiates radiation effects on Brevipalpus yothersi (Trombidiformes: Tenuipalpidae) Andre Ricardo Machi1,2, and Valter Arthur2,1,* Abstract The objective of the study was to compare the effect of pure oxygen to that of ambient air on gamma irradiation of Brevipalpus yothersi (Baker) (Trombidiformes: Tenuipalpidae). Flasks containing the mites were irradiated in a Gammacell-220 irradiator with Cobalt-60 emitting gamma radiation at a rate of 381 Gy/h. Seventy mites per flask replicated 4 times were irradiated in either pure oxygen or air with 0 (control), 200, 230, 270, or 300 Gy as the intended doses. All eggs, deutonymphs and adults were counted each day and the parameters of egg production, egg hatch, development and mortality were recorded. Data were analyzed with ANOVA and means were separated with Tukey’s Honestly Significant Difference (HSD) test at 5% probability. Generally, irradiation of females with progressively larger doses—whether in oxygen or in air—resulted in progressively greater negative biological effects, and these effects were greater when females were irradiated in oxygen than in air. Non-irradiated gravid females exposed to pure oxygen deposited 79.3 ± 0.3 eggs per female compared to 73.0 ± 0.3 per female in ambient air. The numbers of eggs oviposited by females irradiated with the largest dose (300 Gy) were 29.1 ± 0.2 in air and 18.1 ± 0.3 in oxygen. In the ambient air + 270 Gy treatment egg hatch was 3.8 ± 0.1%, but in the oxygen + 270 Gy treatment it was 0%.
  • EU Project Number 613678

    EU Project Number 613678

    EU project number 613678 Strategies to develop effective, innovative and practical approaches to protect major European fruit crops from pests and pathogens Work package 1. Pathways of introduction of fruit pests and pathogens Deliverable 1.3. PART 7 - REPORT on Oranges and Mandarins – Fruit pathway and Alert List Partners involved: EPPO (Grousset F, Petter F, Suffert M) and JKI (Steffen K, Wilstermann A, Schrader G). This document should be cited as ‘Grousset F, Wistermann A, Steffen K, Petter F, Schrader G, Suffert M (2016) DROPSA Deliverable 1.3 Report for Oranges and Mandarins – Fruit pathway and Alert List’. An Excel file containing supporting information is available at https://upload.eppo.int/download/112o3f5b0c014 DROPSA is funded by the European Union’s Seventh Framework Programme for research, technological development and demonstration (grant agreement no. 613678). www.dropsaproject.eu [email protected] DROPSA DELIVERABLE REPORT on ORANGES AND MANDARINS – Fruit pathway and Alert List 1. Introduction ............................................................................................................................................... 2 1.1 Background on oranges and mandarins ..................................................................................................... 2 1.2 Data on production and trade of orange and mandarin fruit ........................................................................ 5 1.3 Characteristics of the pathway ‘orange and mandarin fruit’ .......................................................................
  • Multipartite Viruses: Organization, Emergence and Evolution

    Multipartite Viruses: Organization, Emergence and Evolution

    UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE BIOLOGÍA MOLECULAR MULTIPARTITE VIRUSES: ORGANIZATION, EMERGENCE AND EVOLUTION TESIS DOCTORAL Adriana Lucía Sanz García Madrid, 2019 MULTIPARTITE VIRUSES Organization, emergence and evolution TESIS DOCTORAL Memoria presentada por Adriana Luc´ıa Sanz Garc´ıa Licenciada en Bioqu´ımica por la Universidad Autonoma´ de Madrid Supervisada por Dra. Susanna Manrubia Cuevas Centro Nacional de Biotecnolog´ıa (CSIC) Memoria presentada para optar al grado de Doctor en Biociencias Moleculares Facultad de Ciencias Departamento de Biolog´ıa Molecular Universidad Autonoma´ de Madrid Madrid, 2019 Tesis doctoral Multipartite viruses: Organization, emergence and evolution, 2019, Madrid, Espana. Memoria presentada por Adriana Luc´ıa-Sanz, licenciada en Bioqumica´ y con un master´ en Biof´ısica en la Universidad Autonoma´ de Madrid para optar al grado de doctor en Biociencias Moleculares del departamento de Biolog´ıa Molecular en la facultad de Ciencias de la Universidad Autonoma´ de Madrid Supervisora de tesis: Dr. Susanna Manrubia Cuevas. Investigadora Cient´ıfica en el Centro Nacional de Biotecnolog´ıa (CSIC), C/ Darwin 3, 28049 Madrid, Espana. to the reader CONTENTS Acknowledgments xi Resumen xiii Abstract xv Introduction xvii I.1 What is a virus? xvii I.2 What is a multipartite virus? xix I.3 The multipartite lifecycle xx I.4 Overview of this thesis xxv PART I OBJECTIVES PART II METHODOLOGY 0.5 Database management for constructing the multipartite and segmented datasets 3 0.6 Analytical
  • Evolutionary Continuum Between Small Rna and Dna Viruses

