Insight Into the Cargo Recognition Mechanism of Kinesin Light Chain 1

Insight into the Cargo Recognition Mechanism of Kinesin Light Chain 1

Han Youl Lee

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Pharmacology and Toxicology University of Toronto

Insight into the Cargo Recognition Mechanism of Kinesin Light Chain 1

Han Youl Lee

Master of Science

Graduate Department of Pharmacology and Toxicology University of Toronto

2011 Abstract

Kinesin-1 transports various cargos along the axon, while the light chain subunits play a role in selecting the types of cargos to transport. However, the mechanisms of cargo recognition and interaction have yet to be characterized. Both c-Jun kinase-interacting protein-1 (JIP1) and alcadein-1 (ALC1) are kinesin-1 cargos and compete with each other for the axonal transport machinery. I identified two polar patches of

KLC1 that play a role in the interactions with JIP1 and ALC1, respectively. The main components of these two polar patches are asparagine “clamps” surrounded by positively charged lysines. Consistent with this finding, negatively charged residues of JIP1 and ALC1 are required to interact with KLC1. By structural modeling, I narrowed down the possible key residues of KLC1 that are required for interaction with c-Jun kinase interacting protein-3 (JIP3). Together, these findings reveal the versatility of KLC in the mode of interaction with many different cargos.

Acknowledgments

First and foremost, I would like to thank my supervisor, Dr. Hee-Won Park for his dedication and understanding. I first came into the lab with very limited research experience and understanding of science. Within two years, not only did you expand my knowledge in field of science and research, but you helped me develop the tools to succeed in life. Thank you for welcoming me to the lab and giving me such a great opportunity along with your endless support for my work.

I would also like to thank everyone in our lab. I’ve been lucky to have worked with such a talented group; you guys have shown me the “art of science”. I will never have been able to accomplish anything that I have done without your help. Thank you for always greeting all the good and bad times with a smile.

I would like to thank Dr. McPherson and Dr. Mitchell who without any hesitation were willing to be my advisor and co-supervisor. Thank you for being a part of my graduate experience. Also, I am grateful to Dr. Pai, Dr. Salahpour, and Dr. Wells for your dedication in evaluating and greatly improving this thesis.

I owe the greatest appreciation to my family and friends, who have stuck by me to this day. Thank you for your love, patience and understanding for all my life. I am honoured to call you guys my family and friends. Thank You!

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Tables ...... vii

List of Figures ...... viii

List of Abbreviations ...... ix

1 Introduction ...... 1

1.1 Intracellular Transport ...... 1

1.2 Motor Proteins ...... 1

1.3 Kinesin ...... 2

1.3.1 Kinesin Superfamily ...... 2

1.3.2 Kinesin-1 ...... 3

1.3.3 Kinesin Heavy Chains ...... 4

1.3.4 Kinesin Light Chains ...... 6

1.4 TPR domains ...... 7

1.5 Introduction to Kinesin-1’s Cargo and Biological Relevance ...... 13

1.5.1 Alzheimer’s disease (AD) ...... 13

1.5.2 Huntington’s Disease (HD) ...... 14

1.5.3 Mood Disorder ...... 15

1.5.4 Diabetes ...... 15

1.5.5 Axon Outgrowth ...... 16

1.6 Clinical Relevance ...... 17

1.6.1 Kinesin Light Chain Single Nucleotide Polymorphisms ...... 17

1.6.2 Kinesin-1 as a Drug Target ...... 17

1.7 Macromolecular Crystallography ...... 18

1.8 Hypothesis & Approach ...... 19

1.8.1 X-ray Crystallography ...... 20

1.8.2 Biochemical & Biophysical Assays ...... 20

1.8.3 Analysis of Structural Model ...... 21

2 Materials and Methods ...... 23

2.1 Cloning ...... 23

2.2 Site-directed Mutagenesis ...... 23

2.3 Solubility Test ...... 24

2.4 Expression ...... 26

2.5 Purification ...... 26

2.5.1 Cell Lysis ...... 26

2.5.2 Metal Ion Affinity Chromatography ...... 27

2.5.3 Size Exclusion Chromatography ...... 27

2.5.4 Ion Exchange Chromatography ...... 27

2.6 Binding assay using size exclusion chromatography ...... 28

2.7 Crystallization...... 28

2.8 Isothermal Titration Calorimetry (ITC) ...... 29

2.9 Structural Analysis...... 29

3 Results ...... 30

3.1 Crystallography ...... 30

3.1.1 Solubility & Expression of Constructs ...... 30

3.1.2 Purification ...... 30

3.1.3 Detection of Protein-Protein Interaction by Size Exclusion Chromatography (SEC) ...... 32

3.1.4 Crystallization ...... 33

3.2 Mutagenesis Binding Studies ...... 34

3.2.1 Mutagenesis of KLC1-TPR ...... 34

3.2.2 Mutagenesis of pJIP1 and pALC1 ...... 39

3.3 Structural Analysis...... 42

3.3.1 Mapping of the JIP3 and JIP4 binding site ...... 42

4 Discussion ...... 43

4.1 X-ray Crystallography ...... 43

4.1.1 Cloning, Expression & Purification of Proteins ...... 43

4.1.2 KLC1-TPR interacts with ALC1 and S100A6 ...... 43

4.2 Mechanism of Interaction by KLC1-TPR ...... 46

4.2.1 KLC1-TPR Interaction Interface ...... 46

4.2.2 Negatively Charged Residues in ALC1 and JIP1 are Essential in KLC1-TPR Binding ...... 49

4.2.3 N343 Polar Patch versus N301 Polar Patch ...... 49

4.3 Structural Analysis...... 50

4.3.1 Mapping of the JIP3 binding site – Putative Binding Site #3...... 50

4.4 Limitations ...... 52

5 Summary ...... 53

References ...... 54

List of Tables

TABLE I List of known kinesin-1 binding proteins and the protein origin…………… 5

TABLE II All of the cargo proteins constructs with their specific start and end

positions, vectors, and their construct code………………………………… 25

TABLE III Themodynamic parameters of the respective TPR domains and cargo

Peptide………………………………………………………………………. 39

vii

List of Figures

FIGURE 1.1 Structures of KLC1 and KLC2 TPR domains…………………………… 8

FIGURE 1.2 Sequence alignment of KLC1 and KLC2 TPR domains………………… 9

FIGURE 1.3 KLC1-TPR structural alignment with other TPR domains……………… 11

FIGURE 1.4 Mechanism of interactions utilized by the TPR domain ………………... 12

FIGURE 1.5 Schematic showing the cargo proteins and their domain that interact

with KLC1.……………………………………………………………… 22

FIGURE 3.1 Small Scale Solubility & Expression Test……………………………...... 31

FIGURE 3.2 Size Exclusion Chromatography Binding Assay ……………………….. 35

FIGURE 3.3 The crystallization drop of KLC1 and ALC1 complex………………...... 37

FIGURE 3.4 Crystals of KLC1 and pALC1 co-crystallizations……………………...... 38

FIGURE 3.5 Isothermal titration calorimetry data …………………………………… 40

FIGURE 4.1 The polyhistidine-tag linker blocking the groove of KLC1-TPR……….. 45

FIGURE 4.2 Structural insight into N343 of KLC1-TPR & S328 of KLC2-TPR ……. 47

FIGURE 4.3 The structure of S100A6 (PDB: 1K96) and the putative site of

interaction with KLC1-TPR……………………………………………... 48

FIGURE 4.4 Electrostatic potential of KLC1-TPR……………………………………. 49

FIGURE 4.5 Structural alignment of N301 polar patch to N343 polar patch…………. 51

viii

List of Abbreviations

A Alanine

Aβ -Amyloid

AD Alzheimer’s Disease

ALC1 Alcadein 1

AMPA -amino-3-hydroxy-6-methylisoxazole-4-propionate

APP Amyloid Precusor Protein

ARF6 ADP-ribosylation factor 6

BME -mercaptoethanol

CPP Conditioned Place Preference

CRMP2 Collapsin Response Mediator Protein 2

D Aspartic Acid

E Glutamic Acid

GRIP Glur2-interacting protein

GSK Glycogen Synthase Kinase

H Histidine

HAP1 Huntingtin-Associated Protein 1

HOP Heat Shock 70/90 Organizing Protein

HSC Heat Shock Protein

HSV Herpes Simplex Virus

IPTG Isopropyl β-D-1-thiogalactopyranoside

ITC Isothermal Titration Calorimetry

JIP JNK-interacting Protein

JNK c-Jun N-terminal Kinases

K Lysine

Kd Dissociation Constant

KHC Kinesin Heavy Chain

KIDINS220 Kinase D-interacting substrate of 220kDa

KIF Kinesin Superfamily of Proteins

KLC Kinesin Light Chain

KLCM1-TPR Kinesin Light Chain 1 TPR domain Mutant 1

KLCM2-TPR Kinesin Light Chain 1 TPR domain Mutant 2

LZD Leucine Zipper Domain

MAPK Mitogen-activated Protein Kinase

MBO Membrane Bound Organelle

MS Mass Spectrometry

N Asparagine

NFT Neurofibrillary Tangles

Ni-NTA Nickel nitrilotriacetic acid p67phox 67kDa neutrophil oxidase factor pALC1 Peptide Alcadein 1 pALCM1 Peptide Alcadein 1 mutant

PDB Protein Data Bank

PEX5p Peroxisomal targeting signal 1 receptor pJIP1 Peptide JNK-interacting Protein 1 pJIPM1 Peptide JNK-interacting Protein 1 Mutant 1 pJIPM2 Peptide JNK-interacting Protein 1 Mutant 2

PP5 Protein Phosphatase 5

PTB Phosphotyrosinebinding

Q Glutamine

RV Retention Volume

RW Red Wing

S Serine

SAD Selenium Anamalous X-ray Scattering

SEC Size Exclusion Chromatography

SGC Structural Genomics Consortium

SGT Small Glutamine-Rich Tetratricopeptide Repeat-Containing Protein

SLPM Standard Litres Per Minute

SNP Single Nucleotide Polymorphism

TEV Tobacco Etch Virus

TPR Tetratricopeptide Repeat

Trka Tyrosine Kinase Receptor

W Tryptophan

X11 Amyloid beta A4 precursor protein-binding family A member 2

xi 1

1 Introduction 1.1 Intracellular Transport

Intracellular transport of proteins, lipids and organelles is vital for cell survival. In neurons, protein synthesis machinery exists in the cell body, and synthesized proteins are transported to their destinations via the axon which can exceed 1 metre in length. Therefore, neurons use an intricate system of axonal and dendritic transport to traffic membranous organelles and protein complexes along the cytoskeleton. Microtubules are the major cytoskeletal proteins located in the axons and dendrites, whereas actin filaments are primarily located in the presynaptic terminals and postsynaptic spines. The importance of proper intracellular transport is exemplified by the fact that abnormal accumulation of organelles and proteins are the hallmark pathologies of many human neurodegenerative diseases (De Vos et al., 2008).

1.2 Motor Proteins

Motor proteins travel on cytoskeletons in an ATP-dependent manner. Myosin proteins, which are best known for their role in muscle contraction, bind to actin filaments. In comparison, kinesin and dynein superfamily proteins move along the microtubules and constitute the majority of the axonal transport system in neurons. Kinesins and dyneins have a common dimeric motor domain (the ATPase domain) that moves by binding to and dissociating from microtubules. This movement, powered by the hydrolysis of ATP, resembles “bipedal walking” (Verhey et al., 2011). The microtubules are polarized into plus and minus ends, and kinesins and dyneins cooperate to achieve bidirectional transports respectively. In neurons, the microtubule plus ends point away from the cell body whereas the minus ends are towards the cell body from the cell periphery. Kinesins transport cargos towards the plus end (known as anterograde transport) while dyneins move towards the minus end (known as retrograde transport).

2 1.3 Kinesin

1.3.1 Kinesin Superfamily

The Kinesin superfamily (KIF) is composed of 15 families (Kinesin-1 to Kinesin-14 and orphan kinesin), which are grouped into three different types depending on the location of the motor domain. The motor domains are found in the N-terminal (N-KIFs) and, C-terminal (C-KIFs) ends or in the middle (M-KIFs) (Miki et al., 2001). In humans, 45 genes encode for KIFs, with 39 N-KIF, 3 M-KIF and 3 C-KIF genes. Most of the KIFs retain a high level of sequence homology of 30-60% among their motor domains, as they all utilize a similar mechanism to move along the microtubule (Hirokawa & Noda, 2008). The rest of the protein is composed of a coiled-coil stalk domain and unique regions for proper cargo recognition and transport regulation.

The large number of KIFs reflects the multiple cellular functions that require the transport system. Kinesins transport proteins, membrane bound organelles (Hirokawa & Noda, 2008), synaptic vesicles (Hirokawa et al., 2009; Okada et al., 2005), mitochondria (Nangaku et al., 1994), lysosomes (Nakata & Hirokawa, 1995), and are also involved in the recycling of membranes between the golgi and endoplasmic reticulum (Lippincott-Schwartz et al., 1995). KIFs participate in two forms of transport, fast and slow transport. Fast transport is associated with membranous organelles that move at a rate of 50-400 mm/day whereas the slow transport with the cytosolic and cytoskeletal proteins move at a rate of less than 8mm/day (Hirokawa, 1997). Interestingly, Kinesin-1(also known as KIF-5) is able to switch between fast and slow transport, although the regulation of the switch between the two types of transport is not clear.

The functions of KIFs are not only limited to the aforementioned list of activities. Kinesin-13, which is one of the few M-Kifs, is involved in cell division. Although the precise mechanisms are not clearly understood, kinesin-13 is required for spindle assembly (Ganem & Compton, 2004), regulation of kinetochore-microtubule attachment during anaphase (Maney et al., 1998), and chromosome segregation. With such functions, regulation of kinesin-13 has been a subject of extensive research as a possible anti-carcinogenic target (Maney et al., 1998).

