DOCSLIB.ORG

Environmental DNA Sampling Provides New Management Strategies for Vernal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Environmental DNA Sampling Provides New Management Strategies for Vernal bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 1 2 3 4 Environmental DNA sampling provides new management strategies for vernal 5 pool branchiopods in California 6 7 Shannon Rose Kieran1*, Joshua Hull2, Amanda Finger1 8 9 10 11 1Department of Animal Science, University of California, Davis, Davis, California, USA 12 2Sacramento Fish and Wildlife Office, United States Fish and Wildlife Service, Sacramento, 13 California, USA 14 15 16 * Corresponding author 17 E-mail: [email protected] 18 19 20 21 22 23 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 24 ABSTRACT 25 California’s vernal pools are declining ecosystems that support valuable native plant and animal 26 diversity. Vernal pool branchiopods are particularly at risk from vernal pool habitat loss and 27 conservation efforts have targeted their long-term protection through the establishment of 28 preserves and conservation banks. These conservation strategies require repeated, perpetual 29 monitoring of preserved habitat, which is currently carried out through dip-net surveys and visual 30 identification of specimens. Dip-netting may be destructive and frequently requires some 31 sacrifice of protected species. Environmental DNA offers a new, modern method to monitor 32 many protected freshwater organisms. We designed qPCR-based species-specific assays for four 33 of California’s vernal pool branchiopods: The Vernal Pool Fairy Shrimp Branchinecta 34 lynchi (BRLY), the Midvalley Fairy Shrimp Branchinecta mesovallensis (BRME), and the 35 Conservancy Fairy Shrimp Branchinecta conservatio (BRCO), and the Vernal Pool Tadpole 36 Shrimp Lepidurus packardi (LEPA). We tested these assays using eDNA sampling protocols 37 alongside traditional dip-net surveys to assess their viability as an alternative method to monitor 38 vernal pool branchiopods. Based on occupancy modeling, each of our assays achieved a 95% or 39 higher detection rate when using optimized sampling protocols. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 40 INTRODUCTION 41 42 Vernal pool wetlands support high levels of biodiversity and provide a wide range of 43 ecosystem services [1], but are facing decline. California’s vernal pool habitats support 44 ecologically and phylogenetically distinct biota, including a diverse assemblage of endemic 45 branchiopod crustaceans [2]. Since the mid-1800s, alteration of vernal pool wetlands and 46 conversion to agricultural and urban landscapes are estimated to have contributed to the 47 extinction of 15-33% of crustacean species in Central Valley vernal pools [3]. Of the remaining 48 vernal pool crustacean species, six are listed as threatened or endangered [4]. 49 50 A variety of conservation approaches have been implemented to help slow wetland loss 51 and conserve remaining vernal pool biodiversity, with particular emphasis on conservation of 52 vernal pool crustaceans . Conservation banks and habitat conservation plans are two important 53 tools that establish permanent, managed habitat protections for vernal pools. These land 54 ownership plans are designed to offset small-scale habitat loss from development and facilitate 55 the protection of strategically-located, large, unfragmented habitats. A central part of these 56 agreements are provisions for repeated, long-term monitoring of all listed species to help ensure 57 their persistence within protected lands. Repeated monitoring ensures that the habitat bank 58 perpetually supports the target, but comes at the cost of human impact on lands that are often 59 pristine and delicate. Monitoring tools that minimize repeated impact would be useful for long- 60 term monitoring of vernal pool conservation banks. 