Proteins Binding to 5' Untranslated Region Sites: a General Mechanism for Translational Regulation of Mrnas in Human and Yeast Cells RENATA STRIPECKE,' CARLA C

Home , Untranslated region

Proteins Binding to 5' Untranslated Region Sites: a General Mechanism for Translational Regulation of mRNAs in Human and Yeast Cells RENATA STRIPECKE,' CARLA C. OLIVEIRA,2 JOHN E. G. McCARTHY 2 AND MATTHIAS W. HENTZEI* Gene Expression Programme, European Molecular Biology Laboratory, D-69117 Heidelberg,' and Department of Gene Expression, Gesellschaft fiir Biotechnologische Forschung mbH, D-38124 Braunschweig,2 Germany Received 1 April 1994/Returned for modification 20 May 1994/Accepted 31 May 1994

We demonstrate that a bacteriophage protein and a spliceosomal protein can be converted into eukaryotic translational repressor proteins. mRNAs with binding sites for the bacteriophage MS2 coat protein or the spliceosomal human UlA protein were expressed in human HeLa cells and yeast. The presence of the appropriate binding protein resulted in specific, dose-dependent translational repression when the binding sites were located in the 5' untranslated region (UTR) of the reporter mRNAs. Neither mRNA export from the nucleus to the cytoplasm nor mRNA stability was demonstrably affected by the binding proteins. The data thus reveal a general mechanism for translational regulation: formation of mRNA-protein complexes in the 5' UTR controls translation initiation by steric blockage of a sensitive step in the initiation pathway. Moreover, the findings establish the basis for novel strategies to study RNA-protein interactions in vivo and to clone RNA-binding proteins.

A rapidly increasing number of examples provide evidence L32 yeast ribosomal protein (10) and proteins acting on that gene expression can be regulated in the cytoplasm of Drosophila spermatogenesis (47) are possible candidates for eukaryotic cells at the level of mRNA stability, translation, or repressors functionally similar to IRP. In contrast, thymidylate the subcellular localization of mRNAs (reviewed in references synthase binds to its own mRNA 75 nucleotides downstream 11, 36, and 46). Common to these modes of posttranscriptional from the cap structure (9), a position from which IRP functions control is the role played by specific interactions between inefficiently (14, 15). LOX-BP binds to the 3' UTR of erythroid cis-acting sequences contained in the mature mRNAs and 15-lipoxygenase mRNA and represses its translation (40), regulatory RNA-binding proteins. Most biochemical informa- whereas IRP binding to an IRE in the 3' UTR fails to affect tion pertaining to cytoplasmic gene regulation by RNA-protein translation (7). Thus, it is doubtful whether the mechanism of interactions addresses translational control. Most commonly, action of thymidylate synthase and LOX-BP is similar to that the regulatory RNA sequences are found in the untranslated of IRP. Comparison of the systems that may function in a way regions at the 5' and 3' ends of the transcripts (26, 35). similar to that of IRP with those that seem to function In vertebrate cells, the regulation of ferritin and erythroid differently provides few clues to the mechanisms involved. The 5-aminolevulinate synthase mRNAs by iron has served as a paucity of well-studied physiological examples of repressor model system to elucidate how the binding of iron regulatory protein-binding site effector pairs thus led us to search for an protein (IRP; formerly known as IRF, IRE-BP, FRP, or P90) alternative approach to uncover mechanistic principles for to an RNA element (the iron-responsive element [IRE]) in the translational control. 5' untranslated region (UTR) of an mRNA controls the We asked whether RNA-binding proteins with physiological initiation step of translation. When IRP binds to an IRE, it roles unrelated to eukaryotic mRNA translation would func- represses the translation of the downstream open reading tion as translational repressor proteins when a specific mRNA frame both in vivo and in vitro (14, 18, 56). No sequences other binding site was present in a position similar to that of the IRE than the IRE are required. For an IRE-IRP complex to in ferritin mRNA. Cell-free translation experiments had sup- efficiently inhibit protein synthesis, the IRE must be localized ported the feasibility of this approach (53). We demonstrate in in a cap-proximal position of the mRNA (14, 15), whereas the this report that human and yeast cells respond to the expres- distance between the IRE and the AUG appears to be of little sion of an RNA-binding protein by strongly diminished trans- functional relevance (15, 23). lation of those mRNAs that carry a binding site for these Numerous examples of translational regulation by specific proteins in their 5' UTRs. These findings provide a basis for repressor proteins in prokaryotes exist. In most cases, the the construction of heterologous regulatory systems acting at repressor proteins directly or indirectly occlude the Shine- the translational level in eukaryotic cells. At the same time, Dalgarno sequence and/or the initiation codon (reviewed in they suggest new strategies that can be used to clone cDNAs references 13 and 34). More recently, further examples of for (regulatory) RNA-binding proteins and to study RNA- repressor proteins that, like IRP, bind to specific RNA regu- protein interactions in vivo. latory sequences have been identified in eukaryotic cells. The MATERIALS AND METHODS * Corresponding author. Mailing address: Gene Expression Pro- gramme, European Molecular Biology Laboratory, Meyerhofstrasse 1, Construction of recombinant plasmids. The plasmids used D-69117 Heidelberg, Germany. Phone: (49)-6221-387 501. Fax: (49)- to express RNA-binding proteins in yeast under control of the 6221-387 518. GAL::PGK fusion promoter are derived from YCpCATex 5898 VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5899