As every cell requires an intracellular transport system, KIFs are expressed ubiquitously in all types of cells (Miki et al., 2003). However, due to greater dependence on the intracellular transport machinery (Niclas et al., 1994), particularly high number of KIFs are present in

3 neurons. In the CA1 region of the hippocampus, as many as 19 different KIFs are expressed with kinesin-1, kinesin-2, kinesin-3, and kinesin-4 having the highest level of expression.

1.3.2 Kinesin-1

The functional form of kinesin-1 is a heterotetramer of two kinesin heavy chains (KHCs) and two kinesin light chains (KLCs) (DeBoer et al., 2008; Hirokawa, 1998). KHCs express the motor domain that is required for cargo movement, while KLCs contain the tetratricopeptide repeat (TPR) domain that interacts with kinesin-1 cargos.

Kinesin-1 is the major motor protein involved in anterograde transport, and currently 43 cargo proteins are known to be transported by kinesin-1 (Gindhart, 2006). Of the 43 different cargos, it is possible that the cargos do not interact directly with kinesin-1, but the interactions are mediated by adaptor proteins. The cargos can be classified into five different groups: membrane bound organelles (MBO), messenger RNAs (mRNAs), pathogens, cytoskeleton subunits, and signaling proteins.

An example of kinesin-1 dependent MBO transport is the delivery of amyloid precursor protein (APP) containing vesicles (Kamal et al., 2001). The transportation is mediated by an adaptor protein, JNK-interacting protein-1 (JIP1), which interacts with both kinesin-1 and the APP containing vesicle. A similar mechanism is involved in the transport of -amino-3-hydroxy-6- methylisoxazole-4-propionate (AMPA) receptors to the plasma membranes via the Glur2- interacting protein-1 (GRIP1) (Dong et al., 1997) (Wyszynski et al., 1999).

Proper transport of mRNAs is required for nervous system development and cell differentiation during embryogenesis. This process involves large adaptor proteins such as fragile X mental retardation protein and cytoplasmic polyadenylation element binding protein that mediate complex formation between mRNAs and kinesin-1 (Ling et al., 2004; Tekotte & Davis, 2002).

Two known viruses that utilize the kinesin-1 transport machinery are herpes simplex virus (HSV) and vaccinia virus (Diefenbach, Miranda-Saksena et al., 2002; Ward & Moss, 2004). HSV infects neurons located at nerve terminals, by replicating in the nucleus and translocating to the synapse. Kinesin-1 plays a role in the delivery of newly synthesized virus particles from the nucleus to the synapse by interacting with US11 viral protein (Diefenbach, Miranda-Saksena et

4 al., 2002). Vaccinia virus produces a protein known as A36R, exclusively expressed in the enveloped forms of virus, which mediates the interaction between the virus and kinesin-1 (Ward & Moss, 2004).

Microtubules, which act as “road” for kinesins, are composed of - and -tubulins (Gindhart, 2006). The tubulin subunits are proteins that are transported by kinesin-1 to the dynamic ends of microtubules, which are constantly in assembly and disassembly phases. Collapsin response mediator protein 2 (CRMP2) is a tubulin binding protein that interacts with kinesin-1 to elongate the microtubule (Kawano et al., 2005).

The Mitogen-activated protein kinase (MAPK)/c-jun N-terminal kinase (JNK) signaling pathway is dependent on kinesin-1-mediated transport (Horiuchi et al., 2007). The MAPK/JNK signaling pathway is primarily involved in stress response, as well as in nervous system development, cell differentiation and apoptosis. JIPs act as a scaffold and bind to multiple subunits to amplify the JNK signal. JIP, in turn binds to kinesin-1 to transport signaling proteins along the axon (Whitmarsh et al., 2001). In conjunction with the dynein retrograde motor, kinesin-1 transports signaling proteins to their destinations during stress response (Dong et al., 2005).

Kinesin-1 mediated transport is responsible for moving a diverse range of proteins, including proteins known to perform important cellular functions and others with unknown functions. Currently, the list of proteins that are transported by kinesin-1 is expanding.

1.3.3 Kinesin Heavy Chains

Kinesin heavy chains were the first identified components of kinesin protein and are the most abundant of all motor proteins. In humans, there are three KHC isoforms (KIF5A, KIF5B, and KIF5C), all of which are highly expressed in neurons within the CNS (Gindhart, 2006). KIF5A, and KIF5C are neurospecific isoforms whereas KIF5B is ubiquitously expressed (Hirokawa & Noda, 2008). KHC contains three domains: a motor domain that drives movement, an -helical coiled-coil region that mediates dimerization of the two heavy chains, region that interacts with KLCs (Diefenbach et al., 1998; J. G. Gindhart, Jr. et al., 1998). KHCs can form homo- and heterodimers which in turn recruit KLCs. KHCs are widely recognized as the “engine” of kinesin-1 as they contain the ATPase motor domain. However, in the absence of KLC, KHC has

6 the ability to bind to cargos directly and successfully transport them. Specifically, KHCs transport SNARE (Diefenbach, Diefenbach et al., 2002), syntabulin (Su et al., 2004) and syntaxins proteins directly via the C-terminal end.

To generate movement, one motor head of the KHC dimer uses hydrolysis of one ATP to swing itself to the front of the second motor head that is not undergoing ATP hydrolysis. Subsequent ATP hydrolysis in the second motor head moves the second motor head ahead of the first motor head as the motor not undergoing ATP hydrolysis stays bound to the microtubule (Verhey et al., 2011). This process generates a stepping motion of 8.3 nm along the microtubule per step. Simultaneously, the C-terminal end is either bound to its cargo or the KLC-cargo complex.

1.3.4 Kinesin Light Chains

KLCs are important for cellular functions, and loss of KLCs leads to neuronal defects (Rahman et al., 1999). KLCs are composed of three domains: the N-terminal heptad repeat, a TPR domain, and a C-terminal domain. KLCs bind to KHCs through a coiled-coil motif in the heptad repeat. The TPR domain is a well-known protein-protein interaction domain (Blatch & Lassle, 1999) that mediates the interaction between kinesin-1 specific cargos with KHCs. In KLC1, the C- terminal domain is responsible for the 19 alternatively spliced variants. It is believed that different C-terminal lengths of the spliced variants may contribute to KLCs’ cargo specificity (Wozniak & Allan, 2006).

Four KLC (KLC1-KLC4) isoforms exist in humans. With an exception to spermatids, all four isoforms of KLC are expressed ubiquitously. KLC3 is the only isoform expressed in spermatids while KLC1 and KLC2 are highly expressed in neurons (Junco et al., 2001). KLC1 is highly expressed in the brain in a region-specific manner. The highest expression levels of KLC1 are found in the hippocampus, striatum, amygdala, and frontal cortex (Bilecki et al., 2009). Specifically, KLC1 is primarily localized in the cell bodies of neurons.

KLCs have been known to regulate KHC function by inhibiting the motor domain in the absence of a cargo protein (Coy et al., 1999). This auto-inhibitory function helps the cells conserve energy as ATP will not be wasted to move a kinesin that is cargo unbound.

7 Human KLC1 and KLC2 are composed of 573 and 622 amino acids respectively. KLC1 and KLC2 share a high level of homology, with 69% identity throughout the whole protein. Most of the variability arises within the C-terminal end of KLC2, which is 64 residues longer than KLC1. This region allows KLC2 to interact with proteins such as Na-K-ATPase containing vesicles and tyrosine 3-monooxygenase acting protein (Rong et al., 2007). Meanwhile, the TPR domains have even higher homology with 87% identity (Fig 1.2). The variability arises mostly in the outer helices and the non-TPR helix region. There is one difference that stands out between the helices (helix-A) that form the groove of the KLC-TPRs at N343 of KLC1-TPR and S328 of KLC2- TPR. Interestingly, the shorter KLC1 has specific cargos that KLC2 cannot bind, such as torsinA and JIP1, which are two proteins implicated in the pathogenesis of torsion dystonia and Alzheimer’s diseases (AD), respectively (Kamal et al., 2001; Kamm et al., 2004; King & Scott Turner, 2004). In addition, both KLC isoforms can bind to common cargos such as alcadein-1 (ALC1) (Araki et al., 2007), JIP3 (Bowman et al., 2000), and CRMP2 (Araki et al., 2007; Kawano et al., 2005). Due to the redundancy of the CRMP2 interaction between the KLC isoforms, deletion of any one of the KLC genes does not result in any defects. Since the TPR domains of KLC1 (KLC1-TPR) and KLC2 (KLC2-TPR) are highly homologous with different cargo specificities, the mechanisms of interaction can be hypothesized by assessing their differences.

1.4 TPR domains

TPR domains are characterized by 3-16 repeats of antiparallel -helices that generates a right-handed super helix with a channel-forming groove. There are approximately 50 proteins with the TPR domain that are involved in numerous cellular functions such as cell cycle control, co-chaperone, and signal transduction (Blatch & Lassle, 1999; Lamb et al., 1995). The primary function of this domain is to mediate protein-protein interactions. Sequence and structural analysis of the TPR domain reveals conserved hydrophobic and small amino acids with a modified loop region. This conservation gives the TPR domain the versatility to mediate protein- protein interactions on several different proteins (D'Andrea & Regan, 2003). An interesting yet common theme in -helical repeat protein structures such as the TPR domain structure is that there are only small conformational changes upon binding to ligands or proteins (Grove et al., 2008).

Figure 1.1 – Structures of KLC1 and KLC2 TPR domains. (A) KLC1-TPR domain indicating the helix-A (Red) and helix-B (Blue). Every repeat is composed of one helix-A and one helix-B (B) Structure of the KLC2-TPR domain (C) Structural alignment of KLC1-TPR (Orange) and KLC2-TPR (Green) at a RMSD of 2.6 Å

KLC2 (KLC2-TPR) are highly homologous while having different cargos, this property can be used to deduce the possible mechanisms of interaction.

Figure 1.2 – Sequence alignment of KLC1-TPR and KLC2-TPR. All of the  helices are TPR helices

except for 11 and 10 for KLC1-TPR and KLC2-TPR, respectively

The TPR domain of KLC1 and KLC2 have 13 -helices, 12 of which correspond to six TPR

repeats with one non-TPR helix in between repeats 5 and 6. The KLC TPR domain is larger, with 42 amino acid repeats, compared to 34 residues of the consensus TPR domains (Fig 1.1). This results in the lengthening of every helix in the KLC-TPR by one turn and may explain the ability of KLCs to interact with a large number of proteins. Despite the addition of an extra turn, the KLC TPR maintains the consensus TPR sequence within the 4th and 37th residues of its repeat. Electrostatic charge calculations of KLC-TPR reveal a positively charged groove and a negatively charged outer surface hot spots formed by inter-TPR loops.

The structural alignment of KLC TPR domains to the TPR domains of HSP70/HSP90 organizing protein (HOP) (Scheufler et al., 2000), peroxisomal targeting signal receptor (PEX5p) (Gatto et al., 2000), protein phosphatase 5 (PP5) (Das et al., 1998), p67phox (Lapouge et al., 2000) and small glutamine-rich tetratricopeptide repeat containing protein (SGT) (Dutta & Tan, 2008) demonstrates the high level of structural versatility of the KLC1 TPR domain (Fig 1.3). Alignment of the KLC1-TPR with HOP, PEX5p, PP5, and SGT start from TPR2 or TPR3 onwards (Holm & Park, 2000). Moreover, a synthetic consensus TPR motif designed using amino acids with the highest propensity at each position was aligned starting at TPR3 of the KLC1 TPR domain (Kajander et al., 2007). In contrast, the TPR domain of p67phox is the only

10 region of the protein that aligns with KLC1 from TPR1, which is the repeat with the greatest variance. These two alignment characteristics may be indicative of the differences and similarities with respect to the mechanism of interaction which will be discussed below.

Although primary sequence comparisons of the KLC TPR domains share a sequence identity of less than 20% with other TPR domains, they show modest structural homology with Root-Mean- Square-Deviation (RMSD), a measure of the average deviation of -carbons of the two proteins, values below 3.0Ǻ. This structural conservation helps model the binding sites of the KLC TPR domains for various cargos, as the binding sites of several TPR domains have already been identified for their binding partners.

The structural alignment of the KLC1-TPR to the protein partner bound p67phox and HOP sheds light on the possible mechanisms of interaction with cargos. P67phox is one of the cytosolic subunits of NADPH oxidase. A crucial step in activating the NADPH oxidase is the binding of p67phox to Rac (Lapouge et al., 2000). This interaction is mediated by a series of hydrogen bonds formed by a network of polar residues on p67phox; serine, histidine, arginine, asparagine, and two aspartic acids located on the outer surface of the TPR domain. Interestingly, the corresponding residues of the KLC1-TPR conserve the polarity with its own polar residues such as histidine and lysine, which are located within the inter-TPR loops (Fig 1.4A).

The second binding site is located within the concave groove formed by the superhelical turns of the TPR domain. HOP acts as a co-chaperone to the Hsp70 and Hsp90 proteins and links the two proteins together (Scheufler et al., 2000). To do so, HOP utilizes “asparagine clamp” formed by a pair of aspartic acid residues located within the groove. This is aided by a series of polar residues such as lysine and serines that are capable of forming hydrogen bonds. Hydrophobic residues surrounding the clamp provide further specificity to bind to Hsp by providing

Figure 1.3 – KLC1-TPR structural alignment with other TPR domains. KLC1-TPR (green) alignment with TPR domains (red); (A) SGT (RMSD: 2.6 Ǻ) (B) Consensus Sequence (RMSD: 2.1 Ǻ) (C) HOP (RMSD: 2.1 Ǻ), (D) p67phox (RMSD: 2.6 Ǻ), (E) Pex5P (RMSD: 3.2 Ǻ), (F) PP5 (RMSD: 2.8 Ǻ). The structural alignment was completed with DaliLite (Holm & Park, 2000).