    Evolutionary Continuum Between Small Rna and Dna Viruses

    EVOLUTIONARY CONTINUUM BETWEEN SMALL RNA AND DNA VIRUSES Mart Krupovic Institut Pasteur [email protected] 03.07.2014 100 nm 20 nm 100 nm Giant viruses versus tiny ones Mimivirus Porcine circovirus 1 Capsid diameter: ~400 nm Capsid diameter: ~17 nm Genome size: 1,181,404 bp Genome size: 1,758 nt # of genes: 1,018 # of genes: 2 2000 nm 100 nm Courtesy Prof D. Raoult Courtesy Prof S. McNulty The (described) virosphere: 120 distinct taxa Adenoviridae, Alloherpesviridae, Alphaflexiviridae, Alphatetraviridae, Alvernaviridae, Amalgaviridae, Ampullaviridae, Anelloviridae, Arenaviridae, Arteriviridae, Ascoviridae, Asfarviridae, Astroviridae, Bacilladnavirus, Bacillarnavirus, Baculoviridae, Barnaviridae, Benyviridae, Betaflexiviridae, Bicaudaviridae, Bidnaviridae, Birnaviridae, Bornaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Carmotetraviridae, Caulimoviridae, Chrysoviridae, Cilevirus, Circoviridae, Clavaviridae, Closteroviridae, Coronaviridae, Corticoviridae, Cystoviridae, Deltavirus, Dicistroviridae, Dinodnavirus, Emaravirus, Endornaviridae, Filoviridae, Flaviviridae, Fuselloviridae, Gammaflexiviridae, Geminiviridae, ‘Gemycircularvirus’, Globuloviridae, Guttaviridae, Hepadnaviridae, Hepeviridae, Herpesviridae, Higrevirus, Hypoviridae, Hytrosaviridae, Idaeovirus, Iflaviridae, Inoviridae, Iridoviridae, Labyrnavirus, Leviviridae, Lipothrixviridae, Luteoviridae, Malacoherpesviridae, Marnaviridae, Marseilleviridae, Megabirnaviridae, Mesoniviridae, Metaviridae, Microviridae, Mimiviridae, Myoviridae, Nanoviridae, Narnaviridae, Nimaviridae,
  • (Cilv-N) ST 06: Citrus Leprosis Virus Family

    (Cilv-N) ST 06: Citrus Leprosis Virus Family

    Pest report Citrus leprosis virus C (CiLV-C) Citrus leprosis virus N (CiLV-N) ST 06: Citrus leprosis virus Family: Rhabdoviridae (CiLV-N), non-designated (CiLV-C) Genus: Dichorhabdovirus (CiLV-N), Cilevirus (CiLV-C) Approval date: 26-10-2015 Photo: Alanís-Martínez Synonym(s): leprosis de los cítricos, leprosis and lepra explosiva (Spanish), Citrus leprosis virus (English). Pest overview Citrus leprosis virus causes one the most destructive diseases of citrus in the Americas (Rodrigues et al. 2003). It is an endemic disease in several countries in South America that has recently spread as far north as Mexico (Bastianel et al. 2010). Citrus leprosis is associated with two different causal agents, Citrus leprosis virus cytoplasmic type (CiLV-C) and Citrus leprosis virus nuclear type (CiLV-N) (Freitas-Astúa et al. 2005), which are transmitted by mites from the genus Brevipalpus (Acari: Tenuipalpidae). Within the cytoplasmic type, there are two subtypes - cytoplasmic type 1 (CiLV-C1, the most prevalent one) and cytoplasmic 2 (CiLV-C2) that was found in Colombia (Roy et al. 2013a). The virus has been transmitted mechanically with some difficulty from sweet orange to sweet orange and some herbaceous hosts. The most important method for spread and transmission is through the mite vector. Geographic distribution of the pest Citrus leprosis has been reported in many of the citrus growing regions of the world (Mora-Aguilera et al. 2013; Table 1). Citrus leprosis virus 2 Table 1. Geographic distribution of Citrus leprosis virus Country Year detected Reference China (South) Beginning of the 20th Bastaniel et al. 2010 India (North) century Ceylon (presently Sri Lanka) Japan Philippines Indonesia (Java) Egypt South Africa US (Florida) Brazil 1930 Bastaniel et al.
  • Pomegranate: Botany, Horticulture, Breeding

