US009428749B2
(12) United States Patent (10) Patent No.: US 9,428,749 B2 van Rooij et al. (45) Date of Patent: Aug. 30, 2016
(54) CONTROL OF WHOLE BODY ENERGY 8,304,397 B2 11/2012 Olson etal. HOMEOSTASIS BY MICRORNA eee 55 Teta Onn ‘ a 1 ’ son ¢ . REGULATION 8,642,751 B2 2/2014 Dalbyet al. (71) Applicants: THE BOARD OF REGENTS, THE 8,716,258 B2* 5/2014 Olson “en we. C12Nrrr15/113 UNIVERSITY OF TEXAS SYSTEM, 8,962,588 B2* 2/2015 Olson ou. A61K 31/7105
Austin, TX (US); MIRAGEN 2004/0127443 Al 7/2004 Pershadsinghershadsing Saag THERAPEUTICS,INC., Boulder, CO 2004/0157790 Al 8/2004 Herweijer etal. (US) 2005/0059005 Al 3/2005 Tuschlet al. 2005/0075492 Al 4/2005 Chenetal. (72) Inventors: Eva van Rooij, Utrecht (NL); Eric 2005/0124568 Al 6/2005 Usman etal.
Oban, Dal7 TE (USCa : Bogeae tLe Eaorvitz et al. Caeter: Richardson. eSys Rusty 2006/0185027 Al 8/2006 Bartel et al. ontgomery, Boulder, (US) 2007/0287179 Al 12/2007 Tuschletal. 2007/0292878 Al 12/2007 Raymond. (73) Assignees: THE BOARD OF REGENTS, THE 2008/0050744 Al 2/2008 Brownet al. —_- UNIVERSITY OF TEXAS SYSTEM, 2008/0176766 Al 7/2008 Brownetal.
Austin, TX (US); MIRAGEN 200910108174 AL 42009 Tayasenaayasena THERAPEUTICS, INC., Boulder, CO 2009/0137504 Al 5/2009 Echwaldet al. (US) 2009/0143326 Al 6/2009 Obadet al. 2009/0180957 Al 7/2009 Olsonet al. (*) Notice: Subject to any disclaimer, the term of this 2009/0286969 Al 11/2009 Esau et al. patent is extended or adjusted under 35 2009/0291906 Al 11/2009 Esauet al. U.S.C. 154(b) by 30 days 2009/0291907 Al 11/2009 Esauetal. (Continued) (21) Appl. No.: 14/350,027 FOREIGN PATENT DOCUMENTS (22) PCT Filed: Oct. 9, 2012 EP 1959012 A2 8/2008 (86) PCT No.: PCT/US2012/059349 EP 2113567 AL 11/2009 (Continued) 5)Dawn Aug. 6, 2014 OTHER PUBLICATIONS : . 6, . Diseases and Conditions Metabolic syndrome by Mayo Clinic Staff, (87) PCT Pub. No.: WO2013/052965 Aug. 22, 1014, pp. 1-2, retrieved on Nov. 2, 2015 from www. PCT Pub. Date: Apr. 11, 2013 mayoclinic.org/diseases-conditions/metabolic syndrome/bascis/ symptoms.* (65) Prior Publication Data van Rooij et al. Cell 24, 2008, pp. 159-166.* Agrawalet al., “Antisense therapeutics: is it as simple as comple- US 2014/0303236 Al Oct. 9, 2014 mentary base recognition?” Molecular Med. Today, vol. 6, pp. 72-81 (2000). Related U.S. Application+ att Data Anselmino: et: al., » “Implicationsmp of : abnormal &glucose metabolism: in patients with coronary artery disease,” Diab. Vasc. Dis. Res. (60) Provisional application No. 61/544,187,filed on Oct. 5(A):285-290 (2008). 6, 2011, provisional application No. 61/638,345, filed Chirila et al., “The use of synthetic polymers for delivery of on Apr. 25, 2012. therapeutic antisense oligodeoxynucleotides,” Biomaterials, vol. 23, pp. 321-342 (2002). (51) Int. CL (Continued) CI2N 15/1 (2006.01) CI2N 15/113 (2010.01) Primary Examiner — Brian Whiteman (52) U.S. Cl. (74) Attorney, Agent, or Firm — Cooley LLP CPC ...... CI2N 15/113 (2013.01); CI2N 2310/113 (57) ABSTRACT (2013.01); Cl2N 2310515a5(0013.01) The disclosure provides a method of regulating fatty acid or 58) Field of Classification S h , glucose metabolism in a cell by contacting the cell with a (58) cPC on asl cation ON1 5/113: CION 2310/14 modulator of miR-208a and/or miR-208b activity or expres- S olioeoefilef \ ? h hi sion. The disclosure also provides a method of treating or ee application file tor complete search history. preventing a metabolic disorder, such as obesity, diabetes, or : metabolic syndrome, in a subject by administering to the (56) References Cited subject an inhibitor of miR-208a and/or miR-208b activity U.S. PATENT DOCUMENTS. or expression. Also provided is a method of enhancing or improving mitochondrial function and/or redox-homeostasis 6,632,628 Bl 10/2003 Olson etal. in a subject by administering to the subject an inhibitor of rears BS .sero Ten .il miR-208a and/or miR-208b activity or expression. 1 1 ue ¢ . 8,222,221 B2 7/2012 Coreyet al. 19 Claims, 10 Drawing Sheets US 9,428,749 B2 Page 2
(56) References Cited WO WO 2009/114681 A2 9/2009 =—_ WO WO 2009/149182 Al 12/2009 U.S. PATENT DOCUMENTS WO WO 2010/048585 A2 4/2010 WO WO 2010/091204 Al 8/2010 2009/0293148 Al 11/2009 Renet al. WO WO 2010/144485 Al 12/2010 2009/0326049 Al 12/2009 Aristarkhovetal. WO WO 2011/139911 A2 11/2011 2010/0004320 Al 1/2010 Elmenet al. WO WO 2011/154553 A2 12/2011 2010/0029003 Al 2/2010 Bartel et al. WO WO 2011/158191 Al 12/2011 2010/0173288 Al 7/2010 Zhanget al. WO WO 2012/006577 A2 1/2012 2010/0210712 Al 8/2010 Hansenet al. WO WO 2012/020307 A2 2/2012 — 2010/0269183 Al 10/2010 Olsonetal. WO WO 2012/027206 Al 3/2012 2010/0280094 Al 11/2010 Beuvink etal. WO WO 2012/149646 Al 11/2012 2010/0292297 AL* 11/2010 Wang o..ccccesssee: C12N514/44415/113. WOWO 2013/0529652013/054113 AlA2 4/2013 =— 2010/0298410 Al 11/2010 Obadetal. WO WO 2013/057527 A2 4/2013 — 2011/0020345 Al ‘1/2011 Herringetal. WO WO 2013/059496 Al 4/2013 2011/0071211 Al 3/2011 Thum etal. WO WO 2013/087907 Al 6/2013 2011/0098338 Al 4/2011 Hajjar etal. WO WO 2013/088338 Al 6/2013 2011/0105593 Al 5/2011 Steelet al. WO WO 2013/090457 A2 6/2013 2011/0117560 Al $/2011 Spinale et al. 2011/0152352 Al 6/2011 Hata et al. OTHER PUBLICATIONS soi loreoss ‘I ooort Andersonet al. Crooke,S., “Progress in Antisense Technology,” Annu. Rev. Medi- 2011/0294869 Al 12/2011 Petersen cine, vol. 55, pp. 61-95 (2004), —— 2011/0313019 Al 12/2011 Swayzeetal. Fichtlscherer et al., “Circulating MicroRNAs in Patients With 9012/0035243 Al 9/2012 Olson et al. Coronary Artery Disease,” Circ. Res. 107(5):677-684 (2010). 2012/0041052 Al 2/2012 Beuvink et al. Fichtlscherer et al., “Circulating MicroRNAs. Biomarkers or 2012/0083596 Al 4/2012 Elmenetal. Mediators of Cardiovascular Diseases?” Arterioscler. Thromb. 2012/0114744 Al 5/2012 Beuvink et al. Vasc. Biol. 31(11):2383-2390 (2011). 2012/01845962012/0172416 Al 7/2012 VelinDalbyetetal.al. 074866,International14 pagesSearch(mailedReportJun.and20,Written2008).Opinion for PCT/US2007/ sor eperasos ‘I peer Hardeeet al International Preliminary Report on Patentability, PCT appl..No. 5013/0079508 Al 3/2013 Moeller etal. PCT/US2011/065121, 9 pages (Jun. 18, 2013). | 2013/0096290 Al 4/2013 Brown International Preliminary Report on Patentability, PCT appl. No. 2013/0109738 Al 5/2013 Chang et al. PCT/US2012/059349, 10 pages (Apr. 8, 2014). 2013/0137753 Al 5/2013 Samantet al. International Search Report, PCT appl..No. PCT/US2011/065121, 5 2013/0150256 Al 6/2013. Synnergrenetal. pages (Jun. 5, 2012). 2013/0156845 Al 6/2013 Manoharan etal. International Search Report, PCT appl. No. PCT/US2012/059349, 8 2013/0157883 Al 6/2013 Keller et al. pages (Apr. 1, 2013). 2013/0171242 Al 7/2013 Lim etal. Jang et al., “Gene delivery from polymer scaffolds for tissue = 2014/0187603 Al 7/2014 Dalby et al. engineering,” Expert Rev. Medical Devices, vol. 1, No. 1, pp. 127-138 (2004). FOREIGN PATENT DOCUMENTS Krutzfeldt, J., et al. (2005) Silencing of microRNAsin vivo with ‘antagomirs’. Nature, v.438, pp. 685-689. EP 2194129 A2 6/2010 Lagos-Quintanaet al., “Identification of tissue-specific microRNAs EP 2208798 Al 7/2010 from mouse,” Current Biology, vol. 12:735-739, 2002. EP saanaoe ‘i Hoot Lagos-Quintanaet al., “New microRNAsfrom mouse and human,” EP 2447274 A2 5/2012 RNA,vol. 9:175-179, 2003. ; EP 2205737 Bl 2/2013 Montgomery et al., “Therapeutic Inhibition of miR-208a Improves EP 2550442 Al 2/2013 Cardiac Function and Survival During Heart Failue,” Cire. EP 2604690 Al 6/2013 124(14):1537-1547, Supplemental Material (2011). EP 2610342 Al 7/2013 Myocardial Infarction definition [online]. [retrieved on Feb. 23, Wo WO 2005/013901 A2 2/2005 2012]. Retrieved from the Internet:
PIGURE i
BW HUEY * A , 5D ¥
ao E soma
Be i
3 20 4 10-4 44
i ’ R ge ¢ Saline AR1SS94 M.PO104 Saline PAGS} M-t0101
C HWkt D HWE 200- Wy wp 1804 SE 8 $ = ang eM = = x x 4 emmnemnneirewnnn SS 5
tenement Saline Saline M0594 RMA18404
#9<0,05 vs, Saline *p U.S. Patent Aug.30, 2016 Sheet 2 of 10 US 9,428,749 B2 FIGURE2 Body Weight Over Time 450- aeae ian 400~ Oea Peal _* oo” oon ee ¥ a o “of wo Nena oo oe es “of aocs oe ap es ve =@ oyE af iy = a & 300+ ff - wg ~@- Saline ef ~¥- 25 mg/kg M-10101 2504 44a? -®- 25 mg/kg M-10591 3 § 1 # q 5 : % m %% A 9 wn U.S. Patent Aug. 30, 2016 Sheet 3 of 10 US 9,428,749 B2 AntimiR-2084 oOo & oo Oo Oo oS & FSF & 6 (%} Buiueous = © jeuoloR is 3 28 “f 3 xf = > wD © uo mS Soom re GS a “ > oS (6) pabieaaPRR meu cA JRE 2 U.S. Patent Aug.30, 2016 Sheet 4 of 10 US 9,428,749 B2 9 9 v SMOOAA & bgp 2 Hinny ft 0 so mN BUD UAB” ON Rp BGO?-HUY-*- GUO gq Roe IOQHUOD-2- spe Ee ¢ ected ~~ flo be an SHON se ae JH fi4 BQO? }ONUO g HUY bo. deVp danOld — U.S. Patent Aug. Sheet US 9,428,749 30, 2016 5 of 10 B2 2g0e-luy lOHUCO RE fe sepept o ae LM jORUCD ra | en, . : me nsaayini A. “ep ; f *, oe a ¥ ge Ba > , $ ON Q OL Ye . Sed m rom, , . ~ ° MOD BRO’ seg HURL’ U.S. Patent Aug. 30, 2016 Sheet 6 of 10 US 9,428,749 B2 g _&ae: SOD OR] okae OM steedis 82oS = Ooc< ie Bo : : : : o ot oo Q & = Le aie) to ) te oy es = rn =o (ypy/bus) 5 (24!) Bele 80 LYM jouaysajoyo winies 38a8 s sv e Se ube (je S ec a ca Bp onsonnesrosnoansnees 3 3 o> CS uw eo wey yee rem (yp/Bu) “ SOpUOOABu) WMES 4F-I FIGURE U.S. Patent Aug.30, 2016 Sheet 7 of 10 US 9,428,749 B2 BQOe HUY “OD056 KOOOSL 0002 0000 OOS a > O el ON | CNUCS ~e-— 4H OuES a ew OVS HAND U.S. Patent Aug.30, 2016 Sheet 8 of 10 US 9,428,749 B2 eg "9 wBie~a — 7“ eo SD Apog 5 5 Oo 18Ip 4 78) UBIY ul 3 g eabueuD sod = by. sysaaA ¥ ZGLOLIN ZBLLEW S800 GrIOL-W C£Q0bIN LOLOL LEGG L6SObIN e jJusoueg aueS sunege La Gd Gal dH Gah HH dH GH GaH aH Bex f oo Fe @ -e & @ ae Eine 3 1 vor be Leg 14 BOE Ve & |S & v & o @ oy “oO = 8 - x4 qj $b Ob ino heOC 19 wyBiap, Tr Te} UDI) 3 ISOd 3 Apog Sysana ? ZOLOLW ZOLLEI EL90b SSO0LIN AyR0LN LOLOL L800 LeGODN £ SUNES auyes G4 Gd V9 oN Od G4dH Ca dH daw dH Gan Gay ee BAO & << ake Fe @ G- a @ CE 6 | W . & a & te z S S. Patent 2016 9 of 10 B2 U. Aug. 30, Sheet US 9,428,749 BUuHeS/MoUy & z €2901-WOsH ee90L-WO4H LOLOL-WWOdH Lagol-WaaH LOGO “ aus L-WWCdH /O4H Boy <& be @« (seinunu) & . aunty & > , OO rig z e iqpyBu asoanii L Fano U.S. Patent Aug. 30, 2016 Sheet 10 of 10 US 9,428,749 B2 FIGURE § A ss. Body Weight @ HED M-16101 7 “F HED M-10673 te HED M-10684 @- HED M-10683 50s @ HED M-10594 (gq) 45a weight 49+ Body 354 30 X z t r ot Ny 5 v zg g 4 2 3 4 5 6 7 3 Weeks post high fat diet Percent Change in Body Weight ee 20% Ns (%) aw 1 wwee ww weight body in change Percent ~20- US 9,428,749 B2 1 2 CONTROL OF WHOLE BODY ENERGY glucose tolerance, fuel metabolism, mitochondrial function, HOMEOSTASIS BY MICRORNA and redox-homeostasis. Accordingly, the present invention REGULATION provides methods of treating or preventing metabolic dis- orders, such as obesity and diabetes, and/or by modulating RELATED APPLICATIONS the expression or activity of miR-208a and/or miR-208b in cells (e.g. cardiac and/or skeletal muscle cells) in a subject This application is a national phase of International Appli- in need thereof. The present invention also provides methods cation No. PCT/US2012/059349, which claims the benefit of enhancing mitochondrial function, redox-homeostasis, and fuel metabolism by modulating the expression or activ- of U.S. Provisional Application Nos. 61/544,187, filed Oct. 10 ity of miR-208a and/or miR-208b in cells in a subject in 6, 2011, and 61/638,345, filed Apr. 25, 2012, each of which are each is herein incorporated by reference in its entirety. need thereof. In one embodiment, the method of the present invention DESCRIPTION OF THE TEXT FILE comprises administering to the subject an inhibitor of miR- SUBMITTED ELECTRONICALLY 208a and/or miR-208b (e.g. an antisense oligonucleotide 15 inhibitor), wherein the expression or activity of miR-208a The contents of the text file submitted electronically and/or miR-208b is reduced in the cells of the subject herewith are incorporated herein by reference in their following administration. Administration of the inhibitor entirety: A computer readable format copy of the Sequence may be for treating or preventing a metabolic disorder in a Listing (filename: MIRG_031_02US_SeqList_ST25 txt, subject in need thereof. In one embodiment, administration date recorded: Apr. 4, 2014, file size 138 kilobytes). 20 of the inhibitor is for enhancing mitochondrial function in a subject in need thereof. FIELD OF THE INVENTION The metabolic disorder to be treated can include meta- bolic syndrome, obesity, diabetes mellitus, diabetic neph- The present invention relates to the treatment and pre- ropathy, insulin resistance, atherosclerosis, a lipid storage vention of metabolic disorders by administering agents that 25 disorder, a glycogen storage disease, medium-chain acyl- modulate the activity or expression of a microRNA coenzyme A dehydrogenasedeficiency, lipid oxidation, high (miRNA). In particular, the invention provides a method for cholesterol, or aberrant glucose uptake and/or utilization. treating or preventing metabolic disorders by inhibiting the Secondary diseases or conditions resulting from these meta- expression or activity of miR-208a and/or miR-208b in cells bolic disorders can also be prevented or treated with the of a subject. In addition, the invention provides a method for 30 methods of the invention. For example, in one embodiment, regulating fatty acid metabolism in a cell by contacting the the invention provides a method of preventing or treating cell with a modulator of miR-208a and/or miR-208b expres- secondary diseases or disorders resulting from obesity, such sion or activity. The present invention also provides a as sleep apnea, cancer, stroke, and osteoarthritis, by admin- method for enhancing or elevating mitochondrial function, istering an inhibitor of miR-208a and/or miR-208b. Disor- improving fuel metabolism, and/or maintenance of redox- 35 ders due to mitochondrial dysfunction can also be treated by homeostasis by inhibiting the expression or activity of the methods disclosed herein. For example, the subject can miR-208a and/or miR-208b in cells of a subject. suffer from, or be at risk for muscle weakness, frailty, sarcopenia, muscular dystrophy, muscle atrophy, amyo- BACKGROUND trophic lateral sclerosis, or a mitochondrial myopathy. 40 The miR-208a and miR-208b inhibitors suitable for use in Maintaining energy homeostasis requires a balance the methods of the present invention can be antisense between energy consumption and energy expenditure. In oligonucleotides. In one embodiment, the antisense oligo- Western societies, excess food consumption hasled to a shift nucleotide comprises a sequence that is at least partially in energy balance resulting in a dramatic increase in obesity complementary to a mature sequence of miR-208a and/or (Van et al., (2006) Nature 444, 875-880), a multi-organ 45 miR-208b. In certain embodiments, the antisense oligo- disorder that enhances the risk of type 2 diabetes (T2D), nucleotides comprise one or more sugar or backbone modi- hypertension, hyperlipidemia and cardiovascular disease fications, such as locked nucleic acids, bicyclic nucleosides, (Mathieu et al., (2008) The International Journal of Bio- phosphonoformates, 2' O-alkyl modifications, and phospho- chemistry & Cell Biology 40, 821-836). Impaired metabo- rothioate linkages. In one embodiment, the antisense oligo- lism of energy-providing substrates and myocardial lipid 50 nucleotides comprise a 2' O-alkyl modification or a 2'-halo accumulation are early abnormalities found in obese and modification, such as a 2'-fluoro modification. In other insulin-resistant individuals (Harmancey et al., (2008) embodiments, the miR-208a and/or miR-208b inhibitor is an Hypertension 5, 181-187). Mitochondrial dysfunction in antisense oligonucleotide of about 6 to about 22 nucleotides metabolically active tissues (e.g. adipose, liver and skeletal in length. muscle) is commonly associated with metabolic diseases 55 In another embodiment, the present invention provides a including metabolic syndrome (MS), insulin resistance (IR) method of regulating fatty acid metabolism in a cell com- and T2D (Muoio and Newgard, (2008) Nat Rev Mol Cell prising contacting the cell with a modulator of miR-208a Biol, 2008. 9, 193-205). and/or miR-208b expression or activity. The modulator can Accordingly, there is a growing need to identify effective be an inhibitor or agonist of miR-208a and/or miR-208b therapies to treat and prevent obesity and related metabolic 60 expression or activity. In certain embodiments, fatty acid diseases, such as by enhancing mitochondrial function. metabolism is increased in the cell following contact with a miR-208a and/or miR-208b inhibitor as comparedto a cell SUMMARY OF THE INVENTION not exposed to the inhibitor. In other embodiments, fatty acid metabolism is decreased in the cell following contact The present invention is based, in part, on the surprising 65 with a miR-208a and/or miR-208b agonist as comparedto a discovery that miR-208 inhibition reduces age-induced cell not exposed to the agonist. The cell may be in vitro or weight gain and high fat-induced weight gain and improves in vivo. In some embodiments,the cell is a cardiomyocyte, US 9,428,749 B2 3 4 a skeletal muscle cell, a preadipocyte, an adipocyte, a and 6 weeks after a high-fat diet (HF). The white sections of hepatocyte, or a pancreatic cell. each bar representthe fat weight. D. Weightof visceral white The present invention encompassesthe use of chemically adipose tissue (WAT) and subscapular brown adipose tissue modified antisense oligonucleotides capable of inhibiting (BAT) from control (M-10591) and antimiR-208a the expression (e.g., abundance) of miR-208 family miR- (M-10101) treated mice on a normal diet (NC) and 6 weeks NAs, including miR-208a and miR-208b, to affect energy after a high-fat diet (HF). E. H&E stain of visceral WAT and homeostasis. The invention further provides pharmaceutical subscapular BAT from control and antimiR-208-treated compositions comprising the antisense oligonucleotides, mice on normaldiet or high-fat diet. Scale bar=40 um.F. and methods of treating patients having conditions or dis- Pictures of visceral WAT and liver from antimiR-208a and orders related to or affecting energy homeostasis such as 10 control antimiR treated mice on high-fat diet for 6 weeks. G. metabolic disorders. Cell size of visceral WAT (n=5). Images from 3 sections 200 In another aspect, the invention provides pharmaceutical mm apart were analyzed from 7-8 mice in each group compositions and formulations comprising the antisense representing>500 cells. Serum triglyceride levels (H) and oligonucleotide inhibitors described herein for use in the serum cholesterol levels (1) from control (M-10591) and methods of the invention. Such formulations and composi- 15 antimiR-208a (M-10101) treated mice on a normal diet (NC) tions may involve incorporation of the antisense oligonucle- and 6 weeks after a high-fat diet (HF). otide within a variety of macromolecular assemblies, FIG. 5. AntimiR-208a (M-10101) treated mice are resis- micelle, or liposome compositions for cellular delivery. In tant to glucose intolerance. Glucose tolerance test (A) and certain embodiments, the compositions are suitable or for- area underthe curve for the glucose tolerance test (B) from mulated for intradermal, subcutaneous, intramuscular, intra- 20 control antimiR (M-10591) and antimiR-208a (M-10101) peritoneal or intravenous injection, or by direct injection treated mice on a normal diet (NC) and 6 weeks after a into target tissue (e.g., cardiac or skeletal muscle tissue). high-fat diet (HF). Fasting insulin (C) and leptin (D) levels Other aspects and embodiments of the invention will be from control antimiR and antimiR-208a treated mice on a apparent from the following detailed description of the normal diet (NC) and 6 weeksafter a high-fat diet (HF). invention. 25 FIG. 6. Growth curves (A) and percent increase in body weight (B) comparing saline, control antimiR (M-10591, BRIEF DESCRIPTION OF DRAWINGS M-10649, M-10702, M-11182), and antimiR-208a (M-10101, M-10673, M-10681, M-10683) treated mice on a FIG. 1. AntimiR-208a (M-10101) reduces age-induced normal diet (REG) and 12 weeksafter a high-fat diet (HFD). weight gain in mice. Mice treated with 3x25 mg/kg of 30 FIG. 7. miR-208a inhibition enhances glucose tolerance. antimiR-208a (M-10101) at day 1, 2 and 3 and a mainte- Glucosetolerance test from control antimiR (M-10591) and nance dose of 25 mg/kg every 2 weeks show a reduction in antimiR-208a (M-10101, M-10673, M-10681, M-10683) body weight (BW) increase with age, compared to either treated mice on regular chow and 11 weeks after a high-fat control (M-10591) or saline injected animals (A). While all diet (HFD). groups started at a comparable weight at 8 weeks of age, 35 FIG. 8. Body weight over time (A) and percent change in saline and control injected animals show a significantly body weight (B) of obese mice receiving control antimiR lower heart weight to body weight (HW/BW)ratio due to a (M-10591) or one of four antimiR-208a compounds decrease in age-induced body weight (B). Also shown are (M-10101, M-10673, M-10681, M-10683). the heart weights (HW) and heart weights to total weights (AW/TL)ofthe different groups in panels C and D, respec- 40 DETAILED DESCRIPTION OF THE tively. INVENTION FIG. 2. AntimiR-208a (M-10101) reduces age-induced weight gain in rats. Dosing male adult rats with either The present invention provides a method oftreating or antimiR-208a (M-10101), control (M-10591) orsaline every preventing a metabolic disorder in a subject in need thereof. 