Figure 1.4 – Mechanism of interactions utilized by the TPR domain. (A) Alignment of KLC1- TPR (Orange) with p67phox (Marine) in complex with Rac1 (Yellow) (B) Alignment of KLC1- TPR (Orange & PDB: 3NF1) with HOP1 (Marine) in complex with Hsc70 peptide (Yellow)

13 hydrophobic contacts. Again, the alignment of the KLC1-TPR to HOP conserves this similar interface (Fig 1.4B). The corresponding residues in the KLC1-TPR form a similar “clamp” with N259 and N302 and are supplemented by similar polar residues such as lysine in position 340 and 344.

1.5 Introduction to Kinesin-1’s Cargo and Biological Relevance

1.5.1 Alzheimer’s disease (AD)

Deficient or abnormal axonal transport in neurons is frequently observed in humans with neurodegenerative diseases (Stokin et al., 2005). In particular, axonal swellings that are caused by abnormal accumulation of cargo proteins are a common pathological characteristic of these diseases (Coleman, 2005). Alzheimer’s disease (AD), the most common form of dementia, is characterized by the presence of neurofibrillary tangles (NFTs) and senile plaques (Mountjoy et al., 1983). NFTs are aggregates of helical filaments and hyperphosphorylated tau proteins that disrupt microtubule-mediated axonal transport. Senile plaques are extracellular deposits composed of -amyloid (A) that are concurrently found in dystrophic neurites and axonal swellings. A is generated by proteolytic cleavage of APP. APP is a type 1 transmembrane protein, and mutations in the gene encoding this protein are implicated in familial Alzheimer’s disease (Ertekin-Taner, 2007). The role of this protein is still unclear, although the possible functions include cell-cell interaction, cell adhesion, protease inhibition and neurite outgrowth (Turner et al., 2003).

APP metabolism and its axonal transport are closely associated with AD. However the role of APP in the pathogenesis of AD is complex and not fully understood. APP is cleaved by two proteases, -secretase and -secretase to generate the most potent 42-residue -amyloid. Temporal regulation of this cleavage is unclear, although APP is thought to be susceptible to proteolytic cleavage during axonal transport, on the plasma membrane, and during endocytotic cycles (Suzuki et al., 2006). APP is transported in the axon by kinesin-1 via JIP1. Alcadein-1 (ALC1) is another type 1 transmembrane protein that is transported by kinesin-1, albeit through a direct interaction with kinesin-1. This interaction inhibits the transport of APP by inhibiting the JIP1 and KLC1 interaction. ALC1 also inhibits the formation of the JIP1-APP complex by forming a tripartite complex with APP through a neural-specific adaptor protein, X11 (Araki et

14 al., 2004; Konecna et al., 2006). This complex, which is formed exclusively in the plasma membrane and the golgi apparatus and not during axonal transport, stabilizes and protects APP from degradation (Suzuki et al., 2006). The suppression of APP transport by ALC1 has been shown to facilitate A generation, which mimics the process of AD pathogenesis. Similar to APP, ALC1 accumulates in dystrophic neuritis in AD brains, suggesting significant roles for both JIP1 and ALC1 in the transport of APP and generation of A.

Kinesin-1 is involved in the alternative mechanism of neurodegeneration, tauopathies. Tau is a microtubule-binding protein that stabilizes microtubules and regulates kinesin- and dynein- mediated axonal transport (Dixit et al., 2008). Not only are hyperphosphorylated tau proteins a component of the NFTs, overexpression of tau impairs kinesin-dependent transport of cargos (Stamer et al., 2002). Hallmarks of transport defects such as axonal protein accumulation and neuritic swelling are associated with the phenotypes caused by hyperphosphorylated tau proteins (McGowan et al., 2006; Terwel et al., 2002). In mice models, these hallmark signs of neurodegeneration have been shown to occur early and distant from A deposition sites. Not only can abnormal tau seem to spark the cascade of neurotoxicity, but abnormal KLC1 can lead to the same pathway. In Klc1-/- mice, cargo and tau proteins were accumulated, causing axonpathies (Falzone et al., 2009). The stress caused by axonpathy leads to increased JNK- mediated stress response. Direct inhibition of KLC1-driven kinesin-1 transport demonstrates the pathological consequences of misdirected cargo proteins.

1.5.2 Huntington’s Disease (HD)

Kinesin-1 cargo includes an adaptor protein known as huntingtin-associated protein-1 (HAP1) (McGuire et al., 2006). This protein is implicated in neurite growth and in increasing synaptic transmission and plasticity (Harjes & Wanker, 2003). HAP1 also interacts with the protein responsible for Huntington’s disease, huntingtin (Htt). Normal Htt is involved in the transport of neutrophin containing vesicles, whereas the polymorphic Htt which contains a glutamine residue tail (polyQ) exceeding 36 residues, interferes with this transport (Caviston & Holzbaur, 2009). At the same time, the length of the polyQ tail is directly correlated with the binding affinity with HAP1. Htt mutants with polyQ tails that exceed 36 amino acids are toxic to neurons. One possible mechanism of toxicity by the Htt mutant is the consequence of increased affinity for

15 HAP1. This interferes with HAP1’s cellular function as an adaptor protein in vesicle transport (Gauthier et al., 2004) and decreases the trafficking of brain-derived neurotrophic factor (BDNF) and receptor tyrosine kinase (TrkA) for which HAP1 is responsible for. Suppression of HAP1 also inhibits GABA-receptor trafficking which suggest that HD pathogenesis may be linked to the inability of HAP1 and kinesin-1 to transport these cargos (Falzone et al., 2009).

1.5.3 Mood Disorder

Chronic consumption of opioids can lead to the impairment of axonal transport system (Beitner- Johnson & Nestler, 1993). Klc1 is a candidate gene for opiod addiction, as KLC1 expression levels directly correlate with opiod addiction levels (Kabbaj et al., 2004). Increased KLC1 expression in amygdala, frontal cortex and hippocampus had clear correlations with condition place preference scores of morphine conditioned mice.

Although, glycogen synthase kinase 3 (GSK3) is a kinesin-1 cargo, it is able to regulate kinesin-1 transport. GSK3 phosphorylates KLC1 at serine 460 (S460) and regulates the transport of its cargos (Vagnoni et al., 2011). One notable example is the transport of AMPA receptors through the interaction with GRIP1 (Dong et al., 1997). GSK3 phosphorylation causes the dissociation of KLC from the GRIP1-AMPAR complex, which in turn brings the trafficking of AMPA receptors to a halt (Du et al., 2010). Such changes lead to an anti- depressant like effect in animal models and mimicked lithium’s effect. For this reason, this transport mechanism has been a target for mood disorders as AMPA receptor trafficking is important for synaptic plasticity.

1.5.4 Diabetes

The significance of kinesin-1 function is also evident in pancreatic -cells (McDonald et al., 2009; Varadi et al., 2002). As an initial response to increased blood glucose levels, insulin is released from insulin granules from the plasma membrane. The second phase requires the mobilization of insulin granules to the periphery from intracellular storage pools to sustain high insulin concentrations. Kinesin-1 takes part in the second phase of granule mobilization, as the inactivation of kinesin-1 inhibits the granule mobilization (Varadi et al., 2002). Conditional

16 Kif5b knockout mice showed glucose intolerance due to insulin secretory defects (Cui et al., 2011). The importance of kinesin-1 and insulin may also lie in the fact that kinesin-1 is involved in the -cell development in addition to mobilizing the insulin granules.

1.5.5 Axon Outgrowth

Several kinesin-1 cargos are involved in axonal outgrowth and are required in the growing ends of axons. One of the cargos that are upregulated during development is CRMP2. The upregulated protein localizes in the distal parts of growing axons and is required for axonal outgrowth as the knock down of CRMP2 suppresses axon formation (Byk et al., 1998; Inagaki et al., 2001). Kinesin-1 is responsible for transporting CRMP2 to these distal ends of axons (Kawano et al., 2005). Therefore the knockdown of KLC1 and KLC2 suppressed axonal outgrowth as CRMP2 could not be accumulated at the axon tips.

Another protein in the JIP family, JIP3, is exclusively expressed in the brain. JIP3 acts as an adaptor protein, and mediates the transport of TrkB receptors that are used in signal transduction (Huang et al., 2011). As such, the disruption of JIP3 halts the TrkB induced axonal filopodia formation. In axon outgrowth, these filopodia are essential in proper growth cone extension which is malformed in cells without JIP3 (Cavalli et al., 2005).

Early onset dystonia is a movement disorder caused by mutagenic torsinA protein (Kamm et al., 2004). TorsinA interacts with KLC1 and is transported to the distal ends of axons where it colocalizes with growth cones. Interestingly, the mutant form of torsinA does not get transported and accumulates only in the cell body of the neuron (Granata et al., 2009). Although the function of torsinA is not clearly understood, it’s speculated that, it functions in enhancing synaptic plasticity, which is important for motor learning in the brain.

Kinase D-interacting substrate of 220 kDa (KIDINS220) is a membrane protein and a binding partner of KLC1 (Bracale et al., 2007). KIDINS220 is a downstream target of neutrophins and is transported to growing neurites where it interacts with Rho family proteins to regulate axon growth. Therefore, the inhibition of this transport interferes with neurite outgrowth in PC12 cells (Neubrand et al., 2010).

17 1.6 Clinical Relevance

1.6.1 Kinesin Light Chain Single Nucleotide Polymorphisms

Although the known single nucleotide polymorphisms (SNPs) of Klc1 are all in the introns or transcription factor binding sites, several of the SNPs in the Klc1 gene have clinical relevance (Andersson, Sjolander et al., 2007; Andersson, Zetterberg et al., 2007; Dhaenens et al., 2004; Szolnoki et al., 2007a; von Otter et al., 2009). There are 668 known SNPs, two of which are significantly associated with some form of degenerative disease. The most convincing evidence comes from SNP rs8702 and the risk of leukoaraiosis. Hypertensive smokers with the rs8702 (G56836C) SNP showed a 7 fold increase in the risk of leukoaraiosis and showed markedly increased cognitive disturbances and neurodegeneration (Szolnoki et al., 2007b). The same SNP was associated with other forms of degenerative diseases, and increased risks for AD and cataract by 1.7 fold (von Otter et al., 2009). These effects of rs8702 SNP are believed to be caused by changes in mRNA splicing. Another SNP, rs8007903, also significantly increases AD risk all the while decreasing the risk of cataract. Although the associations between Klc1 polymorphisms’ and disease risk are starting to emerge, no genome wide association studies have been able to find the same association. As such, Klc1 polymorphisms require more experimental studies to clarify the role of the Klc1 gene.

1.6.2 Kinesin-1 as a Drug Target

Currently there is no drug on the market to target the kinesin family of proteins for therapeutic purposes. But as a side effect, there are drugs such as lidocaine that inhibits the transport system by blocking the motor head and neck junction (Miyamoto et al., 2000). Furthermore, acrylamide covalently binds to kinesin achieving 100% detachment of the protein from microtubules at concentrations of 1 mM (Sickles et al., 1996). However, the kinesin family of proteins has not been subjected to major drug development as a target for therapeutics. Primarily, diseases associated with kinesin are caused by the obstruction and impairment of the kinesin transport making it difficult as a therapeutic target. Kinesins could be a target when its normal function is abused by the cellular system making it more disease prone in cases such as cancer. The KIF5B mRNA is upregulated in cancer cells and tissues, and the depletion of KIF5B induces apoptosis in HeLa cells, making it a possible target in anti-neoplastic treatment (Yu & Feng, 2010).

18 Kinesins in pathogens such as bacteria, virus, and parasites are also suitable targets (Dumont et al., 2010; Ward & Moss, 2004). KIF5, kinesin-1 homologue in vaccinia virus, is responsible for carrying the viral protein A36R. This protein also interacts with the TPR domain of KLC1, and helps transport vaccinia viruses across the cell. Inhibitors of the interaction between the proteins may serve as a target. A more difficult and unclear strategy of kinesin targeting is with respect to neurodegenerative disease. Diseases such as, Alzheimer’s diseases, Huntington’s disease, torsion dystonia are heavily interconnected and reliant on the transport system but are a good example of the difficulty in targeting kinesins as all of these diseases are associated with the impairment of kinesins.

1.7 Macromolecular Crystallography

There are several ways to obtain the structural model of macromolecules. Two of the most prominent methods are Nuclear Magnetic Resonance (NMR) and X-ray crystallography. NMR uses high frequency magnetic fields to stimulate and measure the resonances of nuclei to locate protein atoms. X-ray crystallography uses the photon diffraction of electrons to obtain structural models. NMR has its advantages in that the proteins are in solution which allows the capture of kinetics, motion and the functional active sites, whereas, x-ray crystallography has limited restriction in the size of the proteins.

Macromolecular crystallography is the method of choice for determining the 3D protein. As of May 2011, crystallography accounts for more than 63900 structures out of 73300 in the Protein Data Bank (PDB). Proteins naturally exist in aqueous conditions whereas the proteins solved by crystallography are in the crystalline state. This has caused some differences in the crystal structures compared to the solution structures, but these differences occur on rare occasions. Evidence that proteins in the crystalline state retain their biologically important conformations is that the proteins are able to interact with their substrates or catalyze a kinetic reaction within the crystal.