(39), which contains URA3 as a selection marker. For con- the lithium acetate procedure as previously described (21). For structing YCp-UlA, pGEM-A (2) was digested with StyI, the induction of the GAL promoter, overnight inocula were grown ends were blunt ended, and the 900-bp fragment was intro- at 30°C in lactate medium (pH 4.5) containing 0.84% (vol/vol) duced into the blunt-endedXhoI and XbaI sites of YCpCATex. sodium lactate (60%, wt/vol; Sigma), 1.13% (vol/vol) lactic For the construction of pCT1-5' containing the bacteriophage acid, 0.67% (wt/vol) yeast nitrogen base without amino acids, MS2 coat protein (CP) gene with a mammalian consensus 0.05% glucose, 0.05% yeast extract, and the corresponding sequence for efficient translation initiation (31), pCT1 (41) was amino acids or nucleotides. Induction was performed by digested with PstI and SalI and ligated to annealed and diluting the culture to an optical density at 600 nm of 0.1, phosphorylated complementary oligonucleotides containing adding 1/10 volume of 20% galactose, and continuing incuba- the sequence 5' GGATCCTCGA GCCACCAUGG CTTCTA tion at 30°C for the desired time. Protein extract preparation ACT-T TACTCAGTTC GTTCTCG 3' (underlining refers to followed the procedure described by Kingsman et al. (28) with the mammalian consensus sequence for efficient translation minor modifications. Culture (5 to 15 ml; approximate optical initiation [31]). The plasmid pCT1-5' was digested with KpnI, density at 600 nm = 0.8) was harvested by centrifugation, blunt ended, and digested with XhoI, and the 400-bp fragment washed once with 10 ml of distilled water, and suspended in 1.0 was introduced into YCpCATex by using the XhoI-XbaI sites ml of yeast lysis buffer (100 mM NaCl, 50 mM Tris-HCI [pH to generate YCp-CP. The yeast indicator plasmids are driven 7.4]). The suspension was briefly centrifuged again and resus- by the TEF1 (translation elongation factor) promoter and pended in 200,ul of lysis buffer containing 1 mM phenylmeth- contain the TRP1 selection marker. Oligonucleotides corre- ylsulfonyl fluoride, 10 ,ug of leupeptin per ml, and 1 mM sponding to the RNA-binding sequences for UlA and CP (see dithiothreitol. Cells were disrupted with glass beads at 4°C by Fig. 1) were cloned into the Aflll site present in the luciferase three cycles of vortexing for 1 min and incubation on ice for 1 leader sequence. The indicator constructs were confirmed by min. After centrifugation for 2 min at 6,000 x g, the superna- sequencing. tant was collected into a fresh tube and centrifuged for 5 min The constructs for the expression of RNA-binding proteins at 15,000 x g. The supernatant soluble extract was kept on ice in mammalian cells are derived from pSG5 (19), which con- or frozen at -80°C. Luciferase assays were performed as tains the simian virus 40 early promoter, intron 2 from the rat described by Brasier et al. (4). P-globin gene, a multiple cloning site, and the simian virus 40 Gel retardation assays. 2P-labeled RNA probes (specific polyadenylation signal. EcoRI fragments harboring the UlA activity -S x 106 cpm/,ug) containing the binding sites for (50) coding sequences were subcloned into the EcoRI site of UlA and MS2-CP were made by digesting UlA-CAT and pSG5 to generate pSG5-U1A. The MS2-CP gene containing MSC-CAT (53) with XbaI and cotranscriptionally labeling the the eukaryotic translation initiation consensus was obtained by RNA transcripts with T7 RNA polymerase. In vitro transcrip- digesting pCT1-5' with KpnI, blunt ending, and subsequently tion products were gel purified, phenol-chloroform extracted digesting with BamHI. The resulting 400-bp fragment was twice, ethanol precipitated, washed, and finally resuspended in introduced into pSG5 by using the BamHI and blunt-ended H20. Aliquots (2.5 to 5.0 ,ug each) of yeast extracts were BglII sites to yield pSG5-CP. incubated for 30 min at room temperature with 0.5 x 104 to 1 The indicator constructs used in mammalian cells are de- X 104 cpm of probe in 10 to 15 RI of the corresponding binding rived from D4-GH (also called L5-GH [7]), which contains buffer. The binding assay for CP was performed in binding adjacent 5' BamHI and XbaI 3' sites sandwiched between the buffer containing 0.2 M Tris-HCl (pH 8.5), 160 mM KCl, 20 transcription start site of the ferritin promoter (24) and the mM magnesium acetate, and 160 mg of bovine serum albumin protein-coding region of the human growth hormone (hGH) per ml. The UlA binding assay contained a binding buffer with gene. Pairs of complementary oligonucleotides corresponding the following final concentrations: 25 mM Tris-HCl (pH 7.4), 2 to the protein-binding sequences (see Fig. 6) were annealed, mM MgCl2, 0.2 mM EDTA, 0.25 mM dithiothreitol, and 40 phosphorylated, and cloned between the BamHI and XbaI mM (NH4)2SO4. Subsequently, samples were incubated for 10 sites of D4-GH, resulting in the constructs MSC-GH, MSA- min with heparin (0.5 mg/ml) and analyzed by nondenaturing GH, and MSa-GH. The indicator constructs were confirmed by gel electrophoresis (32). sequencing. D4-GHs (where "s" stands for "short"), which RNA isolation from yeast cells. Culture (100 ml) was contains a deletion of the third exon from the hGH gene, was harvested, washed, and resuspended in 500 [lI of buffer (50 used as an internal control for transfection and immunopre- mM sodium acetate-10 mM EDTA, adjusted to pH 5.0 with cipitation assays and constructed as follows. D4-GH was acetic acid). A 100-,u1 volume of 10% sodium dodecyl sulfate subjected to PCR with primer A (5' CCTGTAGACA GAGC (SDS), 0.4 g of glass beads, and 1 ml of phenol (65°C) were CCCCGG 3') and the M13 universal primer for 30 cycles (30 added to the samples, and the resulting mixtures were incu- s at 93°C, 30 s at 40°C, and 150 s at 70°C), generating an bated for 10 min at 65°C. During this incubation, the samples amplification product of -800 bp. D4-GH was digested with were vortexed three times for 30 s each time. After incubation AccI and HindlIl, and the 4-kb fragment was isolated and on ice for 2 min and centrifugation, the aqueous phase was ligated to the AccI-HindIII-digested PCR product. The plas- extracted once with prewarmed phenol and twice with chloro- mid pCMV-luc was a kind gift of Vivanco Ruiz (European form-isoamyl alcohol (24:1), mixed with 50 pu1 of 3 M sodium Molecular Biology Laboratory, Heidelberg, Germany). acetate (pH 5.3) and 3 volumes of ethanol, and incubated at Yeast culture conditions, preparation of protein extracts, -20°C for several hours. The RNA pellet was washed with and luciferase assays. The Saccharomyces cerevisiae strain 80% ethanol, dried briefly, and resuspended in 100 pI of RS453a (AL4Ta ade2-1 trpl-1 leu2-3 his3-11 ura3-52 lys+ diethylpyrocarbonate-treated H20. canl-100) was a kind gift from Ram6n Serrano (Valencia, Transient transfection, metabolic labeling, and immunopre- Spain). Yeast was cultured in yeast-selective defined medium cipitation. HeLa cells were maintained at 37°C and 5% CO2 in containing 0.67% (wt/vol) yeast nitrogen base without amino Dulbecco modified Eagle medium containing 10% fetal calf acids (Difco), 2.0% glucose, and the following amino acids and serum and 1 U of penicillin-streptomycin (Gibco) per ml and nucleotides in the indicated final concentrations (in milligrams transfected by the calcium phosphate method of Graham and per liter): adenine, 20; arginine, 20; histidine, 20; leucine, 60; van der Eb (16). Sodium butyrate (5 mM, pH 7.3) was added tryptophan, 20; and uracil, 20. Yeast cells were transformed by -24 h after transfection. Following overnight incubation, the 5900 STRIPECKE ET AL. MOL. CELL. BIOL.