61 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 62 Currently, vernal pool branchiopods (Arthropoda: Crustacea: Branchiopoda) are 63 primarily monitored during the wet season using dip-net surveys. Surveyors wade into vernal 64 pools and move a fine mesh net through the water column to disrupt the substrate and capture 65 benthic invertebrates. Once captured, adult vernal pool branchiopods are identified visually in- 66 field or in the lab under a microscope. Drawbacks to this labor-intensive survey method include 67 difficulty identifying morphologically-similar branchiopod species in-field, habitat disturbance, 68 and death of specimens used for laboratory identification. Additionally, no detection rates have 69 been established for dip-net surveys of adult vernal pool branchiopods, and juveniles in common 70 target genera cannot be identified to species visually. Long-term monitoring plans would benefit 71 from a survey method that was repeatable, with a known detection rate, that minimized the 72 sacrifice of protected species while providing highly accurate results. Environmental DNA 73 (eDNA) provides a viable alternative for sampling many habitats, including vernal pools, and 74 monitoring species of conservation concern [16-22]. 75 76 Here, we developed eDNA monitoring methods for three morphologically-similar vernal 77 pool species of conservation concern: The Vernal Pool Fairy Shrimp Branchinecta 78 lynchi (BRLY), the Midvalley Fairy Shrimp Branchinecta mesovallensis (BRME), and the 79 Conservancy Fairy Shrimp Branchinecta conservatio (BRCO), as well as for the endangered 80 Vernal Pool Tadpole Shrimp Lepidurus packardi (LEPA). We designed four species-specific 81 qPCR assays to detect the presence of each of these four large branchiopods, which are 82 commonly targeted and monitored in Central Valley dip-net surveys. We tested these protocols 83 on tissue-derived DNA and using eDNA samples collected from existing conservation lands 84 alongside dip-net surveys to determine their viability as an alternative monitoring method. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 85 86 87 RESULTS 88 Laboratory Development and Validation 89 To develop qPCR assays able to identify our four species in the laboratory, we used 90 Sanger sequences from whole specimens of each target species sourced from at least two sites in 91 California. For each species we sequenced multiple genes to determine the best primer and probe 92 sequences (“assay”) for each species (see Materials and Methods). Using individuals from 93 multiple geographic sites allowed us to account for inter-population, intraspecific single- 94 nucleotide polymorphisms (SNPs) which might impact the assay efficiency. We determined the 95 best gene and assay independently for each species. We developed assays on the 12S Ribosomal 96 RNA Gene for BRLY and BRME, the 16S Ribosomal RNA Gene for LEPA and Cytochrome 97 Oxidase I for BRCO (see Table 1 for the sequences of each assay). We tested the assays on 98 tissue-derived target DNA and optimized our thermocycling protocols. Each assay amplifies 99 tissue-derived target DNA within 20 cycles of qPCR, except for BRLY, which amplifies within 100 30 cycles of PCR. Our optimized reaction recipe used 1X Taqman Environmental Mastermix 101 (ThermoFisher), 0.9 uM each forward and reverse primer, 0.15 uM probe, and 1X bovine serum 102 albumin. The thermocycling protocol consisted of a 10 minute initial denaturing at 95 °C 103 followed by 50 cycles of denaturing at 95 °C and a one minute elongation step that varied in 104 temperature for each assay, see Table 2 for full conditions. 105 Table 1. The complete DNA sequences of the primers and probes used in each species- 106 specific assay. Species Gene Oligo Assay Sequences bioRxiv preprint doi: https://doi.org/10.1101/2020.11.20.391052; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. Primer F TGCAGAAAGGGGAGGATARACC Branchinecta conservatio (BRCO) Cytochrome Oxidase I Primer R TGCCTCCTGCCTTRACCTTRC Probe1,2 6-FAM/YCACCCAGT/ZEN/CCCAGCTCCACT/IBFQ/ Primer F GGATTTGGCGGTTCTTAAACTT Branchinecta lynchi (BRLY) 12S Ribosomal RNA Primer R TTTTCCTAGAAAAATGCATCCGT Probe1,2 6-FAM/TYAACAGCT/ZEN/TATATACCGTCGTTTAGAGGA/IBFQ/ Primer F CCGTCGCTTAGAGGATTACATT Branchinecta mesovallensis (BRME) 12S Ribosomal RNA Primer R ATGAGCTACGCCTTGATCTG Probe1,3 6-FAM/TTTAAATTCTTTTATTGGGAGTTCC/BHQ-1 Primer F CCGTGCGAAGGTAGCATAAT Lepidurus packardi (LEPA) 16S Ribosomal RNA Primer R AGGGTCTTATCGTCCCTCAA Probe1,3 6-FAM/TGAAGGCTGGTATGAATGGCTGGA /BHQ-1 107 1The probe is synthesized with a 5’ FAM fluorophore. 2The probe uses the proprietary IDT 108 internal ZEN™ quencher and 3’ Iowa Black® Quencher FQ. 3The probe uses the proprietary 109 IDT Black Hole Quencher®-1.