2 weeks for 11 weeks shows that antimiR-208a reduces 45 Also provided herein is a method of enhancing mitochon- age-induced increase in body weight. drial function, redox-homeostasis, and/or fuel metabolism. FIG. 3. A. Northern blot analysis of mice treated for 6 MiRNAsrepresent novel therapeutic targets for the devel- weeks with antimiR-208a or control antimiR (control). U6 opment of treatments for such diseases, including, obesity, RNAwasdetected as a loading control. Hearts from 5 mice diabetes, and other metabolic disorders. from each treatment were analyzed. Note the absence of 50 In one embodiment, the method comprises administering miR-208a in antimiR-208a-treated hearts. B. Heart weight to the subject an inhibitor of miR-208a and/or miR-208b as from antimiR-208a and control antimiR treated mice on described herein, wherein the expression or activity of normal chow (NC) or high fat diet (HF) for 6 weeks. miR-208a and/or miR-208b is reduced in the cells of the (n=5-13). C. Fractional shortening for antimiR-208a and subject following administration. As used herein, the term control antimiR treated mice on NC for 6 weeks. (n=5), D. 55 “patient” or “subject” refers to any vertebrate including, Heart rate in beats per minute for antimiR-208a and control without limitation, humans and other primates (e.g., chim- antimiR treated mice on NC for 6 weeks. (n=5). panzees and other apes and monkey species), domestic FIG. 4. AntimiR-208a (M-10101) treated mice are resis- mammals (e.g., dogs and cats), farm animals (e.g., cattle, tant to diet-induced obesity. A. Representative images com- sheep, pigs, goats and horses), laboratory animals (e.g., paring control (M-10591) and antimiR-208a (M-10101) 60 rodents such as mice, rats, and guinea pigs), and birds(e.g., treated mice on a normal diet (NC) and 6 weeks after a domestic, wild and gamebirds such as chickens, turkeys and high-fat diet (HF). B. Growth curves and percentincrease in other gallinaceousbirds, ducks, geese, and the like). In some body weight comparing control (M-10591) and antimiR- embodiments, the subject is a mammal. In certain embodi- 208a (M-10101) treated mice on a normal diet (NC) and 6 ments, the subject is a human. weeks after a high-fat diet (HF). C. Body composition 65 In certain embodiments, the subject in need thereof has measured by NMR comparing control (M-10591) andanti- been diagnosed with, is suffering from, and/or has exhibited miR-208a (M-10101) treated mice on a normal diet (NC) symptoms of a metabolic condition or disorder. In other US 9,428,749 B2 5 6 embodiments, the subject has not been diagnosed with, is The inventors have surprisingly found that inhibition of not suffering from, and/or has not exhibited symptoms of a miR-208a activity results in enhanced mitochondrial func- metabolic condition or disorder. The metabolic disorders tion in liver, skeletal muscle, and cardiac tissue. Accord- include, but are not limited to, metabolic syndrome, obesity, ingly, the present invention also provides a method of diabetes mellitus, diabetic nephropathy, resistance, athero- enhancing mitochondrial function or redox-homeostasis in a sclerosis, dyslipidemia (such as mixed or diabetic dyslipi- subject in need thereof. In one embodiment, the method demia), hypercholesterolemia, low HDL cholesterol, high comprises administering to the subject an antisense oligo- LDL cholesterol, hyperlipidemia, hypertriglyceridemia, nucleotide comprising a sequence that is at least partially hypoglycemia, hyperglycemia, glucose intolerance, insulin complementary to a miR-208a or miR-208b sequence, resistance, hyperinsulinemia, hypertension, hyperlipopro- wherein the expression or activity ofmiR-208a or miR-208b teinemia, metabolic syndrome, syndrome X, thrombotic is reduced in the cells of the subject following administra- disorders, claudication, stroke and others, kidney diseases, tion of the antisense oligonucleotide. In certain embodi- ketoacidosis, nephropathy, diabetic neuropathy, diabetic ret- inopathy, nonalcoholic fatty liver diseases such as steatosis ments, the subject in need of enhanced mitochondrial func- or nonalcoholic steatohepatitis (NASH), a lipid storage tion or redox-homeostasis is diagnosed with, suffers from, or disorder (e.g., Niemann-Pick disease, Gaucher’s disease, is at risk for muscle weakness, frailty, sarcopenia, muscular Farber disease, Fabry disease, Wolman disease, and choles- dystrophy, muscle atrophy, amyotrophic lateral sclerosis, or teryl ester storage disease), polycystic ovarian syndrome a mitochondrial myopathy. Mitochondrial myopathies (PCOS), high cholesterol, or aberrant glucose uptake and/or include, but are not limited to, mitochondrial encephalo- utilization. In certain embodiments, the metabolic disorder myopathy, lactic acidosis, and stroke-like syndrome to be treated with the methods of the invention is obesity, (MELAS), myoclonic epilepsy and ragged-red fibers hypercholesterolemia, type 2 diabetes, hepatic steatosis or (MERRF), Kearns-Sayre syndrome (KSS), or chronic pro- hyperlipidemia. gressive external ophthalmoplegia (CPEO). In other embodiments, the subject has not been diagnosed In related embodiments, the present invention provides a with, is not suffering from, and/or has not exhibited symp- methodoftreating muscle atrophy or sarcopenia in a subject toms of a cardiovascular disease or disorder, such as ath- in need thereof. Sarcopenia describes the slow but progres- erosclerosis and its sequelae including angina, heart attack, sive loss of muscle mass with advancing age and is char- heart failure, coronary artery disease, myocardial infarction, acterized by a deterioration of muscle quantity and quality congestive heart failure, and for cardiac hypertrophy. In leading to a gradual slowing of movementand a decline in some embodiments, the subject has not been diagnosed with, strength (Ryall et al., Biogerontology (2008) 9:213-228). is not suffering from, and/or has not exhibited symptomsof Sarcopenia is a componentof frailty syndrome frequently a cardiovascular disease or disorder, and has been diagnosed observed in elderly populations. In one embodiment, the with, is suffering from, and/or has exhibited symptomsof a methodoftreating muscle atrophy or sarcopenia in a subject metabolic condition or disorder. in need thereof comprises administering to the subject an In certain embodiments, the subject in need thereof has antisense oligonucleotide comprising a sequence that is at been diagnosed with, is suffering from, and/or has exhibited least partially complementary to a miR-208a or miR-208b symptomsof a condition or disorder related to mitochondrial sequence, wherein the expression or activity of miR-208a or dysfunction. In other embodiments, the subject has not been miR-208b is reduced in the cells of the subject following diagnosed with, is not suffering from, and/or has not exhib- administration of the antisense oligonucleotide. In some ited symptoms of a condition or disorder related to mito- 40 embodiments, the method further comprises administering chondrial dysfunction. The disorder or condition can the anti-miR-208a/anti-miR-208b oligonucleotide in com- include, but are not limited to, muscle weakness, frailty, bination with one or more additional therapies to counteract sarcopenia, muscular dystrophy, muscle atrophy, amyo- muscle atrophy. Such suitable additional therapies include, trophic lateral sclerosis, or a mitochondrial, myopathy. In but are not limited to, selective androgen receptor modula- certain embodiments, the subject in need thereof has been 45 tors (e.g., ostarine, BMS-564,929, and LGD-4033), anabolic diagnosed with, is suffering from, and/or has exhibited steroids, human growth hormone, and dehydroepiandroster- symptomsof a condition or disorder related to mitochondrial one (DHEA). In certain embodiments, a subject in need of dysfunction, and has not been diagnosed with, is not suf- treatment for muscle atrophy or sarcopenia is an elderly fering from, and/or has not exhibited symptomsof a car- patient, preferably an elderly human patient. diovascular disease or disorder 50 The present invention also includes a method of prevent- In some embodiments, the metabolic disorder is a glyco- ing or treating secondary diseases or conditions resulting gen storage disease (GSD). For instance, the methodsof the from metabolic disorders or mitochondrial dysfunction by invention provide treating or preventing any of the types of administering to a subject in need thereof an inhibitor of GSD(e.g., GSD type 0 and GSD type I to GSD type XIII) miR-208a and/or miR-208b as described herein. For in a subject in need thereof by administering to the subject example, in one embodiment, the invention provides a a miR-208a and/or miR-208b inhibitor. GSDs include, but method of preventing or treating sleep apnea comprising are not limited to, von Gierke’s disease, Pompe’s disease, administering to a subject in need thereof an inhibitor of Cori’s disease or Forbes’ disease, Andersen disease, miR-208a and/or miR-208b. In another embodiment, the McArdle disease, Hers’ disease, Tarui’s disease, Fanconi- invention provides a methodof preventing or treating cancer Bickel syndrome,andred cell aldolase deficiency. In another by administering to a subject in need thereof an inhibitor of embodiment, the metabolic disorder is medium-chain acy]- miR-208a and/or miR-208b. In still another embodiment, coenzyme A dehydrogenase (MCAD)deficiency. Individu- the invention provides a method of preventing or treating als having MCADdeficiency exhibit an impairmentin fatty osteoarthritis by administering to a subject in need thereof acid oxidation that can be fatal. In one embodimentof the an inhibitor of miR-208a and/or miR-208b. In one embodi- invention, fatty acid metabolism is increased in subjects ment, the invention provides a method of preventing or having MCAD deficiency following administration of a treating a stroke by administering to a subject in need thereof miR-208a and/or miR-208b inhibitor. an inhibitor of miR-208a and/or miR-208b. US 9,428,749 B2 7 8 In some embodiments, the methods of the present inven- (n) Glucagon receptor antagonists; tion are used preventatively prior to the development of any (0) GLP-1 or GLP-1 analogs, such as exendins, for example metabolic disorder or secondary disease or condition result- exenitide; ing from a metabolic disorder or mitochondrial dysfunction. (p) GIP-1; and In these embodiments, subjects in need of preventative (q) Hydroxysterol dehydrogenase-1 (HSD-1) inhibitors. treatment may be identified on the basis of such factors as a One or more of any of the above conventional therapies family history of a metabolic disorder or secondary disease can be co-administered with one or more antisense oligo- or condition. nucleotides described herein or a pharmaceutical composi- tion or formulation containing such antisense oligonucle- In certain embodiments, the methods of treating or pre- 10 otides to treat or prevent a metabolic disorder in a subject in venting a metabolic disorder in a subject in need thereof need thereof. Non-limiting examples of combination thera- further comprises administering one or more conventional pies include combinations of an antisense oligonucleotide therapies for treating metabolic disorders. Thus, included targeting miR-208a and/or miR-208b with one or more within the scope of the present invention are embodiments conventional therapies selected from biguanides, sulfonylu- comprising co-administration of, and compositions and 15 reas, HMG-CoAreductase inhibitors, other PPAR agonists, medicaments which contain, in addition to an antisense PIP-1B inhibitors, DP-IV inhibitors and anti-obesity com- oligonucleotide used in the present invention or a pharma- pounds. ceutical composition or formulation containing such an The antisense oligonucleotides described herein or a antisense oligonucleotide, other therapeutic agents and/or pharmaceutical composition or formulation containing such active ingredients. Such multiple drug regimens, often 20 antisense oligonucleotides, and conventional therapies may referred to as combination therapies, may be used in the be administered in the same dosage forms or in separate treatment and/or prevention of metabolic disorders. dosage forms. When administered in separate dosage forms, Examples of conventional therapies that may be admin- the antisense oligonucleotides may be administered simul- istered in combination with one or more antisense oligo- taneously or serially (i.e. separated by some interval) with nucleotides described herein or a pharmaceutical composi- 25 the conventional therapy. Thus, the administration of the tion or formulation containing such antisense antisense oligonucleotide may be prior to, concurrent with, oligonucleotides, and either administered separately or in or subsequent to the administration of the conventional the same pharmaceutical composition, include but are not therapy. limited to: The inventors have found that the effects of miR-208 30 inhibition on metabolism are mediated in part through (a) PPARy agonists and partial agonists, including both de-repression of its target MED13 (a.k.a THRAP1), such as glitazones and non-glitazones (e.g. troglitazone, pioglita- in cardiac tissue. Cardiac-specific over-expression of zone, englitazone, MCC-555, rosiglitazone, balaglitazone, MED13 in mice confers resistance to high fat diet-induced netoglitazone, T-131, LY-30051.2 and LY-818; obesity and improves systemic insulin sensitivity and glu- (b) Biguanides such as metformin and phenformin; 35 cose tolerance, whereas genetic deletion of MED13, such as (c) Protein tyrosine phosphatase-1B (PIP-1B) inhibitors, in cardiomyocytes, enhances Obesity in response to high fat (d) Dipeptidyl peptidase IV (DP-IV) inhibitor, such as diet and exacerbates metabolic syndrome (data not shown). MK-0431 and LAF-237; Thus, the present invention also encompasses a method of (e) Insulin or insulin mimetics; treating or preventing a metabolic disorder in a subject in (f) Sulfonylureas such as tolbutamide and glipizide or 40 need thereof comprising enhancing MED13 expression, related materials; such as in cardiac cells. For example, provided herein is a (g) a-glucosidase inhibitors (such as acarbose); method of administering a MED13 agonist, such as an (h) agents which improvea patient’s lipid profile such as (i) expression vector encoding MED13. The polynucleotide HMG-CoA reductase inhibitors (lovastatin, simvastatin, encoding MED13 can be under the control of a cardiac- rosuvastatin, pravastatin, fluvastatin, atorvastatin, rivastatin, 45 specific promoter, such as alpha-myosin heavy chain. itavastatin, ZD-4522 andotherstatins), (ii) bile acid seques- In another embodiment, the present invention encom- trants (cholestyramine, colestipol and dialkylaminoalkyl passes a method of increasing glucose uptake and/or utili- derivatives of a cross-linked dextran), (iii) nicotinyl alcohol, zation in a subject in need thereof comprising administering nicotinic acid or a salt thereof, (tv) PPARa agonists such as to the subject an inhibitor of miR-208a and/or miR-208b fenofibric acid derivatives (gemfibrozil, clofibrate, fenofi- 50 activity or expression as described herein. In some embodi- brate and bezafibrate), (v) cholesterol absorption inhibitors ments, the subject is diagnosed with insulin resistance or such as for example ezetimibe, (vi) acyl CoA:cholesterol diabetes mellitus. In one embodiment, the subject’s blood acyltransferase (ACAT) inhibitors such as avasimibe, (vii) glucose level is reduced following administration of the CETP inhibitors such as torcetrapib and (viii) phenolic miR-208a and/or miR-208b inhibitor as compared to the anti-oxidants such as probucol; 55 blood glucose level of the subject prior to administration of (i) PPARa/y dual agonists such as muraglitazar, tesaglitazar, the inhibitor. In another embodiment, the subject’s blood farglitazar and JT-501; glucose level is reduced to within normallevels as measured (j) PPARS agonists such those disclosed in WO97/28149; by the oral glucose tolerance test following administration of (k) Antiobesity compounds such as fenfluramine, dextenflu- the miR-208a and/or miR-208b inhibitor. For instance, in ramine, phentiramine, subitramine,orlistat, neuropeptide Y5 60 certain embodiments, the subject’s fasting blood glucose inhibitors, MC4R agonists, cannabinoid receptor 1 antago- level is less than about 110 mg/dl. In other embodiments,the nists/inverse agonists and 63 adrenergic receptor agonists; subject’s blood glucose level 2 hours post glucose ingestion (1) Ileal bile acid transporter inhibitors; is less than about 140 mg/dl. (m) Agents intendedfor use in inflammatory conditions such In another embodiment, the present invention encom- as aspirin, non-steroidal, anti-inflammatory drugs, glucocor- 65 passes a method of decreasing cholesterol in a subject in ticoids, azulfidine and cyclo-oxygenase 2 selective inhibi- need thereof comprising administering to the subject an tors; inhibitor of miR-208a and/or miR-208b activity or expres- US 9,428,749 B2 9 10 sion as described herein. In some embodiments, the subject In certain embodiments, the modulator is an inhibitor of is diagnosed with a disease associated with high cholesterol miR-208a and/or miR-208b expression or activity, and glu- such as coronary heart disease, stroke, peripheral vascular cose metabolism is increased in the cell following contact disease, type 2 diabetes, and high blood pressure. In one with the miR-208a and/or miR-208b inhibitor as compared embodiment, the subject’s total cholesterol level is to a cell not exposedto the inhibitor. In other embodiments, decreased and/or HDL cholesterollevel is increased follow- the modulator is an agonist of miR-208a and/or miR-208b ing administration of the miR-208a and/or miR-208b inhibi- expression or activity, and glucose metabolism is decreased tor as comparedto the total cholesterol and HDL cholesterol in the cell following contact with the miR-208a and/or levels of the subject prior to administration of the inhibitor. miR-208b agonist as compared to a cell not exposed to the In another embodiment, the subject’s cholesterol levels are agonist. The cell can be in vitro or in vivo. In some restored to within normal levels as measured by a lipopro- embodiments,the cell is, but is not limited to, a cardiomyo- tein profile blood test following administration of the miR- cyte, a skeletal muscle cell, a preadipocyte, an adipocyte, a 208a and/or miR-208b inhibitor. For instance, in certain hepatocyte, or a pancreatic cell. embodiments, the subject’s total cholesterol level is reduced In some embodiments, the modulator is an inhibitor of to less than about 200 mg/dL. In other embodiments, the miR-208a and/or miR-208b expressionor activity, and mito- subject’s HDL cholesterol level is increased to greater than chondrial function is increased in the cell following contact or equal to about 40 mg/dL. with the miR-208a and/or miR-208b inhibitor as compared In another embodiment, the present invention encom- to a cell not exposedto the inhibitor. In other embodiments, passes a method of treating obesity in a subject in need the modulator is an agonist of miR-208a and/or miR-208b thereof comprising administering to the subject an inhibitor 20 expression or activity, and mitochondrial function is of miR-208a and/or miR-208b activity or expression as decreased in the cell following contact with the miR-208a described herein. In some embodiments, the subject is and/or miR-208b agonist as comparedto a cell not exposed diagnosed with obesity. In certain embodiments, the subject to the agonist. The cell can be in vitro or in vivo. In some in need of treatment has a body mass index of 25 or greater. embodiments,the cell is, but is not limited to, a cardiomyo- In other embodiments, the subject in need of treatment has cyte, a skeletal muscle cell, a preadipocyte, an adipocyte, a a body mass index of 30 or greater. In one embodiment, the hepatocyte, or a pancreatic cell. subject’s body mass index and/or waist circumference is In some embodiments, the modulator is an inhibitor of reduced following administration of the miR-208a and/or miR-208a and/or miR-208b expression or activity, and miR-208b inhibitor as compared to the body mass index redox-homeostasis is improvedin the cell following contact and/or waist circumference of the subject prior to adminis- 30 with the miR-208a and/or miR-208b inhibitor as compared tration of the inhibitor. In another embodiment, the subject’s to a cell not exposedto the inhibitor. In other embodiments, body mass index and/or waist circumference is reduced to the modulator is an agonist of miR-208a and/or miR-208b within normal levels adjusted for the sex and age of the expression or activity, and redox-homeostasis is impaired in subject following administration of the miR-208a and/or the cell following contact with the miR-208a and/or miR- miR-208b inhibitor. 