cells were labeled for 2 h with 100 ,uCi of [L-35S]methionine using lx MOPS buffer. After electrophoresis, the gels were (specific activity, 1,300 Ci/mmol) in 2.5 ml of methionine-free equilibrated in 1/3 x TAE buffer (1 x TAE buffer is 40 mM Tris RPMI medium containing 10% fetal calf serum, 1 U of base, 20 mM sodium acetate, and 1 mM EDTA [pH 7.0]), and penicillin-streptomycin (Gibco) per ml, and 2 mM glutamine, the RNA was transferred onto nylon membranes by electro- washed twice with ice-cold phosphate-buffered saline, har- blotting and UV cross-linked. The membranes were prehybrid- vested, and lysed in 1 ml of buffer (300 mM NaCl, 50 mM ized in 10 ml of Church buffer (0.5 M P04 [pH 7.2], 1 mM Tris-HCl [pH 7.4], 1% Triton X-100, 0.1% phenylmethylsul- EDTA, 7% SDS) for 2 h at 65°C. DNA probes were labeled fonyl fluoride, 10 pug of leupeptin per ml) by vortexing and with [a-32P]dCTP with the Oligolabeling Kit (Pharmacia) incubation on ice for 30 min. Equal aliquots of trichloroacetic following the manufacturer's instructions. The membranes acid-precipitable labeled protein (1 X 107 to 5 x 107 cpm) were hybridized against the denatured radioactive probes in were immunoprecipitated with saturating quantities of poly- 5.0 ml of Church buffer, held overnight at 65°C, washed (50 clonal anti-hGH antibodies (National Hormone and Pituitary mM P04 [pH 7.2], 1.0% SDS) at 65°C, and exposed. Program, Baltimore, Md.) or antiluciferase antibodies (a kind For primer extension analysis of hGH mRNAs, a synthetic gift from H. Hauser, GBF, Braunschweig, Germany) by using DNA oligonucleotide (complementary to a region at positions protein A-Sepharose. The gel was washed twice (50 mM -25 to -45 upstream of the hGH translation initiation codon Tris-HCl [pH 7.5], 100 mM NaCl, 0.1% Triton X-100), boiled [5' ACCCTGAGTG GYTCGGGGAG 3']) was labeled at its in electrophoresis sample buffer (125 mM Tris-HCl [pH 6.8], 5' terminus with [y-32P]ATP and polynucleotide kinase. Puri- 2% SDS, 10% glycerol, 0.7 M 2-mercaptoethanol, 0.05% fied RNA (10 ,ug) was mixed with 0.5 pmol of labeled primer bromophenol blue), and analyzed on SDS-polyacrylamide gels and 5 RI of 1 M KCl in a final volume of 50 [LI. The primer was (15 to 17.5% acrylamide). annealed (90°C for 5 min followed by cooling at room temper- Isolation of total, cytoplasmic, and nuclear RNA from HeLa ature for 15 min), and the following were then added to each cells. Isolation of total, cytoplasmic and nuclear RNA from sample: 25 RI of 40 mM Tris-HCl (pH 8.0), 5 ,lI of 10 mM HeLa cells was performed by the method of Chen-Kiang and solutions of each deoxynucleotide triphosphate, 3 RI of 0.1 M Lavery (8) with some modifications. A total of 0.5 x 107 to 5 dithiothreitol, 1 [lI of 10% Nonidet P-40, 1 Il' of 1 M MgCl2, X 107 cells were differentially processed to yield total or and 1.5 U of avian myeloblastosis virus reverse transcriptase. fractionated (cytoplasmic and nuclear) RNA preparations. After incubation at 42°C for 1 h, the nucleic acids were ethanol Total RNA was obtained by homogenizing the cell pellets precipitated and resuspended in 20 plI of formaldehyde dye directly in 5 ml of 4 M GTC solution (4 M guanidinium mix. A 10-pl portion of each sample was denatured at 95°C for thiocyanate, 0.1 M sodium acetate [pH 5.0], 5 mM EDTA [pH 5 min and loaded onto 8 M urea-0.5 x TBE (lx TBE is 0.089 8.0], 2.0% sarcosyl, 0.14 M 2-mercaptoethanol) with a 20- M Tris-borate, 0.089 M boric acid, and 0.002 M EDTA [pH gauge needle. The cytoplasmic fraction was obtained by resus- 8.0])-8% polyacrylamide gels for electrophoresis. Primer ex- pending the cell pellet gently in 450 RI of Iso-Hi solution (0.14 tension analysis for luciferase mRNA expression in yeast was M NaCl, 10 mM Tris base [pH 8.4], 1.5 mM MgCl2), adding performed exactly as described previously (38). dropwise 50 ,ul of Iso-Hi solution containing 5% Nonidet P-40 and immediately centrifuging at 550 x g for 5 min at 4°C. The RESULTS supernatant containing the cytoplasmic fraction was then transferred directly into a tube containing 3.5 ml of 6 M GTC Experimental strategy and expression of functional RNA- solution (as described above except with 6 M guanidine binding proteins in S. cerevisiae. MS2-CP and the human thiocyanate) and vortexed briefly. The pellets containing the spliceosomal component UlA were chosen as examples of nuclei were resuspended in 900 RI of Iso-Hi solution by gentle RNA-binding proteins which have functions normally unre- tapping, and 100 ,u of 1ox Magic Wash (10X Magic Wash is lated to the regulation of eukaryotic translation and for which 425 mM Tris-OH [pH 8.3], 85 mM NaCl, 26 mM MgCl2, 40 the parameters of their interaction with RNA were well mM vanadyladenosine, 12 mM phenylmethylsulfonyl fluoride, studied (6, 22, 33, 48, 57). cDNAs encoding the two proteins 6% [vol/vol] Tween 40, 3.0% [wt/vol] sodium deoxycholate) were cloned into a yeast expression vector bearing an inducible was added dropwise. The mixture was centrifuged at 550 x g GAL/PGK fusion promoter (GPF) (Fig. 1A). This promoter for 5 min at 4°C, the supernatant was transferred to the supports transcription when the yeast cells are grown in cytoplasmic fraction in the 6 M GTC solution, and the mixture galactose-containing media but is repressed when glucose or was homogenized as described previously. The remaining lactate is used as a carbon source (38). A second centromeric nuclear pellet was homogenized in 5 ml of 4 M GTC solution. plasmid allowed coexpression of luciferase indicator mRNAs A 1-ml portion of 4 M GTC solution was added to each from the TEF1 promoter. Binding sites for UlA or MS2-CP fraction, which was then laid onto 4.4 ml of CsCl solution (0.83 were introduced into the 5' UTR of the luciferase mRNA by g of CsCl per ml, 0.1 M sodium acetate [pH 5.2], 5 mM EDTA) using an AflIl restriction site 9 nucleotides downstream of the and centrifuged for >30 h in an SW-41 ultracentrifuge at major transcription initiation site. The binding sites were 33,000 rpm at 20°C. RNA was resuspended in diethylpyrocar- designed, with minor modifications, for MS2-CP as described bonate-treated H2O, DNase treated, ethanol precipitated, by Witherell et al. (57) to generate (in decreasing order of washed with 80% ethanol, and resuspended in 50 RI of affinities for the binding protein) MSC, MSA, and MSA/del; diethylpyrocarbonate-treated H20. for UlA (48), they were designed to create UlAwt, UlAwt/ Northern (RNA) blotting and primer extension analysis. del, and UlAmut (Fig. 1B and C). Purified RNA (2 to 10 ,ug) was denatured in sample loading We first analyzed whether the UlA and the MS2-CP could buffer (10 ml of buffer contains 4.8 ml of formamide, 1.73 ml of be expressed as active RNA-binding proteins in yeast. Extracts formaldehyde [37%], 1.07 ml of 1ox MOPS [morpholinepro- were prepared from cells grown under inducing (galactose panesulfonic acid] buffer [400 mM MOPS, 100 mM sodium medium) and noninducing (lactate medium) conditions and acetate, 10 mM EDTA; pH 7.0], 0.67 ml of 80% glycerol, 0.53 analyzed by gel retardation assays. For both RNA-binding ml of 0.05% bromophenol blue, and 1.2 ml of diethylpyrocar- proteins, complexes formed only with extracts from induced bonate-treated H2O) at 65°C for 5 min, cooled on ice for 2 min, cells (Fig. 2; compare lanes 1 through 6 with lanes 9 through and separated on 1.0 to 1.2% agarose-formaldehyde gels by 14). These RNA-protein complexes comigrated with com- VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5901

Xb A) H A H I I I II CPA1A -1 J CEN4 ARSI URA3 GAIJPGK Represor protein PGK1 Term Fusion Promoter gene

Xb C N B) I H LuciferaseAL.W%,Ulu Ma CEN4 ARSI TRPI A Tefl Promoter Reporter gene PGKI Term

C) LEADER

FL AATTATCTACTTAAGAACACAAAACTCGAGAACATATG

UlAwt AATTATCTACTTAAGCGATTGCACTCCCGCTTAAGAACACAAAACTCGAGAACATATG UlAwt/del AATrATCTACTTXAGCGATIGCACTCCCGCTrAAGAACACAAAACTCGAGAACATATG UlAmut AATrATCTACTTAAGCGATTFAICTCCCGCTTAAGAACACAAAACTCGAGAACATATG

MSC AATTATCTACTTAAGGACCATCAGGCCTTAAGAACACAAAACTCGAGAACATATG MSA AATTATCTACTTAAGGACCATM&AGGCCTTAAGAACACAAAACTCGAGAACATA7TG MSA/del AATTATCTACTTAAGGACCAT&AGXCCTTAAGAACACAAAACTCGAGAACATATG FIG. 1. Plasmids used in experiments with S. cerevisiae. (A) Plasmids used for galactose-inducible expression of the RNA-binding proteins. The sequences encoding MS2-CP or human UlA were cloned between XhoI (X) and Xbal (Xb) sites to generate YCP-CP and YCP-UIA, respectively. These plasmids contain the URA3 selection marker. (B) Indicator constructs containing binding sites for MS2-CP or U1A cloned into the Aflll (A) site. The binding sites are located 9 nucleotides downstream from the transcription start site and 20 nucleotides upstream from the luciferase open reading frame. The plasmids harbor a TRPI selection marker. (C) Sequences and nomenclature of binding site insertions. Mutations in the stem-loops that alter the protein-binding affinity are underlined. Point deletion mutations are represented by the letter X. The 5' UTR sequence of the FL leader containing no insertion is also shown. H, HindIII; C, ClaI; N, NdeI; FL, plasmid with TEF promoter plus Luc. plexes formed between the purified proteins and the probes 3). The analysis of cells harboring the MSA/del or UlAmut (Fig. 2, lanes 15), and were present only when the galactose- binding site or no binding sites upstream of the luciferase open grown cells had been transformed with a plasmid that encodes reading frame showed that the ratios of luciferase activity from the protein that corresponds to the probe used; e.g., the MS2 induced cells to activity from uninduced cells were >1.0 (Fig. probe is shifted in extracts from YCp-CP but not YCp-UlA 3 and data not shown). This result must be interpreted in the transformants (Fig. 2; compare lanes 1 through 6 with lanes 7 light of the increased luciferase mRNA levels in cells grown and 8). under inducing conditions (see Fig. 5). In contrast, luciferase Galactose regulation of luciferase activity by UIA and activity decreased to -50% for the MSA and UlAwt/del MS2-CP. Preliminary experiments established that the rela- constructs, to -30 to 50% for UlAwt, and to -10 to 20% for tively weak stem-loop structures (stabilities predicted to range MSC (Fig. 3). Thus, a decrease in luciferase activity requires between -6.9 and -8.5 kcal/mol on the basis of work by Zuker both the presence of an RNA binding site and a cognate and Stiegler [58]) representing the binding sites for UIA and binding protein and closely correlates with the affinity between MS2-CP have only a small (<20% decrease) effect on the binding protein and binding site. Similar results were obtained expression of the luciferase reporter mRNAs. Moreover, in the for indicator constructs in which the TEFI promoter had been absence of the cognate binding proteins, luciferase expression replaced by the TRPI promoter (data not shown). For reasons from the mutant leaders MSA and UlAmut and that from to be discussed below, the MS2-CP system was consistently their wild-type counterparts MSC and UlAwt were equivalent found to be quantitatively more efficient. (data not shown). We then analyzed the effect of the binding For further characterization, the time course of RNA- proteins on luciferase expression. Triplicates of independently binding protein expression and luciferase activity was assayed isolated transformants (numbered 1 through 3) which express over a period of 24 h. Protein extracts of cells grown in MS2-CP and luciferase mRNAs bearing the MSA/del, MSA, galactose or lactate medium were prepared after 0, 3, 6, 9, 12, and MSC binding sites (Fig. 3A) or the UIA protein and and 24 h of incubation and analyzed in parallel for RNA- indicator mRNAs with the UlAmut, UlAwt/del, and UIA binding and luciferase activities (Fig. 4). In this experiment, the binding sites (Fig. 3B) were tested. The yeast cells were grown cells grew logarithmically only for the first 9 h of incubation. As in logarithmic phase under inducing and noninducing condi- early as 3 h after induction, RNA-binding activity was apparent tions, harvested after 9 h, and assayed for luciferase activity. (Fig. 4C and D) and correlated with reduced luciferase activity Qualitatively similar results with minor experimental variation originating from the MSC and UlAwt constructs, respectively were obtained for both the MS2-CP and the UlA systems (Fig. (Fig. 4A and B). After 6 h of incubation and more, increased 5902 STRIPECKE ET AL. MOL. CELL. BIOL.