    Pomegranate: Botany, Horticulture, Breeding

    2 Pomegranate: Botany, Horticulture, Breeding D. Holland, K. Hatib, and I. Bar-Ya’akov Section of Deciduous Fruit Trees Sciences Newe Ya’ar Research Center Agricultural Research Organization PO Box 1021 Ramat Yishay, 30095, Israel I. INTRODUCTION II. TAXONOMY AND MORPHOLOGY A. Botanical Classification B. Vegetative Growth C. The Flower D. The Fruit E. Juvenility and Age of Fruiting III. ORIGIN AND GENETIC RESOURCES A. Origin and Cultivating Regions B. Collections and Germplasm IV. HORTICULTURE A. Cultivars 1. India 2. Iran 3. China 4. Turkmenistan and Tajikistan 5. Turkey 6. Israel 7. Spain 8. United States 9. Georgia 10. Tunisia 11. Egypt 12. Saudi Arabia and Iraq 13. Vietnam 14. Morocco 15. Sicily, Italy Horticultural Reviews, Volume 35 Edited by Jules Janick Copyright & 2009 John Wiley & Sons, Inc. 127 128 D. HOLLAND, K. HATIB, AND I. BAR-YA’AKOV B. Irrigation C. Fertilization D. Tree and Orchard Design E. Plant Protection F. Weed Control G. Fruit Physiological Disorders H. Postharvest V. BREEDING VI. HEALTH BENEFITS VII. CONCLUDING REMARKS VIII. ACKNOWLEDGMENTS IX. LITERATURE CITED I. INTRODUCTION Pomegranate (Punica granatum L., Punicaceae) is an ancient, beloved plant and fruit. The name ‘‘pomegranate’’ follows the Latin name of the fruit Malum granatum, which means ‘‘grainy apple.’’ The generic name Punica refers to Pheonicia (Carthage) as a result of mistaken assump- tion regarding its origin. The pomegranate and its usage are deeply embedded in human history, and utilization is found in many ancient human cultures as food and as a medical remedy. Despite this fact, pomegranate culture has always been restricted and generally con- sidered as a minor crop.
  • Edna-Host: Detection of Global Plant Viromes Using High Throughput Sequencing

    Edna-Host: Detection of Global Plant Viromes Using High Throughput Sequencing

    EDNA-HOST: DETECTION OF GLOBAL PLANT VIROMES USING HIGH THROUGHPUT SEQUENCING By LIZBETH DANIELA PENA-ZUNIGA Bachelor of Science in Biotechnology Escuela Politecnica de las Fuerzas Armadas (ESPE) Sangolqui, Ecuador 2014 Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY May 2020 EDNA-HOST: DETECTION OF GLOBAL PLANT VIROMES USING HIGH THROUGHPUT SEQUENCING Dissertation Approved: Francisco Ochoa-Corona, Ph.D. Dissertation Adviser Committee member Akhtar, Ali, Ph.D. Committee member Hassan Melouk, Ph.D. Committee member Andres Espindola, Ph.D. Outside Committee Member Daren Hagen, Ph.D. ii ACKNOWLEDGEMENTS I would like to express sincere thanks to my major adviser Dr. Francisco Ochoa –Corona for his guidance from the beginning of my journey believing and trust that I am capable of developing a career as a scientist. I am thankful for his support and encouragement during hard times in research as well as in personal life. I truly appreciate the helpfulness of my advisory committee for their constructive input and guidance, thanks to: Dr. Akhtar Ali for his support in this research project and his kindness all the time, Dr. Hassan Melouk for his assistance, encouragement and his helpfulness in this study, Dr. Andres Espindola, developer of EDNA MiFi™, he was extremely helpful in every step of EDNA research, and for his willingness to give his time and advise; to Dr. Darren Hagen for his support and advise with bioinformatics and for his encouragement to develop a new set of research skills. I deeply appreciate Dr.