35 208b agonist as compared to a cell not exposed to the The present invention also provides a method of regulat- agonist. The cell can be in vitro or in vivo. In some ing fatty acid metabolism in a cell. Also provided herein is embodiments,the cell is, but is not limited to, a cardiomyo- a method of regulating glucose metabolism, such as by cyte, a skeletal muscle cell, a preadipocyte, an adipocyte, a regulating glycogen synthesis. A method of enhancing mito- hepatocyte, or a pancreatic cell. chondrial function and improving redox-homeostasis by 40 In one particular embodiment, the cell is a cardiomyocyte. administering a modulator of miR-208a and/or miR-208b Thus, the present invention also encompasses a method of expression or activity, such as an inhibitor of miR-208a regulating cardiac metabolism by contacting a cardiomyo- and/or miR-208b expression or activity, is also provided. cyte with a modulator ofmiR-208a and/or miR-208b expres- In one embodiment, the methods disclosed herein com- sion or activity. In one embodiment, contacting the cardio- prise contacting a cell with a modulator of miR-208a and/or 45 myocyte with a miR-208a and/or miR-208b inhibitor miR-208b expression or activity. As used herein, a “modu- prevents or reduces the metabolic shift from oxidative lator” is a molecule that regulates the expression or activity metabolism to glycolytic metabolism induced bya stressor. of miR-208a and/or miR-208b. Modulators can be agonists In another embodiment, contacting the cardiomyocyte with of miR-208a and/or miR-208b function (i.e. enhance the amiR-208a and/or miR-208b inhibitor reduces carbohydrate activity or expression ofmiR-208a or miR-208b)or they can metabolism in the cardiomyocyte. In still another embodi- be inhibitors of miR-208a and/or miR-208b function (i.e. ment, contacting the cardiomyocyte with a miR-208a and/or reduce the activity or expression ofmiR-208a or miR-208b). miR-208b inhibitor increases fatty acid metabolism in the Modulators can include proteins, peptides, polypeptides, cardiomyocyte. In yet another embodiment, contacting the polynucleotides, antisense oligonucleotides, or small mol- cardiomyocyte with a miR-208a and/or miR-208b inhibitor ecules. Modulators of miR-208a and/or miR-208b expres- increases glucose metabolism in the cardiomyocyte. In one sion or activity include miR-208a and/or miR-208b inhibi- embodiment, contacting the cardiomyocyte with a miR-208a tors and agonists as described herein. and/or miR-208b inhibitor enhances mitochondrial function In certain embodiments, the modulator is an inhibitor of in the cardiomyocyte. In another embodiment, contacting miR-208a and/or miR-208b expression or activity, and fatty the cardiomyocyte with a miR-208a and/or miR-208b acid metabolism is increased in the cell following contact inhibitor improves redox-homeostasis in the cardiomyocyte. with the miR-208a and/or miR-208b inhibitor as compared The cardiomyocyte can be in vitro or in vivo. to a cell not exposed to the inhibitor. In other embodiments, In another particular embodiment, the cell is a skeletal the modulator is an agonist of miR-208a and/or miR-208b muscle cell. Thus, the present invention also encompasses a expression or activity, and fatty acid metabolism is method of regulating metabolism in skeletal muscle by decreased in the cell following contact with the miR-208a contacting a skeletal muscle cell with a modulator of miR- and/or miR-208b agonist as compared to a cell not exposed 208a and/or miR-208b expression or activity. In one to the agonist. embodiment, contacting the skeletal muscle cell with a US 9,428,749 B2 11 12 miR-208a and/or miR-208b inhibitor prevents or reduces the preventing hyperthyroidism (Graves’ Disease) in a subject metabolic shift from oxidative metabolism to glycolytic in need thereof by administering to the subject a miR-208a metabolism induced by a stressor. In another embodiment, and/or miR-208b agonist. contacting the skeletal muscle cell with a miR-208a and/or miR-208a, including its structure and processing, is miR-208b inhibitor reduces carbohydrate metabolism in the described in WO 2008/816924, which is hereby incorpo- skeletal muscle cell. In still another embodiment, contacting rated by reference in its entirety. the skeletal muscle cell with a miR-208a and/or miR-208b miR-208a is located within an intron of the a-MHCgene. inhibitor increases fatty acid metabolism in the skeletal The precise intron location is dependent on the particular muscle cell. In yet another embodiment, contacting the species and specific transcript. For example, in humans, skeletal muscle cell with a miR-208a and/or miR-208b 10 miR-208a is encoded within the 28th intron of the a-MHC inhibitor increases glucose metabolism in the skeletal gene, while in mice, it is encoded within the 29th intron. The muscle cell. In one embodiment, contacting the skeletal pre-miRNA encoding sequences for miR-208a for human, muscle cell with a miR-208a and/or miR-208b inhibitor mouse,rat, and canine are shown below as SEQ ID NO:5, enhances mitochondrial function in the skeletal muscle cell. SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO:8, 15 In another embodiment, contacting the skeletal muscle cell respectively. The mature miR-208a sequence is provided in with a miR-208a and/or miR-208b inhibitor improves SEQ ID NO:9. Like a-MHC, miR-208a is expressed solely redox-homeostasis in the skeletal muscle cell. In still in the heart. another embodiment, contacting the skeletal muscle cell with a miR-208a and/or miR-208b inhibitor increases the 20 level of dipeptides in the skeletal muscle cell. In still yet Human pre-miR-208a (SEQ ID No: another embodiment, contacting the skeletal muscle cell ACGGGCGAGC TTTTGGCCCG GGTTATACCT GATGCTCACG with a miR-208a and/or miR-208b inhibitor inhibits skeletal muscle cell growth. The skeletal muscle cell can be in vitro TATAAGACGA GCAAAAAGCT TGTTGGTCAG A 25 or in vivo. Mouse pre-miR-208a In anotherparticular embodiment,thecell is a liver cell or (SEQ ID No: hepatocyte. Thus, the present invention also encompasses a ACGGGTGAGC TTTTGGCCCG GGTTATACCT GACTCTCACG methodof regulating metabolism in liver cell by contact- TATAAGACGA GCAAAAAGCT TGTTGGTCAG A a ing a liver cell with a modulator of miR-208a and/or miR-208b expression or activity. In one embodiment, con- 30 Rat pre-miR-208a tacting the liver cell with a miR-208a and/or miR-208b (SEQ ID No: ACGGGTGAGC TTTTGGCCCG GGTTATACCT GACTCTCACG inhibitor prevents or reduces the metabolic shift from oxi- dative metabolism to glycolytic metabolism induced by a TATAAGACGA GCAAAAAGCT TGTTGGTCAG A stressor. In another embodiment, contacting the liver cell 35 Canine pre-miR-208a with a miR-208a and/or miR-208b inhibitor reduces carbo- (SEQ ID No: hydrate metabolism in the liver cell. In still another embodi- ACGCATGAGC TTTTGGCTCG GGTTATACCT GATGCTCACG ment, contacting the liver cell with a miR-208a and/or TATAAGACGA GCAAAAAGCT TGTTGGTCAG A miR-208b inhibitor increases fatty acid metabolism in the liver cell. In yet another embodiment, contacting the liver 40 Mature miR-208a cell with a miR-208a and/or miR-208b inhibitor increases (SEQ ID NO: 9) AUAAGACGAGCAAAAAGCUUGU glucose metabolism in the liver cell. In one embodiment, contacting the liver cell with a miR-208a and/or miR-208b The genomecontains another microRNArelated to miR- inhibitor enhances mitochondrial function in the liver cell. 208a, called miR-208b, which is located within the B-MHC In another embodiment, contacting the liver cell with a 45 gene at intron 31, and like B-MHC, miRNA 208b is miR-208a and/or miR-208b inhibitor improves redox-ho- expressed solely in the heart and slow skeletal muscle (e.g. meostasis in the liver cell. The liver cell can be in vitro or soleus). Genes regulated by miR-208b include, for example, in vivo. Sp3, Myostatin, PURbeta, THRAP1, and fast skeletal The present invention also provides a method for pre- muscle protein genes. The sequenceof this miRNAislargely venting or treating disorders or diseases associated with a 50 overlapping with miR-208a with a 100% homology in the deficiency in glycolytic or fatty acid metabolism. For “seed region,” the region that defines mRNAtargets of a instance, in one embodiment, the present invention provides certain miRNA. The pre-miR-208b sequence is conserved a method for preventing or treating hypoglycemia or hyper- across several mammalian species (e.g. human, mouse, rat, insulinism in a subject in need thereof by administering to and canine). The pre-miR-208b sequence as well as the the subject a miR-208a and/or miR-208b agonist described 55 herein. Subjects at risk of developing hypoglycemia or mature miR-208b sequence is shown below: hyperinsulinism include diabetic patients who overdose on insulin or certain diabetes medications chlorpropamide,tola- pre-miR-208b zamide, acetohexamide, glipizide, or tolbutamide), subjects (SEQ ID NO: 10) who have an insulin secreting tumor (insulinoma), patients 60 TTTCTGATCC GAATATAAGA CGAACAAAAG GTTTGTCTGA GGG diagnosed withliver disease or genetic conditions that cause hyperinsulinism. Other disorders or conditions that may be Mature miR-208b (SEQ ID NO: 11) treated or prevented with agonists of miR-208a and/or AUAAGACGAA CAAAAGGUUU GU miR-208b described herein are those in which patients have difficulty maintaining a normal body weight or experience 65 The structure and processing of miR-208b is also unintentional weightloss. For instance, in one embodiment, described in WO 2009/018492, which is hereby incorpo- the present invention includes a method of treating or rated by reference in its entirety. The sequences for the US 9,428,749 B2 13 14 various forms of miR-208a and miR-208b may be used to -continued design complementary inhibitors in accordance with the invention. It is understood that all ribonucleic acid sequences dis- closed herein can be converted to deoxyribonucleic acid sequences by substituting a thymidine base for a uridine base in the sequence. Likewise, all deoxyribonucleic acid sequences disclosed herein can be converted to ribonucleic acid sequences by substituting a uridine base for a thymidine base in the sequence. Deoxyribonucleic acid sequences, ribonucleic acid sequences, and sequences containing mix- The antisense oligonucleotides targeting miR-208a and/or tures of deoxyribonucleotides and ribonucleotides of all miR-208b can contain a BSN (LNA, ENA, cDNA and the sequences disclosed herein are included in the invention. like) and other modified nucleotides, and ribonucleotides or deoxyribonucleotides. In one embodiment, the antisense In some embodiments, an inhibitor of miR-208a and/or oligonucleotides targeting miR-208a and/or miR-208b con- miR-208b suitable for use in any of the methods of the tain a BSN (LNA, ENA, cDNAand the like) and a 2'-O- invention is an antisense oligonucleotide. The antisense alkyl modification and/or 2' halo modification, such as oligonucleotides can include ribonucleotides or deoxyribo- 2'-fluoro modification. In yet another embodiment, the anti- nucleotides or a combination thereof. Preferably, the anti- sense oligonucleotides targeting miR-208a and/or miR-208b sense oligonucleotides have at least one chemical modifi- contain combinations of BSN (LNA, ENA, cDNAand the cation (e.g., sugar or backbone modification). For instance, like) or other modified nucleotides, and ribonucleotides or suitable antisense oligonucleotides can be comprised of one deoxyribonucleotides. In one embodiment, the antisense or more “conformationally constrained” or bicyclic sugar oligonucleotides targeting miR-208a and/or miR-208b con- nucleoside modifications (BSN) that confer enhanced ther- tain a combination of BSN (LNA, ENA, cDNAandthelike) mal stability to complexes formed between the antisense and a 2'-O-alkyl modification and/or 2' halo modification, oligonucleotide containing BSN and their complementary such as 2'-fluoro modification. microRNAtarget strand. For example, in one embodiment, In one embodiment, the antisense oligonucleotides com- the antisense oligonucleotide of the invention contains one prise a 2'-O,4'-C-ethylene-bridged nucleic acid, such as or more locked nucleic acid (LNAs) residues, or “locked 30 2'-O,4'-C-ethylene ribonucleoside, and a 2'-O,4'-C-methyl- nucleotides.” LNAsare described, for example, in U.S. Pat. ene ribonucleoside. In another embodiment, the antisense No. 6,268,490, U.S. Pat. No. 6,316,198, U.S. Pat. No. oligonucleotides comprise a 2'-O,4'-C-ethylene-bridged 6,403,566, U.S. Pat. No. 6,770,748, U.S. Pat. No. 6,998,484, nucleic acid, such as 2'-O, 4'-C-ethylene ribonucleoside, US. Pat. No. 6,670,461, and U.S. Pat. No. 7,034,133, all of 2'-O,4'C-methylene ribonucleoside, and a 2'-O-alkyl modi- which are hereby incorporated by reference in their entire- fication and/or 2'-halo modification, such as 2'-fluoro modi- ties. LNAs are modified nucleotides or ribonucleotides that fication. contain an extra bridge between the 2' and 4' carbonsof the Other suitable locked nucleotides that can be incorporated ribose sugar moiety resulting in a “locked” conformation, in the antisense oligonucleotides of the invention include and/or bicyclic structure. In exemplary embodiments, the those described in U.S. Pat. No. 6,403,566 and U.S. Pat. No. 6,833,361, both of which are hereby incorporated by refer- locked nucleotides have a 2' to 4' methylene bridge, as ence in their entireties. shown in structure A, for example. In one embodiment, the The antisense oligonucleotide may comprise, consist antisense oligonucleotide contains the 2'-O,4'C-methylene essentially of, or consist of, a sequence that is at least ribonucleoside (structure A) wherein the ribose sugar moiety partially complementary to a full length or truncated miR- is in a “locked” conformation. In yet another embodiment, 45 208a or miR-208b sequence. As used herein, the term “full the antisense oligonucleotides contains a 2'-O, 4% C-ethyl- length” in reference to a miRNA sequence refers to the ene-bridged nucleic acid (ENA), such as 2'-O,4'-C-ethylene length of the mature miRNA. Thus, the inhibitors described ribonucleoside. Alternatively or in addition, the antisense herein may be truncated or full-length, antisense to mature oligonucleotide may contain at least one 2',4'-C-bridged 2' miRNA sequences, or may comprise these sequences in deoxyribonucleoside (cDNA,structure B). Alternatively or combination with other polynucleotide sequences. In certain in addition, the antisense oligonucleotide contains one or embodiments, the specific chemical modification motifs more LNAs having the structure shown by structure C described herein render frill length antisense miRNA (ma- below. ture) sequences unnecessary. In these embodiments, the antisense oligonucleotide is from 8 to 20 nucleotides in 55 length, or is from 10 to 18 nucleotides in length, or is from 11 to 16 nucleotides in length. The antisense oligonucleotide in some embodimentsis about 12, about 13, about 14, about 15, about 16, about 17, or about 18 nucleotides in length. The truncated antisense oligonucleotide may have a 60 sequence that targets, by antisense inhibition, a miR-208a sequence within 5'-UAAGACGAGCAAAAAG-3' (SEQ ID NO:7) or a miR-208b sequence within UAAGAC- GAACAAAAAG-3' (SEQ ID NO:8). The antisense oligonucleotide generally has a nucleotide 65 sequence designed to target mature miR-208a and/or miR- 208b. The antisense oligonucleotide may, in these or other embodiments,also or alternatively be designed to target the US 9,428,749 B2 15 16 pre-miRNAor pri-miRNA forms. In certain embodiments, such patterns find use with an antisense oligonucleotide the antisense oligonucleotide may be designed to have a having the sequence of SEQ ID NO:3 or SEQ ID NO:4. sequence containing from 1 to 5 (eg., 1, 2, 3, or 4) For non-locked nucleotides, the nucleotide may contain a mismatches relative to the fully complementary (mature) 2' modification with respect to a 2' hydroxyl. For example, miR-208 sequence. the 2' modification may be 2' deoxy. Incorporation of In certain embodiments, the antisense oligonucleotide 2'-modified nucleotides in antisense oligonucleotides may comprises a nucleotide sequence that is completely comple- increase both resistance of the antisense oligonucleotides to mentary to a nucleotide sequence ofmiR-208a or miR-208b. nucleases and their thermal stability with complementary For example, the antisense oligonucleotide may comprise RNA. Various modifications at the 2' positions may be the nucleotide sequence of 5' TGCTCGTCTTA-3' (SEQ ID 10 independently selected from those that provide increased NO:1) or may comprise the nucleotide sequence of 5'-TGT- nuclease sensitivity, without compromising molecular inter- TCGTCTTA3' (SEQ ID NO:2). In particular embodiments, actions with the RNA target or cellular machinery. Such the antisense oligonucleotide comprises, consists essentially modifications may be selected on the basisof their increased of, or consists of the nucleotide sequence 5'-CTTTTT- potency in vitro or in vivo. 15 GCTCGTCTTA-3' (SEQ ID NO:3) or '5-CCTTTTGT- In some embodiments the 2' modification may be inde- TCGTCTTA (SEQ ID NO:4). In this context, “consists pendently selected from O-alkyl (which may be substituted), essentially of’ includes the optional addition of nucleotides halo, and deoxy (A). Substantially all, or all, nucleotide 2' (e.g., one or two) on either or both of the 5' and 3' ends, so positions of the non-locked nucleotides may be modified in long as the additional nucleotide(s) do not substantially 20 certain embodiments, e.g., as independently selected from affect the antisense oligonucleotide’s inhibition of the target O-alkyl (e.g., O-methyl), halo fluoro), and deoxy (H). For miRNA.In one embodiment, the antisense oligonucleotide example, the 2' modifications may each be independently has the structure of Compound 10101, 10673, 10674, 10677, selected from O-methyl and fluoro. In exemplary embodi- 10679, 10707, 10680, 10681, or 10683 shownin Table 1. In ments, purine nucleotides each have a 2' OMeand pyrimi- another embodiment, the antisense oligonucleotide has the 25 dine nucleotides each have a 2'-F. In certain embodiments, structure of Compound 10101, 10673, 10681, or 10683 from one to aboutfive 2' positions, or from about one to shown in Table 1. In certain embodiments, the antisense about three 2' positions are left unmodified (e.g., as 2' oligonucleotide has the structure of Compound 10101 or hydroxyls). 10683 shown in Table 1. 2' modifications in accordance with the invention also The antisense oligonucleotide may contain at least 3, at 30 include small hydrocarbon substituents. The hydrocarbon least 5, or at least 7 locked nucleotides, but in various substituents include alkyl, alkenyl, alkynyl, and alkoxyalkyl, embodiments is not fully comprised of locked nucleotides. where the alkyl (including the alkyl portion of alkoxy), Generally, the numberandposition of locked nucleotides is alkenyl]and alkynyl may be substituted or unsubstituted. The such that the antisense oligonucleotide reduces miR-208a alkyl, alkenyl, and alkynyl may be C1 to C10 alkyl, alkenyl and/or miR-208b activity as determinedin vitro or in vivo as 35 described in the Examples or other methods knownto those or alkynyl, such as C1, C2, or C3. The hydrocarbon sub- of skill in the art. In certain embodiments, the antisense stituents may include one or two or three non-carbon atoms, oligonucleotide does not contain a stretch of nucleotides which may be independently selected from N, O, and/or S. with more than four, or more than three, contiguous non- The 2' modifications may further include the alkyl, alkenyl, locked nucleotides. In certain embodiments, the antisense 40 and alkynyl as O-alkyl, O-alkenyl, and O-alkynyl. oligonucleotide does not contain a stretch of nucleotides Exemplary 2' modifications in accordance with the inven- with more than two contiguous non-locked nucleotides. For tion include 2'-O-alkyl (C1-3 alkyl, such as 2'O0Me or example, the antisense oligonucleotide may have just one 2'OEFt), 2'-O-methoxyethyl (2'-O-MOB), 2'-O-aminopropyl occurrence of contiguous non-locked nucleotides. In these (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOB), 2'-O- or other embodiments, the region complementary to the 45 dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylamino- miR-208a and/or miR-208b seed region comprises at least ethyloxyethyl (2'-O-DMAEOE), or 2'-O—N-methylacet- three or at least four locked nucleotides. These embodiments amido (2'-O—NMA)substitutions. may, for example, employ a nucleotide sequence of SEQ ID In certain embodiments, the antisense oligonucleotide NO:3 or SEQ ID NO:4. contains at least one 2'-halo modification (e.g., in place of a Thus, in various embodiments, the antisense oligonucle- 50 2' hydroxyl), such as 2'-fluoro, 2'-chloro, 2'-bromo, and otide contains at least nine locked nucleotides, or at least 2'-iodo. In some embodiments, the 2' halo modification is eleven locked nucleotides. The antisense oligonucleotide fluoro. The antisense oligonucleotide may contain from 1 to may contain at least three non-locked nucleotides. For about 5 2'-halo modifications (e.g., fluoro), or from 1 to example, the antisense oligonucleotide may contain nine about 3 2'-halo modifications(e.g., fluoro). In some embodi- locked nucleotides and seven non-locked nucleotides, or 55 ments, the antisense oligonucleotide contains all 2'-fluoro may contain eleven locked nucleotides and five non-locked nucleotides at non-locked positions, or 2'-fluoro on all nucleotides. non-locked pyrimidine nucleotides. In certain embodiments, The pattern of locked nucleotides may be suchthatat least the 2'-fluoro groups are