Load more

Recommended publications
  • US Format C V2.1
    APPENDIX G-7 Listed, Proposed Species, and Critical Habitat Potentially Occurring or Known to Occur in the Project Region Listed, Proposed Species, and Critical Habitat Potentially Occurring or Known to Occur in the Project Region. Scientific Name/ Common Federal/State/ General Habitat Description Habitat Rationale Name CNPS/other Present/ Status Absent Invertebrates Adela oplerella --/--/G2G3, S2S3 Opler's longhorn moth is recorded from 18 sites A Suitable habitat for this species is not Opler’s longhorn moth extending along the west side of the San present within the project site. Francisco Bay from 5 miles southeast of Nicasio in Marin County south to the Gilroy area of Santa Clara County and from the Oakland area on the inner Coast Ranges. Habitat for Opler's longhorn moth consists of serpentine grassland (Federal Register 50CFR17). Andrena blennospermatis --/--/G2, S2 Known occurrences in Contra Costa, Lake, A Yellow carpet is absent from the Blennosperma vernal pool Sonoma, Solano, Yolo, Tehamea, Sacramento, project site. Upland habitat adjacent andrenid bee San Joaquin, El Dorado, and Placer Counties. to vernal pools in the area is Habitat consists of upland areas near vernal pools composed of substrate, such as containing yellow carpet (Blennosperma sp.). gravel, compacted soil, or heavily Forages exclusively on flowering yellow carpet. disturbed soil, which does not This species excavates nests in soil in adjacent provide suitable nesting habitat for upland areas (Thorp 2008). this species. Branchinecta conservatio FE/--/-- Conservancy fairy shrimp inhabit rather large, cool- A Suitable habitat for this species does conservancy fairy shrimp water vernal pools with moderately turbid water. It not occur on site.
    [Show full text]
  • Fig. Ap. 2.1. Denton Tending His Fairy Shrimp Collection
    Fig. Ap. 2.1. Denton tending his fairy shrimp collection. 176 Appendix 1 Hatching and Rearing Back in the bowels of this book we noted that However, salts may leach from soils to ultimately if one takes dry soil samples from a pool basin, make the water salty, a situation which commonly preferably at its deepest point, one can then "just turns off hatching. Tap water is usually unsatis- add water and stir". In a day or two nauplii ap- factory, either because it has high TDS, or because pear if their cysts are present. O.K., so they won't it contains chlorine or chloramine, disinfectants always appear, but you get the idea. which may inhibit hatching or kill emerging If your desire is to hatch and rear fairy nauplii. shrimps the hi-tech way, you should get some As you have read time and again in Chapter 5, guidance from Brendonck et al. (1990) and temperature is an important environmental cue for Maeda-Martinez et al. (1995c). If you merely coaxing larvae from their dormant state. You can want to see what an anostracan is like, buy some guess what temperatures might need to be ap- Artemia cysts at the local aquarium shop and fol- proximated given the sample's origin. Try incu- low directions on the container. Should you wish bation at about 3-5°C if it came from the moun- to find out what's in your favorite pool, or gather tains or high desert. If from California grass- together sufficient animals for a study of behavior lands, 10° is a good level at which to start.