A) B) ISO A MS2 coat protein 150 ilicdiuiil (GALACTOSE 11\( fAIL

Y( 1' -olisIruct f CP (E-p'\.(I { ) () 100 1:1. ctiitruc91t' MSC MSA MSAkkl U1Asit MS( MSA MS,/&I 0a

loncIr 2 2 2 2 2

3 so .....-... I10L

1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 Binding site: MSA/del MSA MSC UlAmut UlAwt/dd Ul Awt FIG. 3. Inhibition of luciferase expression by MS2-CP (A) and UlA (B) in yeast. The luciferase activities measured in extracts from H.1). - cells grown for 9 h in galactose were expressed as percentages of those grown for 9 h in lactate medium. The luciferase reporter constructs used are indicated below the x axis. All analyses were performed in triplicate (numbered 1 through 3) with independently isolated transformants. F.1P.' _0 -:112 1 1 2 1 2 expression of the binding proteins led to a further reduction in luciferase activities. In general, an inverse correlation between P.P* RNA-binding and luciferase activities was observed, although 1 2 4 5 (0 7 8 9 11)I 12 13 14 15 the relationship between these two parameters is not strict. For example, the maximal MS2-CP activity after 9 h (Fig. 4C) B correlates well with the minimal luciferase activity at this time mediium GiALACTOSE LACTATE point (Fig. 4A), but the reduction in MS2-CP activity observed at later time points is not reflected in an increase in luciferase YCP-construct UIA UIA UIA CP UIJA UIA UIA - activity. It should be borne in mind that additional parameters FL-construct such as the stability of the UlA, MS2-CP, and luciferase UlAw[U1AntuUl,AAId121212-: MSC L1AwtU]Aniu1U1Av"l21212 proteins as well as the luciferase mRNA levels directly influ- clone# ence the luciferase activity. We conclude that over a range of time points and growth conditions, luciferase activity was galactose regulated by means of a mechanism which requires binding of MS2-CP or UlA to sites in the 5' UTRs of the luciferase mRNAs. B.P. _0r Repressor protein binding diminishes luciferase activity without reduction in luciferase mRNA levels. In view of the analogy with the IRE-IRP system and the 5' UTR location of the RNA-protein complex formation, the effect of the RNA- binding proteins on luciferase activity seemed most likely to be the result of translational repression of the luciferase mRNA. To examine this point in more depth, total RNA prepared from different transformants grown in galactose or lactate medium was analyzed by primer extension (Fig. 5A) and F.P. _ Northern blotting (Fig. SB). The primer extension experiment demonstrated that the TEF] promoter initiated transcription at the same major site irrespective of whether protein-binding sites were inserted downstream or of whether cells were grown FIG. 2. Expression of active MS2-CP (A) and UlA (B) in yeast. in galactose or lactate medium. Moreover, extension products RS453a cells harboring the indicated YCP and FL constructs were were more abundant from cells grown in galactose (Fig. 5A, grown in galactose-containing (lanes 1 through 8) or lactate-containing compare lanes 1 through 3 and 7 through 9 with lanes 4 (lanes 9 through 14) medium for 9 h. Cell extracts were incubated with appropriate RNA probes and analyzed by native PAGE. Positive through 6 and 10 through 12). This finding was confirmed by control samples containing the purified proteins are in lanes 15; the Northern blotting. While the signal for the actin control comigration of these complexes with those in lanes 1 through 6 is displayed little variation, luciferase mRNA levels were in- somewhat obscured by gel "smiling" (longer and shorter exposures of creased two- to threefold after incubation in galactose medium the film for lanes 15 in panels A and B, respectively). RNA-protein (Fig. SB). Thus, full-length luciferase mRNA was actually complexes (bound protein [B.P.]) and free probe (F.P.' and F.P.") are more abundant under conditions in which luciferase activity indicated by arrows. The reasons for the migration of the MS2-CP (particularly from the MSC and UlAwt constructs) was de- probe (A) as a doublet on the nondenaturing gel are not entirely clear creased, and the effective degree of inhibition per unit of and may be related to alternative secondary structures. mRNA exceeded the percent reduction in luciferase activity. The data strongly argue that luciferase mRNA is translation- VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5903

A B logi M52 coat orotein Luclf erase

x x

2 4* -i

a 12 24 hourfI a 24 hour i C D land shmr

...L . A..tA_ U1l/UIA 40:0.^.." of

Zs MSC/CP

.,i: iii "..

msc Ul L

!"Iffl,WIII11 1--'1111.1.11111W

FIG. 4. Time course analysis of luciferase activities (A and B) and binding protein expression (C and D). Double transformants harboring FL-MSC and YCP-CP (A and C) or FL-UlAwt and YCP-U1A (B and D) were pregrown in lactate medium, diluted to an optical density at 600 nm of 0.1 in galactose or lactate medium, and incubated for the indicated times at 30°C under agitation. The luciferase activities measured in extracts from cells grown in galactose were expressed as percentages of those grown in lactate medium. Aliquots of extracts were analyzed in parallel by band shift assays as described for Fig. 2. ally repressed upon MS2-CP or UlA binding. Since it is of exon 3 from the GH gene was generated from the parental technically very difficult to obtain reliable separation of nuclear plasmid D4-GH. This construct, referred to as D4-GHs, en- and cytoplasmic RNAs from yeast, we cannot formally exclude codes a 17.5-kDa GH polypeptide and bears the same pro- the possibility that the 5' UTR RNA-protein complex exerted moter and RNA processing signals as the indicator plasmids an inhibitory effect on the nucleocytoplasmic transport of (Fig. 6). Thus, D4-GHs differs from MSC-GH, MSA-GH, and mature luciferase mRNA without affecting the nuclear stability MSa-GH only by the absence of an MS2-CP binding site and of the retained mRNAs. the deletion of exon 3. The plasmids pSG5-CP and pSG5-UlA Function of MS2-CP as a translational repressor in mam- allowed expression of MS2-CP and UlA, respectively, in malian cells. To assess the scope of translational regulation by mammalian cells from a simian virus 40 early promoter. RNA-binding proteins in eukaryotic cells in general, the HeLa cells were transiently cotransfected with MSC-GH or function of MS2-CP as a translational repressor was tested in MSa-GH as indicators, D4-GHs as an internal control, and human HeLa cells. The high-affinity MS2-CP binding site increasing concentrations of pSG5-CP. After metabolic label- MSC, the lower-affinity site MSA (57), or a variant thereof, ing for 2 h with [35S]methionine, total cellular protein extracts MSa, was introduced into the 5' UTR of an hGH indicator (Fig. 7A) or specifically immunoprecipitated GH and GHs gene (D4-GH; also referred to as L5-GH in reference 7) to (Fig. 7B) were analyzed by SDS-polyacrylamide gel electro- generate MSC-GH, MSA-GH, and MSa-GH, respectively phoresis (PAGE) and autoradiography. Cells that were trans- (Fig. 6). In addition, an internal control plasmid with a deletion fected only with D4-GHs plus MSa-GH or D4-GHs plus 5904 STRIPECKE ET AL. MOL. CELL. BIOL.