independently di-, tri-, or un- positions 1, 6, 10, 13, and 15 are locked nucleotides. In methylated. certain embodiments, positions 1, 5, 6, 8, 10, 11, 13, 15, and 60 The antisense oligonucleotide may have one or more 16 are locked nucleotides, and the remaining positions are 2'-deoxy modifications(e.g., H for 2' hydroxyl), and in some non-locked nucleotides. In other embodiments, positions 1, embodiments, contains from 2 to about 10 2'-deoxy modi- 3, 4, 5, 6, 8, 10, 13, 15, and 16 are locked nucleotides, with fications at non-locked positions, or contains 2' deoxyatall the remaining positions being non-locked nucleotides. In non-locked positions. still other embodiments, positions 1, 4, 5, 7, 9, 10, 12, 14, 65 In exemplary embodiments, the antisense oligonucleotide and 16 are locked nucleotides, with the remaining positions contains 2' positions modified as 2'OMe in non-locked being non-locked nucleotides. In exemplary embodiments, positions. Alternatively, non-locked purine nucleotides are US 9,428,749 B2 17 18 modified at the 2' position as 2'OMe, with non-locked nucleotide base chemical groups at the 1' position. For pyrimidine nucleotides modified at the 2' position as example, the abasic nucleotide may be a reverse abasic 2'-fluoro. nucleotide, e.g., where a reverse abasic phosphoramidite is In certain embodiments, the antisense oligonucleotide coupled via a 5' amidite (instead of 3' amidite) resulting in further comprises at least one terminal modification or a 5'-5' phosphate bond. The structure of a reverse abasic “cap”. The cap may be a 5' and/or a 3'-cap structure. The nucleoside for the 5' and the 3' end of a polynucleotide is terms “cap” or “end-cap” include chemical modifications at shown below. either terminus of the antisense oligonucleotide (with respect to terminal ribonucleotides), and including modifi- cationsat the linkage betweenthe last two nucleotides on the 10 OH 5' end and the last two nucleotides on the 3' end. The cap structure as described herein may increase resistance of the antisense oligonucleotide to exonucleases without compro- mising molecular interactions with the RNA target or cel- Oo | 15 O—P—O B lular machinery. Such modifications may be selected on the O basis of their increased potency in vitro or in vivo. The cap can be present at the 5'-terminus (5'-cap) or at the 3'-termi- 5’ end of oligo nus (3'-cap) or can be present on both ends. In certain embodiments,the 5'- and/or 3'-cap is independently selected 5 R from phosphorothioate monophosphate, abasic residue 20 (moiety), phosphorothioate linkage, 4'-thio nucleotide, car- bocyclic nucleotide, phosphorodithioate linkage, inverted nucleotide or inverted abasic moiety (2'-3' or 3'-3'), ; B phosphorodithioate monophosphate, and methylphospho- O nate moiety. The phosphorothioate or phosphorodithioate 25 linkage(s), when part of a cap structure, are generally positioned between the two terminal nucleotides on the 5' end and the two terminal nucleotides on the 3' end. Oo R In certain embodiments, the antisense oligonucleotide has 3’ end of oligo obo at least one terminal phosphorothioate monophosphate. The 30 phosphorothioate monophosphate may support a higher oO| potency by inhibiting the action of exonucleases. The phos- OH phorothioate monophosphate maybeat the 5' and/or 3' end of the antisense oligonucleotide. A phosphorothioate mono- The antisense oligonucleotide may contain one or more phosphate is defined by the following structures, where B is 35 phosphorothioate linkages. Phosphorothioate linkages have base, and R is a 2' modification as described above: been used to render antisense oligonucleotides more resis- tant to nuclease cleavage. For example, the polynucleotide may be partially phosphorothioate-linked, for example, I 40 phosphorothioate linkages may alternate with phophodiester “~O—P—O HO. linkages. In certain embodiments, however, the antisense | BB S OO oligonucleotide is fully phosphorothioate-finked. In other embodiments, the antisense oligonucleotide has from one to five or one to three phosphate linkages. 45 In one embodiment, the invention provides a method of OH R 1 R using chemically modified antisense oligonucleotides to inhibit the expression e.g., abundance) of miR-208 family 5' phosphorothioate o=Pp—s miRNAs,including miR-208a and miR-208b. The invention monophosphate | o provides in some embodiments, a methodof using antisense 50 oligonucleotides to inhibit, in a specific fashion, the expres- 3’ phos- sion or abundance of each of miR-208a and miR-208b in phorothioate cardiac and/or skeletal muscle tissue. The invention further monophosphate provides methods of treating patients having conditions or disordersrelating to or involving a miR-208 family miRNA, Where the cap structure can support the chemistry of a 55 such as a metabolic disorder. The invention further provides locked nucleotide, the cap structure may incorporate a for a method of regulating fatty acid metabolism with a locked nucleotide as described herein. modulator or inhibitor of miR-208a and/or miR-208b Phosphorothioate linkages may be present in some expression or activity. embodiments, such as between the last two nucleotides on Antisense oligonucleotides used in the present invention the 5' and the 3' end as part of a cap structure), or as 60 can comprise a sequence that is at least partially comple- alternating with phosphodiester bonds. In these or other mentary to a miR-208a and/or miR-208b sequence, e.g. at embodiments, the antisense oligonucleotide may contain at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or least one terminal abasic residue at either or both the 5' and 99% complementary to a miR-208a and/or miR-208b 3' ends. An abasic moiety does not contain a commonly sequence. In some embodiments, the antisense oligonucle- recognized purine or pyrimidine nucleotide base, such as 65 otide can be substantially complementary to a miR-208a adenosine, guanine, cytosine, uracil or thymine. Thus, such and/or miR-208b sequence, that is at least about 90%, 95%, abasic moieties lack a nucleotide base or have other non- 96%, 97%, 98%, or 99% complementary to a miR-208a US 9,428,749 B2 19 20 and/or miR-208b sequence. In one embodiment, the anti- The antisense oligonucleotide may comprise, consist sense oligonucleotide comprises a sequence that is com- essentially of or consist of a sequence at least partially pletely complementary (.c., 100% complementary) to a complementary to a full length or truncated miR-208a or miR-208a and/or miR-208b sequence. miR-208b. In these embodiments, the antisense oligonucle- In some embodiments, the inhibitor of miR-208a and/or 5 otide is from about 6 to 22 nucleotides in length, or is from about 10 to 18 nucleotides in length, or is about 11 to about miR-208b used in the methods of the present invention is an 16 nucleotides in length. The antisense oligonucleotide in antisense oligonucleotide that is at least partially comple- some embodiments is about 14, 15, 16, or 17 nucleotides in mentary to a miR-208a or miR-208b nucleotide sequence. In length. The antisense oligonucleotide may comprise the other embodiments, the inhibitor of miR-208a and/or miR- : : Lo. 10 nucleotide sequence of 5'-TGCTCGTCTTA-3' (SEQ ID 208b used in the methods of the present invention is an" NO:1) or may comprise the nucleotide sequence of 5'-TGT- antisense oligonucleotide that is substantially complemen- TCGTCTTA-3' (SEQ ID NO:2). In particular embodiments, tary to a nucleotide sequence of human miR-208a and/or _the antisense oligonucleotide comprises, consists essentially miR-208b (or corresponding pre-miRNA or pri-miRNA), of, or consists of the nucleotide sequence 5'-CTTTTT- and may contain a mixture of locked and non-locked nucleo- ,, GCTCGTCTTA-3' (SEQ ID NO:3) or 5'-CCTTTTGT- tides optionally with a phosphorothioate backbone. For TCGTCTTA-3' (SEQ ID NO:4). example, the antisense oligonucleotide may contain at least The antisense oligonucleotide may also contain one or three, at least five or at least seven locked nucleotides, and more phosphorothioate linkages. For example, the antisense at least one non-locked nucleotide. A substantially comple- oligonucleotide may be fully phosphorothioate-linked. mentary antisense oligonucleotide may have from 1 to 4 ,, Exemplary inhibitors for use in the methodsof the inven- | mismatches(e.g., 1, 2, 3 or 4 mismatches) with respectto its tion are antisense oligonucleotides having the structure of a target sequence of miR-208a or miR-208b. In exemplary compound listed in Table 1, below. Antisense oligonucle- embodiments, the locked nucleotides may have a 2' to 4' otides that reduce miR-208a and miR-208b activity are methylene bridge. In some embodiments, such antisense described in International Application No. PCT/US2011/ oligonucleotides having one or more locked nucleotides has 065121 (published as WO2012/083005), which is hereby a full phosphorothioate backbone. incorporated by reference in its entirety. TABLE 1 Exemplary Antisense Oligonucleotide Inhibitors SEQ cmpd# ID (M) Alias Sequence (5' to 3') NO: Length 10101 208a_DNA_LNA_16_PS 1Cs;aTs;dTs;dTs;1Ts;1Ts;dGs;1Cs;dTs;1Cs;1Gs;daTs; 13 16 1Cs;dTs;1Ts;1A 10570 208fam_optdes1 1Ts;dGs;1Cs;1Ts;1Cs;dGs;1Ts;1Cs;dTs;1Ts;1A 14 11 10571 208fam_optdes2 1Ts;dGs;1Cs;1Ts;1Cs;dGs;dTs;1Cs;dTs;1Ts;1A 15 11 10572 208fam_optdes3 1Ts;dGs;1Cs;dAs;1Cs;dGs;1Ts;dCs;1Ts;1Ts;1A 16 11 10573 208fam_optdes4 1Ts;1Gs;dCs;dAs;1Cs;1Gs;dTs;1Cs;dTs;1Ts;1A 17 11 10673 208a LNA 1Cs;dTs;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs; 18 16 C_T_DNA_16_1 1cs;aTs;1Ts;dA 10674 208a_LNA 1Cs;dTs;dTs;1Ts;1Ts;1Ts;dGs;1Cs;1Ts;1Cs;dGs;1Ts; 19 16 c_TDNA162 1cs;1TS;1Ts;dA 10677 208a_LNA 1¢Cs;1Ts;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;1Ts;1Cs;dGs;1Ts; 20 16 c_TDNA163 1cs;1Ts;1Ts;dA 10679 208LNAopt_1l 1Cs;dTs;1Ts;dTs;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;1Ts; 21 16 dCs;1Ts;1Ts;dA 10680 208LNAopt_2 1Cs;dTs;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs; 22 16 1Cs;dTs;dTs;1A 10681 208LNAopt_3 1Cs;dTs;1Ts;1Ts;dTs;1Ts;dGs;1Cs;1Ts;1Cs;dGs;dTs; 23 16 1Cs;dTs;1Ts;dA 10682 208LNAopt_4 1Cs;dTs;1Ts;dTs;1Ts;dTs;1Gs;dCs;1Ts;dcs;1Gs;dTs; 24 16 1Cs;dTs;1Ts;1A 10683 208LNAopt_5 1Cs;dTs;dTs;1Ts;1Ts;dTs;1Gs;dCs;1Ts;1Cs;dGs;1Ts; 25 16 dCs;1Ts;dTs;1A 10707 208b_DNA_LNA_16_PS 1Cs;dCs;dTs;dTs;1Ts;1Ts;dGs;1Ts;1Gs;dTs;1Cs;daTs; 26 16 1Cs;dTs;1Ts;1A 10718 208a like151 1Ts;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 27 15 aTs;1Ts;dA US 9,428,749 B2 TABLE 1-continued Exemplary Antisense Oligonucleotide Inhibitors SEQ cmpd# ID (M) Alias Sequence (5' to 3') NO: Length 10719 208a like152 1Ts;1Ts;dTs;1Ts;1Ts;dGs;1Cs;dts;1Cs;dGs;dTs;1Cs; 28 15 aTs;1Ts;dA 10720 208a like153 1Ts;1Ts;1Ts;1Ts;1Ts;dGs;dCs;dTs;1Cs;dGs;1Ts;1Cs; 29 15 aTs;1Ts;dA 10721 208a like154 1Ts;dTs;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 30 15 1Ts;1Ts;dA 10722 208a like15.5 1Ts;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 31 15 1Ts;1Ts;1A 10723 208a like_156 1Ts;dTs;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 32 15 1Ts;1Ts;1A 10724 208b like15.1 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 33 15 aTs;1Ts;dA 10725 208b like152 1¢Cs;1Ts;dTs;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 34 15 aTs;1Ts;dA 10726 208b like153 1Cs;dTs;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 35 15 1Ts;1Ts;dA 10727 208b like154 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 36 15 aTs;1Ts;1A 10728 208b like15.5 1Cs;dTs;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs; 37 15 aTs;1Ts;1A 10729 208b like156 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;dCs;dTs;1Cs;dGs;1Ts;1Cs; 38 15 aTs;1Ts;dA 10730 208b_151 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs; 39 15 aTs;1Ts;dA 10731 208b_152 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs; 40 15 aTs;1Ts;1A 10732 208b_153 1¢s;1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts;1Cs; 4l 15 aTs;1Ts;dA 10733 208a like_15_7 1Ts;dTs;1Ts;dTs;1Ts;dGs;dCs;dTs;1Cs;1Gs;1Ts;1Cs; 42 15 1Ts;1Ts;1A 10734 208b like15.7 1Cs;dTs;1Ts;dTs;1Ts;dGs;dCs;dTs;1Cs;1Gs;1Ts;1Cs; 43 15 1Ts;1Ts;1A 10735 208b_154 1Cs;dTs;1Ts;dTs;1Ts;dGs;dTs;dTs;1Cs;1Gs;1Ts;1Cs; 44 15 1Ts;1Ts;1A 10736 208a like141 1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs; 45 14 1Ts;dA 10737 208a like142 1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs; 46 14 1Ts;1A 10738 208a like143 1Ts;1Ts;1Ts;1Ts;dGs;dCs;dTs;1Cs;dGs;dTs;1Cs;dTs; 47 14 1Ts;1A 10739 208a like144 1Ts;1Ts;1Ts;1Ts;dGs;dCs;dTs;1Cs;dGs;1Ts;1Cs;dTs; 48 14 1Ts;1A 10740 208a like145 1Ts;1Ts;1Ts;1Ts;dGs;dCs;1Ts;1Cs;dGs;1Ts;dcs;1Ts; 49 14 1Ts;dA 10741 208a like146 1Ts;dTs;1Ts;dTs;dGs;1Cs;dTs;1Cs;1Gs;1Ts;1Cs;1Ts; 50 14 1Ts;1A 10742 208b141 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs; 51 14 1Ts;dA 10743 208b_142 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs; 52 14 1Ts;1A US 9,428,749 B2 TABLE 1-continued Exemplary Antisense Oligonucleotide Inhibitors SEQ cmpd# ID (M) Alias Sequence (5' to 3') NO: Length 10744 208b_143 1Ts;1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;dTs;1Cs;dTs; 53 14 1Ts;1A 10745 208b_144 1Ts;1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;1Ts;1Cs;dTs; 54 14 1Ts;1A 10746 208b_145 1Ts;1Ts;1Ts;1Ts;dGs;dTs;1Ts;1Cs;dGs;1Ts;dcs;1Ts; 55 14 1Ts;dA 10747 208b_146 lts;dTs;1Ts;dTs;dGs;1Ts;dTs;1Cs;1Gs;1Ts;1Cs;1Ts; 56 14 1Ts;1A 10748 208a like13.1 1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 57 13 dA 10749 208a like132 1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 58 13 1A 10750 208a like_133 1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 59 13 1A 10751 208a like134 1Ts;dTs;1Ts;dGs;1Cs;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 60 13 1A 10752 208b_131 1Ts;1Ts;1TS;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 61 13 dA 10753 208b_132 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 62 13 1A 10754 208b_133 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 63 13 1A 10755 208b_134 1Ts;dTs;1Ts;dGs;1Ts;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 64 13 1A 10756 208a like111 1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts;dA 65 11 10757 208a like_112 1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts;1A 66 11 10758 208b11.1 1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts;dA 67 11 10759 208b_112 1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts;1A 68 11 10760 208b_161 1Cs;dCs;1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs; 69 16 1Cs;dTs;1Ts;dA 10761 208b_162 1Cs;dCs;1Ts;dTs;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts; 70 16 dCs;1Ts;1Ts;dA 10762 208b_163 1Cs;dCs;1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs; 71 16 1Cs;dTs;dTS;1A 10763 208b like161 1Cs;dCs;1Ts;1Ts;1Ts;1TS;dGs;1Cs;dTs;1Cs;dGs;dTs; 72 16 1Cs;dTs;1Ts;dA 10764 208b like162 1Cs;dCs;1Ts;dTs;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;1Ts; 73 16 dCs;1Ts;1Ts;dA 10765 208b like163 1Cs;dCs;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs;dGs;dTs; 74 16 1Cs;dTs;dTs;1A 10775 208b_155 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs; 75 15 1Ts;dAs;1T 10776 208b_156 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs; 76 15 1Ts;1As;1T 10777 208b_15_7 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts;1Cs;dTs; 77 15 1Ts;dAs;1T 10778 208b_158 1Ts;1Ts;dTs;1Ts;dGs;dTs;dTs;1Cs;1Gs;1Ts;1Cs;1Ts; 78 15 1Ts;1As;1T US 9,428,749 B2 TABLE 1-continued Exemplary Antisense Oligonucleotide Inhibitors SEQ cmpd# ID (M) Alias Sequence (5' to 3') NO: Length 10779 208b_159 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs; 79 15 1Ts;1lAs;dT 10780 208b_15_10 1Ts;1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts;1Cs;dTs; 80 15 1Ts;1lAs;dT 10781 208b_1511 1Ts;1Ts;dTs;1Ts;dGs;1Ts;dTs;1Cs;1Gs;1Ts;1Cs;1Ts 81 15 1Ts;1lAs;dT 10782 208b_1512 1Ts;1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;dTs;1Cs;1Ts; 82 15 1Ts;dAs;1T 10783 208b_15_13 1Ts;1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;dTs;1Cs;1Ts; 83 15 1Ts;1lAs;dT 10784 208b_147 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 84 14 dAs;1T 10785 208b_148 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 85 14 1As;1T 10786 208b_149 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts;1Cs;dTs;1Ts; 86 14 dAs;1T 10787 208b_1410 1Ts;dTs;1Ts;dGs;dTs;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 87 14 1As;1T 10788 208b_1411 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;dTs;1Cs;dTs;1Ts; 88 14 1As; dT 10789 208b_1412 1Ts;1Ts;1Ts;dGs;1Ts;dTs;1Cs;dGs;1Ts;1Cs;dTs;1Ts; 89 14 1As; dT 10790 208b_1413 1Ts;dTs;1Ts;dGs;1Ts;dTs;1Cs;1Gs;1Ts;1Cs;1Ts;1Ts; 90 14 1As; dT 10791 208b_1414 1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;dTs;1Cs;1Ts;1Ts; 91 14 dAs;1T 10792 208b_1415 1Ts;1Ts;1Ts;dGs;dTs;dTs;1Cs;dGs;dTs;1Cs;1Ts;1Ts; 92 14 1As; dT 10793 208b_164 1Cs;dTs;1Ts;1Ts;1Ts;1Gs;dTs;1Ts;dCcs;1Gs;dTs;dcCs; 93 16 1Ts;dTs;1lAs;dT 45 TABLE 2 The synthesis of antisense oligonucleotides, including modified polynucleotides, by solid phase synthesis is well Description of Notations in Table 1 known and is reviewed in New Chemical Methods for deoxy A dA Synthesizing Polynucleotides. Caruthers M H, Beaucage S deoxy G dG 50 L, Efcavitch J W, Fisher E F, Matteucci M D, Stabinsky Y. deoxy C dc Nucleic Acids Symp. Ser. 1980; (7):215-23. deoxy T aT Alternatively, the antisense oligonucleotides can com- Ina A IA :: :: : :: InaG IG prise peptide nucleic acids (PNAs), which contain a peptide- Ina C Ic based backbone rather than a sugar-phosphate backbone. Ina T IT 55 Other modified sugar or phosphodiester modifications to the deoxy AP=8 dAs antisense oligonucleotide are also contemplated. For deoxy GP=S dGs : : :: : deoxy C P= S dCs instance, other chemical modifications that the antisense deoxy TP=S dTs oligonucleotides can contain include, but are not limited to, Ina AP=S lAs sugar modifications, such as 2'-O-alkyl 2'-O-methyl, 2'-O- ae . ee 60 methoxyethyl), 2'-fluoro, and 4' thio modifications, and Inna TP=S$= ITsSs backbone modifications,*. such as one or more phosphoroth- ioate, morpholino, or phosphonocarboxylate linkages (see, for example, U.S. Pat. Nos. 6,693,187 and 7,067,641, which In particular embodiments, the antisense oligonucleotide are herein incorporated by reference in their entireties). In is 10101, 10673, 10674, 10677, 10679, 10707, 10680, 65 one embodiment, antisense oligonucleotides targeting miR- 10681, or 10683, or other antisense oligonucleotide 208a and/or miR-208b contain 2'O-methyl sugar modifica- described in Table 1. tions on each base and are linked by phosphorothioate US 9,428,749 B2 27 28 linkages. Antisense oligonucleotides, particularly those of about 25 nucleotides in length. The polynucleotides com- shorter lengths(e.g., less than 15 nucleotides) can comprise prising the mature miR-208a, mature miR-208b, pre-miR- one or more affinity enhancing modifications, such as, but 208a, or pre-miR-208b sequence can be single stranded or not limited to, LNAs, bicyclic nucleosides, phosphonofor- double-stranded. The polynucleotides can contain one or mates, 2' O-alkyl modifications and the like. In some more chemical modifications, such as locked nucleic acids, embodiments, suitable antisense oligonucleotides are 2'-O- peptide nucleic acids, sugar modifications, such as 2%0- methoxyethyl “gapmers” which contain 2'-O-methoxyethyl- alkyl (e.g. 2'-O-methyl, 2'-O-methoxyethy]l), 2'-fluoro, and 4' modified ribonucleotides on both 5 and 3' ends with at least thio modifications, and backbone modifications, such as one ten deoxyribonucleotides in the center. These “gapmers” are or more phosphorothioate, morpholino, or phosphonocar- capable of triggering RNase dependent degradation mecha- 10 boxylate linkages. In one embodiment, the polynucleotide nisms of RNA targets. Other modifications of antisense comprising a miR-208 sequence (e.g., mature miR-208a, oligonucleotides to enhance stability and improveefficacy, mature miR-208b, pre-miR-208a, or pr2-miR-208b) is con- such as those described in U.S. Pat. No. 6,838,283, which is jugated to a steroid, such as cholesterol, a vitamin, a fatty herein incorporated by reference in its entirety, are known in acid, a carbohydrate or glycoside, a peptide, or another small the art and are suitable for use in the methods of the 15 molecule ligand. invention. For instance, to facilitate in vivo delivery and Any of the inhibitors or agonists of miR-208a and/or stability, the antisense oligonucleotide can be linked to a miR-208b described herein can be deliveredto the target cell steroid, such as cholesterol moiety, a vitamin, a fatty acid, a (e.g. heart or skeletal muscle cell) by delivering to the cell carbohydrate or glycoside, a peptide, or other small mol- an expression vector encoding the miR-208a and/or miR- ecule ligand at its 3' end. 20 208b inhibitors or agonists or by delivering the inhibitor or In some embodiments, the antisense oligonucleotides are agonist itself directly to the target cell. A “vector” is a antagomirs. “Antagomirs” are single-stranded, chemically- composition ofmatter which can be usedto deliver a nucleic modified ribonucleotides that are at least partially comple- acid of interest to the interior of a cell. Numerousvectors are mentary to a miR-208a and/or miR-208b sequence. Antago- knownin the art including, but not limited to, linear poly- mirs may comprise one or more modified nucleotides, such 25 nucleotides, polynucleotides associated with ionic or amphi- as 2'-O-methyl-sugar modifications. In