    [Show full text]
  • Vernal Pool Fairy Shrimp (Branchinecta Lynchi)
    Invertebrates Vernal Pool Fairy Shrimp (Branchinecta lynchi) Vernal Pool Fairy Shrimp (Brachinecta lynchi) Status State: Meets the requirements as a “rare, threatened, or endangered species” under CEQA Federal: Threatened Critical Habitat: Designated 2006 (USFWS 2006) Population Trend Global: Declining due to habitat loss and fragmentation (Eriksen and Belk 1999) State: As above Within Inventory Area: Unknown Data Characterization The location database for the vernal pool fairy shrimp (Brachinecta lynchi) within the inventory area includes 6 records from 1993, 1997, and 1999. The majority of locations are vernal pools within non-native grassland. Other natural and artificial habitats have a high probability of being occupied by additional populations of the vernal pool fairy shrimp throughout the grassland habitats within the ECCC HCP/NCCP inventory area. Beyond the original description (Eng et al. 1990), a scanning electron micrograph of the cyst (resting egg) (Hill and Shepard 1997), and some generalized natural history data (Helm 1997), no peer-reviewed technical literature has been published concerning the vernal pool fairy shrimp. Eriksen and Belk (1999) presented a brief discussion of the vernal pool fairy shrimp and provided a distribution map. Range The vernal pool fairy shrimp is found from Jackson County near Medford, Oregon, throughout the Central Valley, and west to the central Coast Ranges. Isolated southern populations occur on the Santa Rosa Plateau and near Rancho California in Riverside County (Eng et al.1990, Eriksen
    [Show full text]
  • Final Designation of Critical Habitat for Four Vernal Pool Crustaceans and Eleven Vernal Pool Plants in California and Southern Oregon; Final Rule
    Wednesday, August 6, 2003 Part II Department of the Interior Fish and Wildlife Service 50 CFR Part 17 Endangered and Threatened Wildlife and Plants; Final Designation of Critical Habitat for Four Vernal Pool Crustaceans and Eleven Vernal Pool Plants in California and Southern Oregon; Final Rule VerDate jul<14>2003 21:54 Aug 05, 2003 Jkt 200001 PO 00000 Frm 00001 Fmt 4717 Sfmt 4717 E:\FR\FM\06AUR2.SGM 06AUR2 46684 Federal Register / Vol. 68, No. 151 / Wednesday, August 6, 2003 / Rules and Regulations DEPARTMENT OF THE INTERIOR SUPPLEMENTARY INFORMATION: court orders and court-approved settlement agreements, compliance with Preamble Fish and Wildlife Service which now consumes nearly the entire Designation of Critical Habitat Provides listing program budget. This leaves the 50 CFR Part 17 Little Additional Protection to Species Service with little ability to prioritize its activities to direct scarce listing RIN 1018–AI26 In 30 years of implementing the ESA, resources to the listing program actions the Service has found that the with the most biologically urgent Endangered and Threatened Wildlife designation of statutory critical habitat and Plants; Final Designation of species conservation needs. provides little additional protection to The consequence of the critical Critical Habitat for Four Vernal Pool most listed species, while consuming Crustaceans and Eleven Vernal Pool habitat litigation activity is that limited significant amounts of conservation listing funds are used to defend active Plants in California and Southern resources. The Service’s present system Oregon lawsuits and to comply with the for designating critical habitat is driven growing number of adverse court orders.
    [Show full text]
  • Vernal Pool Fairy Shrimp (Branchinecta Lynchi)
    fairy shrimp populations are regularly monitored by Bureau of Land Management staff. In the San Joaquin Vernal Pool Region, vernal pool habitats occupied by the longhorn fairy shrimp are protected at the Kesterson National Wildlife Refuge. 4. VERNAL POOL FAIRY SHRIMP (BRANCHINECTA LYNCHI) a. Description and Taxonomy Taxonomy.—The vernal pool fairy shrimp (Branchinecta lynchi) was first described by Eng, Belk and Eriksen (Eng et al. 1990). The species was named in honor of James B. Lynch, a systematist of North American fairy shrimp. The type specimen was collected in 1982 at Souza Ranch, Contra Costa County, California. Although not yet described, the vernal pool fairy shrimp had been collected as early as 1941, when it was identified as the Colorado fairy shrimp by Linder (1941). Description and Identification.—Although most species of fairy shrimp look generally similar (see Box 1- Appearance and Identification of Vernal Pool Crustaceans), vernal pool fairy shrimp are characterized by the presence and size of several mounds (see identification section below) on the male's second antennae, and by the female's short, pyriform brood pouch. Vernal pool fairy shrimp vary in size, ranging from 11 to 25 millimeters (0.4 to 1.0 inch) in length (Eng et al. 1990). Vernal pool fairy shrimp closely resemble Colorado fairy shrimp (Branchinecta coloradensis) (Eng et al. 1990). However, there are differences in the shape of a small mound-like feature located at the base of the male's antennae, called the pulvillus. The Colorado fairy shrimp has a round pulvillus, while the vernal pool fairy shrimp's pulvillus is elongate.