A) Primer extension BmnHI Xb ATG TAG D4-GH S@ G 3, 15, 67 1460 160 LAC FL-MSC GAL LAC FL-UlAwt GAL MSa - GH s5 ggttgAgAThAcccsac 3' MSA - GH 5 aagi8gactagAccATAgctagtctcaa 3' LL LLLU U- LL- MSC - GH 5'aagg99acAccATaAggctagtctcaa 3'

AmG TAG D4.OHs 5 short-----OH [I!i 3'

D4-GHS 3 ...~~ 1320 160 A ATG TAG pCMV-Luc 5' 3- FIG. 6. Control and reporter plasmids used in mammalian cell transfection experiments. Relevant restriction sites, nucleotide dis- tances, and nomenclature are indicated. The sequences of the binding site insertions are predicted to form stem-loop structures. Stems are represented by small letters, and bulges and loops are represented by capital letters. Mutations in the loops that alter the protein binding affinity are underlined. The deletion of exon 3 from the hGH gene is 1 23 4 56 789 indicated by the stippled box. Fer, human ferritin heavy-chain pro- B) Ngrthern Blot moter; CMV, cytomegalovirus early promoter. Reporter plasmid FL FL-MSC FL-MSAIFUJ1AwtRL4U1AmUI

Medium G L Gj L G L G L G L G L this repression, transfected HeLa cells were analyzed in parallel for GH protein synthesis by metabolic labeling and for GH mRNA expression by primer extension and Northern -<-Luc blotting. Consistent with the results shown in Fig. 7, MS2-CP (but not U1A) reduced GH synthesis from MSC-GH mRNA without significantly affecting GHs (Fig. 8A). When total RNA was examined by reverse transcription with a primer complementary to a region preceding the GH open reading frame,

1 2 3 4 5 6 7 8 9 10 11 12 two specific extension products of predicted sizes corresponding to MSC-GH (Fig. 8B, lane 1) and D4-GHs (Fig. 8B, lane 3) mRNA which were absent from nontransfected cells (Fig. 8B, cells grown either in lactate (LAC [A] or L [B]) or in galactose (GAL lane 6) could be resolved. When GH synthesis was controlled [A] or G [B]) medium and analyzed by primer extension (A) and by MS2-CP (Fig. 8A; compare lanes 1 and 2 as well as lanes 4 Northern blot (B). (A) The 5' ends of luciferase mRNAs were mapped and 5), both the quantity and length of the GH mRNA were with Moloney murine leukemia virus reverse transcriptase. YCp22FL- the same in the repressed and unrepressed states (Fig. 8B, MSC and -UlA DNAs were sequenced as a reference, using the same lanes 1, 2, 4, and 5). Thus, MS2-CP acts without affecting the primer as for the primer extension reaction. (B) Northern blot showing the relative abundance of luciferase mRNAs. DNA fragments corre- amount or 5' end structure of MSC-GH mRNAs. sponding to luciferase (Luc) and actin (Act) mRNAs were radioac- Since MSC-GH and D4-GHs mRNAs differ by only 143 tively labeled and used as probes. nucleotides, they cannot be adequately resolved on agarose gels for Northern blotting. Thus, MSC-GH and MSA-GH were cotransfected with pSG5-CP or pSG5-UlA and pCMV-Luc instead of D4-GHs as controls. Once again, MS2-CP specifi- MSC-GH expressed two immunoprecipitable polypeptides of cally repressed GH synthesis (relative to coimmunoprecipi- the expected sizes of 22.0 and 17.5 kDa (Fig. 7B, lanes 1, 2, 5, tated luciferase) from MSC-GH (Fig. 9A; compare lanes 1 and and 6) which were absent from nontransfected cells (lane 14). 2). To a much lesser extent, the MSA-GH transcript was also Cotransfection of 0.1 to 3.2 ~xg of pSG5-CP caused expression repressed (Fig. 9A; compare lanes 3 and 4), which is in accord of the 14-kDa MS2-CP (Fig. 7A, lanes 3, 4, and 7 through 12). with the results obtained for its relative MSa-GH (Fig. 7). The presence of MS2-CP reduced GH synthesis from Nuclear and cytoplasmic RNAs were isolated and resolved on MSC-GH in a dose-dependent fashion by up to 94%, while the agarose gels. While the amount of precursor rRNA exceeded highest concentration of pSG5-UlA had little effect on the the level of 18S rRNA in the nuclear fraction, no precursor expression of MSC-GH73;(Fig. compare lanes 6 through 12 rRNA was found in the cytoplasmic fraction on ethidium with lane 13). Compared with the internal control GHs, bromide-stained gels (Fig. 9B), indicating that the cytoplasmic MS2-CP also caused modest suppression of GH synthesis from RNA was not significantly contaminated with nuclear RNA. the lower-affinity construct MSa-GH (Fig. 7B3, lanes 2 through Furthermore, Northern blots hybridized against an hGH in- 4; Table 1). We conclude that mRNAs bearing MS2-CP tron probe confirmed that the cytoplasmic RNA fraction was binding sites were specifically repressed by MS2-CP. Similar not detectably contaminated with nuclear mRNA (data not results were obtained with murine fibroblastoid B6 cells, which shown). Hybridization with a complete hGH gene probe stably expressed MS2-CP (data not shown). demonstrated that the level of cytoplasmic GH mRNA was not MS2-CP binding does not affect nucleocytoplasmic mRNA reduced by the expression of MS2-CP (Fig. 9C, lanes 1 through transport or mRNA stability. To investigate the mechanism of 4). Thus, MS2-CP acts on the translation of MSC-GH (and VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5905

MSa-GH MSC-GH nt

D4-GHs + + + + + + + + + + + + + pSG5-CP - o0.4 3.2 0. I0.2 0.4 0.8 1.6 3.2 - _ pSG5-UIA ...... 3.2- A ) 234 5 6 7 8 91011129 13 114 kDa Total cellular UIA so w ~ ' w IJIAw - protein MW W W, WW X W W. qw-iw -- - IA

4_ .4-J A Jim _.. _8_ . ..j. - 18

CP - #4

B )

I1 21314151617181 91101II121131141 29 Growth hormone immunoprecipitation GH lo -_ _ _ _ - 18

GHs 0- --- 14

FIG. 7. MS2-CP represses GH mRNA translation by binding to 5' UTR sites in transiently transfected HeLa cells. A total of 10 ,.ig of the internal control plasmid D4-GHs (lanes 1 through 13) plus 10 ,ug of the reporter plasmid MSa-GH (lanes 1 through 4) or MSC-GH (lanes 5 through 13) was cotransfected into HeLa cells in the absence (lanes 1, 2, 5, and 6) or presence (lanes 3, 4, and 7 through 12) of the indicated amounts (in micrograms) of the repressor protein expression plasmid pSG5-CP or the nonspecific repressor protein plasmid pSG5-UlAwt (lane 13). Lane 14 corresponds to nontransfected (nt) cells. After transfection and metabolic labeling with [35S]methionine, cell extracts were analyzed either directly by SDS-PAGE (A) or by quantitative growth hormone immunoprecipitation (B). The positions of the UlA and MS2-CP proteins (A) as well as of wild-type (GH) and truncated (GHs) polypeptides (B) are indicated by arrows. In lanes 3, 7, 8, and 9, the levels of MS2-CP are too low to be seen clearly in total cell extracts. Molecular mass markers are on the right.

MSA-GH) mRNAs without affecting the stability or the nu- effectors. These findings suggest that a common, relatively cleocytoplasmic transport of the respective transcripts. simple mechanism (see below) to regulate the translation of cytoplasmic mRNAs can operate in most if not all eukaryotic DISCUSSION cells. The best-studied system for translational regulation in yeast A common principle for translational regulation in eukary- is the amino acid control of GCN4 synthesis by a kinase- otic cells. In this study, we have employed yeast, murine, and dependent reinitiation mechanism (25). In multicellular eu- human cells, two different RNA-binding proteins with three karyotic organisms, iron regulation of ferritin and erythroid variant binding sites each, and transient as well as stable 5-aminolevulinate synthase expression by binding of IRP to repressor protein expression systems to investigate the role of IREs in the mRNAs is the most intensively studied example RNA-binding proteins in translational regulation. When ap- (29, 35). Our data show that the yeast translation apparatus is propriate binding sites were introduced into a cap-proximal also amenable to regulation by mRNA-protein interactions, was position in the 5' UTR of mRNAs, mRNA translation even when the RNA-binding proteins that are employed as regulated in mammalian and yeast cells by RNA-binding repressors do not fulfill this function in their normal cellular proteins that have not evolved to act as eukaryotic translational environments. Moreover, recent work has demonstrated that the IRE-IRP regulatory system can be reconstructed in S. cerevisiae (38). Autoregulation of the ribosomal protein L32 of MSa-GH and TABLE 1. Quantitative analysis of the repression could perhaps prove to be a physiological example of this type MSC-GH mRNAs by MS2-CP in HeLa cells of mechanism in yeast (10). % Expression with amt (,ug) of pSG5-CPa Efliciency of RNA-binding proteins as translational effec- mRNA tors. In human and in murine cells, the translation of MSC-GH 0 0.1 0.2 0.4 0.8 1.6 3.2 mRNA is repressed up to 20-fold by MS2-CP (Table 1 and MSa 100 ND ND 80 ND ND 61 data not shown). This efficiency of MS2-CP to function as a MSC 100 45 33 18 13 8 6 translational repressor in mammalian cells contrasts with the relative inefficiency of the UlA protein to do so. The differ- a The data shown in Fig. 7 were quantitated by phosphorimaging analysis. Values for GH were normalized for GHs expression and are expressed as ences between the translation of UlAwt-GH mRNA and that percentages of expression in the absence of MS2-CP. ND, not determined. of UlAmut-GH mRNA in HeLa and B6 cells were minor 5906 STRIPECKE ET AL. MOL. CELL. BIOL.