some embodiments, philic compounds, plasmids, and viruses. Thus, the term antagomirs comprise only modified nucleotides. Antagomirs “vector” includes an autonomously replicating plasmid or a can also comprise one or more phosphorothioate linkages virus. Examples of viral vectors include, but are not limited resulting in a partial or full phosphorothioate backbone. To to, adenoviral vectors, adeno-associated virus vectors, ret- facilitate in vivo delivery andstability, the antagomir can be 30 roviral vectors, and the like. An expression construct can be linked to a cholesterol or other moiety at its 3' end. Antago- replicated in a living cell, or it can be made synthetically. For mirs suitable for inhibiting miR-208a and/or miR-208b can purposes of this application, the terms “expression con- be about from 8 to 20 nucleotides in length, or is from 10 to struct,” “expression vector,” and “vector,” are used inter- 18 nucleotides in length, or is from 11 to 16 nucleotides in changeably to demonstrate the application of the invention length. The antagomirs can be at least about 75%, 80%, 35 in a general, illustrative sense, and are not intended to limit 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary the invention. to a miR-208a or miR-208b sequence. In some embodi- In one embodiment, an expression vector for expressing ments, the antagomir may be substantially complementary an inhibitor or agonist of miR-208a and/or miR-208b com- to a miR-208a or miR-208b sequence, that is at least about prises a promoter operably linked to a polynucleotide encod- 95%, 96%, 97%, 98%, or 99% complementary to a target 40 ing an antisense oligonucleotide or agonist oligonucleotide. polynucleotide sequence. In other embodiments, the antago- In one embodiment, an expression vector for expressing an mirs are 100% complementary to a miR-208a or miR-208b inhibitor of miR-208a and/or miR-208b comprises a pro- sequence. Antagomirs may comprise a sequence that is moter operably linked to a polynucleotide encoding an substantially complementary to a precursor miRNA antisense oligonucleotide, wherein the sequence of the sequence (pre-miRNA) or primary miRNA sequence (pri- 45 expressed antisense oligonucleotide is partially or perfectly miRNA) for miR-208a or miR-208b. complementary to a mature sequence of miR-208a (e.g., Also provided herein are agonists of miR-208a and miR- SEQ ID NO:9) or a mature sequence of miR-208b (SEQ ID 208b. An agonist of miR-208a and/or miR-208b expression NO:11). In another embodiment, an expression vector for or activity can be a polynucleotide comprising a miR-208a expressing a polynucleotide comprising a miR-208a and/or miR-208b sequence. For instance, in one embodi- 50 sequence comprises a promoter operably linked to a poly- ment the miR-208a agonist is a polynucleotide comprising a nucleotide comprising a human pre-miR-208a sequence miR-208a sequence, such as SEQ ID NO: 5-9. In one (e.g., SEQ ID NO:5). In another embodiment, an expression embodiment, the agonist is a polynucleotide comprising a vector for expressing a polynucleotide comprising a miR- mature miR-208a sequence, such as SEQ ID NO:9. Instill 208b sequence comprises a promoter operably linked to a another embodiment, the miR-208a agonist can be a poly- 55 polynucleotide comprising a pre-miR-208b sequence(e.g., nucleotide comprising the pre-miRNA sequence for miR- SEQ ID NO: 10). The phrase “operably linked” or “under 208a, such as SEQ ID NO:5. In another embodiment, the transcriptional control” as used herein meansthat the pro- miR-208b agonist is a polynucleotide comprising a miR- moter is in the correct location andorientation in relation to 208b sequence. In one embodiment, the agonist is a poly- a polynucleotide to control the initiation of transcription by nucleotide comprising a mature miR-208b sequence, such as 60 RNA polymerase and expression of the polynucleotide. SEQ ID NO:11. In still another embodiment, the miR-208b As used herein, a “promoter” refers to a DNA sequence agonist can be a polynucleotide comprising the pre-miRNA recognized by the synthetic machinery of the cell, or intro- sequence for miR-208b, such as SEQ ID NO:10. duced synthetic machinery, required to initiate the specific The polynucleotide comprising a miR-208a and/or miR- transcription of a gene. Suitable promoters include, but are 208b sequence can be from about 18 to about 2000 nucleo- 65 not limited to RNA polI, pol I, pol II, and viral promoters tides in length, about 70 to about 200 nucleotides in length, (e.g. human cytomegalovirus (CMV) immediate early gene about 20 to about 50 nucleotides in length, or about 18 to promoter, the SV40 early promoter, and the Rous sarcoma US 9,428,749 B2 29 30 virus long terminal repeat). In one embodiment, the pro- delivery, such as those described in WO 2010/129672, moteris a tissue-specific promoter. Of particular interest are which is hereby incorporated by reference. muscle specific promoters, and more particularly, cardiac The composition or formulation may employ a plurality specific promoters. These include the myosin light chain-2 of therapeutic antisense oligonucleotides, including at least promoter (Franzet al. (1994) Cardioscience, Vol. 5(4):235- one described herein. For example, the composition or 43; Kelly et al. (1995) J. Cell Biol., Vol. 129(2):383-396), formulation may employ at least 2, 3, 4, or 5 miRNA the alpha actin promoter (Mosset al. (1996) Biol. Chem., inhibitors or agonists described herein. Vol. 271(49):31688-31694), the troponin 1 promoter The inhibitors (such as antisense oligonucleotides) or (Bhavsar et al. (1996) Genomics, Vol. 35(1):11-23); the agonists of the invention may be formulated as a variety of Na+/Ca2+ exchanger promoter (Barneset al. (1997) J. Biol. 10 pharmaceutical compositions. Pharmaceutical compositions Chem., Vol; 272(17): 11510-11517), the dystrophin pro- will be prepared in a form appropriate for the intended moter (Kimura et al. (1997) Dev. Growth Differ., Vol. application. Generally, this will entail preparing composi- 39(3):257-265), the alpha7 integrin promoter (Ziober and tions that are essentially free of pyrogens, as well as other Kramer (1996) J. Bio. Chem., Vol. 271(37):22915-22), the impurities that could be harmful to humans or animals. brain natriuretic peptide promoter (LaPointe et al. (1996) 15 Exemplary delivery/formulation systems include colloidal Hypertension, Vol. 27(3 Pt 2):715-22) and the alpha B-crys- dispersion systems, macromolecule complexes, nanocap- tallin/small heat shock protein promoter (Gopal-Srivastava sules, microspheres, beads, and lipid-based systems includ- (1995) J. Cell. Biol., Vol. 15(147081-7090), alpha myosin ing oil-in-water emulsions, micelles, mixed micelles, and heavy chain promoter (Yamauchi-Takihara et al. (1989) liposomes. Commercially available fat emulsions that are Proc. Natl. Acad. Sci. USA, Vol. 86(10):3504-3508) and the 20 suitable for delivering the nucleic acids of the invention to ANFpromoter (LaPointe et al., (1988) J. Biol. Chem., Vol. cardiac and skeletal muscle tissues include Intralipid®, 263(19):9075-9078). In one embodiment, the tissue-specific Liposyn®, Liposyn® Liposyn® III, Nutrilipid, and other promoter is an adipocyte-specific promoter, such as an similar lipid emulsions. A preferred colloidal system for use adipocyte protein 2 (ap2)/fatty acid binding protein 4 as a delivery vehicle in vivo is a liposome(1.e., an artificial (FABP4) promoter or a PPARy promoter. 25 membranevesicle). The preparation and use of such systems In certain embodiments, the promoter operably linked to is well known in the art. Exemplary formulations are also a polynucleotide encoding a miR-208a and/or miR-208b disclosed in U.S. Pat. No. 5,981,505; U.S. Pat. No. 6,217, inhibitor or a polynucleotide encoding a miR-208a or miR- 900; U.S. Pat. No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. 208b sequence can be an inducible promoter. Inducible Pat. No. 7,202,227; U.S. Pat. No. 6,379,965; U.S. Pat. No. promoters are known in the art and include, but are not 30 6,127,170; U.S. Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; limited to, tetracycline promoter, metallothionein IA pro- and WO03/093449, which are hereby incorporated by ref- moter, heat shock promoter, steroid/thyroid hormone/ret- erence in their entireties. inoic acid response elements, the adenovirus late promoter, The pharmaceutical compositions and formulations may and the inducible mouse mammary tumor virus LTR. employ appropriate salts and buffers to render delivery Methodsof delivering expression constructs and nucleic 35 vehicles stable and allow for uptake by target cells. Aqueous acids to cells are known in the art and can include, for compositions of the present invention comprise an effective example, calctum phosphate co-precipitation, electropora- amount of the delivery vehicle comprising the inhibitor tion, microinjection, DEAE-dextran, lipofection, transfec- antisense oligonucleotide or agonist (e.g. liposomesor other tion employing polyamine transfection reagents, cell soni- complexes), dissolved or dispersed in a pharmaceutically cation, gene bombardment using high velocity 40 acceptable carrier or aqueous medium. The phrases “phar- microprojectiles, and receptor-mediated transfection. maceutically acceptable”or “pharmacologically acceptable” The present invention also includes methodsfor scaveng- refers to molecular entities and compositions that do not ing or clearing miR-208a and/or miR-208b inhibitors fol- produce adverse,allergic, or other untoward reactions when lowing treatment. The method may comprise overexpressing administered to an animal or a human. As used herein, binding sites for the miR-208a and/or miR-208b inhibitors 45 “pharmaceutically acceptable carrier” may include one or in cardiac or skeletal muscle tissue. The binding site regions more solvents, buffers, solutions, dispersion media, coat- preferably contain a sequence of the seed region for miR- ings, antibacterial and antifungal agents, isotonic and 208a and/or 208b. The seed region is the 5' portion of a absorption delaying agents and the like acceptable for use in miRNA spanning bases 2-8, which is important for target formulating pharmaceuticals, such as pharmaceuticals suit- recognition. In some embodiments, the binding site may 50 able for administration to humans. The use of such media contain a sequence from the 3'UTR of one or more targets and agents for pharmaceutically active substances is well of miR-208a and/or miR-208b, such as thyroid hormone knownin the art. Supplementary active ingredients also can receptor associated protein 1 (THRAP1, a.k.a MED13), be incorporated into the compositions. Sox6, Sp3, Myostatin, PURbeta, andthe fast skeletal muscle Administration or delivery of the pharmaceutical compo- protein genes. 55 sitions according to the present invention may be via any The inhibitors (such as antisense oligonucleotides) or route so long as the target tissue is available via that route. agonists of the present invention may be incorporated within For example, administration may be by intradermal, subcu- a variety of macromolecular assemblies or compositions. taneous, intramuscular, intraperitoneal or intravenousinjec- Such complexes for delivery may include a variety of tion, or by direct injection into target tissue (e.g., cardiac or liposomes, nanoparticles, and micelles, formulated for deliv- 60 skeletal muscle tissue). The stability and/or potency of the ery to a patient. The complexes may include one or more antisense oligonucleotides disclosed herein allows for con- fusogenic or lipophilic molecules to initiate cellular mem- venient routes of administration, including subcutaneous, brane penetration. Such molecules are described, for intradermal, and intramuscular. Pharmaceutical composi- example, in U.S. Pat. No. 7,404,969 and U.S. Pat. No. tions comprising miRNA inhibitors may also be adminis- 7,202,227, which are hereby incorporated by reference in 65 tered by catheter systems or systems that isolate coronary their entireties. Alternatively, the oligonucleotide may fur- circulation for delivering therapeutic agents to the heart. ther comprise a pendant lipophilic group to aid cellular Various catheter systems for delivering therapeutic agents to US 9,428,749 B2 31 32 the heart and coronary vasculature are known in the art. mayeasily be administered in a variety of dosage forms such Some non-limiting examples of catheter-based delivery as injectable solutions, drug release capsules and thelike. methods or coronary isolation methods suitable for use in For parenteral administration in an aqueous solution, for the present invention are disclosed in U.S. Pat. No. 6,416, example, the solution generally is suitably buffered and the 510; U.S. Pat. No. 6,716,196; U.S. Pat. No. 6,953,466, WO liquid diluent first rendered isotonic for example with suf- 2005/082440, WO 2006/089340, U.S. Patent Publication ficient saline or glucose. Such aqueous solutions may be No. 2007/0203445, U.S. Patent Publication No. 2006/ used, for example, for intravenous, intramuscular, subcuta- 0148742, and U.S. Patent Publication No. 2007/0060907, neous and intraperitoneal administration. Preferably, sterile which are all hereby incorporated by reference in their aqueous media are employedas is knownto those of skill in entireties. 10 the art, particularly in light of the present disclosure. By way In certain embodiments, the antisense oligonucleotide is of illustration, a single dose may be dissolved in 1 ml of administered at a dose of 25 mg/kg orless, or a dose of 10 isotonic NaCl solution and either added to 1000 ml of mg/kg or less, or a dose of 5 mg/kg or less. In these embodiments, the antisense oligonucleotide or composition hypodermoclysis fluid or injected at the proposed site of may be administered by intramuscular or subcutaneous infusion, (see for example, “Remington’s Pharmaceutical injection, or intravenously. Sciences” 15th Edition, pages 1035-1038 and 1570-1580). The compositions or formulations may also be adminis- Somevariation in dosage will necessarily occur depending tered parenterally or intraperitoneally. By way ofillustra- on the condition of the subject being treated. The person tion, solutions of the conjugates as free base or pharmaco- responsible for administration will, in any event, determine logically acceptable salts can be prepared in water suitably the appropriate dose for the individual subject. Moreover, mixed with a surfactant, such as hydroxypropylcellulose. for human administration, preparations should meetsterility, Dispersions can also be prepared in glycerol, liquid poly- pyrogenicity, general safety and purity standards as required ethylene glycols, and mixtures thereof and in oils. Under by FDA Office of Biologics standards. ordinary conditions of storage and use, these preparations All publications, patents and patent applications, includ- generally contain a preservative to prevent the growth of ing any drawings and appendices, herein are incorporated by microorganisms. reference to the same extent as 1f each individual publication The pharmaceutical forms suitable for injectable use or or patent application was specifically and individually indi- catheter delivery include, for example, sterile aqueous solu- cated to be incorporated by reference. tions or dispersions and sterile powders for the extempora- This invention is further illustrated by the following neous preparation of sterile injectable solutions or disper- 30 additional examples that should not be construedas limiting. sions. Generally, these preparations are sterile and fluid to Those of skill in the art should, in light of the present the extent that easy injectability exists. Preparations should disclosure, appreciate that many changes can be madeto the be stable under the conditions of manufacture and storage specific embodiments which are disclosed andstilt obtain a and should be preserved against the contaminating action of like or similar result without departing from the spirit and microorganisms, such as bacteria and fungi. Appropriate 35 solvents or dispersion media may contain, for example, scope of the invention. water, ethanol, polyol (for example, glycerol, propylene EXAMPLES glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The properfluidity can be maintained, for example, by the use of a coating, such as 40 Example 1 lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The AntimiR-208 Inhibits Age-Induced Weight Gain prevention of the action of microorganisms can be brought about by various antibacterial an antifungal agents, for While studying the potential therapeutic effects of miR- example, parabens, chlorobutanol, phenol, sorbic acid, 45 208 inhibitors in mice, we observed that animals treated for thimerosal, and the like. In many cases, it will be preferable long term studies with antimiR-208 did not show the age- to include isotonic agents, for example, sugars or sodium induced increase in body weight that mice normally show, chloride. Prolonged absorption of the injectable composi- while control treated (M-10591), or mice treated with saline tions can be brought aboutby the use in the compositions of did. Treatment wasstarted at 8 weeks of age (body weight agents delaying absorption, for example, aluminum monos- 50 between 20-25 grams) and continued for up to 6 months, tearate and gelatin. during which the mice received a loading dose of 3x25 Sterile injectable solutions may be prepared by incorpo- mg/kg at day 1, 2 and 3 and 25 mg/kg every other week of rating the conjugates in an appropriate amountinto a solvent either antimiR-208 (M-10101), non-targeting control along with any other ingredients (for example as enumerated (M-10591), or a comparable volume of saline. M-10591 above) as desired. Generally, dispersions are prepared by 55 targets a C. elegans-specitic miRNA and has the following incorporating the varioussterilized active ingredients into a sequence: TCCTAGAAAGAGTAGA (SEQ ID NO: 12). sterile vehicle which contains the basic dispersion medium Like M-10101, M-10591 also contains 9 LNA-modified and the desired other ingredients, e.g., as enumerated above. nucleotides and is 16 nucleotides in length. Mice treated In the case of sterile powders for the preparation of sterile with M-10101 showeda significantly higher heart-to-body injectable solutions, the preferred methods of preparation weight ratio compared to either control treated or saline include vacuum drying and freeze-drying techniques which injected animals. This difference was not due to an increase yield a powderofthe active ingredient(s) plus any additional in heart weight (HW), hut rather due to a smaller increase in desired ingredient from a previously sterile-filtered solution body weight (BW) during the course of the study (FIG. 1). thereof. A comparable observation was made when we dosed 8 Upon formulation, solutions are preferably administered week old male Wistar rats for an extended period of time in a manner compatible with the dosage formulation and in with 25 mg/kg of M-10101 every 2 weeks, while this effect such amountasis therapeutically effective. The formulations was not observed in the M-10591-treated groups (FIG. 2). US 9,428,749 B2 33 34 Example 2 overnight fasting. Baseline measurements were taken using an Accu-Chek Compact Plus glucometer (Roche). Mice AntimiR-208 Confers Resistance to High Fat were subsequently injected with 1 mg/g glucose intraperi- Diet-Induced Obesity toneally. Glucose levels were then measured at 15, 30, 60 and 120 minutes following glucose injection. On HF diet, To determine the effects of long-term treatment with an control antimiR-treated, obese mice displayed an increase in antimiR-208a oligonucleotide, six week old, male C57B16 fat mass and glucose intolerance (FIGS. 4D and 5A). In mice were injected subcutaneously with 10 mg/kg of an INA contrast, antimiR-208a treated mice showed a normal glu- modified antimiR-208a (M-10101) dissolved in saline or a cose response after 6 weeks of HF diet as revealed by GTT control oligonucleotide directed against a C. elegans-spe- 10 and the calculated area under the curve (FIGS. 5A and 5B). cific miRNA (M-10591). The mice were injected for three Fasting insulin levels from antimiR-208a treated mice consecutive days and then given a weekly maintenance were significantly lower than those of control antimiR injection throughout the experiment. Subcutaneousdelivery of antimiR-208a (M-10101) efficiently inhibited miR-208a treated mice (FIG. 5C). Similarly, levels of leptin, an adio- pocyte-derived circulating hormonethat reflects body lipid levels in the heart, as detected by Northern blot analysis 15 (FIG. 3A). Treatment of mice for 6 weeks with antimiR- content (Frederich et al., Nat. Med., Vol. 1: 1311-1314, 208a or the control antimiR had no effect on heart weight, 1995), were reduced by antimiR-208a compared to control cardiac contractility or heart rate (FIG. 3 B-D). antimiR in animals on NC and HFdiet (FIG. 5D). AntimiR- To further investigate the role of miR-208a in regulating 208a had noeffect on physical activity or food consumption body weight and metabolism, we tested the effect of anti- 20 (data not shown). These findings suggest that miR-208a miR-208a on weight gain in response to high fat (HF) diet. inhibition improves whole-body insulin sensitivity. Because Six week-old male C57B16 mice