    [Show full text]
  • Longhorn Fairy Shrimp (Branchinecta Longiantenna)
    Invertebrates Longhorn Fairy Shrimp (Branchinecta longiantenna) Longhorn Fairy Shrimp (Branchinecta longiantenna) Status State: Meets the requirements as a “rare, threatened, or endangered species” under CEQA Federal: Endangered Critical Habitat: Designated 2006 (USFWS 2006) Population Trend Global: Declining due to habitat loss and fragmentation (Eriksen and Belk 1999) State: As above Within Inventory Area: Unknown Data Characterization The location database for the longhorn fairy shrimp (Branchinecta longiantenna) within the inventory area includes 2 records from 1982 and 1990 near the Los Vaqueros Reservoir (Eng et. al. 1990, California Natural Diversity Database 2001). These 2 locations are shallow, sandstone-rock-outcrop vernal pools within non-native grassland. Other natural and artificial habitats have a high probability of being occupied by additional populations of the longhorn fairy shrimp throughout the grassland habitats within the ECCC HCP/NCCP inventory area. In addition to the original description (Eng et. al. 1990), Eriksen and Belk (1999) presented a brief discussion of the longhorn fairy shrimp and provided a distribution map. Hill and Shepard (1997) produced a scanning electron micrograph of the cyst (resting egg), and Helm (1997) provided some generalized natural history data. No other peer-reviewed technical literature has been published concerning the longhorn fairy shrimp. Range Only 8 populations of the longhorn fairy shrimp are known (U.S. Fish and Wildlife Service 1996). Longhorn fairy shrimp occurrences are rare and highly disjunct with specific pool characteristics largely unknown (USFWS 2003). The Altamont pass subunits of the species occur within clear depression pools in sandstone outcrops (Eriksen and Belk 1999; EBRPD 2001; CNDDB 2002). Other populations in the middle and southern range of the species occur in loam and shallow alkaline soil, respectively (USFWS 2003).
    [Show full text]
  • Longhorn Fairy Shrimp Research EA
    Longhorn Fairy Shrimp Habitat Research in Contra Costa and Alameda Counties Environmental Assessment U.S. Department of the Interior Bureau of Reclamation March 2017 Mission Statements The Department of the Interior protects and manages the Nation's natural resources and cultural heritage; provides scientific and other information about those resources; and honors its trust responsibilities or special commitments to American Indians, Alaska Natives, and affiliated island communities The mission of the Bureau of Reclamation is to manage, develop, and protect water and related resources in an environmentally and economically sound manner in the interest of the American public. List of Abbreviations and Acronyms BPRP Brushy Peak Regional Preserve CCWD Contra Costa Water District CFR Code of Federal Regulations CVP Central Valley Project CVPCP Central Valley Project Conservation Program EBRPD East Bay Regional Park District Geographic Information System GPS Global Positioning System LARPD Livermore Area Recreation and Park District LFS Longhorn Fairy Shrimp NHPA National Historic Properties Act USFWS U.S. Fish and Wildlife Service VCRP Vasco Caves Regional Preserve Contents Page Section 1 Introduction ................................................................................... 1 1.1 Background ........................................................................................... 1 1.2 Need for the Proposal............................................................................ 1 Section 2 Alternatives Including the Proposed
    [Show full text]
  • Conservancy Fairy Shrimp (Branchinecta Conservatio)
    2. CONSERVANCY FAIRY SHRIMP (BRANCHINECTA CONSERVATIO) a. Description and Taxonomy Taxonomy.—The Conservancy fairy shrimp (Branchinecta conservatio) was described by Eng, Belk, and Eriksen (Eng et al. 1990). The type specimens were collected in 1982 at Olcott Lake, Solano County, California. The species name was chosen to honor The Nature Conservancy, an organization responsible for protecting and managing a number of vernal pool ecosystems in California, including several that support populations of this species. Description and Identification.—Conservancy fairy shrimp look similar to other fairy shrimp species (Box 1- Appearance and Identification of Vernal Pool Crustaceans). Conservancy fairy shrimp are characterized by the distal segment of the male’s second antennae, which is about 30 percent shorter than the basal segment, and its tip is bent medially about 90 degrees (Eng et al. 1990). The female brood pouch is fusiform (tapered at each end), typically extends to abdominal segment eight, and has a terminal opening (Eng et al. 1990). Males may be from 14 to 27 millimeters (0.6 to 1.1 inch) in length, and females have been measured between 14.5 and 23 millimeters (0.6 and 0.9 inch) long. Conservancy fairy shrimp can be distinguished from the similar looking midvalley fairy shrimp (Branchinecta mesovallensis) by the shape of two humps on the distal segment of the male's second antennae (Belk and Fugate 2000). The midvalley fairy shrimp's antennae is bent such that the larger of the two humps is anterior (towards the head), whereas this same hump in the Conservancy fairy shrimp is posterior (towards the tail).