A) ImmunopreCipitatfon B) Primer Extension

- lMS2-CP - + Binding protein UMCA +F - |UlA + - MSC-GH + + + + +- + IMSC-GH GH-construct D4-GHs - 4+ D4-GHs - - + + +

MSC-GH ---> M 4_

short GH--->

1 2 3 4 5 MSC-GH ---> O'd-

short GM H-*9>

1 2 3 4 5 6 FIG. 8. Repression of MSC-GH mRNA by MS2-CP does not alter the GH mRNA. HeLa cells were cotransfected transiently with 0.4 jig of pCMV-luc (lanes 1 through 6), 10 ,ug of MSC-GH (lanes 1, 2, 4, and 5), 10 ,ug of D4-GHs (lanes 3 through 5), and 0.4 ,ug of pSG5-UlAwt (lanes 1, 3, and 4) or pSG5-CP (lanes 2 and 5), as indicated. (A) Metabolically labeled cell extracts were analyzed by quantitative GH immunoprecipitation as described for Fig. 7. The positions of wild-type (GH) and shortened (GHs) polypeptides are indicated by arrows. (B) Primer extension analysis was performed with total RNA samples prepared from cells transfected in parallel. A probe that hybridizes to both MSC-GH and D4-GHs mRNAs was used, and the quantitative nature of the assay was confirmed by primer titration (data not shown). The migration of the labeled cDNA products is indicated by arrows.

(consistent reductions less than twofold), irrespective of interferes with the translation initiation pathway has recently whether the endogenous UlA protein was supplemented with been characterized (17). In the work described here, we exogenously transfected UlA (data not shown). The reasons wanted to gain insight into the question of whether the effect of for this unexpected result are not entirely clear, but UlA is a IRE-IRP complexes on the translation apparatus requires predominantly nuclear protein and subject to negative auto- specific interactions with other proteins or modification of regulation at the level of polyadenylation (3, 27). It seems translation factors or, alternatively, whether IRP interferes probable that nuclear localization, negative autoregulatory sterically with translation initiation. The data show that two homoeostatic mechanisms, or competition between the re- proteins which are physiologically not involved in translational porter mRNA and the physiological binding sites (Ul small control can affect translation in the context of the luciferase nuclear RNA and UlA mRNA) accounts for these results. and GH reporter mRNAs used here. These results appear to This notion is further supported by the finding that the UlA exclude a requirement for specific interactions of a repressor protein can function efficiently as a translational repressor for protein with other proteins or modification of initiation fac- both polyadenylated and nonadenylated transcripts in a mam- tors. They rather argue that the eukaryotic translation initia- malian cell-free translation system (52, 53). In S. cerevisiae, tion pathway can be blocked by a steric barrier. The IRE-IRP both UlA and MS2-CP reduce luciferase activity expressed system may represent the prototypic physiological example of from appropriate indicator constructs 5- to 10-fold, with such a mechanism for translational regulation, since the bind- MS2-CP consistently yielding a higher degree of repression ing of UlA and that of MS2-CP to sites positioned to resemble (Fig. 3). Since the luciferase mRNA levels are increased two- the location of the IRE yield responses in a manner that is to threefold under the conditions in which the repressor qualitatively and quantitatively similar to that of the binding of protein is expressed (Fig. 5), the effective translational repres- IRP to IREs: iron regulation of IRE-containing hGH indicator sion per unit of mRNA is more likely to be in the range of 20- mRNAs was -9-fold (15), compared with the -12- to 16-fold to 30-fold for both repressor proteins. regulation of MSC-GH by MS2-CP in transfected HeLa cells Is IRP the prototypic example of a steric translational (Fig. 8; Table 1). Moreover, both IRE-IRP and Ul-UlA block repressor? The mechanism by which an IRE-IRP complex translation initiation by preventing the same step in the VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5907

A) lmmunoprecipitation B) EtBr-stained RNA Gel C) Northern Blot

pSG5-CP - cytopi. RNA nuclear RNA RNA nuclear RNA Binding protein h -- cylopi. pSG5-U1Al A + MSC-GH - - GH-construct - - MSA-GH + Transtec. controll CMV-Luc + 28S- kDa luciferase -- .. -43 Iuc-_ .9 *#ee