For successful crystallization, the protein must be ordered and aligned into a crystal lattice (Blundell & Johnson, 1976). Purity of the protein is a main determinant for growing crystals. In the case of co-crystallization of a protein-protein complex, it would be ideal if the solution contains only the complex without any un-bound individual proteins. Crystals form as a protein

19 drop, highly concentrated before equilibration (5-50 mg/mL), becomes supersaturated by precipitants using the vapour diffusion method. Vapour diffusion is a technique used to slowly increase the concentration of the protein drop by sealing the protein drop and a reservoir containing precipitants in a chamber, which is separated by a vapor phase. In the sealed chamber, water molecules of the protein drop, which also contains the same precipitant as the reservoir but at a lower concentration, diffuse into the reservoir, hence slowly approaching the same concentration of precipitant in the reservoir and the protein drop.

To build a structural model from the crystal, an x-ray beam is passed through the cryo-cooled crystal, collecting the diffraction patterns by rotating the crystal. The diffraction represents the amplitude of the structure factors, whereas the phase angles and the amplitudes of the structure factors are required for calculating an interpretable electron density map. By using methods such as isomorphous replacement, anomalous scattering, and molecular replacement, the phase angles are estimated and optimized to yield an accurate electron-density map that can be used to create the structural model.

Not only are we able to see the structural aspects of the macromolecule from the model, but more information on how the molecule actually works can be acquired. The structural model can be a powerful tool to gather information on how KLC binds to and disengage from its cargos, what the mechanism of action KLC uses can be deduced.

1.8 Hypothesis & Approach

As outlined in the introduction, the importance and function of kinesin-1 are highly interconnected to the cargos’ function. Since kinesin-1 transports over 40 different cargos, it plays a role in a wide range of biological functions. The majority of research into kinesin-1 dependent axonal transport has focused on identifying cargos and the importance of cargo transport. Meanwhile, understanding of the mechanism of cargo recognition by kinesin-1, and of cargo dissociation from kinesin at the destination is limited. The mechanism of cargo recognition is of special interest as KLC1 and its TPR domain are responsible for many different cargos. Also, there has yet to be identified KLC1 binding motif that is conserved in the cargo proteins. What allows the TPR domain to recognize so many binding partners? What are the binding sites

20 on the TPR domain to accomplish this and how many sites are there? How do the cargos share the TPR domain to reach their own destinations?

For instance, no two of the same family of domains interact with KLC1-TPR. Although, JIP1, ALC1, and torsinA use their C-terminus to interact with KLC1-TPR, no common KLC binding site has been found. JIP3 uses its Leucine zipper domain (LZD) which is an -helix dimer, which bears no resemblance to the other cargos (Fig 1.5A). For some cargos such as JIP1, ALC1, and Daxx, the sequences involved in the interaction with KLCs’ are known. As mentioned, the highly homologous KLC1-TPR and KLC2-TPR have differential binding properties towards JIP1, even though little variability rises within the groove of the TPR domain. Together with the known mechanism of HOP-TPR and HSc interaction which utilizes the groove, we hypothesize that one way KLC1-TPR achieves its cargo recognition is through a “clamp” similar to that of the HOP-Hsc70 interaction that will involve N343. Here we will investigate the mechanism of the interaction between KLC and its cargos at the protein and peptide level by using X-ray crystallography, biochemical assays, mutagenesis studies, and the analysis of the structural models in order to explain the cargo interaction mechanism in molecular detail.

1.8.1 X-ray Crystallography

By using X-ray crystallography, it is our goal to obtain structural models for KLC and its cargo proteins in their complex form. Also the obtained KLC structures will be the basis for understanding the cargo recognition mechanism.

1.8.2 Biochemical & Biophysical Assays

By using the well established techniques such as isothermal titration calorimetry and size exclusion chromatography, we will investigate the binding characteristics of KLCs and their cargos. Site-directed mutagenesis will be used to investigate the importance of specific residues of KLC and its cargos.

21 1.8.3 Analysis of Structural Model

There have been several mutational analyses of KLCs in the literature. By mapping these mutants onto our KLC structure, we will deduce possible binding sites of KLCs and their important regions for cargo interactions.

Figure 1.4 – Schematic showing the cargo proteins and their domain that interact with KLC1. (A) Different types of domains binding to the TPR domain of KLC (B) Sequences that are known to be important in the interaction with the cargo protein and KLC-TPR. The key residues are highlighted in red.

23 2 Materials and Methods 2.1 Cloning

For the generation of the constructs: KLC1 (BC008881) and KLC2 (BC034373) TPR domains, ALC1 (BC033902), CRMP2 (BC067109), DAXX (BC109074), HAP1 (BC034089) JIP1(BC068470), JIP3(BC137124), KIDINS220 (BC130610), S100A2 (BC002829), and TorA (BC000674), the cDNA templates were obtained from the Mammalian Gene Collection (MGC). PCR was carried out using a Thermocycler (Eppendorf) and Pfu Ultra polymerase (Stratagene). The PCR conditions were 95C for 2 min, then 20 cycles of 95C for 30 seconds, and 5C under  Tm of the primers for 30 seconds, and 72 C for 1 minute for every kilobase. The PCR was finished with 10 minute 72C annealing step. Using different primers, we made multiple constructs of different lengths from the same template, resulting in three ALC1, four CRMP2, five DAXX, eight KIDINS220, fifteen JIP1, six JIP3, two S100A2, and four TorA constructs (Table II). There were also fourteen KLC1 constructs and six KLC2 constructs. The PCR products were confirmed on 1.5% agarose gels and purified using a PCR purification kit (Qiagen). Three different plasmids were used as cloning vectors, pET28-MHL (NCBI: EF456735), pET28-GST (NCBI: EF456739) and pNIC-CH (NCBI: EF199843). Annealing of the PCR products to the vectors was completed with the In-Fusion Dry-Down PCR Cloning Kit (Clontech) and restriction enzymes BseRI (New England Biolab) for the pET28-MHL and pET28-GST vectors and BfuAI (New England Biolab) for the pNICH-CH vector. 30ng of vector was mixed with 25-50ng of the PCR product and half of an infusion pellet. The mixture was incubated in 37C for 30 minutes. The annealed products were then transformed into DH5 (Stratagene) competent cells for plasmid propagation and the newly grown colonies were tested with PCR to confirm the successful ligation of construct to the plasmid. Confirmed colonies were grown in 5 mL of Lysogeny Broth (LB) and purified with MINIPREP (QIAGEN). Purified plasmids were re-transformed into BL21(DE3)-p2RARE (Stratagene) competent cells.

2.2 Site-directed Mutagenesis

KLC1-TPR and KLC2-TPR mutants were prepared using QuickChange® kits (Stratagene). Using the cloned KLC1 construct with TPR-domain only (amino acids 205-497) and KLC2 construct with TPR-domain only (amino acids 217-480) as a template and mutagenesis primers, 5’

24 GTTGCCAAGCAGTTAAGTAACTTGGCCTTACTGTGC 3’ and 5’ CAGTAAGGCCAAGTTACTTAACTGCTTGGCAACATC 3’, the KLC1 N343S mutation was achieved with PCR. For the KLC2 S328N mutation, KLC2 construct was used as a template with primers, 5’GTGGCCAAGCAGCTCAGCAATCTGGCCCTGCTG 3’ and 5’ CAGCAGG GCCAGATTGCTGAGCTGCTTGGCCAC 3’. The PCR condition was similar to the condition used for cloning. The PCR products were digested with Dpn1 for 100 minutes and purified with MINIPREP (QIAGEN) and then were transformed into DH5 competent cells. Cells grown with DH5 transformed KLC mutants were purified with MINIPREP (QIAGEN) then transformed into BL21 (DE3)-p2RARE (Stratagene) competent cells. All cloned constructs were verified by DNA sequencing prior to expression. The sequencing to confirm the site-directed mutagenesis was done by ACGT DNA Technologies Corporation (Toronto).

2.3 Solubility Test

Constructs transformed into BL21 (DE3)-p2RARE cells were grown in 2 mL lysogeny broth (LB) for 18 hours at 37C in a shaker. To prepare a 33% glycerol stock, 300 L of the culture was removed and mixed with 65% glycerol, flash-frozen and stored in -80C. 50 l of the culture was added into 3 mL of terrific broth (TB) and were grown further at 37C in a shaker until the optical density at wavelength 600 nm (OD600) reached ~3.0. The shaker temperature was reduced to 18C and isopropyl β-D-1-thiogalactopyranoside (IPTG) was introduced to a final concentration of 1 mM. 18 hours after induction, the cultures were centrifuged, and the pellet was suspended in 300 L of suspension buffer containing 30mM HEPES 7.4, 200 mM NaCl, 5% glycerol, 5 mM imidazole, and 5 mM -mercaptoethanol (BME). 800 L of suspension buffer containing 1% CHAPS, protease inhibitor cocktail (Sigma), 500 units of benzonase, and 5% (w/v) lysozyme in addition to suspension buffer was added to the suspended cultures. To test the expression, 10uL of the lysed samples were collected and analyzed on sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). Mini-PROTEAN TGX gels (BioRad) was used at 180 volts for 30 minutes. To test the solubility of the protein constructs, the lysed samples were centrifuged and the supernatant was collected. 20 L of Nickel- nitrilotriacetic acid (Ni-NTA) beads were incubated with the supernatant for 10 minutes and the protein was

26 eluted with 20 L of elution buffer (suspension buffer with an additional 300mM imidazole). 10 L of loading dye with 1:10 BME was added into the eluted protein. 10 L of eluted protein solution was run on the same gel as the expression test samples and run on PAGE to assess the expression and solubility of the protein constructs. The gels were stained with InstantBlue (Expedon), a Coomassie based gel stain, for 20 minutes. The results of this solubility test were used to select the most promising constructs to express and purify in large-scale quantities.

2.4 Expression

For every soluble construct, seed cultures were grown initially in 50 mL LB overnight at 37C in a shaker. The overnight cultures were then transferred into 1.8L TB containing bottles. These bottles were attached to the Liquid Expression Bubbling system at 1 standard litres per minute (SLPM) per 1L of culture at 37C. The cell growth was continued until the OD600 of the culture reached ~3.0, when IPTG was introduced to a concentration of 1 mM. Further cell growth was carried out at 18C for 16-18 hours with 0.5 SLPM per 1L of culture. The cells were harvested by centrifuging the samples at 12195 RCF for 10 minutes and the pellets flash frozen and stored at -80C for future use. To test the expression of each culture, 1 mL from each construct was removed to test for protein expression on SDS-PAGE.

2.5 Purification

2.5.1 Cell Lysis

The frozen cell pellets were re-suspended in binding buffer containing 30mM HEPES 7.4, 200 mM NaCl, 5% glycerol, 5 mM imidazole, and 5 mM BME. Before cell lysis, 0.5% 3-[(3- cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 500 units of benzonase nuclease, 1 mM phenylmethanesulfonylfluoride (PMSF), 1 mM benzamidine was added. The cells were lysed in a sonicator at 120W for 8 minutes with ON and OFF periods of 10 seconds and 15 seconds, respectively on ice. Lysed cells were centrifuged for 80 minutes at 4C at 39000 RCF, the supernatants filtered with cheesecloth were incubated with 2-5 mL of Ni-NTA resins suspended 50:50 in ethanol at 4C for 1 hour.

27 2.5.2 Metal Ion Affinity Chromatography

Metal ion affinity chromatography was carried out using open columns. The Ni-NTA resins were washed with 50 mL of binding buffer, then 20-50 mL of washing buffer (30 mM HEPES 7.4, 200 mM NaCl, 5% glycerol, 30 mM imidazole, and 5 mM BME), and eluted with 10 mL of elution buffer (30mM HEPES 7.4, 200mM NaCl, 5% glycerol, 300 mM imidazole, and 5 mM BME). The polyhistidine-tags of KLC1 and KLC2 were cleaved using 1:50 tobacco etch virus (TEV) protease at 4C while being dialyzed against the gel filtration buffer (30mM HEPES 7.4, 200 mM NaCl, 5% glycerol, 1 mM tris(2-carboxyethyl) phosphine (TCEP)) for 12 hours. Cleaved polyhistidine-tags were removed with the second pass over a Ni-NTA column.

2.5.3 Size Exclusion Chromatography

Eluted proteins and polyhistidine-tag removed KLC1 and KLC2 were further purified using the AKTAFPLCTM (GE Healthcare). HiLoad SuperdexTM 75, and HiLoad SuperdexTM 200 26/60 columns were used to carry out size exclusion chromatography (SEC). Following columns equilibration with the gel filtration buffer, protein samples were loaded onto the columns at 4 mL/min. The column was subsequently passed with 1.2 column volume and fractions of 2-4 mL were collected from 0.3 to 0.8 column volume (CV). Fractions that corresponded to protein peaks on the UV chromatograph (A280) were collected and concentrated with Amicon Ultra-15 centrifugal filter units (Milipore). 10-20 l of protein samples were removed from various expression and purification steps including cell lysis, metal ion affinity chromatography, and SEC to analyze on SDS-PAGE. Protein concentration was obtained by measuring A280 with NanoDrop 1000 Spectrophotometer (Thermo Scientific).

2.5.4 Ion Exchange Chromatography

KLC1 samples that contained contaminants were further purified using a MonoS 10/100 column (GE Healthcare). The column was equilibrated with Buffer A (30 mM Bis-Tris 6.5, 5% glycerol) for 20 CV. The protein samples were loaded onto the column at 2 mL/min, and at 2 mL/min the Buffer B (30 mM Bis-Tris 6.5, 5% glycerol, 1M NaCl) was added slowly as a gradient to 100%.

28 4 mL fractions were collected and the corresponding protein peaks were analyzed on SDS- PAGE.

2.6 Binding assay using size exclusion chromatography

For the purification of protein complex, KLC1 was mixed with its cargo to follow the same method as the size exclusion chromatography purification of the single protein (section 2.5.3). 0.5 mL of purified and concentrated protein samples were loaded onto the Superdex 10/300 GL columns (GE Healthcare) manually with 1 mL syringe. With minimal tubing connection and at a flow rate of 0.5 mL/min, samples of KLC1-TPR alone, cargo protein alone, and a mixture of KLC1-TPR and cargo protein together were run separately. UV chromatograph of the SEC runs was overlaid using the UNICORN System Control (GE Healthcare). The fractions of the newly formed protein peaks were collected and analyzed on SDS-PAGE gel.