were injected subcutane- miR-208a is only expressed in cardiomyocytes (Callis et al., ously with 10 mg/kg body weight of antimiR 208a J. Clin. Invest., Vol. 119: 2772-2786, 2009; van Roojj et al., (M-10101) or control antimiR (M-10591) for three consecu- Science, Vol. 316: 575-579, 2007), the beneficial metabolic tive days. On the third day, the mice were placed on either 25 effects of antimiR-208a suggest a potential influence of the a HFdiet (60% keal/fat) or normal chow (NC; 10% keal/fat). heart on systemic metabolism. The mice were weighed and given maintenance doses of 10 The results of this series of experiments show that phar- mg/kg weekly throughout the study. Mice on HF diet and macologic inactivation of miR-208a, which is cardiac-spe- treated with the control antimiR increased their bodyweight cific, through systemic delivery of an antimiR confers an by 75% within six weeks, whereas antimiR-208a-treated 30 enhanced metabolic phenotype, suggesting that miR-208a mice on HF diet showed only a 29% increase in body weight inhibitors may have therapeutic usefulness in a variety of (FIG. 4A-B), which was comparable to mice maintained on metabolic disorders, such as obesity, hypercholesterolemia, normal chow and treated with the control antimiR or anti- type 2 diabetes, hepatic steatosis and hyperlipidemia. miR-208a (28% and 25%, respectively). NMR spectrometry revealed the difference in weight 35 Example 3 between the treatment groups was due to differences in fat weight represented by the white sections in each bar of FIG. AntimiR-208 Compounds Regulate Metabolism 4C. Consistent with these findings, visceral white adipose and subscapular adipose tissue, containing both white and To identify other chemically-modified antisense oligo- brown fat, were significantly smaller in antimiR-208a treat- 40 nucleotide inhibitors of miR-208a that are efficacious for ment groups on HF diet and NC compared to the control regulating metabolism, mice on a high-fat diet received one antimiR treated animals, based on fat mass and adipocyte of four different antimiR-208 inhibitors, two of which pre- size (FIG. 4D-G). Serum triglyceride and cholesterol levels viously exhibited target de-repression in vivo (M-10101 and were also reduced in antimiR-208a treated mice on HF diet M-10683) and two of which previously did not exhibit target (FIGS. 4H and 41). Similarly, hepatic steatosis seen in 45 de-repression in vivo (M-10673 and M-10681). Four other control animals on HF diet was blunted by treatment with groups ofmice received one of four control oligonucleotides antimiR-208a (FIG. 4F). (M-10591, M-10649, M-10702, and M-11182). C57BI1/6 HFdiet-induced obesity causes glucose intolerance. Anti- mice at 6-8 weeks of age were fed a 60% high-fat (HF) diet miR-208a treated mice on NC showed a normal glucose or regular chow and received a 25 mg/kg subcutaneous dose response, as measured by glucosetolerance test (GTT) (FIG. 50 of an antimiR oligonucleotide every week. The treatment 5A). Glucose tolerance tests were performed following groups are listed in Table 3: TABLE 3 Treatment Groups for AntimiR-208 Compound Identification Number of Group Animals Diet Chemistry Sequence (5! to aryl Alias 1 8 Reg saline Chow 2 8 High saline Fat 3 8 High M-10101 1cs;dTs;dTs;dTS;1Ts;1Ts;dGs;1Cs;dTs;1Cs; Trunc_208PS Fat 1Gs;dTs;1Cs;dTs;1Ts;1A (SEQ ID NO: 13) US 9,428,749 B2 TABLE 3-continued Treatment Groups for AntimiR-208 Compound Identification Number of Group Animals Diet Chemistry Sequence (5! to 3')! Alias 4 8 High M-10673 1cs;dTs;1Ts;1Ts;1Ts;1Ts;dGs;1Cs;dTs;1Cs; 208a LNA Fat aGs;dTs;1Cs;dTs;1Ts;dA (SEQ ID NO: 18) c_TDNA161 5 8 High M-10681 1cs;dTs;1Ts;1Ts;dTs;1Ts;dGs;1Cs;1Ts;1Cs; 208_LNAopt_3 Fat aGs;dTs;1Cs;dTs;1Ts;dA (SEQ ID NO: 23) 6 8 High M-10683 1cs;dTs;dTs;1Ts;1Ts;dTs;1Gs;dCs;1Ts;1Cs; 208LNAopt_5 Fat aGs;1Ts;dCs;1Ts;dTs;1A (SEQ ID NO: 25) 7 8 High M-10591 1Ts;dCs;dCs;1Ts;1As;dGs;1As;1As; Control; Trunc Fat dAs;1Gs;1As;dGs;dTs;1As;dGs;1A 16mer_UnivMM (SEQ ID NO: 94) 8 8 High M-10649 1cs;dCs;1Ts;dAs;dGs;1As;1As;dAs;dGs; Control; trunc Fat 1As;dGs;1Ts;dAs;1Gs;1Gs;1A (SEQ ID NO: 95) 15mer_Univ 9 8 High M-10702 1As;dCs;1Ts;dTs;1Ts;1Ts;dGs;1Ts;dGs;1Ts; Control; Fat 1AS;dGs;1Ts;dAs;dCs;1A (SEQ ID NO: 96) UnivCont2_16mer 10 8 High M-11182 1cs;dTs;1Ts;dTs;dTS;1GS;1Ts;dGs;dTs;1As; Control; Fat dGs;1Ts;dAs;1Cs;1A (SEQ ID NO: 97) UnivCont2_15mer INotations are defined in Table 2. All antimiR-208a compounds had an effect on reducing TABLE 4-continued body weight (FIGS. 6A and 6B). M-10101 and M-10683 were the mostefficacious and mice receiving these inhibitors 4, Treatment Groups for Reversal Study exhibited body weights comparable to saline-treated mice on Number SEQ a normal diet. M-10673 and M-10681 appeared to have an of ID intermediate effect on weight gain. A glucose tolerancetest Group Animals Diet Chemistry NO: Alias performed after 11 weeks of high fat diet and antimiR 2 8 High M-10673 18 208a LNA C_T_DNA16_1 treatment with all antimiR-208a compounds showedthatall 35 Fat antimiR-208a compounds had someeffect on glucose tol- 3 7 neh M-10681 23 208_LNA_ept_3 erance with. the M-10101 being. the most efficacious. (FIG. 4 7 Highal M-10683 25 208LNA_opt_5 7). Molecular analyses showedall antimiR-208a compound Fat treated groups to have robust inhibition of miR-208a in the 5 8 neh M-10591 94 Trune 16mer _UnivMM heart, and all antimiR-208a treated groups showed signifi- 40 8 cant de-repression of Sox6, a validated miR-208a target (data not shown). Weekly body weight measurements revealed that all anti- In summary, all antimiR-208a compounds reduced high miR-208a compounds reduced body weight in obese mice fat diet-induced weight gain over time, with M-10101 and (FIG. 8). M-10101 was the most efficacious compound as M-10683 being the most efficacious of the miR-208a inhibi- treatment with this compoundresulted in a ~10 percentloss tors tested. These same two compounds showed the best of body weight in obese mice. This weight loss occurred target de-repression in rat cardiac tissue (data not shown). while the mice continued on a high fat diet. Conversely, In the next series of experiments, a reversal study was mice treated with a control oligo (M-10591) continued to performed to determine whether antimiR-208a compounds gain weight on a high fat diet. The three other antimiR-208a could reduce body weight in animals who were already compounds showed intermediate effects on weight loss, obese. Mice were subjected to a high fat diet until they however, all compounds reduced further weight gain. reached ~45 grams. At this point, the mice received one of The data from the studies described in this Example four antimiR-208a compounds (M-10101, M-10683, demonstrate that antisense oligonucleotide inhibitors of M-10673, and M-10681) subcutaneously at 25 mg/kg miR-208a play an important role in regulating metabolism weekly. Mice were maintained on the high-fat diet during and can serve as an effective therapeutic for preventing and the experiment. The treatment groupsare listed in Table 4: treating obesity and related metabolic disorders. TABLE 4 Example 4 60 Treatment Groups for Reversal Study AntimiR-208 Promotes Hepatic Energy Metabolism Number SEQ and Mitochondrial Function of ID Group Animals Diet Chemistry NO: Alias Six mice per group were treated with high-fat diet (HFD) 1 7 High M-10101 13 Trunc_208_PS a alone (control) or HFD in combination with the antimiR- Fat 208a M-10101. The samples were initially blinded in which following biochemical identification and data curation, the US 9,428,749 B2 37 38 samples were “unblinded” for data analysis, revealing TABLE 6 Group 1 as HFD+antimiR-208a and Group 2 as HFD only (control). Relative Fold Change for Metabolite in Hepatic Glucose Metabolism Following treatment, plasma, heart, skeletal muscle, liver Group 1/Group 2 and retroperitoneal fat were collected from each animal: Sub Pathway Biochemical (relative fold of change) —_ snap frozen and sent to Metabolon (Durham, N.C.) for Glycolysis, 1,5-anhydroglucitol (1,5-AG) 0.86 metabolomic analysis. A total of 60 samples were analyzed gluconegenesis, glycerate 0.94 in this study. Samples consisted of 2 distinct treatment pyruvate glucose-6-phosphate (G6P) 1.62 metabolishm glucose 1.06 groups [HFD+antimiR-208a (Groupl) vs. RFD Controls 10 fructose-6-phosphate 1.45 (Group2)] at one time point (1 week) with six replicates for Isobar: fructose 1,6- 2.09 each matrix (plasma, heart, skeletal muscle, liver and fat). diphosphate, glucose 1,6-diphosphate, myo-inositol 1,4, The samples were extracted and split into equal parts for or 1,3-diphosphate analysis on the GC/MS and LC/MS/MSplatforms. Software 3-phosphoglycerate 0.94 Dihydroxyacetone 18 was used to match ions to an in-house library of standards 15 phosphate (DHAP) for metabolite identification and for metabolite quantitation 1,3-dihydroxacetone 0.97 by peak area integration. The identification and relative pyruvate 1.02 quantitation of metabolites for the samples was accom- lactate 1.04 plished with Metaholon’s technology platforms, which glucuronate 0.88 detected a total of 327, 275, 260, 314 and 234 biochemicals 20 in plasma, heart, skeletal muscle, liver and retroperitoneal Glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), fat; respectively. Biochemical data were analyzed by fructose-1,6-phosphate (identification based on MS/MS Welch’s two-sample t-tests. Welch’s two-sample t-tests were fragmentation and other chemical properties), and dihy- used to identify biochemicals whoserelative levels differed droxyacetone-phosphate (DHAP) were all shown to be between the various treatment groups. 25 elevated with treatment of antimiR-208a vs. controls (G6P For quality control, a number of internal standards were and F6P showedtrending significance, 0.05 TABLE 5 TCA/Krebs Cycle citrate 0.69 alpha-ketoglutarate 0.73 Quality Control Statistics 50 succinate 0.99 succinylcarnitine 1.01 Quality Control Median RSD succinyl CoA 0.51 fumarate 0.76 Sample Retroperitoneal Skeletal malate 0.77 (Matrix) Heart Fat Liver Muscle Plasma Pantothenate and CoA pantothenate 0.85 55 metabolism phosphopantetheine 1.33 Internal Standards 6% 6% 5% 6% 5% Coenzyme A 1.25 Endogenous 11% 11% 10% 14% 9% 3'-dephosphocoenzyme A 1.13 Biochemicals Collectively, a decrease in the majority of TCA cycle For the liver samples, 36 of the 314 biochemicals iden- 60 intermediates suggests an increase in energy metabolism tified showed a significant difference between HFD mice efficiency in the HFD model with anti-miR treatment vs. no receiving antimiR-208a vs. HFD controls. For biochemicals treatment. Additionally, as TCA pathway energy metabolism involved in glucose metabolism and pyruvate incorporation is inherent to mitochondria, these changes indicate an anti- into the TCA cycle, an increase in early intermediates of the miR-mediated improvement in mitochondrial function in the glycolytic pathway with a concurrent maintenance of down- 65 HFD mouse model.Increased glucose utilization in the HFD stream metabolites was seen, as shown in Table 6, in which mouse model would be advantageous, particularly in the the relative fold of change for each metabolite is provided. CS57B1/6 strain which is known to be more sensitive to US 9,428,749 B2 39 40 diet-induced dysglycemia (Gallou-Kabani et al., (2007) maltotriose, the observed elevation in higher glucosaccha- Obesity, 15. p. 1996-2005). Furthermore, coenzyme A rides are assumed to be intermediates in glycogen synthesis (CoA)is required for a-ketoglutarate dehydrogenase-medi- and their elevation in association with glycogen deposition. ated conversion of a-ketoglutarate to succinyl CoA, and a With the apparent anti-diabetic/obese efficacy of antimiR- pattern of increased CoA with a decrease in the CoA 5 208a treatment in terms of elevated liver glucose metabo- precursor pantothenate was also observed in the liver of lism and enhanced mitochondrial function, increased hepatic animals treated with antimiR-208a vs. HFD alone. This glycogen synthesis is consistent with an advantageous anti- pattern of change mayreflect anti-miR-dependentrelease of miR-208a effect. Increasing glycogen deposition in liver THRAP1 (a.k.a. MED13) and a subsequent increase in represents an effective mechanism to reduce hyperglycemia mitochondrial biogenesis related to thyroid receptor signal- 10 in the management of diabetes/insulin resistance. While ing. plasma glucose levels are not substantially altered at one Branched-chain amino acid (BCAA) metabolism appears week following HFD+antimiR-208a vs. HFD alone (not to play a role in the development of insulin resistance and shown, 1.09-fold control), this finding provides insight into obesity (Newgard et al., (2009) Cell Metab. 9, 311-26; the possible mechanism of action whereby the anti-miR Altmaieret al., (2008) Endocrinology, 149, 3478-89; She et 15 affects glycemic control as the HFD model progresses. al. (2007) Am J Physiol Endocrinol Metab, 293, B1552-63). This example demonstrates that the liver from mice Elevated levels of the BCAA,isoleucine, leucine andvaline, treated with antimiR-208ais utilizing its preferred energy are often observed during conditions of insulin resistance source (e.g. glycolysis) and processing excess substrate with various short-chain metabolites derived from the more optimally (e.g. glycogen deposition), than control metabolism of BCAA showing a distinctive pattern of 20 mice. Further, indications are that mitochondria of the mice expression in association with insulin sensitivity and/or IR treated with antimiR-208a are functioning more optimally as (Newgard et al., Altmaier et al.). The BCAAs leucine and compared to control mice (e.g. TCA cycle, branched-chain valine were shownto be significantly decreased with anti- aminoacids). All of these effects could be consistent with an miR-208a treatment vs. control (p<0.05), and isoleucine improvement in thyroid hormone signaling which poten- trendedsignificant decrease (0.05 TABLE 8 30 AntimiR-208 Promotes Improved Skeletal Muscle Fuel Utilization and Mitochondrial Function Relative Fold Change for Hepatic BBCA and Metabolites Group 1/Group 2 Metabolomic analysis of skeletal muscle from mice Sub Pathway Biochemical (relative fold of change) treated with high-fat diet (HFD) alone or HFD in combina- - - - - 35 tion with antimiR-208a (M-10101) was performed as Valine,: leucine: isoleucine: 0.91 described::in Example 4. Alterations::in skeletal muscle and isoleucine leucine 0.90 . .. 7 metabolism valine 0.89 metabolism are commonly associated with metabolic dis- 2-hydroxyisobutyrate 0.95 ease states such as IR, T2D and MS (Muoio and Newgard, alpha-hydroxyisovalerate 1.01 (2008) Nat Rev Mol Cell Biol, 9, 193-205; Hulveret al., hydroxyisovaleroyl carnitine 0.63 40 (2003) Am J Physiol Endocrinol Metab, 284, E741-7). methylglutaroylcamitine 0.77 . Table 10 showsthat skeletal muscle glucose metabolism . ; ; ; upstream intermediates are elevated with anti-miR treatment _ In addition to the increase in glucose metabolism and while downstream triosephosphate intermediates are main- improved TCA cycle efficiency observed in the liver, further tained or slightly decreased. indications of anti-diabetic/obese eflicacy in this organ were 45 evident with antimiR-208a treatmentvs. control. Significant TABLE 10 alterations in maltose-derived metabolites associated with aspects of glycogen metabolism presented an indication of Relative Fold Change for Metabolite in Skeletal increased hepatic glycogen deposition following treatment Muscle Glucose Metabolism with antimiR-208a. In this instance, higher glucosaccharides 50 Group V/Group (i.e. maltopentaose and maltohexaose) showedstatistically 2 (relative significant elevations (p<0.05) in response to treatment in Sub Pathway Biochemical fold of change) the HFD model at one week (Table 9). Glycolysis, 1,5-anhydroglucitol (1,5-AG) 0.88 gluconegenesis, glycerate 1.09 TABLE 9 55 pyruvate glucose-6-phosphate (G6P) 2.85 metabolishm glucose 1-phosphate 2.59 Relative Fold Change for Metabolites in glucose 1 Hepatic Glycogen Biosynthesis fructose-6-phosphate 2.76 Isobar: fructose 1,6-diphosphate, 1.13 Group 1/Group 2 glucose 1,6-diphosphate, myo- Biochemical (relative fold of change) 60 inositol 1,4, or 1,3-diphosphate 2-phosphoglycerate 0.96 maltose 0.79 3-phosphoglycerate 0.92 maltotriose 0.87 phosphoenolpyroruvate (PEP) 0.83 maltopentaose 1.89 pyruvate 0.96 maltohexaose 2.61 lactate 0.9 65 In combination with the concurrent decrease in the shorter This pattern is again consistent with an increased use of glucosaccharide precursors maltose (significant) and glucose that is efficiently fed into the TCA cycle energy US 9,428,749 B2 41 42 metabolism pathway, a pattern that is notably similar to the TABLE 12-continued pattern observed in the liver samples from animals treated with anti-miR therapy vs. HFD controls (Example 4). Relative Fold Change for Skeletal Muscle Lysophospholipids Although these differences did not reach statistical signifi- Group 1/ cance, the fact that the pattern so closely reflects those Sub Group 2 (relative differences observed in the liver with treatment supports a Pathway Biochemical fold of change) similar mechanism of action affecting both liver and skeletal 2-oleoylglycerophosphoethanolamine* 0.84 muscle that would convey a metabolic advantage in the 1-linoleoylglycerophosphoethanolamine* 0.99 setting of a HFD model. 2-linoleoylglycerophosphoethanolamine* 1.35 Also consistent with the anti-miR-related effects observed 1-arachidonoylglycerophosphoethanolamine* 0.84 in liver, skeletal muscle samples showed a decrease in 2-arachidonoylglycerophosphoethanolamine* 0.95 2-docosapentaenoylglycerophospho- 0.45 multiple TCA cycle intermediates relative to HFD controls ethanolamine* includingcitrate (statistically significant, p<0.05), fumarate 2-docosahexaenoylglycerophospho- 0.41 and malate (statistically significant, p<0.05) (Table 11). ethanolamine* Again, a uniform decrease in the TCA cycle intermediates 1-myristoylglycerophosphocholine 0.39 1-palmitoylglycerophosphocholine 0.32 suggests a relative increase in energy metabolism efficiency 2-palmitoylglycerophosphocholine* 0.39 with anti-miR treatment when compared to HFD controls. 1-palmitoleoylglycerophosphocholine* 0.48 This pattern of difference between treatment and control 1-stearoylglycerophosphocholine 0.3 groups also supports the elevated increasein theefficient use 1-oleoylglycerophosphocholine 0.84 2-oleoylglycerophosphocholine* 0.49 of glucose-related triosephosphate intermediates to fuel 20 1-linoleoylglycerophosphocholine 0.9 TCA cycle energetics proposed above. The combined obser- 2-arachidonoylglycerophosphocholine* 0.28 vation that both liver and skeletal muscle display elevated 1-plamitoylglycerophosphoinositol* 0.8 glucose metabolism and increased TCA cycle efficiency 1-stearoylglycerophosphainositol 0.81 1-arachidonoylglycerophosphoinositol* 0.95 with anti-miR treatment indicates a drug-related effect that 2-arachidonoylglycerophosphoinositol* 0.89 may improve or at least maintain mitochondrial function, 1-palmitoylplasmenylethanolamine* 0.94 which are consistent with anti-miR-mediated release of THRAP1 (MED13) and thyroid receptor signaling to elevate *identification based on MS/MSfragmentation and other chemical properties mitochondrial biogenesis. GPL-derived lysolipids in particular were uniformly decreased in skeletal muscle with anti-miR treatment vs. TABLE 11 30 controls and that both ethanolamine- and choline-conjugated species were affected similarly. This difference suggests Relative Fold Change for Metabolites in Skeletal Muscle TCA Cycle anti-miR treatment blocks a general rise in lysolipids in the Group 1/Group 2 HFD model, as HFD likely induces an accumulation of Sub Pathway Biochemical (relative fold of change) GPL-derived lysolipids. Also the observed pattern of 35 decrease was not different between the sn-1 and sn-2 vari- TCA/Krebs Cycle citrate 0.72 ants of lysolipids, indicating that anti-miR treatment was not succinylcarnitine 0.96 fumarate 0.86 preferentially affecting phospholipase Al or A2, further malate 0.79 supporting anti-miR-induced changesin lysolipid uptake in the HFD model vs. biosynthetic changes. 