    [Show full text]
  • VERNAL POOL FAIRY SHRIMP Branchinecta Lynchi
    U.S. Fish & Wildlife Service Sacramento Fish & Wildlife Office Species Account VERNAL POOL FAIRY SHRIMP Branchinecta lynchi CLASSIFICATION: Threatened Federal Register 59-48136; September 19, 1994 http://ecos.fws.gov/docs/federal_register/fr2692.pdf On October 9, 2007, we published a 5-year review recommending that the species remain listed as threatened. CRITICAL HABITAT: Designated Originally designated in Federal Register 68:46683; August 6, 2003. The designation was revised in FR 70:46923; August 11, 2005. Species by unit designations were published in FR 71:7117 (PDF), February 10, 2006. RECOVERY PLAN: Final Recovery Plan for Vernal Pool Ecosystems of California and Southern Oregon, December 15, 2005. http://ecos.fws.gov/docs/recovery_plan/060614.pdfhttp://ecos.fws.gov/docs/recovery_plan/0606 14.pdf DESCRIPTION The vernal pool fairy shrimp (Branchinecta lynchi), is a small crustacean in the Branchinectidae family. It ranges in size from ½ to one inch long. Fairy shrimp feed on algae, bacteria, protozoa, rotifers and bits of detritus. Fairy shrimp are aquatic species in the order Anostraca. They have delicate elongate bodies, large stalked compound eyes, no carapaces, and eleven pairs of swimming legs. They glide gracefully upside down, swimming by beating their legs in a complex, wavelike movement that passes from front to back. The vernal pool fairy shrimp occupies a variety of different vernal pool habitats, from small, clear, sandstone rock pools to large, turbid, alkaline, grassland valley floor pools. Although the species has been collected from large vernal pools, including one exceeding 25 acres, it tends to occur in smaller pools. It is most frequently found in pools measuring less than 0.05 acre.
    [Show full text]
  • United States Department of the Interior
    United States Department of the Interior FISH AND WILDLIFE SERVICE Pacific Southwest Region 2800 Cottage Way, Suite W-2606 Sacramento, California 95825-1846 IN REPLY REFER TO: May 31, 2015 Survey Guidelines for the Listed Large Branchiopods Introduction The endangered Conservancy fairy shrimp (Branchinecta conservatio), longhorn fairy shrimp (Branchinecta longiantenna), vernal pool tadpole shrimp (Lepidurus packardi), and the threatened vernal pool fairy shrimp (Branchinecta lynchi) were listed on September 19, 1994, under the Endangered Species Act of 1973, as amended (Act) (59 Federal Register 48136). These species are endemic to vernal pools in the Agate Desert Region of Oregon and in California’s Central Valley, Coast Ranges, and a limited number of sites in and south of the Transverse Ranges. The endangered Riverside fairy shrimp (Streptocephalus woottoni) was listed under the Act on August 3, 1993 (58 Federal Register 41391). This species inhabits Riverside, Orange, Los Angeles, and San Diego counties, California, and northwestern Baja California, Mexico. The San Diego fairy shrimp (Branchinecta sandiegonensis) was listed under the Act on February 3, 2007 (62 Federal Register 4925). This species inhabits San Diego and Orange counties in California, and northwestern Baja California, Mexico. These six species, hereafter referred to as the listed large branchiopods, are fully protected under the Act. Surveys for all of these species should follow the methods described in these Survey Guidelines for the Listed Large Branchiopods (Guidelines). It is expected that the Guidelines will be revised in the future as additional information becomes available. The U.S. Fish and Wildlife Service (Service) has published recovery plans for vernal pool species in Southern California (Service 1998a) and in Northern California and Southern Oregon (Service 2005, 2012).