2.7 Crystallization

Crystallization trials were carried out using KLC1 with its cargo protein (ALC1, CRMP2, HAP1, JIP1, JIP3, S100A6) and cargo peptides (pALC1, pJIP1). The proteins were concentrated to 10- 20 mg/mL by using Amicon Ultra-15 centrifugal filter units (Milipore) and the concentrations of the cargo peptides were 1.5-2.0 times higher than that of KLC1. Initial crystallization trials were performed by the sitting drop vapour-diffusion method. Structural Genomics Consortium (SGC), and Red Wing (RW) buffer kits (96-well plate format) were used to set drops mixed from 0.5 L each of protein and well solutions. These drops were placed automatically using the Phoenix robot (Rigaku), an automated drop setter, from well solution reservoirs containing 100ul of the buffer. The KLC1 and ALC1 co-crystallization trial was also conducted with a manual buffer screen optimized for protein complex crystallization in addition to the SGC and RW buffer kits. For the manual buffer screen, 24-well plates were used and equal drops of 1ul protein and well solution were mixed manually. Optimization trials for crystals that had formed were set on both 24-well hanging drop and sitting drop plates. The crystallization plates were kept at 18C and were checked with the help of a microscope at 2 days, 1 week, and 2 week time intervals.

29 Crystals were mounted in cryoloops (Hampton Research) and were immersed in either paratone oil or the well solution containing an additional 10-15 % glycerol and were cryo-cooled in liquid nitrogen for screening.

Structural figures were generated using PyMol (http://www.pymol.org) and sequence alignments were performed with ClustalW and rendered using ESPript (Chenna et al., 2003; Gouet et al., 1999). The structural alignments were performed using DaliLite (Holm & Park, 2000).

2.8 Isothermal Titration Calorimetry (ITC)

To prepare for ITC, purified KLC1 samples were concentrated to 80-120 M. The peptides: JIP1(Ac-CPTEDIYLE-COOH), JIPM1 (Ac-CPTQNIYLE-COOH), JIPM2 (Ac- CPTEDIYLQ), ALC1 (Ac-KESEMDWDDSA-COOH), and ALCM1 (Ac-SEMDWNNSA-COOH), were synthesized by Tufts University Core Facility. The peptides were mixed with buffer to a concentration of 1-3 mM. Both protein and peptides were dialyzed against the same buffer (20 mM Bis-Tris 6.5, 500mM NaCl, 0.5mM TCEP) for 18 hours using Spectra/Por cellulose ester 100-500 molecular weight cut off tubing (Spectrum Labs).

ITC was used to measure binding affinities using VP-ITC microcalorimeter (MicroCal Inc.) at 25C by injecting 5-10 L of peptide solution into the sample chamber containing the KLC. A total of 25 injections were performed with an interval of 300 seconds and a reference power of 13 μcal/s. Thermodynamic parameters and Kd were calculated using Origin (MicroCal Inc.) and the data were fit to a one-site binding model.

2.9 Structural Analysis

Visual analysis of the KLC1-TPR and KLC2-TPR structures and possible mechanism of interaction deduction was carried out using PyMOL (Schrodinger LLC). Mutated residues investigated were taken from a yeast-two hybrid study with an error prone PCR conducted by Hammond et al., and a site-directed mutagenesis study by Nguyen et al., (Hammond et al., 2008; Nguyen et al., 2005). The structural model of KLC1-TPR (PDB: 3NF1) was used for the analysis.

30 3 Results 3.1 Crystallography

3.1.1 Solubility & Expression of Constructs

A total of 52 constructs were successfully cloned and preliminary experiments were conducted to establish the best constructs for crystallization and binding experiments. Solubility and the expression level were evaluated by small-scale solubility tests. The intensity of the supernatant bands on the SDS-PAGE gel allowed us to assess the solubility whereas the intensity of the whole cell lysate was used to assess total protein expression (Fig 3.1). ALC1 had two soluble constructs (A1, A2) with both expressing the cytosolic domain (Fig 3.1A). CRMP2 had three soluble constructs, two (C1, C4) of which were near full length proteins (Fig 3.1B). Interestingly, all five Daxx constructs did not express any protein, whereas all four of the torsinA constructs were insoluble (Fig 3.1C, I). All except one construct for KIDINS220 were soluble and highly expressed (Fig 3.1E), while all of the constructs for HAP1 were highly soluble (Fig 3.1D). The HAP1 bands on the SDS-PAGE did not represent the true size of the protein. While the molecular weights of the constructs were 15-25 kDa, the bands on the SDS-PAGE gel indicated the sizes of the protein to be 30-50 kDa. However, we were able to confirm the correct protein sizes through mass-spectrometry (MS). JIP1 constructs expressing the SH2 and the PTB domain were more soluble compared to those constructs with PTB alone (Fig 3.1F). Seven constructs were soluble enough to be purified. Two of the JIP3 constructs expressing the LZD were successfully cloned and expressed (Fig 3.1G). Finally, both full length S100A6 proteins were highly expressed and soluble and contained two EF-hand motifs.

3.1.2 Purification

The constructs of CRMP2, HAP1, KIDINS220, S100A6 and JIP3, identified as candidate constructs from the solubility test were expressed and purified. All of these purified proteins were used for crystallization whereas only one construct for each protein was used for the binding studies. If similar levels of solubility were shown by more than one construct of the same protein, the construct selected for the binding studies were chosen using the following criteria; the longer construct, the construct with the vector least likely to obstruct the interaction

Figure 3.1 – Small Scale Solubility & Expression Test. Conducted for (A) ALC1, (B) CRMP2, (C) DAXX, (D) HAP1, (E) KIDINS220, (F) JIP1, (G) JIP3, (H) S100A6, (I) TorsinA. The construct code is denoted in blue and soluble constructs are highlighted by the red box. Each construct is composed of two lanes, the supernatant (“S” lane), and the whole cell lysate (“W” lane).

32 with KLC, or the protein that exhibited the least chemical modification as assessed by MS. The selected constructs were C4, H3, K2, M2, and S2 for the proteins CRMP2, HAP1, KIDINS220 JIP3, and S100A6 respectively.

The purification of ALC1 was difficult because a contaminant protein with a similar molecular weight and multiple histidines was co-expressed. This posed a problem for the immobilized metal affinity purification and size exclusion purifications. There were at least four histidines on the contaminant protein as the MS data showed four sites of -N-6-phosphogluconoylation, which is a modification that occurs in polyhistidine-tagged proteins. ALC1 also did not show strong affinity to nickel columns. These problems were overcome by skipping the washing steps of the nickel affinity column with imidazole and using a slow flow rate at 0.5 mL/min with a fraction size of 2 mL compared to the 1-2 mL/min flow rate with a fraction size of 4 mL used in the other protein purifications. The apparent molecular weight of ALC1 on the SEC was estimated to be approximately 26 kDa suggesting that ALC1 was eluted as a dimer. The A2 construct was chosen for the subsequent studies as it was the construct with the better yield.

Seven JIP1 constructs, five consisting of the SH2 and PTB domains (J1-J5) and two with only the PTB domain (J11, J12) were purified. Construct J2 in the pET28-MHL vectors showed signs of protease activity leading to fragments of smaller proteins during purification. Constructs J3-J5 in the pNIC-CH vectors had low yield after the nickel affinity chromatography and further purification was unsuccessful, even with increased amount of cell culture. Constructs J11 and J12 did not encounter any protease activity and had of high yield. However, during nickel affinity chromatography, the protein precipitated on the column when eluted. A small amount of the J11 protein was recovered from the precipitant by centrifugation. Construct J1 was the only construct with the pET28-GST vector which expresses a GST-tag, and did not have any apparent problems with solubility, proteases, and stability. Construct J1 along with J11 were the JIP1 constructs used for subsequent binding assays.

3.1.3 Detection of Protein-Protein Interaction by Size Exclusion Chromatography (SEC)

SEC can be used to detect protein-protein interaction as it helps separate molecules by size. If two proteins combined elute faster than they do alone indicating higher molecular mass, it would

33 be suggestive of a positive protein-protein interaction. Therefore, SEC was used to detect interactions between KLC1 and its cargos.

Initially, KLC1 did not interact with any of the tested cargos, as the retention volume (RV) of the KLC1-cargo protein samples were equivalent to the controls, KLC1 alone and cargo alone. With the possibility that the polyhistidine tag of the TPR domain of KLC1 may affect its interaction with cargo proteins, the polyhistidine tag was cleaved with TEV. Subsequent tests showed a reduction in RV for the KLC1-ALC1 and KLC1-Sl00A6 samples. The RV for the KLC1-ALC1 sample was 14.5 mL an earlier RV compared to the KLC1 control (16 mL) and the ALC1 control (15.5 mL) (Fig 3.2A). In the case of KLC1-S100A6, the KLC1 control eluted at 16.2 mL, and S100A6 control at 17 mL (Fig 3.2B). The complex eluted faster with an RV of 13.3 mL. The two interactions were also confirmed to contain both proteins by SDS-PAGE. An interesting pattern also emerged from the tests with KLC1-TPR and CRMP2 where the complex showed an increased RV compared to the CRMP2 control. Since it was possible the tetramer CRMP2 in the CRMP2 alone control, dissociated to a smaller monomer or dimer to bind to KLC1-TPR, the new peak was assessed by SDS-PAGE. The new peak consisted only of CRMP2, and did not contain any KLC1-TPR. Interaction of KLC1-TPR with JIP1, JIP3, and HAP1 were not detected (Fig 3.2C, D).

3.1.4 Crystallization

KLC1-TPR was set for co-crystallization trials with two synthesized peptides derived from the kinesin binding sites of ALC1 (pALC1) and JIP1 (pJIP1). Co-crystallization trials of KLC1-TPR and ALC1, CRMP2, HAP1, JIP1, and JIP3 proteins were also setup.

When a solution of KLC1-TPR with CRMP2 was set up for crystallizations, crystals were obtained from four different conditions. These four different conditions share PEG3350 as the primary precipitant, but were different in the secondary precipitants: potassium chloride (KCl), ammonium phosphate (NH4PO4), sodium iodide (NaI), and succinic acid. The crystals diffracted to 3.2 Å resolution. However, the electron density map corresponded to CRMP2 but not to KLC1, proving that the CRMP2 was crystallized alone.

34 The KLC1-TPR and ALC1 complex was set in RW and SGC crystallization screens in addition to a protein-complex optimized buffer screen. Crystallization trials of the KLC1-TPR and ALC1 complex produced crystals in the condition of 15% isopropyl alcohol, 0.2 M sodium citrate, and 0.1 M sodium cacodylate at pH 6.5. Upon screening, the diffraction pattern that of a salt.

Protein complex optimized buffer screen also did not produce high quality crystals although nucleation was evident in the formation of spherulites and needle-like precipitation in the condition 15% PEG3350, 0.1 M MgCl2, 0.1 M HEPES pH 7.0 buffer (Fig 3.2). The optimization of this condition was conducted by modifying the concentrations of PEG3350, and MgCl2, but did not yield any improvements in crystal quality.

The mixture of KLC1-TPR and pALC1 produced crystals from one condition of 20% PEG1500, 0.2 M NaCl, 0.1 M HEPES pH 7.5, and 5% glycerol. These initial crystals which were plate-like crystals, diffracted to 8 Å resolutions (Fig 3.3A). To optimize the quality of these crystals, we modified the concentrations of PEG1500 and NaCl, pH, storage temperature, protein concentrations and the ratio between protein and the well solution. As well, dehydration of the original crystals was tried to improve crystal quality. Lowering the storage temperature and changes in protein drop to buffer ratio did not produce any crystals. Lowering the PEG1500 and NaCl concentrations and a decrease in pH improved the crystal diffraction to 6.5 Å (Fig 3.3B). In addition, dehydration of the original crystals was unsuccessful. Co-crystallization of KLC1 with pJIP1 and all the cargos did not yield crystals.

3.2 Mutagenesis Binding Studies

3.2.1 Mutagenesis of KLC1-TPR

To identify key residues involved in KLC1-TPR’s interaction with its cargos, ITC was used to derive the binding characteristics of wild-type KLC1-TPR and the mutants to its cargo peptides.

The binding of wild-type KLC1-TPR to pJIP1 was observed with a dissociation constant (Kd) of 32 Mol/L (Fig 3.4A). This exothermic reaction was mostly enthalpy driven as the latter contributed -5302 cal/mol to the total change of Gibbs free energy of -5985 cal/mol. To confirm that KLC2-TPR and pJIP1 do not interact, the same experiment was conducted for those two molecules. It was evident, KLC2-TPR did not interact with pJIP1 (Fig 3.4B). To test our

sample 1 KLC control with 500ul001:10_UV sample 10 ALC and KLC001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 9 ALC control001:10_UV A mAU A280

500

400

300

200

100

1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste 0.0 5.0 10.0 15.0 20.0 ml Retention Volume sample 8 KLC control with CaCl2001:10_UV sample 6 S100A6 control with CaCl2001:10_UV sample 6 S100A6 with KLC1 with CaCl2001:10_UV sample 8 KLC control with CaCl2001:10_Fractions B mAU A280140

120

100

0 1A1 1A31A41A51A61A71A81A9 1A11 1B12 1B10 1B81B71B61B51B41B31B21B11C1 1C3 1C5 1C7 1C9 1C11 1D12 1D10 1D8 1D6 1D4 Waste 0.0 5.0 10.0 15.0 20.0 ml Retention Volume

sample 1 KLC control with 500ul001:10_UV sample 4 CRMP2 control001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 5 CRMP2 and KLC1001:10_UV C mAU A280

140

120

100

0 1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste 0.0 5.0 10.0 15.0 20.0 ml Retention Volume

DA280 sample 1 KLC control with 500ul001:10_UV sample 2 JIP3 control001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 3 JIP3 and KLC1001:10_UV mAU

120

100

1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste 0.0 5.0 10.0 15.0 20.0 ml Retention Volume

37 Figure 3.2 – Size Exclusion Chromatography Binding Assay of KLC1-TPR (Blue) and cargos (Red); (A) ALC1, (B) S100A6, (C) CRMP2, (D) JIP3,. The green peaks represent the mixture of KLC1-TPR and the respective cargo. The arrows indicate positive interaction peaks. hypothesis that asparagine 343 (N343) of KLC1-TPR and serine 328 (S328) of KLC2-TPR was responsible for the discrepancy in the binding, N343 was mutated into a serine (KLC1M1), and S328 was changed into an asparagine (KLC2M1) by site-directed mutagenesis. Upon testing the binding properties of the two mutants, KLC1M1 was unable to interact with pJIP1, whereas

KLC2M1 gained the ability to interact with pJIP1 with a Kd of 12.5 Mol/L (Fig 3.4 C).