40 Additionally, anti-miR treatment also decreased skeletal Obesity and overnutrition are associated with the intra- muscle mono- and di-acylglycerols as well as sphingolipids muscular accumulation of lipids and lipid metabolites that (Table 13), which is consistent with suggesting that HFD negatively correlate with insulin sensitivity (Muoio and correlates with a general increase in skeletal muscle accu- Newgard, (2008) Nat Rev Mol Cell Biol, 9, 193-205), mulation of lipids and lipid metabolites. Thus, as for glucose although the role of bioactive lipids in skeletal muscle metabolism and increased TCAcycle efficiency (mitochon- insulin resistance is not fully understood. Lysolipids derived drial function), the uniform pattern of change observed in from glycerophospholipids (GPL) possess bioactive proper- lysolipid levels following anti-miR treatmentis indicative of ties and are known to interact at multiple sites in the therapeutic efficacy for conveying preservation of skeletal insulin-signaling cascade ultimately resulting in insulin muscle insulin sensitivity. resistance (Wymann and Schneiter, (2008) Nat Rev MolCell Biol, 9, 162-76; Patti and Kahn, (2004) Nat Med, 10, TABLE13 1049-50). In this example, several lipid species were decreased in the skeletal muscle from anti-miR-treated ani- Relative Fold Change for Skeletal Muscle Mono- and Di-Acylglycerols mals when compared to HFD control samples, as shown in Table 12. Group 1/Group 55 2 (relative Sub Pathway Biochemical fold of change) TABLE 12 Monoacylglycerol 1-palmitoylglycerol* 0.75 Relative Fold Change for Skeletal Muscle Lysophospholipids (1-monopalmitin) 2-palmitoylglycerol 0.79 Group 1/ (2-monopalmitin) 60 Sub Group 2 (relative 1-stearoglycerol (1-monostearin) 0.8 Pathway Biochemical fold of change) Diacylglycerol 1,2-dipalmitoylglycerol 0.71 1,3-dipalmitoylglycerol 0.51 Lysolipid 1-palmitoylglycerophosphoethanolamine 0.88 Sphingolipid sphingosine 0.51 2-palmitoylglycerophosphoethanolamine* 0.98 palmitoyl sphingomyelin* 0.79 1-palmitoleoylglycerophosphoethanolamine* 0.8 stearoyl sphingomyelin 0.85 65 1-stearoylglycerophosphoethanolamine 0.96 1-oleoylglycerophosphoethanolamine 0.82 *statistically significant (p < 0.05) US 9,428,749 B2 43 44 These results demonstrate anti-miR208a treatment con- nificance (0.05 AntimiR-208 Promotes Cardiac Metabolism Group 1/Group 2 (relative fold Sub Pathway Biochemical of change) 15 Metabolomic analysis of the hearts from mice treated with high-fat diet (HFD) alone or HFD in combination with Lyoslipid 1-linoleoylglycerophos- 1.49 phoethanolamine* antimiR-208a (M-10101) was performed as described in 1-stearoylglycerophosphocholine* 1,52 Example 4. 1-linoleoylglycerophosphocholine 1.45 Cardiac muscle utilizes multiple fuel substrates, with fatty 1-oleoylglycerophosphoinositol* 1,22 20 Monoacyl- 1-palmitoylglycerol 1.08 acids and glucose as predominant substrates, and fatty acids glycerol (1-monopalmitin) as its preferred fuel source. Concurrent treatment of mice 2-palmitoylglycerol 1.11 with anti-miR208a at the start of diet administration over (2-monopalmitin) one week resulted in a pattern of elevated long-chain fatty 1-stearoglycerol (1-monostearin) 1.16 2-stearoglycerol (2-monostearin) 1.28 acids (LCFA) when compared to HFD atone (Table 14), in 25 1-oleoylglycerol (1-monoolein) 11 which the change of vaccenate, eicosenoate, dihomoli- 2-oleoylglycerol (2-monoolein) 1.86 noleate, and docosadienoate were statistically significant 2-linoleoylglycerol 1.15 (p<0.05). (2-monolinolein) Diacylglycerol 1,2-dipalmitoylglycerol 1.12 1,3-dipalmitoylglycerol 1.08 TABLE 14 30 Sphingolipid sphinganine 1.16 sphingosine 1,25 Relative Fold Change for Cardiac Long Chain Fatty Acids palmitoyl sphingomyelin 0.99 stearoyl sphingomyelin 0.99 Group 1/Group 2 Sub Pathway Biochemical (relative fold of change) *identification based on MS/MSfragmentation and other chemical properties 35 Long chain fatty acid myristate (14:0) 1.08 In addition to increased uptake of its preferred lipid fuel myristoleate (14:1n5) 1.11 substrates, heart samples from anti-miR-treated animals also pentadecanoate (15:0) 0.99 showed an elevation in several intermediates of the glyco- palmitate (16:0) 1.09 palmitoleate (16:1n7) 1.14 lytic pathway including glucose-6-phosphate, pyruvate and margarate (17:0) 1.1 the end product of glycolysis lactate (statistically significant 10-heptadecenoate (17:1n7) 1.1 40 vs. control) (Table 16). stearate (18:0) 1.14 oleate (18:1n9) 1.11 cis-vaccenate (18:1n7) 1.14 TABLE 16 stearidonate (18:4n3) 0.8 nonadecanoate (19:0) 1.08 Relative Fold Change for Metabolites in Cardiac 10-nonadecenoate (19:1n9) 1.08 45 Glucose Metabolism eicosenoate (20:1n9 or 11) 1.22 dihomolinoleate (20:2n6) 1.18 Group 1/Group 2 mead acid (20:3n9) 1.08 (relative fold arachidonate (20:4n6) 1.07 Sub Pathway Biochemical of change) docosadienoate (22:2n6) 1.21 Glycolysis, glucose-l-phosphate 1.91 docosatrienoate (22:3n3) 1.31 50 adrenate (22:4n6) 1.12 gluconegenesis, glucose-6-phosphate (G6P) 1.28 pyruvate 2-phosphoglycerate 0.9 metabolishm 3-phosphoglycerate 0.92 This difference suggests an increase in cardiac uptake of pyruvate 1.3 its preferred fuel source with anti-miR treatment. Unlike lactate 1.26 pathologic conditions where FA oxidation becomes over- 55 whelmedand ketone body formation ensues, the increase in While this pattern is slightly different from that observed cardiac LCFAlevels with anti-miR treatment correlated with with liver and skeletal muscle, which showed noelevation a relative decrease in cardiac ketone body levels (an anti- in lactate, these differences are not surprising given the miR-dependent decrease in the ketone body 3-hydroxybu- differences in preferred fuel sources that exist between tyrate (BHBA)), when compared to controls. This may 60 cardiac muscle, skeletal muscle and liver and alternative reflect a more efficient use of the preferred FA fuel substrates lactate producing pathways in the heart. Collectively, how- in heart with antimiR-208a treatment. ever, these data support an increase in the metabolism of Unlike skeletal muscle which showed a general decrease primary fuel sources utilized by the heart (lipids and glu- in most lipid species, treatment with anti-miR wasrelated to cose) that may also be related to improved metabolic effi- a general increase in several cardiac lipid species pith 65 ciency associated with elevate THRAP1 (MED13)-induced 2-stearoyl-GPC and 2-stearoylglycerol statistically signifi- mitochondrial biogenesis with antimiR-208a treatment vs. cant (p<0.05), and 1-linoleoyl-GPE showingtrending sig- HEDcontrols. US 9,428,749 B2 45 46 Another biochemical signature that distinguished cardiac As inhibition of miR-208a with M-10101 releases the glucose metabolism from that of the liver is a significant inhibitory effects of miR-208a on THRAP1 (MED13), and increase in the glycogen breakdown product glucose-1- hence TR signaling, oxidative phosphorylation would phosphate, which is produced via phosphorylase activity and increase. Which is consistent with the antimiR-208a-related shuttles glycogen metabolites into the glycolytic pathway changes described herein. Inhibition of complex II of the (Salway, Metabolism at a glance. Third Edition ed. 2004, electron transport chain is associated with increased reactive Malden, Mass.: Blackwell Publishing. 125; Stryer, L., Bio- oxygen species (ROS) and autophagic cell death, suggesting chemistry. Fourth Edition ed, 1995, New York, N-Y.: W.H. that improved efficiency of complex IJ maybe related to Freeman and Co. 1064.) This is in contrast to what would be improved redox balance in the hearts of HFD animals expected in a HFD,wherein the fed state glycogen synthesis 10 treated with antimiR-208a (Chenet al., (2007) J Cell Sci, would preferentially occur over glycogenolysis, suggesting 120, 4155-66). a unique metabolic impact of anti-miR in the HFD model heart. Overall, however, these data indicate an increase in Example 7 cardiac fuel metabolism associated with antimiR-208a effi- 15 cacy that suggests improved carbon handling in the context Plasma Analysis Shows antimiR-208 Promotes of the HFD model. Increased Fuel Utilization, Lipid Handling and As with the liver and skeletal muscle, which both dis- Mitochondrial Function played differences in TCA cycle intermediates consistent with improved metabolic efficiency, the heart from animals 20 Metabolomic analysis of plasma from the mice treated treated with anti-miR also showed changes in TCA cycle with high-fat diet (HFD) alone or HFD in combination with intermediates vs. HFD controls. Not surprisingly, the differ- antimiR-208a (M-10101) was performed as described in ences observed in cardiac fuel metabolism vs. the other Example 4. tissues were extended to differences observed in cardiac Plasma provides biochemical signatures of endogenous TCA cycle changes, in relation to those observedin liver or 25 metabolism within the blood compartment, as well as skeletal muscle (Table 17). metabolites altered or produced from events occurring throughout the host. The detection of multi-source metabo- TABLE 17 lites provides a highly informative data set reflective of systemic events related to a given treatmentor process being Relative Fold Change for Metabolites in Cardiac TCA Cycle 30 studied. While metabolite changes detected in plasma alone Group 1/Group 2 typically do not reveal precisely what is occurring in a Sub Pathway Biochemical (relative fold of change) specific tissue or organ system, they can provide additional support as to organ-specific biochemical events. TCA/Krebs Cycle citrate 1.55 succinate 0.77 Consistent with the early signs of increased FA metabo- 35 succinylcarnitine 1.06 lism resulting from anti-miR treatment of the HFD model, fumarate 1.3 several medium-Chain fatty acids (MCFA) were elevated, malate 1.09 such as heptanoate and undecanoate, both statistically sig- Pantothenate and CoA pantothenate 0.93 metabolism phosphopantetheine 0.94 nificant (p<0.05) and caprylate and pelargonate, both show- coenzyme A 1.53 ing trending significance (0.05 Citrate was significantly elevated in heart tissues from TABLE18 anti-miR-treated animals vs. controls, as was fumarate. 45 Citrate, which can be exported from the mitochondria by the Relative Fold Change for MCFA in Plasma tricarboxylate carrier, can subsequently be used as a fatty Group 1/Group 2 acid synthesis precursor via acetyl- and malonyl-CoA inter- Sub Pathway Biochemical (relative fold of change) mediates (Salway, Metabolism at a glance. Third Edition ed. Medium chain fatty acid isocaproate 1.27 2004, Malden, Mass.: Blackwell Publishing. 125). Fatty acid 50 caproate (6:0) 0.93 uptake appearedto be elevated in the heart of antimiR-208a- heptanoate (7:0) 1.22 treated animals, and an increase in FA uptake mayoffset the caprylate (8:0) 1.23 pelargonate (9:0) 1.21 need for FA synthesis resulting in an accumulation of FA caprate (10:0) 1.21 precursors like citrate. Additionally, the conversion of suc- undecanoate (11:0) 141 laurate (12:0) 1.17 cinate to fumarate is coupled with complex II production of 55 FADH,in the electron transport chain. A significant decrease in succinate (statistically significant, p<0.05) and a concor- Unlike long-chain fatty acids (LCFA) which typically dant significant increase in fumarate(statistically significant, require acylcarnitine conjugation to facilitate their entry into p<0.05) in the hearts of animals treated with anti-miR vs. the mitochondria via palmitoyl-carnitine transferase I (CPT- controls indicate a more efficient utilization of this bio- 60 I), MCFA are able to translocate into the mitochondria chemical correlating with more efficient electron transport without this conjugation step making them more readily and oxidative phosphorylation, and thus, mitochondrial available fuel substrates than their LCFA counterparts. An function. The fatty acid oxidation end product acetyl CoA increase in plasma MCFAis thought to correlate with the and coenzyme A, both increased in the hearts of animals earliest signs of lipolysis. The observed changes in plasma treated with antimiR-208a as compared to controls, as 65 MCFAlikely reflect a beneficial biochemical trend of FA shown in Table 17, which correlate with increased FA mobilization and increased metabolism related to anti-miR metabolism and mitochondrial function. efficacy in the mouse HFD model. US 9,428,749 B2 47 48 Postprandial elevations of plasma bile acids (BA), par- TABLE 20-continued ticularly with high-fat meals, are known to occur in normal weight subjects, which has been shown to improve glycemic Relative Fold Change for Carnitine Metabolites in Plasma control and energy metabolism through BA-mediated acti- Group 1/Group 2 vation of multiple receptors (Glicksmanet al., (2010) Ann 5 Sub Pathway Biochemical (relative fold of change) Clin Biochem. 47, 482-4). Although it is not possible to acetylcarnitine 0.94 discern BA changes associated with the HFD in this hexanoylcamitine 0.99 example, when compared to HFD alone the addition of octanoylcarnitine 0.88 anti-miR to HFD for one week caused a uniform decrease in laurylcamitine 0.74 plasmabile acids for all species detected (Table 19). palmitoylcarnitine 0.69 stearoylcarnitine 0.75 oleoylcarnitine 0.7 TABLE 19 Relative Fold Change for Bile Acid Metabolites in Plasma MiR-208a negatively regulates THRAP1 (MED13), Group 1/Group 2 potentially having a negative impact on TR-mediated mito- Sub Pathway Biochemical (relative fold of change) chondrial biogenesis. The observed decrease in plasma Bile acid metabolism cholate 0.91 FA-AC along with the notable changes in multi-tissue TCA taurocholate 0.13 cycle energetics strongly supports the concept of anti-miR- taurochenodeoxycholate 0.11 related release of THRAP1 (MED13) inhibition and a sub- deoxycholate 0.2 taurodeoxycholate 0.22 sequent increase in mitochondrial biogenesis, which would beta-muicholate 0.42 manifest as an improved mitochondrial function signature tauro-beta-muricholate 0.11 consistent with the observations described herein. alpha-murichoalte 0.37 tauroursodeoxycholate 0.1 Accordingly, biochemical alterations within the plasma 25 from anti-miR208a treated mice in the setting of a HFD All BA species were decreased in Group 1 (i.e. antimiR- suggest that there is an increase in fuel utilization, lipid 208a+HFD). This result lends confidence to an antimiR- handling and mitochondrial function. This is can also be 208a-specific effect in the HFD model. A uniform decrease consistent with a THRAP1 (MED13)-mediated increase in thyroid hormonereceptor signaling. in BA levels may correlate with an increased ability of the 30 animals receiving drug to handle the elevated nutritional input (i.e. increased mitochondria metabolic capacity), Example 8 thereby decreasing the need for elevated plasma BA as a meansto eliminate FA from the system. Alternatively, as mentioned above, BA signaling is known to improve gly- 35 AntimiR-208 Promotes Redox-Homeostasis cemic control and energy metabolism (Glicksman et al., (2010) Ann Clin Biochem. 47, 482-4). Hence, the anti-miR- Metabolomic analysis for glutathione metabolites was related observations noted above with respect to increased performed ontheliver, skeletal muscle, and heart from mice glucose metabolism (liver, heart, skeletal muscle), hepatic treated with high-fat diet (HFD) alone or HFD in combina- glycogen synthesis, improve cardiac FA metabolism and broad improvement in mitochondrial function in multiple tion with antimiR-208a (M-10101) as described in Example tissues would indicate a decreased need for BA signaling to 4. Glutathione plays an important role in redox-homeostasis, resolve impaired metabolic issues related to the early HFD antioxidant defense, protein folding and detoxification of phenotype (or developing issues, as the case may be). drugs, with reduced glutathione (GSH) representing the active form of this tripeptide imposing a substantial influ- Oneof the hallmarks of mitochondrial dysfunction is an 45 elevation in acylcarnitine intermediates of FA oxidation ence on redox balance. The thiol group of glutathione can (FA-AC), particularly in the face of overnutrition where react with electrophiles to generate GSH adducts and glu- elevated FA substrates overwhelm the ability mitochondria tathione-S-transferases (GST) conjugate GSH with toxins to efficiently handle FA metabolically (Muoio and Newgard, and drug metabolites to form water-soluble products for (2008) Nat Rev Mol Cell Biol., 9, 193-205). Several lines of 50 excretion. evidence presented thus far indicate an improvement in Liver from animals treated with anti-miR showedsignifi- mitochondrial function in the liver, skeletal muscle and heart cantly elevated GSH levels in addition to elevations in (Examples 4-7). Plasma FA-AC levels were decreased in several glutathione metabolites vs. control levels, indicating animals receiving anti-miR treatment while on HFD when improved hepatic redox balance with antimiR-208a treat- compared to those on HFD alone (Table 20), further sup- 55 porting a drug-related improvement in mitochondrial func- ment vs. HFD alone (Table 21). Cysteine-glutathione disul- tion in the HFD model. fide is a common biomarker of oxidative stress used in global metabolomic analyses. Consistent with the notion of TABLE 20 drug-induced redox improvement over HFD alone, hepatic cysteine-glutathione disulfide was decreased with anti-miR Relative Fold Change for Carnitine Metabolites in Plasma treatment when compared to controls. While elevated GSH levels could reflect increased glutathione synthesis, the Group 1/Group 2 Sub Pathway Biochemical (relative fold of change) upstream intermediates of glutathione biosynthesis were largely unaffected by anti-miR treatment (not shown). This Carnitine metabolism deoxycarnitine 1.21 carnitine 1.18 observation suggests that elevated hepatic GSH levels cor- 3-dehydrocamitine* 1.03 relate with altered glutathione reduction and/or glutathione recycling. US 9,428,749 B2 49 50 TABLE 21 TABLE 23 Relative Fold Change for Metabolite in Hepatic Glutathione Metabolism Relative Fold Change for Metabolite in Cardiac Glutathione Metabolism Group 1/Group 2 Sub Pathway Biochemical (relative fold of change) wa Group 1/Group 2 —_ Sub Pathway Biochemical (relative fold of change) —_ Glutathione glutathione, reduced (GSH) 1.71 metabolism S-methylglutathione 1.51 Glutathione glutathione, reduced (GSH) 1.19 5-oxoproline 1.06 metabolism 5-oxoproline 1.02 glutathione, oxidized (GSSG) 0.99 glutathione, oxidized (GSSG) 1.01 cysteine-glutathione disulfide 0.77 10 cysteine-glutathione disulfide 1.21 ophthalmate 1.21 S-lactolglutathione 1.88 As described in Example 6 above, heart metabolism is different than metabolism in the liver or skeletal muscle and One changeobservedin the glutathione metabolism path- differences in FA uptake/metabolism, glucose metabolism, waythat positively correlated with antimiR-208a treatment lactate production and TCA cycle energetics were observed. was an elevation in S-lactoylglutathione (1.88-fold HFD Since the S-lactoylglutathione/glyoxylase regeneration of alone). GSH regeneration is linked to glucose metabolism glutathione is dependenton triosephosphate degradation and via the degradation pathway of triosephosphate intermedi- this was observedin liver and skeletal muscle, this pathway ates. Upstream intermediates of glucose metabolism were maynot contribute to the elevation of GSH observed in the elevated in the liver of antimiR-208a treated animals, while heart. However, also mentioned above was the notable the triosephosphate intermediates of glucose metabolism increase in cardiac lactate and concurrent decrease in pyru- appeared unaffected. This would suggest, in addition to an vate, which appears to be associated with an increase in the efficient utilization of glucose-derived pyruvate for TCA malate/oxaloacetate shuttle; providing a potential mecha- cycle energetics, triosephosphate degradation may be occur- nism of improved cytosolic redox status in the hearts of ring with antimiR-208a treatment, which is connected to animals treated with drug vs. untreated HFD controls. GSH regeneration via glyoxylase-mediated restoration of The cardiac muscle engages metabolic pathways that glutathione from S-lactoylglutathione. Consequently, the distinguish it from other tissues, including the malate- anti-miR-mediated increase in glucose metabolism may oxaloacetate shuttle (Strong et al., (1979) Eur J Biochem, contribute, at least in part, to the increase in GSH Observed 102, 625-36), where malate is exported from the mitochon- with antimiR-208a vs. controls. dria into the cytosol and its conversion to oxaloacetate is Asdescribed in Example 5 above, skeletal muscle showed 30 coupledto the conversion of pyruvate to lactate, and cycling a similar pattern of glucose metabolism intermediates as of NAD+/NADH. This shuttle has been proposed as a those foundin liver in the context of antimiR-208a+HFDvs. possible mechanism to regulated redox-homeostasis in car- HFDalone, including elevated upstream intermediates and diomyocytes by potentially countering the cytosolic oxida- apparently no change in the triosephosphate intermediates. tion associated with the malate-aspartate shuttle (Strong et Not surprisingly then, skeletal muscle from animals treated al). This potential mechanism to maintain redox balance in with drug also showed a significant increase in GSH when the HFD model via antimiR-208a treatment may account comparedto controls (Table 22), and this increase correlated for, at least in part, the differences observed in glutathione with an increase in S-lactoylglutathione (1.67-fold HFD metabolism between treated and un-treated samples noted alone). below, and mechanistic differences observed among heart, 40 liver and skeletal muscle for the reconstitution of reduced TABLE 22 glutathione (GSH)that occurs with antimiR-208a treatment. Analysis of the metabolites as described in Examples 4-7 Relative Fold Change for Metabolite in Skeletal Muscle showed that relative to controls on HFD for one week, Glutathione Metabolism anti-miR treatment in combination with HFD for one week Group 1/Group 2 resulted in a limited number of significant biochemical 45 Sub Pathway Biochemical (relative fold of change) changes may demonstrate a degree of advantageous meta- —_ bolic differences with anti-miR administration. Tissue spe- Glutathione glutathione, reduced (GSH) 1.44 cific patterns of biochemical changes revealed an improve- metabolism 5-oxoproline 0.73 glutathione, oxidized (GSSG) 1 ment of mitochondrial function related to elevations in liver cysteine-glutathione disulfide 1.04 and muscle glycolysis and elevated fatty acid uptake and ophthalmate 1.27 50 metabolism in the heart as a primary consequenceofanti- S-lactolglutathione 1.67 miR treatment in the HFD model. These results were also supported by differences in plasma biomarkers suggesting Unlike the liver, which showed a slight decrease in the improved mitochondrial function. Additionally, in response oxidative stress marker cysteine-glutathione disulfide, skel- to antimiR-208a treatment, an improvementor preservation etal muscle samples from antimiR-208a treated animals of redox-homeostasis in the liver, muscle and heart was showed no changein this biochemical, potentially indicating evident as well as increased hepatic glycogen synthesis. No a difference in tissue specific changes in redox balance significant changes were observed in retroperitoneal fat, related to the HFD model. These data further support an which is consistent with the short duration of the HFD anti-miR-related effect on glucose metabolism that is coor- and/or combined HFD+antimiR-208a treatment in a dinated with both enhanced TCA cycle energetics and GSH C57B1/6 mouse model. recycling in the liver and skeletal muscle, all consistent with antimiR-208a efficacy in the early stages of diet-induced Example 9 metabolic changes. Unlike the liver and skeletal muscle, the heart showed a AntimiR-208 Promotes Dipeptide Accumulation slight increase in GSH levels with antimiR-208a treatment vs. HFD controls, with no detection of S-lactoylglutathione Metabolomic analysis for dipeptides was performed on (Table 23). the skeletal muscle from mice treated with high-fat diet US 9,428,749 B2 51 52 (AFD) alone or HFD in combination with antimiR-208a TABLE 24-continued (M-10101) as described in Example 4. Amino acid dipep- tides can be used as building blocks for protein synthesis, Relative Fold Change for Metabolite in Cardiac Glutathione Metabolism and hence muscle growth. Treatment of HFD animals with Group 1/Group 2 anti-miR caused an increase in several skeletal muscle 5 Sub Pathway Biochemical (relative fold of change) dipeptides levels (15 increased of 20 identified, 5 of 20 with vileuci 189 statisticalsue significance,.. p<0.05, and 3 others trending..sig- histidyVa. eucineleucine 0.94. nificance) (Table 24). isoleucylalanine 1.05 isoleucylglycine 0.93 10 isoleucylserine 1.31 TABLE 24 leucylalanine 1.45 Relative Fold Change for Metabolite in Cardiac Glutathione Metabolism lencylglycme 137 leucylserine 1.24 Group 1/Group 2 lysylleucine 1.32 Sub Pathway Biochemical (relative fold of change) phen[alanyIserine ! 