    [Show full text]
  • A.18 Conservancy Fairy Shrimp (Branchinecta Conservatio)
    Appendix A. Species Account Butte County Association of Governments Conservancy Fairy Shrimp A.18 Conservancy Fairy Shrimp (Branchinecta conservatio) A.18.1 Legal and Other Status The Conservancy fairy shrimp is listed as endangered under the ESA throughout its range (59 FR 48136). Critical habitat has been designated for the Conservancy fairy shrimp in Butte County, including areas in the Butte Regional HCP/NCCP Plan Area. Critical habitat includes 20,546 acres (16,182 hectares) in Unit 1 (Vina Plains Unit), a portion of which is in Butte County, and all of which is on private property. The Vina Plains Unit extends from Deer Creek in Tehama County to North of Rock Creek and the Chico Airport near the City of Chico in Butte County (71 FR 7118). A.18.2 Species Distribution and Status A.18.2.1 Range and Status The historical distribution of the Conservancy fairy shrimp is not known; however, the distribution of vernal pool habitats in the areas where the species is now known to occur was once more continuous and larger in area than today. It is likely the Conservancy fairy shrimp once occupied vernal pool habitats throughout a large portion of the Central Valley and southern coastal regions of California, and it may still exist in unsurveyed pools within this region (USFWS 2006). The species is currently known from several disjunct populations: the Vina Plains in Tehama County, south of Chico in Butte County, several areas in Solano County, Sacramento National Wildlife Refuge in Glenn County, San Luis National Wildlife Refuge and the Haystack mountain/Yosemite Lake area in Merced County, in the Tule Ranch unit of the California Department of Fish and Game Yolo Basin Wildlife Area in Yolo County, on Maps Ranch in Stanislaus County, and on Beale Air Force Base in Yuba County (CNDDB 2006).
    [Show full text]
  • Vernal Pool Fairy Shrimp (VPFS, Branchinecta Lynchi)  Conservancy Fairy Shrimp (COFS, B
    Monitoring and Managing California Endemic Large Branchiopods By Brent Helm, Ph.D. Tansley Team, Inc. (dba Helm Biological Consulting) (530) 633-0220 [email protected] Who are the Endemics? Vernal pool fairy shrimp (VPFS, Branchinecta lynchi) Conservancy fairy shrimp (COFS, B. conservatio) Longhorn fairy shrimp (LFS, B. longiantenna) Midvalley fairy shrimp (MFS, B. mesovallensis) California fairy shrimp (CFS, Linderiella occidentalis) Mono Lake brine shrimp (Artemia monica) San Francisco brine shrimp (A. franciscana) San Diego fairy shrimp (SDFS, B. sandiegonensis) San Rosa Plateau fairy shrimp (SRPFS, L. santarosae) Riverside fairy shrimp (RFS, Streptocephalus woottoni) California clam shrimp (CCS, Cyzicus californicus) Vernal pool tadpole shrimp (VPFS, Lepidurus packardi) Goals and Objectives What is the To maintain or increase endemic large branchiopod occurrences and abundances? How do we reach the goal? Objectives The “who, what, when, where, and how” of reaching the goals Objectives First Monitor vernal pools large branchiopods Second The results of the monitoring will dictate what maintenance and management activities are needed. Right? Wait ! Need to know the life histories of targeted species The parameters that influencing their occurrences and abundances Life History Table 1. Endemic Large Branchiopod Habitat "Preferences" Ponding Depth (in inches) Duration (in days) Area (in acres) 1-2 2-4 4-6 6-8 8-10 >12 <14 14-30 30-60 60-90 90-120 > 120 <0.0005 0.0005 - 0.005 0.005 - 0.05 Large Branciopod Species
    [Show full text]