As the peptide ALC1 was thought to behave similar to pJIP1, the same set of assays was conducted. KLC1-TPR, KLC2-TPR, and KLC1M1 proteins retained their ability to interact with pALC1 (Fig 3.4D, E). The Kd values were similar to that of pJIP1 at the micromolar range with 42 Mol/L, 68 Mol/L, and 46 Mol/L for KLC1-TPR, KLC2-TPR, and KLC1M1, respectively. Enthalpy was the driving factor for all of the reactions.

Figure 3.3 – The crystallization drop of the KLC1 and ALC1 mixture. Although no crystals were produced, there were signs of nucleation indicated by the spherulites (red circles) and needle-like precipitations (blue circle).

A B

Figure 3.4 – Crystals of KLC1 and pALC1 co-crystallizations. (A) Initial crystals from screening diffracting to 8Å (B) Crystals after optimization diffracting to 6.5 Å.

Since pALC1 resembles pJIP1 in terms of amino acid composition and was able to interact with both KLC1-TPR and KLC2-TPR, it was possible that pALC1 would use a binding site on KLC1 similar to that of N343 polar patch and a region conserved between both KLC1 and KLC2-TPR domains. Asparagine-301 (N301) of KLC1 is conserved in KLC2-TPR and its surrounding area resembles the pJIP1 binding site. Therefore a mutant KLC1 with the asparagine to alanine mutation at residue 301 (KLC1M2) was created by site directed mutagenesis. The mutation in

KLC1M2 decreased the binding affinity for pALC1 by 10 fold (Kd = 444 Mol/L) (Fig 3.4F). Taken together, N343 and N301 of KLC1 are important residues on KLC1-TPR for the interactions with pJIP1 and pALC1 respectively.

39 3.2.2 Mutagenesis of pJIP1 and pALC1

To identify the key residues of pALC1 and pJIP1involved in the interaction with KLC1- TPR, two mutants of pJIP1 and one mutant of pALC1 were studied by ITC. The pJIPM1 consisted of glutamine (Q) and asparagine mutations from the wildtype glutamic acid-706 (E706) and aspartic acid-707 (D707) respectively (703CPTEDIYLE711 703CPTQNIYLE711) (Fig 3.4G). KLC1-TPR exhibited constant heat loss from each pJIPM1 injection, which represented a loss of binding between the two molecules. pJIPM2 with the mutation of its E711 to Q711 (703CPTEDIYLE711 703CPTQNIYLQ711) was also unable to interact with KLC1-TPR.

To study the role of the aspartic residues of ALC1 in KLC1-TPR binding, the pALCM1 was synthesized with the aspartic acids replaced into asparagines (899SEMDWDDSA907  899SEMDWNNSA907). The mutations eradicated the interaction between the pALCM1 with KLC1-TPR (Fig 3.4H). Together, the importance of the negatively charged acidic residues in KLC1-TPRs cargos was confirmed.

A B

C D

E F

G H

42 Figure 3.4 – Isothermal titration calorimetry data showing (A) interaction between KLC1-TPR and pJIP1, (B) no interaction between KLC2-TPR and pJIP1, (C) no interaction between KLCM1(N343S) and pJIP1, (D) interaction between KLC1-TPR and pALC1, (E) interaction between KLCM1 and pALC1, (F interaction between KLCM2(N301A) and pALC1, (G)no interaction between KLC1-TPR and pJIPM1, (H) no interaction between KLC1-TPR and pALCM1

3.3 Structural Analysis

3.3.1 Mapping of the JIP3 and JIP4 binding site

The KLC1-TPR structure, which was the work of a colleague in the lab, allowed us to map residues that have previously been identified to be important in the interaction with JIP3 and JIP4. There are two known sets of mutations on KLC1-TPR that decreased its binding affinity to JIP3/4.

First, a set of leucine/valine residues of KLC1 that affect binding to JIP3/4 is located in helix-B of TPR2 (L280, L287) and helix-A of TPR3 (V294, L301), forming inter-TPR2/3 hydrophobic interactions. None of these side chains are exposed to solvent for interaction with JIP3 and JIP4, instead their importance lies in maintaining the structural integrity of the TPR domain.

The second set of mutations that specifically affect the binding of KLC1 to JIP3 consists of R214H, G227W, A232T, R310H, L319M, and D334N. The G227 and R310 residues are located in the intra-TPR loops in TPR1 and TPR3, respectively. Located in helix-B of TPR 1 and TPR3 are A232 and L319, both with their side chains hidden away in the crevices of the outer surface. Finally, R214 located in helix-A of TPR1 has its side chain extending to the outer surface of the TPR domain. A similar pattern was observed with D334 as it was located in the inter-TPR loop between TPRs’ 3 and 4. From the structural analysis of these mutations, it is probable that most of these residues do not play a role in the KLC1-TPR and JIP3/4 binding, but two possible candidates, R214 and D334, stand out as the residues most likely to be important in the interaction.

4 Discussion 4.1 X-ray Crystallography

4.1.1 Cloning, Expression & Purification of Proteins

The cargo constructs were designed on the basis of what was known about the protein, and the domains that were involved in KLC1-TPR binding. For our crystallography experiments, we used a high throughput approach by designing multiple constructs for each protein and putting them through the same initial protocol to find the best construct. Designing constructs requires a combination of secondary structure and domain prediction, and examining sequence alignments of homologues that yielded soluble constructs. Even with that, there are still hurdles in expressing human proteins in E.coli. However, by using multi-construct approach we quickly found soluble constructs for most of our proteins from a single cycle of high-throughput cloning and small scale solubility tests. Despite the success, all of the torsinA constructs proved to be insoluble. This may have resulted from protein misfolding due to the lack of human chaperone proteins in an E.coli cell. Alternatively, there may be conditions under which these proteins could be soluble that were not used in our conditions. To make cloning and cell culture more efficient, we used the same expression host, vectors, T7 promoter system, and culture growing conditions (e.g. – IPTG concentration, temperature, time of induction). This might not have been the best condition for torsinA. The expression of torsinA could be improved by the use of mammalian expression host, as the rare codon analysis for the torsinA gene reveal poor codon adaptation index and a high rate of unoptimized codons for the E.coli expression host.

4.1.2 KLC1-TPR interacts with ALC1 and S100A6

Using size-exclusion chromatography, KLC1-TPR binding to its cargo was confirmed. Furthermore, identification of complex formation by the column allowed us to collect homogeneous complexes of two proteins. Our initial inability to see binding between KLC1-TPR and its cargos proved to be the result of inhibition by polyhistidine-tag on the KLC1-TPR. Only after the polyhistidine-tag was removed by TEV protease, KLC1-TPR showed the ability to interact with some of its cargos. Our KLC1-TPR structure was solved with the tag which showed that the polyhistidine-tag and its linker were blocking the inner groove from being exposed from

44 the top (Fig 4.1). The polyhistidine-tag and its linker covered TPR1 to TPR3, leaving only TPR4-6 exposed. Once the polyhistidine-tag was removed, we were able to confirm that KLC1- TPR interacted with the cytosolic domain of ALC1 at a 2:1 ratio of ALC1 to KLC1-TPR, as previously suggested (Konecna et al., 2006).

Unfortunately, only two of the six cargo proteins were able to interact with KLC1-TPR in the SEC binding assay. We believe that several unaccounted factors could explain why majority of the cargo proteins did not interact with KLC1-TPR. First, our KLC1-TPR construct only contains the TPR-domain of KLC1 which spans from residues 227 to 495. On the other hand, experiments that found the cargo interactions with the KLC1 TPR domain included the C- terminal ends of KLC1. This discrepancy may explain the undetectable interaction between KLC1-TPR and the CRMP2 (Kawano et al., 2005). It has been shown that the cargos that bind to the TPR domain may also require a specific splice variant. The splice variants are formed in the C-terminal end of KLC1 and in the case of torsinA, it is only able to interact with KLC1B and KLC1C isoforms.

Secondly, the purified cargo proteins may not have had correct structural folds. GST-tagged JIP1 (construct J1) may have been misfolded as it is sometimes the case with GST-tagged proteins. Also, one of the JIP1 constructs (construct J11) was the soluble recovery portion of a precipitated protein. As such, this sample may not have had the correct fold either.

However, these factors do not explain the undetectable interaction between JIP3 and KLC1-TPR. JIP3 does not require the C-terminal end of KLC1 and did not have obvious sign of misfolded protein. In such case, we believe the assay conditions that we used may not have been optimal for JIP3 and KLC1-TPR. Assay conditions such as, salt concentrations, temperature, and pH are important parameters for protein-protein interactions. There were limited efforts to optimize these conditions as we only tested different salt concentrations, with the temperature constantly kept at 4C to keep the proteins stable. Therefore, it is quite possible that the conditions used to test the interactions were not optimal conditions for protein-protein interactions. Finally, SEC binding assay itself does not have high resolution and is not one of the most common methods in

Figure 4.1 – The polyhistidine-tag linker blocking the groove of KLC1-TPR (PDB: 3NF1). The polyhistidine-tag linker (Blue) extends throughout TPR1-3 blocking the entrance to the groove of KLC1-TPR (Orange).

detecting protein-protein interactions (Mayer et al., 2009). One reason is that SEC employs a large volume of solution and decreases the protein concentration which can hinder the detection of protein interactions with low affinity. However, we required an assay with minimal modifications to our cloned constructs to use it for x-ray crystallography, and our preliminary tests found nickel pull down assays unsuitable as KLC1-TPR actively bound to nickel-beads.

46 4.2 Mechanism of Interaction by KLC1-TPR

4.2.1 KLC1-TPR Interaction Interface

From the ITC results, N343 of KLC1-TPR is a crucial residue in the interaction with pJIP1. To understand the possible role of N343, we inspected the KLC1-TPR structure. The N343, located on helix-A of TPR4, extend towards its neighbouring N386 of TPR5 at a distance of 3.6Å (Fig 4.2A). These two asparagines, N343 and N386 may form an “asparagine clamp” as it was the case for the HOP1-Hsc70 interaction. Upon closer inspection, the two asparagines were surrounded by positively charged lysines creating a highly positive and polar patch (Fig 4.3C). On the other hand, S328 of KLC2, which has a shorter side chain than the corresponding N343 of KLC1, cannot interact with N364 of TPR5 to form an asparagine clamp (Fig 4.2B). The corresponding KLC2-TPR polar patch also contains lysines but since the S328 and N364 are too far apart, it may not form a tight enough “clamp” rendering the polar patch insufficient in interacting with pJIP1 (Fig 4.3D). This result is supported by a yeast two- hybrid analysis, where a set of simultaneous site-directed mutations of N218A, N259A, N301A, N302A, N343A, and N344A inhibited KLC1-TPR and JIP1 interaction supporting that N343 is the residue required for the interaction with JIP1(Hammond et al., 2008).

In addition to the fact that ALC1 and JIP1 have similar sequences that interact with KLC1, these two cargos are known to compete for the KLC1 interaction. Therefore the two cargos may utilize a similar mechanism of interaction for KLC1. Our findings indicate that N301 is involved in ALC1 binding and not N343, whereas N343 of KLC1-TPR is involved in JIP1 interaction. This suggests that the competition between ALC1 and JIP1 arise due to steric hindrance of one protein binding to KLC1 and not because they share the same exact binding interface. Recent studies have shown that phosphorylation of S460 decreases the binding affinity of KLC1 for ALC1 (Vagnoni et al., 2011). S460 is located at the junction of TPR6 and the non-TPR helix in KLC1 and conserved in KLC2. We believe that the non-TPR helix plays a role in keeping TPR5 and TPR6 in close proximity in both KLC1 and KLC2. Together, it is possible that ALC1 may simultaneously bind to the polar patch near N301 of KLC1-TPR and to the TPR 5 and 6. Thus, the binding site would extend throughout the groove of KLC1-TPR. It is tempting to speculate

Figure 4.2 – Structural insight into the environment of N343 of KLC1- TPR (orange) (PDB: 3NF1) and S328 of KLC2-TPR (green) (PDB: 3CEQ). (A) N343 forms a “clamp” with N386 (B) S328 is too distant from N371, unable to form a “clamp”, comparison of the (C) N343 centered polar patch of KLC1, and (D) S328 centered polar patch of KLC2.

48 that this is the reason behind the competition between ALC1 and JIP1 interaction for KLC1. ALC1 binding to KLC1 would cross over N343 creating hindrance for JIP1 whereas JIP1 bound KLC1 would not allow the ALC1 to bind to the N301 polar patch and TPR 5 and 6 simultaneously.