-29 18S-

hGH --- 18 hGHi.4.4L

1 2 3 4

1 2 3 4 1 2 34 1 2 3 4 1 2 3 4 FIG. 9. The cytoplasmic levels of translationally repressed GH mRNAs are not altered. HeLa cells were transiently cotransfected with 0.4 ,ug of pCMV-luc (lanes 1 through 4), 0.4 ,ug of the specific repressor plasmid pSG5-CP (lanes 2 and 4) or the nonspecific repressor plasmid pSG5-UlAwt (lanes 1 and 3), and 10 jig of the reporter plasmid MSC-GH (lanes 1 and 2) or MSA-GH (lanes 3 and 4). (A) Cells were labeled with [35S]methionine, and lysates were analysed by simultaneous, quantitative luciferase and GH immunoprecipitation (the positions are indicated by arrows on the left; molecular mass standards are on the right). (B and C) Nuclear and cytoplasmic RNAs were isolated from cells transfected in parallel with those in panel A and separated in a 2% agarose-formaldehyde gel containing ethidium bromide (EtBr). The gel was exposed to UV illumination; rRNAs were visualized and are indicated by arrows. (C) The RNA was blotted and hybridized against luciferase and hGH probes. The migration of the corresponding mRNAs is indicated by arrows. assembly of a functional ribosome on the mRNA (17). We between MS2-CP (compared with U1A) and its binding sites suggest that IRP is a steric inhibitor of translation and that would provide a straightforward explanation, although this IRP, UIA, and MS2-CP belong to the same mechanistic class seems unlikely in view of affinity constant measurements for of translational regulators. similar sites (22, 54, 57) and of previous findings in cell-free Mechanistic aspects of translational regulation by steric translation systems (53). Alternatively, the ability of the hindrance. The steric hindrance model may be conceptually MS2-CP to multimerize might enhance its activity as a steric appealing because of its relative simplicity, but it should not be translational repressor by allowing it to form a larger complex oversimplified. For example, threonyl-tRNA synthetase and that more effectively blocks translation initiation. Mutants of the ribosomal proteins S4 and S15 autoregulate the translation MS2-CP which bind to RNA with unaltered affinity but fail to of their mRNAs in Escherichia coli by binding to sites within form multimers (42) could be used to test this hypothesis. the 5' UTRs of the respective mRNAs, but the molecular If the mere binding of a protein to a cap-proximal site in the mechanisms by which the proteins exert their roles as transla- mRNA suffices to block its translation, how can mRNAs be tional repressors are quite different: S4 and S15 binding translated at all, considering the relative abundance of general entraps the 30S ribosomal subunit in an inactive conformation RNA-binding proteins in the cytoplasm of cells? As discussed bound to the mRNA, whereas threonyl-tRNA synthetase above and shown by our results (Fig. 3, 4, and 7), the affinity of appears to prevent binding of the 30S subunit to the mRNA by interaction and the cellular concentration of the binding an occlusion mechanism (5, 44,51). The function of IRP, UlA, protein must be such that occupancy of the binding sites by the and MS2-CP as translational effectors in vivo (this report and protein is ensured. The cytoplasmic concentrations and affin- reference 15) and in vitro (18, 53, 56) provides an experimental ities of RNA-binding proteins may limit their potential to basis for defining mechanisms involved in eukaryotic transla- sterically interfere with mRNA translation nonspecifically. On tional regulation with similar molecular precision. the other hand, it is well established that in many cell types a A common feature of IRP, UlA, and MS2-CP is their large fraction of cytoplasmic mRNAs can be found in the binding to RNA sequences that form hairpin structures of translationally inactive cytoplasmic mRNP pool (1, 20). The moderate stabilities. None of the three structures strongly binding of cytoplasmic proteins to cap-proximal positions of affects translation per se, although more-stable hairpins can mRNAs could potentially account for the exclusion of a impede translation without a requirement for a binding protein significant fraction of cytoplasmic mRNAs from translationally (30, 39, 43, 55). The question therefore arises as to which of the active ribosomes. two components represents the active inhibitor in the systems Implications of the steric hindrance mechanism for the studied here: the RNA hairpin after stabilization by the investigation of RNA-protein interactions and for the cloning binding protein, or the protein itself, in which case the RNA of RNA-binding proteins. RNA-protein interactions play cru- motif would simply act as a binding site. Our data do not allow cial roles in many cellular processes ranging from RNA to distinguish between these two models, but evaluation of processing to protein secretion and viral replication (12, 37, RNA-binding proteins that recognize apparently nonstruc- 49). Our findings suggest that RNA-protein interactions can be tured sites may help to find an answer. It is important to note studied in vivo, independently of their physiological roles, by that under all in vivo conditions tested, MS2-CP appeared to functional conversion of RNA-protein complexes into transla- be a more effective repressor than UlA. A higher affinity tional effector pairs. For example, by following the strategy 5908 STRIPECKE ET AL. MOL. CELL. BIOL. employed here for UIA and MS2-CP, it should be possible to of the firefly luciferase assay as a reporter gene in mammalian cell evaluate and possibly select for RNA binding site variants with lines. BioTechniques 7:116-121. altered affinities for the binding protein or for RNA-binding 5. Brunel, C., J. Caillet, P. Lesage, M. Graffe, J. Dondon, H. Moine, mutants with different RNA site P. Romby, C. Ehresmann, B. Ehresmann, and M. Grunberg- protein binding specificities. Manago. 1992. Domains of the Escherichia coli threonyl-tRNA RNA-binding proteins such as MS2-CP could also be uti- synthetase translational operator and their relation to threonine lized for the construction of expression systems that can be tRNA isoacceptors. J. Mol. Biol. 227:621-634. regulated translationally. Such approaches may be particular- 6. Carey, J., V. Cameron, P. L. de Haseth, and 0. C. Uhlenbeck. ly helpful when the effect of mRNA translation on other 1983. Sequence-specific interaction of R17 coat protein with its cellular processes (such as mRNA degradation, localization, or ribonucleic acid binding site. Biochemistry 22:2601-2610. transport) is under investigation. These questions are usually 7. Casey, J. L., M. W. Hentze, D. M. Koeller, S. W. Caughman, T. A. addressed by using inhibitors of translation, which block Rouault, R. D. Klausner, and J. B. Harford. 1988. Iron-responsive translation generally and thus profoundly perturb cellular elements: regulatory RNA sequences that control mRNA levels metabolism. and and translation. Science 240:924-928. By using RNA-binding proteins appropriate 8. Chen-Kiang, S., and D. J. Lavery. 1989. Preparation of precursors binding sites in the 5' UTR of the mRNA of interest, the to mRNA from mammalian cell nuclei. Methods Enzymol. 180: translation of this transcript can be regulated with little, if any, 69-83. effect on the translation of other mRNAs. In addition, such 9. Chu, E., D. Voeller, D. M. Koeller, J. C. Drake, C. H. Takimoto, regulatable translation systems could be combined with other G. F. Maley, F. Maley, and C. J. Allegra. 1993. Identification of an modes of regulating the expression or function of proteins, e.g., RNA binding site for human thymidylate synthase. Proc. Natl. inducible promoters or fusion of the RNA-binding protein to Acad. Sci. USA 90:517-521. hormone-responsive domains (45) to improve the properties of 10. Dabeva, M. D., and J. R. Warner. 1993. Ribosomal protein L32 of expression systems. Saccharomyces cerevisiae regulates both splicing and translation of with the transfection controls D4-GHs its own transcript. J. Biol. Chem. 268:19669-19674. Finally, compared 11. Ding, D., and H. D. Lipshitz. 1993. Localized RNAs and their (Fig. 7 and 8) and luciferase (Fig. 9) or the yeast constructs functions. Bioessays 15:651-658. MSA/del and UlAmut (Fig. 3), even the lower-affinity con- 12. Gait, M. J., and J. Karn. 1993. RNA recognition by the human structs MSA-GH and MSa-GH or FL-MSA and FL-UlAwt/ immuno-deficiency virus Tat and Rev proteins. Trends Biochem. del display some specific reduction in their translation when Sci. 18:255-259. the appropriate binding proteins are overproduced. The high 13. Gold, L. 1988. Posttranscriptional regulatory mechanisms in Esch- level of cytoplasmic expression of the binding proteins must be erichia coli. Annu. Rev. Biochem. 57:199-233. sufficient to ensure translationally relevant occupancy of even 14. Goossen, B., S. W. Caughman, J. B. Harford, R. D. Klausner, and these lower-affinity binding sites. This suggests that the scope M. W. Hentze. 1990. Translational repression by a complex of interactions that can be studied in this is between the iron-responsive element of ferritin mRNA and its RNA-protein way specific cytoplasmic binding protein is position-dependent in vivo. not limited to those with exceptionally high binding affinities. EMBO J. 9:4127-4133. This system might also allow the cloning of cDNAs for 15. Goossen, B., and M. W. Hentze. 1992. Position is the critical RNA-binding proteins. A yeast cDNA library could be pre- determinant for function of iron-responsive elements as transla- pared from cells that express the RNA-binding protein of tional regulators. Mol. Cell. Biol. 12:1959-1966. interest in an inducible expression vector, and the RNA- 16. Graham, F. L., and A. J. van der Eb. 1973. A new technique for the binding site could be cloned into the 5' UTR of an mRNA assay of infectivity of human adenovirus 5 DNA. Virol. 52:456- which encodes a selectable marker. It should then be possible 464. to identify and clone cotransformants carrying the cDNA for 17. Gray, N. K., and M. W. Hentze. Iron regulatory protein prevents the binding protein through reduced expression of the marker binding of the 43S translation pre-initiation complex to ferritin Such may be useful in cases in mRNA. EMBO J., in press. protein. strategies particularly 18. Gray, N. K., S. Quick, B. Goossen, A. Constable, H. Hirling, L. which cloning by conventional means is hindered by the low Kuhn, and M. W. Hentze. 1993. Recombinant iron regulatory abundance of the protein or lack of suitable biological mate- factor functions as an IRE-binding protein, a translational repres- rial. sor and an aconitase. A functional assay for translational repression and direct demonstration of the iron switch. Eur. J. Biochem. ACKNOWLEDGMENTS 18:657-667. 19. Green, S., I. Issemann, and E. Sheer. 1988. A versatile in vivo and We thank Hansjoerg Hauser for luciferase antibodies and the in vitro eukaryotic expression vector for protein engineering. National Hormone and Pituitary Program (Baltimore, Md.) for GH Nucleic Acids Res. 16:369. antibodies. We gratefully acknowledge Yves Henry for helpful techni- 20. Gross, K. W., M. Jacobs-Lorena, C. Baglioni, and P. R. Gross. cal advice, Britta Goossen for contributions to the yeast experiments, 1973. Cell-free translation of maternal messenger RNA from sea and Jeremy Brock, Anne Ephrussi, and lain Mattaj as well as the urchin eggs. Proc. Natl. Acad. Sci. USA 70:2614-2618. members of our groups for comments on the manuscript. 21. Guthrie, C., and G. R. Fink. 1991. Guide to yeast genetics and The Conselho Nacional de Desenvolvimento Cientifico e Tecno- molecular biology. Methods Enzymol. 194:384. logico (CNPq) provided grants to R.S. and C.C.O. 22. Hall, K. B., and W. T. Stump. 1992. Interaction of N-terminal domain of UlA protein with an RNA stem/loop. Nucleic Acids REFERENCES Res. 20:4283-4290. 1. Bag, J., and S. Sarkar. 1976. Studies on a nonpolysomal ribonu- 23. Hentze, M. W., S. W. Caughman, T. A. Rouault, J. G. Barriocanal, cleoprotein coding for myosin heavy chains from chick embryonic A. Dancis, J. B. Harford, and R. D. Klausner. 1987. Identification muscles. J. Biol. Chem. 251:7600-7609. of the iron-responsive element for the translational regulation 2. Boelens, W., D. Scherly, E. J. R. Jansen, K. Kolen, I. W. Mattaj, ferritin mRNA. Science 238:1570-1578. and W. J. van Venrooij. 1991. Analysis of in vitro binding of UlA 24. Hentze, M. W., S. Keim, P. Papadopoulos, S. O'Brien, W. Modi, J. protein mutants to Ul snRNA. Nucleic Acids Res. 19:4611-4618. Drysdale, W. L. Leonard, J. B. Harford, and R. D. Klausner. 1986. 3. Boelens, W. C., E. J. R. Jansen, W. J. van Venrooij, R. Stripecke, Cloning, characterization, expression, and chromosomal localiza- I. W. Mattaj, and S. I. Gunderson. 1993. The human Ul snRNP- tion of a human ferritin heavy-chain gene. Proc. Natl. Acad. Sci. specific UlA protein inhibits polyadenylation of its own pre- USA 83:7226-7230. mRNA. Cell 72:881-892. 25. Hinnebusch, A. G. 1990. Involvement of an initiation factor and 4. Brasier, A. R., J. E. Tate, and J. F. Habener. 1989. Optimized use protein phosphorylation in translational control of GCN4 mRNA. VOL. 14, 1994 TRANSLATIONAL CONTROL BY mRNA-PROTEIN INTERACTIONS 5909