We did not investigate the mechanism of interaction between KLC1-TPR and S100A6 through mutagenesis binding studies. However, S100A6 can interact with the HOP TPR domain and KLC1-TPR, while inhibiting the KLC1-JIP1 interaction (Shimamoto et al., 2008). From this, S100A6 may bind to the “asparagine clamp” of KLC1-TPR which is also conserved in the HOP TPR domain. Our structural observation of S100A6 (PDB: 1K96) has led us to speculate that the interaction may take place near the loop region of the first EF hand motif of S100A6 (Otterbein et al., 2002). Considering that this loop region is the only place on S100A6 ith aromatic and negatively charged side chains facing the same side, this site would be a good candidate for the interaction with KLC1 (Fig 4.3).

Figure 4.3 – The structure of S100A6 (PDB: 1K96) and the possible site of interaction with KLC1-TPR. The first helix-loop-helix motif of EF-hand has aromatic (Y19) and negatively charged residues (E33, E36, E41) on the same face.

49 4.2.2 Negatively Charged Residues in ALC1 and JIP1 are Essential in KLC1-TPR Binding

Aromatic residues, tyrosine 709 (Y709) in JIP1 and tryptophan 903 (W903) or tryptophan 975 (W975) of ALC1 are known to be an integral part of the KLC1-cargo interaction (Konecna et al., 2006; Verhey et al., 2001). These aromatic residues of the cargos are flanked by negatively charged glutamic and aspartic acid residues. Our results have shown that the negatively charged residues are also essential in the KLC1-cargo interaction as indicated by the lack of interaction of the mutant ALC1 and JIP1 peptides for KLC1-TPR. Overall, the inner groove of KLC1-TPR is highly positive, and the polar patches of N301 and N343 are surrounded by lysines (Fig 4.4). Although it is highly speculative, we propose that long-range electrostatic interaction brings the negative residues on the cargos to the lysines on KLC1-TPR which then also allows the Y709 of JIP1 and W903/W975 of ALC1 to interact with their respective clamps on KLC1-TPR.

Figure 4.4 – Electrostatic potential of KLC1-TPR. The positively charged inner groove (blue) and the negatively charged hot spots on the outer surface (red) are quite evident. The figure was generated by the DelPhi which evaluates the electrostatic potential by Poisson-Boltzmann equation (Honig & Nicholls, 1995).

4.2.3 N343 Polar Patch versus N301 Polar Patch

In an attempt to understand how the two suggested polar patches achieve their specificity, sequence and structural alignments were performed. The N301 polar patch is created by TPR

50 repeats 3 and 4 (residues 294-350) whereas N343 polar patch is created by TPR repeats 4 and 5 (residues 336-392). Sequence alignment of the residues reveals several differences in helix-B whereas only one major difference exists in the polar patch forming helix-A. N301 polar patch contains an alanine where N343 polar patch has a lysine. However, difference of one residue near the polar patch does not fully explain the specificity exhibited by the two polar patches. A structural analysis revealed that the asparagine clamp of N343 was much tighter in comparison to the clamp of N301. The distance between the two asparagines in N343 was 3.6 Å, while the same clamp in N301 was 5.7 Å apart (Fig 4.5). This result coincides with our speculation that the aromatic residues interact with the asparagine clamps, as the indole ring in the tryptophan of ALC1 is larger than the phenol ring in the tyrosine of JIP1. Collectively, this may explain the specificity between N301 and N343 polar patches.

4.3 Structural Analysis

4.3.1 Mapping of the JIP3 binding site – Putative Binding Site #3

Through mutation mapping, we were able to identify the locations of mutations that were previously found to be important in KLC1-TPR and JIP3/4 interaction (Hammond et al., 2008; Nguyen et al., 2005). The amino acids in the first set of mutations consisting of leucine/valine are unlikely to interact with JIP3 and JIP4 as their side chains are pushed in towards the crevices by hydrophobic interactions. Hammond et al., have also suggested that these residues are important for the helix-packing and that they are of structural support and not the residues involved in the JIP3/4 binding. The second set of mutations that decreased the affinity of KLC1- TPR and JIP3 interaction consisted of R214, G227, A232, R310, L319, and D334 residues (Hammond et al., 2008). From our analysis, we believe that D334 and R214 are the residues involved in the direct binding of JIP3. This is because A232 and L319 have their aliphatic sidechains away from solvent and are embedded within the crevices the TPR domain. Also, it is unlikely that G227 and R310 residues in the intra-TPR loops are involved in the direct binding, as previous sets of mutations of the intra-TPR loop including the R310 residue had no effect in KLC1-JIP3 interaction. Interestingly, the location of R214 and D334 are the outer surface residues that p67phox used to interact with Rac-1, suggesting that that these residues are good candidates of direct binding involved in KLC1-JIP3/4 interaction.

A298 K340

N301

N343

N344

N386

Figure 4.5 – Structural alignment of N301 polar patch to N343 polar patch. Differences in residues show an alanine (cyan) for N301 polar patch and lysine (orange) for N343 polar patch. The distance between the “clamp” is greater by 2 Å in the N301 polar patch.

This proposed interaction between KLC1 and JIP3/4 mirrors that of adenosine diphosphate- ribosylation factor 6 (ARF6) and JIP4 since both the KLC1 TPR domain and ARF6 interact with the LZDs of JIP3 and JIP4. More importantly, ARF6 inhibits the binding of KLC1-TPR to JIP3 or JIP4 by interacting with the leucine zipper domain of JIP3/4. The interactions between ARF6 and JIP-LZD involve around an elongated network of hydrogen bonds. Similarly, D334 of KLC1 and some of the polar inter-TPR loops of KLC1 can provide an elongated network of polar residues for hydrogen bond interactions with the LZDs of JIP3 and JIP4 as it was evident in the structural alignment of KLC1-TPR and p67phox-TPR.

52 4.4 Limitations

JIP1 proteins were difficult to obtain at sufficient concentrations and with the correct structural fold. To overcome this problem, JIP1 peptides were used to identify the mechanism of interaction and ALC1 peptides were also used to maintain consistency throughout the mutagenesis binding studies. However, it is unknown whether the peptides are sufficient enough to provide all of the binding to KLC1-TPR? It is certain that the peptides do not fully mimic the proteins activity and are only an approximate of the protein. To investigate this possible limitation, we conducted an ITC experiment with KLC1 and ALC1 proteins to identify possible differences between the peptide and protein. We found that the protein-protein interaction did have a higher affinity with a Kd of 1.94Mol/L, an increase from 41 Mol/L seen with the pALC1. However, ALC1 contains two stretches of the kinesin binding site from 891-900 and 962-971 whereas the peptide only contains one of these stretches per molecule. Technically, this translates into a two-fold decrease in the Kd for ALC1 compared to pALC1. However, the two motifs are in close proximity and one could argue that when one stretch is bound, the other motif is in close proximity to also bind. This in turn increases the “local concentration”, contributing to the decrease in the Kd. These additional effects in the Kd may explain the discrepancy between the peptides and proteins. Even if these additional effects do not fully explain the difference, we believe this limitation does not affect the integrity of our results as our objective was to find the mechanism of interaction and the peptides had sufficient capacity to discriminate the mutations on KLC1.

53 5 Summary

To understand the mechanism of cargo interaction and recognition of KLC TPR domains, we explored several interfaces of KLC1. We propose that the KLC1 has at least three possible interfaces, two of which are located in the groove, and one in the outer surface loops of KLC1- TPR. Despite the fact that we were unable to obtain a structure of the KLC1-Cargo complex, we believe that the N343 polar patch and the N301 polar patch are required to interact with JIP1 and ALC1, respectively.

We believe one feature of KLC-TPR that allows it to interact with a number of different cargos comes from its larger than normal TPR domain. With six repeats and one extra helix on every turn, the surface and the groove provides a large interface for interaction. Also, KLC1-TPR is not limited to the two polar patches that were important in JIP1 and ALC1 binding. Another patch exists between TPR5 and TPR6 which could possibly accommodate other cargo proteins.

Although for now we failed to come up with a structural model of the KLC1-cargo complex, there is potential in co-crystallization of KLC1-ALC1 complex as it did show signs of nucleation. However, the C-terminal domain of KLC1, which is important for several of the cargo binding, will have to be incorporated into future constructs. Our preliminary tests of constructs that included C-terminal part of KLC1 showed little stability and solubility. This will have to be overcome through different vectors and/or cell lines which can accommodate the expression of KLC1 with the C-terminal domain. Another future direction would involve analyses of tripartite complexes as KLC1-JIP1-APP is transported together while ALC1-X11L- APP stabilizes APP together. The structures of these complexes would provide invaluable information about ALC1-JIP1 competition and in-depth information about kinesin-1 mediated axonal transport of APP.

References

Andersson, M. E., Sjolander, A., Andreasen, N., Minthon, L., Hansson, O., Bogdanovic, N., Jern, C., Jood, K., Wallin, A., Blennow, K., & Zetterberg, H. Kinesin gene variability may affect tau phosphorylation in early Alzheimer's disease. Int J Mol Med, 20(2): 233- 239.(2007). Andersson, M. E., Zetterberg, M., Tasa, G., Seibt-Palmer, M., Juronen, E., Teesalu, P., Blennow, K., & Zetterberg, H. Variability in the kinesin light chain 1 gene may influence risk of age-related cataract. Mol Vis, 13: 993-996.(2007). Araki, Y., Miyagi, N., Kato, N., Yoshida, T., Wada, S., Nishimura, M., Komano, H., Yamamoto, T., De Strooper, B., Yamamoto, K., & Suzuki, T. Coordinated metabolism of Alcadein and amyloid beta-protein precursor regulates FE65-dependent gene transactivation. J Biol Chem, 279(23): 24343-24354.(2004). Beitner-Johnson, D., & Nestler, E. J. Chronic morphine impairs axoplasmic transport in the rat mesolimbic dopamine system. Neuroreport, 5(1): 57-60.(1993). Blatch, G. L., & Lassle, M. The tetratricopeptide repeat: a structural motif mediating protein- protein interactions. Bioessays, 21(11): 932-939.(1999). Blundell, T. L., & Johnson, L. (1976). Protein Crystallography. New York: Academic Press. Byk, T., Ozon, S., & Sobel, A. The Ulip family phosphoproteins--common and specific properties. Eur J Biochem, 254(1): 14-24.(1998). Cavalli, V., Kujala, P., Klumperman, J., & Goldstein, L. S. Sunday Driver links axonal transport to damage signaling. J Cell Biol, 168(5): 775-787.(2005). Caviston, J. P., & Holzbaur, E. L. Huntingtin as an essential integrator of intracellular vesicular trafficking. Trends Cell Biol, 19(4): 147-155.(2009). Coleman, M. Axon degeneration mechanisms: commonality amid diversity. Nat Rev Neurosci, 6(11): 889-898.(2005). Coy, D. L., Hancock, W. O., Wagenbach, M., & Howard, J. Kinesin's tail domain is an inhibitory regulator of the motor domain. Nat Cell Biol, 1(5): 288-292.(1999). Cui, J., Wang, Z., Cheng, Q., Lin, R., Zhang, X. M., Leung, P. S., Copeland, N. G., Jenkins, N. A., Yao, K. M., & Huang, J. D. Targeted inactivation of kinesin-1 in pancreatic beta-cells in vivo leads to insulin secretory deficiency. Diabetes, 60(1): 320-330.(2011). D'Andrea, L. D., & Regan, L. TPR proteins: the versatile helix. Trends Biochem Sci, 28(12): 655-662.(2003). Das, A. K., Cohen, P. W., & Barford, D. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. Embo J, 17(5): 1192-1199.(1998). De Vos, K. J., Grierson, A. J., Ackerley, S., & Miller, C. C. Role of axonal transport in neurodegenerative diseases. Annu Rev Neurosci, 31: 151-173.(2008).

55 Dhaenens, C. M., Van Brussel, E., Schraen-Maschke, S., Pasquier, F., Delacourte, A., & Sablonniere, B. Association study of three polymorphisms of kinesin light-chain 1 gene with Alzheimer's disease. Neurosci Lett, 368(3): 290-292.(2004). Diefenbach, R. J., Diefenbach, E., Douglas, M. W., & Cunningham, A. L. The heavy chain of conventional kinesin interacts with the SNARE proteins SNAP25 and SNAP23. Biochemistry, 41(50): 14906-14915.(2002). Diefenbach, R. J., Miranda-Saksena, M., Diefenbach, E., Holland, D. J., Boadle, R. A., Armati, P. J., & Cunningham, A. L. Herpes simplex virus tegument protein US11 interacts with conventional kinesin heavy chain. J Virol, 76(7): 3282-3291.(2002). Dixit, R., Ross, J. L., Goldman, Y. E., & Holzbaur, E. L. Differential regulation of dynein and kinesin motor proteins by tau. Science, 319(5866): 1086-1089.(2008). Dong, H., O'Brien, R. J., Fung, E. T., Lanahan, A. A., Worley, P. F., & Huganir, R. L. GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors. Nature, 386(6622): 279-284.(1997). Du, J., Wei, Y., Liu, L., Wang, Y., Khairova, R., Blumenthal, R., Tragon, T., Hunsberger, J. G., Machado-Vieira, R., Drevets, W., Wang, Y. T., & Manji, H. K. A kinesin signaling complex mediates the ability of GSK-3beta to affect mood-associated behaviors. Proc Natl Acad Sci U S A, 107(25): 11573-11578.(2010). Dumont, A., Boucrot, E., Drevensek, S., Daire, V., Gorvel, J. P., Pous, C., Holden, D. W., & Meresse, S. SKIP, the host target of the Salmonella virulence factor SifA, promotes kinesin-1-dependent vacuolar membrane exchanges. Traffic, 11(7): 899-911.(2010). Dutta, S., & Tan, Y. J. Structural and functional characterization of human SGT and its interaction with Vpu of the human immunodeficiency virus type 1. Biochemistry, 47(38): 10123-10131.(2008). Ertekin-Taner, N. Genetics of Alzheimer's disease: a centennial review. Neurol Clin, 25(3): 611- 667, v.(2007). Falzone, T. L., Stokin, G. B., Lillo, C., Rodrigues, E. M., Westerman, E. L., Williams, D. S., & Goldstein, L. S. Axonal stress kinase activation and tau misbehavior induced by kinesin-1 transport defects. J Neurosci, 29(18): 5758-5767.(2009). Gatto, G. J., Jr., Geisbrecht, B. V., Gould, S. J., & Berg, J. M. Peroxisomal targeting signal-1 recognition by the TPR domains of human PEX5. Nat Struct Biol, 7(12): 1091- 1095.(2000). Gauthier, L. R., Charrin, B. C., Borrell-Pages, M., Dompierre, J. P., Rangone, H., Cordelieres, F. P., De Mey, J., MacDonald, M. E., Lessmann, V., Humbert, S., & Saudou, F. Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules. Cell, 118(1): 127-138.(2004). Gindhart, J. G. Towards an understanding of kinesin-1 dependent transport pathways through the study of protein-protein interactions. Brief Funct Genomic Proteomic, 5(1): 74-86.(2006). Granata, A., Schiavo, G., & Warner, T. T. TorsinA and dystonia: from nuclear envelope to synapse. J Neurochem, 109(6): 1596-1609.(2009). Grove, T. Z., Cortajarena, A. L., & Regan, L. Ligand binding by repeat proteins: natural and designed. Curr Opin Struct Biol, 18(4): 507-515.(2008).

56 Hammond, J. W., Griffin, K., Jih, G. T., Stuckey, J., & Verhey, K. J. Co-operative versus independent transport of different cargoes by Kinesin-1. Traffic, 9(5): 725-741.(2008). Hirokawa, N. The mechanisms of fast and slow transport in neurons: identification and characterization of the new kinesin superfamily motors. Curr Opin Neurobiol, 7(5): 605- 614.(1997). Hirokawa, N., & Noda, Y. Intracellular transport and kinesin superfamily proteins, KIFs: structure, function, and dynamics. Physiol Rev, 88(3): 1089-1118.(2008). Hirokawa, N., Noda, Y., Tanaka, Y., & Niwa, S. Kinesin superfamily motor proteins and intracellular transport. Nat Rev Mol Cell Biol, 10(10): 682-696.(2009). Holm, L., & Park, J. DaliLite workbench for protein structure comparison. Bioinformatics, 16(6): 566-567.(2000). Honig, B., & Nicholls, A. Classical electrostatics in biology and chemistry. Science, e(5214): 1144-1149.(1995). Horiuchi, D., Collins, C. A., Bhat, P., Barkus, R. V., Diantonio, A., & Saxton, W. M. Control of a kinesin-cargo linkage mechanism by JNK pathway kinases. Curr Biol, 17(15): 1313- 1317.(2007). Huang, S. H., Duan, S., Sun, T., Wang, J., Zhao, L., Geng, Z., Yan, J., Sun, H. J., & Chen, Z. Y. JIP3 Mediates TrkB Axonal Anterograde Transport and Enhances BDNF Signaling by Directly Bridging TrkB with Kinesin-1. J Neurosci, 31(29): 10602-10614.(2011). Inagaki, N., Chihara, K., Arimura, N., Menager, C., Kawano, Y., Matsuo, N., Nishimura, T., Amano, M., & Kaibuchi, K. CRMP-2 induces axons in cultured hippocampal neurons. Nat Neurosci, 4(8): 781-782.(2001). Junco, A., Bhullar, B., Tarnasky, H. A., & van der Hoorn, F. A. Kinesin light-chain KLC3 expression in testis is restricted to spermatids. Biol Reprod, 64(5): 1320-1330.(2001). Kabbaj, M., Evans, S., Watson, S. J., & Akil, H. The search for the neurobiological basis of vulnerability to drug abuse: using microarrays to investigate the role of stress and individual differences. Neuropharmacology, 47 Suppl 1: 111-122.(2004). Kajander, T., Cortajarena, A. L., Mochrie, S., & Regan, L. Structure and stability of designed TPR protein superhelices: unusual crystal packing and implications for natural TPR proteins. Acta Crystallogr D Biol Crystallogr, 63(Pt 7): 800-811.(2007). Kamal, A., Almenar-Queralt, A., LeBlanc, J. F., Roberts, E. A., & Goldstein, L. S. Kinesin- mediated axonal transport of a membrane compartment containing beta-secretase and presenilin-1 requires APP. Nature, 414(6864): 643-648.(2001). Kawano, Y., Yoshimura, T., Tsuboi, D., Kawabata, S., Kaneko-Kawano, T., Shirataki, H., Takenawa, T., & Kaibuchi, K. CRMP-2 is involved in kinesin-1-dependent transport of the Sra-1/WAVE1 complex and axon formation. Mol Cell Biol, 25(22): 9920- 9935.(2005). Konecna, A., Frischknecht, R., Kinter, J., Ludwig, A., Steuble, M., Meskenaite, V., Indermuhle, M., Engel, M., Cen, C., Mateos, J. M., Streit, P., & Sonderegger, P. Calsyntenin-1 docks vesicular cargo to kinesin-1. Mol Biol Cell, 17(8): 3651-3663.(2006). Lamb, J. R., Tugendreich, S., & Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci, 20(7): 257-259.(1995).

57 Ling, S. C., Fahrner, P. S., Greenough, W. T., & Gelfand, V. I. Transport of Drosophila fragile X mental retardation protein-containing ribonucleoprotein granules by kinesin-1 and cytoplasmic dynein. Proc Natl Acad Sci U S A, e(50): 17428-17433.(2004). Lippincott-Schwartz, J., Cole, N. B., Marotta, A., Conrad, P. A., & Bloom, G. S. Kinesin is the motor for microtubule-mediated Golgi-to-ER membrane traffic. J Cell Biol, 128(3): 293- 306.(1995). Maney, T., Hunter, A. W., Wagenbach, M., & Wordeman, L. Mitotic centromere-associated kinesin is important for anaphase chromosome segregation. J Cell Biol, 142(3): 787- 801.(1998). Mayer, C. L., Snyder, W. K., Swietlicka, M. A., Vanschoiack, A. D., Austin, C. R., & McFarland, B. J. Size-exclusion chromatography can identify faster-associating protein complexes and evaluate design strategies. BMC Res Notes, 2: 135.(2009). McGowan, E., Eriksen, J., & Hutton, M. A decade of modeling Alzheimer's disease in transgenic mice. Trends Genet, 22(5): 281-289.(2006). Miki, H., Setou, M., & Hirokawa, N. Kinesin superfamily proteins (KIFs) in the mouse transcriptome. Genome Res, 13(6B): 1455-1465.(2003). Miyamoto, Y., Muto, E., Mashimo, T., Iwane, A. H., Yoshiya, I., & Yanagida, T. Direct inhibition of microtubule-based kinesin motility by local anesthetics. Biophys J, 78(2): 940-949.(2000). Mountjoy, C. Q., Roth, M., Evans, N. J., & Evans, H. M. Cortical neuronal counts in normal elderly controls and demented patients. Neurobiol Aging, 4(1): 1-11.(1983). Nakata, T., & Hirokawa, N. Point mutation of adenosine triphosphate-binding motif generated rigor kinesin that selectively blocks anterograde lysosome membrane transport. J Cell Biol, 131(4): 1039-1053.(1995). Nangaku, M., Sato-Yoshitake, R., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., & Hirokawa, N. KIF1B, a novel microtubule plus end-directed monomeric motor protein for transport of mitochondria. Cell, 79(7): 1209-1220.(1994). Nguyen, Q., Lee, C. M., Le, A., & Reddy, E. P. JLP associates with kinesin light chain 1 through a novel leucine zipper-like domain. J Biol Chem, 280(34): 30185-30191.(2005). Niclas, J., Navone, F., Hom-Booher, N., & Vale, R. D. Cloning and localization of a conventional kinesin motor expressed exclusively in neurons. Neuron, 12(5): 1059- 1072.(1994). Okada, Y., Takeda, S., Tanaka, Y., Belmonte, J. C., & Hirokawa, N. Mechanism of nodal flow: a conserved symmetry breaking event in left-right axis determination. Cell, 121(4): 633- 644.(2005). Otterbein, L. R., Kordowska, J., Witte-Hoffmann, C., Wang, C. L., & Dominguez, R. Crystal structures of S100A6 in the Ca(2+)-free and Ca(2+)-bound states: the calcium sensor mechanism of S100 proteins revealed at atomic resolution. Structure, 10(4): 557- 567.(2002). Rong, J., Li, S., Sheng, G., Wu, M., Coblitz, B., Li, M., Fu, H., & Li, X. J. 14-3-3 protein interacts with Huntingtin-associated protein 1 and regulates its trafficking. J Biol Chem, 282(7): 4748-4756.(2007).

58 Scheufler, C., Brinker, A., Bourenkov, G., Pegoraro, S., Moroder, L., Bartunik, H., Hartl, F. U., & Moarefi, I. Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70-Hsp90 multichaperone machine. Cell, 101(2): 199-210.(2000). Sickles, D. W., Brady, S. T., Testino, A., Friedman, M. A., & Wrenn, R. W. Direct effect of the neurotoxicant acrylamide on kinesin-based microtubule motility. J Neurosci Res, 46(1): 7-17.(1996). Stamer, K., Vogel, R., Thies, E., Mandelkow, E., & Mandelkow, E. M. Tau blocks traffic of organelles, neurofilaments, and APP vesicles in neurons and enhances oxidative stress. J Cell Biol, 156(6): 1051-1063.(2002). Stokin, G. B., Lillo, C., Falzone, T. L., Brusch, R. G., Rockenstein, E., Mount, S. L., Raman, R., Davies, P., Masliah, E., Williams, D. S., & Goldstein, L. S. Axonopathy and transport deficits early in the pathogenesis of Alzheimer's disease. Science, 307(5713): 1282- 1288.(2005). Su, Q., Cai, Q., Gerwin, C., Smith, C. L., & Sheng, Z. H. Syntabulin is a microtubule-associated protein implicated in syntaxin transport in neurons. Nat Cell Biol, 6(10): 941-953.(2004). Suzuki, T., Araki, Y., Yamamoto, T., & Nakaya, T. Trafficking of Alzheimer's disease-related membrane proteins and its participation in disease pathogenesis. J Biochem, 139(6): 949- 955.(2006). Szolnoki, Z., Kondacs, A., Mandi, Y., & Somogyvari, F. Evaluation of the roles of the A185C and C406T kinesin light-chain 1 variants in the development of leukoaraiosis. Neurosci Lett, 429(2-3): 101-104.(2007a). Szolnoki, Z., Kondacs, A., Mandi, Y., & Somogyvari, F. A genetic variant in cytoskeleton motors amplifies susceptibility to leukoaraiosis in hypertensive smokers: gene- environmental interactions behind vascular white matter demyelinization. J Mol Neurosci, 33(2): 173-179.(2007b). Tekotte, H., & Davis, I. Intracellular mRNA localization: motors move messages. Trends Genet, 18(12): 636-642.(2002). Terwel, D., Dewachter, I., & Van Leuven, F. Axonal transport, tau protein, and neurodegeneration in Alzheimer's disease. Neuromolecular Med, 2(2): 151-165.(2002). Turner, P. R., O'Connor, K., Tate, W. P., & Abraham, W. C. Roles of amyloid precursor protein and its fragments in regulating neural activity, plasticity and memory. Prog Neurobiol, 70(1): 1-32.(2003). Vagnoni, A., Rodriguez, L., Manser, C., De Vos, K. J., & Miller, C. C. Phosphorylation of kinesin light chain 1 at serine 460 modulates binding and trafficking of calsyntenin-1. J Cell Sci, 124(Pt 7): 1032-1042.(2011). Varadi, A., Ainscow, E. K., Allan, V. J., & Rutter, G. A. Involvement of conventional kinesin in glucose-stimulated secretory granule movements and exocytosis in clonal pancreatic beta-cells. J Cell Sci, 115(Pt 21): 4177-4189.(2002). Verhey, K. J., Kaul, N., & Soppina, V. Kinesin assembly and movement in cells. Annu Rev Biophys, 40: 267-288.(2011). Verhey, K. J., Meyer, D., Deehan, R., Blenis, J., Schnapp, B. J., Rapoport, T. A., & Margolis, B. Cargo of kinesin identified as JIP scaffolding proteins and associated signaling molecules. J Cell Biol, 152(5): 959-970.(2001).

59 von Otter, M., Landgren, S., Nilsson, S., Lundvall, C., Minthon, L., Bogdanovic, N., Andreasen, N., Gustafson, D. R., Skoog, I., Wallin, A., Hakansson, A., Nissbrandt, H., Zetterberg, M., Tasa, G., Blennow, K., & Zetterberg, H. Kinesin light chain 1 gene haplotypes in three conformational diseases. Neuromolecular Med, 12(3): 229-236.(2009). Ward, B. M., & Moss, B. Vaccinia virus A36R membrane protein provides a direct link between intracellular enveloped virions and the microtubule motor kinesin. J Virol, 78(5): 2486- 2493.(2004). Wozniak, M. J., & Allan, V. J. Cargo selection by specific kinesin light chain 1 isoforms. Embo J, 25(23): 5457-5468.(2006). Wyszynski, M., Valtschanoff, J. G., Naisbitt, S., Dunah, A. W., Kim, E., Standaert, D. G., Weinberg, R., & Sheng, M. Association of AMPA receptors with a subset of glutamate receptor-interacting protein in vivo. J Neurosci, 19(15): 6528-6537.(1999).