Trends Biochem. Sci. 15:148-152. increase secondary structure within the 5' noncoding region of a 26. Jackson, R. 1993. Cytoplasmic regulation of mRNA function: the eukaryotic mRNA reduces translational efficiency. Cell 40:515- importance of the 3' untranslated region. Cell 74:9-14. 526. 27. Kambach, C., and I. W. Mattaj. 1992. Intracellular distribution of 44. Philippe, C., F. Eyermann, L. Benard, C. Portier, B. Ehresmann, the UlA protein depends on active transport and nuclear binding and C. Ehresmann. 1993. Ribosomal protein S15 from Escherichia to Ul snRNA. J. Cell Biol. 118:11-21. coli modulates its own translation by trapping the ribosome on the 28. Kingsman, S. M., D. Cousens, C. H. Stanway, A. Chambers, M. mRNA initiation loading site. Proc. Natl. Acad. Sci. USA 90:4394- Wilson, and A. J. Kingsman. 1990. High-efficiency yeast expres- 4398. sion vectors based on the promoter of the phosphoglycerate kinase 45. Picard, D., S. J. Salser, and K. R. Yamamoto. 1988. A movable and gene. Methods Enzymol. 185:329-341. regulable inactivation function within the steroid binding domain 29. Klausner, R. D., T. A. Rouault, and J. B. Harford. 1993. Regulat- of the glucocorticoid receptor. Cell 54:1073-1080. ing the fate of mRNA: the control of cellular iron metabolism. Cell 46. Sachs, A. B. 1993. Messenger RNA degradation in eukaryotes. 72:19-28. Cell 74:413-421. 30. Kozak, M. 1986. Influences of mRNA secondary structure on 47. Schafer, M., R. Kuhn, F. Bosse, and U. Schafer. 1990. A conserved initiation by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA element in the leader mediates post-meiotic translation as well as 83:2850-2854. cytoplasmic polyadenylation of a Drosophila spermatocyte mRNA. 31. Kozak, M. 1987. At least six nucleotides preceding the AUG EMBO J. 9:4519-4525. initiator codon enhance translation in mammalian cells. J. Mol. 48. Scherly, D., W. Boelens, W. J. van Venrooij, N. A. Dathan, J. Biol. 196:947-950. Hamm, and I. W. Mattaj. 1989. Identification of the RNA binding 32. Leibold, E. A., and H. N. Munro. 1988. Cytoplasmic protein binds segment of human UlA protein and definition of its binding site in vitro to a highly conserved sequence in the 5' untranslated on U1 snRNA. EMBO J. 8:4163-4170. regions of ferritin heavy- and light-subunit mRNAs. Proc. Natl. 49. Siegel, V., and P. Walter. 1988. Each of the activities of signal Acad. Sci. USA 85:2171-2175. recognition particle (SRP) is contained within a distinct domain: 33. Lowary, P. T., and 0. C. Uhlenbeck. 1987. An RNA mutation that analysis of biochemical mutants of SRP. Cell 52:39-49. increases the affinity of an RNA-protein interaction. Nucleic Acids 50. Sillekens, P.-G., W. Habets, R. Beijer, and W. J. van Venrooij. Res. 15:10483-10493. 1987. cDNA cloning of the human Ul snRNA-associated A 34. McCarthy, J. E. G., and C. Gualerzi. 1990. Translational control of protein: extensive homology between Ul and U2 snRNP-specific prokaryotic gene expression. Trends Genet. 6:78-85. proteins. EMBO J. 6:3841-3848. 35. Melefors, O., and M. W. Hentze. 1993. Translational regulation by 51. Spedding, G., and D. E. Draper. 1993. Allosteric mechanism for mRNA/protein interactions in eukaryotic cells: ferritin and be- translational repression in the Escherichia coli a operon. Proc. yond. Bioessays 15:85-90. Natl. Acad. Sci. USA 90:4399-4403. 36. Merrick, W. C. 1992. Mechanism and regulation of eukaryotic 52. Stripecke, R. 1993. mRNA-specific translational control in eukary- protein synthesis. Microbiol. Rev. 56:291-315. otic cells by proteins binding to the 5' untranslated region. Ph.D. 37. Moore, M. J., C. Query, and P. A. Sharp. 1993. Splicing of thesis. University of Heidelberg, Heidelberg, Germany. precursors to mRNA by the spliceosome, p. 303-357. In R. F. 53. Stripecke, R., and M. W. Hentze. 1992. Bacteriophage and spli- Gesteland and J. F. Atkins (ed.), The RNA world. Cold Spring ceosomal proteins function as position-dependent cis/trans repres- Harbor Laboratory Press, Cold Spring Harbor, New York. sors of mRNA. Nucleic Acids Res. 20:5555-5564. 38. Oliveira, C. C., B. Goossen, N. I. T. Zanchin, J. E. G. McCarthy, 54. van Gelder, C. W. G., S. I. Gunderson, E. J. R. Jansen, W. C. M. W. Hentze, and R. Stripecke. 1993. Translational repression by Boelens, M. Polycarpou-Schwarz, I. W. Mattaj, and W. J. van the human iron-regulatory factor (IRF) in Saccharomyces cerevi- Venrooij. 1993. A complex secondary structure in UlA pre-mRNA siae. Nucleic Acids Res. 21:5316-5322. that binds two molecules of UIA protein is required for regulation 39. Oliveira, C. C., J. J. van den Heuvel, and J. E. G. McCarthy. 1993. of polyadenylation. EMBO J. 12:5191-5200. Inhibition of translational initiation in Saccharomyces cerevisiae by 55. Vega Laso, M. R., D. Zhu, F. Sagliocco, A. J. P. Brown, M. F. Tuite, secondary structure: the roles of the stability and position of and J. E. G. McCarthy. 1993. Inhibition of translational initiation stem-loops in the mRNA leader. Mol. Microbiol. 9:521-532. in the yeast Saccharomyces cerevisiae as a function of the stability 40. Ostareck-Lederer, A., D. H. Ostareck, N. Standart, and B. J. and position of hairpin structures in the mRNA leader. J. Biol. Thiele. 1994. Translation of 15-lipoxygenase mRNA is inhibited by Chem. 268:6453-6462. a protein that binds to a repeated sequence in the 3' untranslated 56. Walden, W. E., M. M. Patino, and L. Gaftield. 1989. Purification of region. EMBO J. 13:1476-1481. a specific repressor of ferritin mRNA translation from rabbit liver. 41. Peabody, D. S. 1990. Translational repression by bacteriophage J. Biol. Chem. 264:13765-13769. MS2 coat protein expressed from a plasmid. J. Biol. Chem. 57. Witherell, G. W., J. M. Gott, and 0. C. Uhlenbeck. 1991. Specific 265:5684-5689. interaction between RNA phage coat proteins and RNA. Prog. 42. Peabody, D. S., and K. R. Ely. 1992. Control of translational Nucleic Acid Res. Mol. Biol. 40:185-220. repression by protein-protein interactions. Nucleic Acids Res. 58. Zuker, M., and P. Stiegler. 1980. Optimal computer folding of 20:1649-1655. large RNA sequences using thermodynamics and auxiliary infor- 43. Pelletier, J., and N. Sonenberg. 1985. Insertion mutagenesis to mation. Nucleic Acids Res. 9:133-148.