15 serylleucine 1.64 Dipeptide glycylvaline 1.24 sery’Iphenylalanine 1.41 glycylleucine 12 threonylleucine 2.14 alanylvaline 2.01 lanylleuci 1.2 : : :: : alanyltryosine 163 A broad increase in skeletal muscle dipeptides possibly prolylleucine 115 indicates inhibition of skeletal muscle growth, resulting in leucylleucine 0.86 the accumulation of the dipeptide building blocks. Thus, antimiR, 208a may alter skeletal muscle protein synthesis. SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 99 <210> SEQ ID NO 1 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208a or miR-208b antisense oligonucleotide <400> SEQUENCE: 1 tgetcgtctt a 11 <210> SEQ ID NO 2 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208a or miR-208b antisense oligonucleotide <400> SEQUENCE: 2 tgttcgtctt a 11 <210> SEQ ID NO 3 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208a or miR-208b antisense oligonucleotide <400> SEQUENCE: 3 etttttgcte gtctta 16 <210> SEQ ID NO 4 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208a or miR-208b antisense oligonucleotide <400> SEQUENCE: 4 ecttttgtte gtctta 16 US 9,428,749 B2 53 54 -continued <210> SEQ ID NO 5 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 5 acegggegage ttttggeccg ggttatacct gatgetcacg tataagacga gcaaaaaget 60 tgttggtcag a 71 <210> SEQ ID NO 6 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp. <400> SEQUENCE: 6 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71 <210> SEQ ID NO 7 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp. <400> SEQUENCE: 7 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71 <210> SEQ ID NO 8 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp. <400> SEQUENCE: 8 acgcatgage ttttggctcg ggttatacct gatgetcacg tataagacga gcaaaaaget 60 tgttggtcag a 71 <210> SEQ ID NO 9 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: mature miR-208a <400> SEQUENCE: 9 auaagacgag caaaaagecuu gu 22 <210> SEQ ID NO 10 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: pre-miR-208b <400> SEQUENCE: 10 tttctgatcc gaatataaga cgaacaaaag gtttgtctga ggg 43 <210> SEQ ID NO 11 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: mature miR-208b US 9,428,749 B2 55 56 -continued <400> SEQUENCE: 11 auaagacgaa caaaagguuu gu 22 <210> SEQ ID NO 12 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Caenorhabditis elegans <400> SEQUENCE: 12 tectagaaag agtaga 16 <210> SEQ ID NO 13 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a_DNA_LNA_16_PS oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate US 9,428,749 B2 57 58 -continued cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 13 etttttgete gtctta 16 <210> SEQ ID No 14 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208fam_optdes1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 14 US 9,428,749 B2 59 60 -continued tgctegtctt a 11 <210> SEQ ID NO 15 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208fam_optdes2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 15 tgctegtctt a 11 <210> SEQ ID NO 16 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208fam_optdes3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 61 62 -continued <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 16 tgcacgtctt a 11 <210> SEQ ID NO 17 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208fam_optdes4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be a phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: US 9,428,749 B2 63 64 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 17 tgcacgtctt a 11 <210> SEQ ID NO 18 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a LNA C_T_DNA_16_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) US 9,428,749 B2 65 66 -continued <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16). .(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 18 etttttgete gtctta 16 <210> SEQ ID NO 19 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a_ LNA C_T_DNA_16_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) US 9,428,749 B2 67 68 -continued <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16). .(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 19 etttttgete gtctta 16 <210> SEQ ID NO 20 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a_ LNA C_T_DNA_16_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 69 70 -continued <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 20 etttttgcte gtctta 16 <210> SEQ ID NO 21 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208_LNAopt_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) US 9,428,749 B2 71 72 -continued <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 21 etttttgcte gtctta 16 <210> SEQ ID NO 22 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208LNAopt_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 73 74 -continued <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 22 etttttgete gtctta 16 <210> SEQ ID NO 23 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208_LNAopt_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: US 9,428,749 B2 75 76 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 23 etttttgete gtctta 16 <210> SEQ ID NO 24 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208LNAopt_4 oligonucleotide US 9,428,749 B2 77 78 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 24 etttttgete gtctta 16 <210> SEQ ID NO 25 US 9,428,749 B2 79 80 -continued <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208_LNAopt_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16). .(16) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 25 US 9,428,749 B2 $1 82 -continued etttttgete gtctta 16 <210> SEQ ID NO 26 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_DNA_LNA_16_PS oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 83 84 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (16). .(16) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 26 eettttgtte gtctta 16 <210> SEQ ID NO 27 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate US 9,428,749 B2 85 86 -continued thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 27 tttttgctcg tctta 15 <210> SEQ ID NO 28 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) US 9,428,749 B2 87 88 -continued <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 28 tttttgctcg tctta 15 <210> SEQ ID NO 29 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 89 90 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 29 tttttgctcg tctta 15 <210> SEQ ID NO 30 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate US 9,428,749 B2 91 92 -continued thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 30 tttttgctcg tctta 15 <210> SEQ ID NO 31 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: US 9,428,749 B2 93 94 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 31 tttttgctcg tctta 15 <210> SEQ ID NO 32 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_6 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate US 9,428,749 B2 95 96 -continued cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 32 tttttgctcg tctta 15 <210> SEQ ID NO 33 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 97 98 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 33 ettttgeteg tetta 15 <210> SEQ ID NO 34 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine US 9,428,749 B2 99 100 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 34 ettttgctcg tctta 15 <210> SEQ ID NO 35 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) US 9,428,749 B2 101 102 -continued <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 35 ettttgeteg tetta 15 <210> SEQ ID NO 36 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate guanosine US 9,428,749 B2 103 104 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 36 ettttgeteg tetta 15 <210> SEQ ID NO 37 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) US 9,428,749 B2 105 -continued <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 37 ettttgeteg tetta <210> SEQ ID NO 38 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_6 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 107 108 -continued <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 38 ettttgeteg tetta 15 <210> SEQ ID NO 39 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b _15_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate US 9,428,749 B2 109 110 -continued cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 39 ettttgtteg tetta 15 <210> SEQ ID NO 40 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b _15_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 111 112 -continued <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 40 ettttgttcg tctta 15 <210> SEQ ID NO 41 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b _15_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine US 9,428,749 B2 113 114 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 41 ettttgtteg tetta 15 <210> SEQ ID NO 42 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_15_7 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine US 9,428,749 B2 115 116 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 42 tttttgeteg tetta <210> SEQ ID NO 43 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_15_7 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 117 118 -continued <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 43 ettttgeteg tetta 15 <210> SEQ ID NO 44 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine US 9,428,749 B2 119 120 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 44 ettttgttcg tctta 15 <210> SEQ ID NO 45 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_14_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine US 9,428,749 B2 121 122 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 45 ttttgetegt ctta 14 <210> SEQ ID NO 46 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_14_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) US 9,428,749 B2 123 124 -continued <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 46 ttttgetegt ctta 14 <210> SEQ ID NO 47 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_14_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) US 9,428,749 B2 125 126 -continued <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 47 ttttgetegt ctta 14 <210> SEQ ID NO 48 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_14_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 127 -continued <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 48 ttttgetegt ctta <210> SEQ ID NO 49 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_14_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine US 9,428,749 B2 129 130 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 49 ttttgctcgt ctta 14 <210> SEQ ID NO 50 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_146 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) US 9,428,749 B2 131 132 -continued <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 50 ttttgetegt ctta 14 <210> SEQ ID NO 51 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine US 9,428,749 B2 133 134 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 51 ttttgttcgt ctta 14 <210> SEQ ID NO 52 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_142 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) US 9,428,749 B2 135 136 -continued <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 52 ttttgttegt ctta <210> SEQ ID NO 53 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 137 138 -continued <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 53 ttttgttcgt ctta 14 <210> SEQ ID NO 54 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_144 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 139 140 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 54 ttttgttcgt ctta 14 <210> SEQ ID NO 55 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) US 9,428,749 B2 141 142 -continued <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 55 ttttgttcgt ctta 14 <210> SEQ ID NO 56 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_6 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine US 9,428,749 B2 143 144 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 56 ttttgttcgt ctta 14 <210> SEQ ID NO 57 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_13_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 57 tttgctcgte tta 13 US 9,428,749 B2 145 146 -continued <210> SEQ ID NO 58 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_13_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 58 tttgetegte tta 13 <210> SEQ ID NO 59 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_13_3 oligonucleotide US 9,428,749 B2 147 148 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 59 tttgctcgte tta 13 <210> SEQ ID NO 60 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_13_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine US 9,428,749 B2 149 150 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 60 tttgctcgte tta 13 <210> SEQ ID NO 61 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_13_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 151 152 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 61 tttgttegte tta 13 <210> SEQ ID NO 62 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_13_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine US 9,428,749 B2 153 154 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 62 tttgttegte tta 13 <210> SEQ ID NO 63 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_13_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) US 9,428,749 B2 155 156 -continued <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 63 tttgttcgte tta 13 <210> SEQ ID NO 64 <211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_13_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine US 9,428,749 B2 157 158 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 64 tttgttegte tta <210> SEQ ID NO 65 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_11_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 159 160 -continued <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 65 tgctegtctt a 11 <210> SEQ ID NO 66 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208a like_11_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 66 tgctegtctt a 11 <210> SEQ ID NO 67 US 9,428,749 B2 161 162 -continued <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_11_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 67 tgttegtctt a 11 <210> SEQ ID NO 68 <211> LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_11_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate US 9,428,749 B2 163 164 -continued thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 68 tgttegtctt a 11 <210> SEQ ID NO 69 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_16_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 165 166 -continued <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16). .(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 69 eettttgtte gtctta 16 <210> SEQ ID NO 70 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_16_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 167 168 -continued <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 70 eettttgtte gtctta 16 <210> SEQ ID NO 71 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_16_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine US 9,428,749 B2 169 170 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 71 ecttttgtte gtctta 16 <210> SEQ ID NO 72 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_16_1 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine US 9,428,749 B2 171 172 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a deoxy adenosine <400> SEQUENCE: 72 ecttttgcte gtctta 16 <210> SEQ ID NO 73 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_16_2 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) US 9,428,749 B2 173 174 -continued <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be deoxy adenosine <400> SEQUENCE: 73 eettttgete gtctta 16 <210> SEQ ID No 74 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b like_16_3 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 175 176 -continued <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 74 eettttgete gtctta 16 <210> SEQ ID NO 75 <211> LENGTH: 15 <212> TYPE: DNA US 9,428,749 B2 177 178 -continued <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_5 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid thymidine <400> SEQUENCE: 75 ttttgttegt cttat 15 <210> SEQ ID NO 76 <211> LENGTH: 15 US 9,428,749 B2 179 180 -continued <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_6 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14) .. (14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid thymidine <400> SEQUENCE: 76 ttttgttegt cttat 15 US 9,428,749 B2 181 182 -continued <210> SEQ ID NO 77 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_7 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid thymidine <400> SEQUENCE: 77 ttttgttegt cttat 15 US 9,428,749 B2 183 184 -continued <210> SEQ ID NO 78 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_8 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). (14) . <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15).. (15) <223> OTHER INFORMATION: May be locked nucleic acid thymidine US 9,428,749 B2 185 -continued <400> SEQUENCE: 78 ttttgttegt cttat <210> SEQ ID NO 79 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_9 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). (14) . <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15).. (15) US 9,428,749 B2 187 188 -continued <223> OTHER INFORMATION: May be a deoxy thymidine <400> SEQUENCE: 79 ttttgttegt cttat 15 <210> SEQ ID NO 80 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_10 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine US 9,428,749 B2 189 190 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy thymidine <400> SEQUENCE: 80 ttttgttcgt cttat 15 <210> SEQ ID NO 81 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_11 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 191 192 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy thymidine <400> SEQUENCE: 81 ttttgttcgt cttat 15 <210> SEQ ID NO 82 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_12 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate US 9,428,749 B2 193 194 -continued thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid thymidine <400> SEQUENCE: 82 ttttgttcgt cttat 15 <210> SEQ ID NO 83 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_15_13 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) US 9,428,749 B2 195 196 -continued <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a deoxy thymidine <400> SEQUENCE: 83 ttttgttcgt cttat 15 <210> SEQ ID NO 84 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_7 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: US 9,428,749 B2 197 198 -continued <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid thymidine <400> SEQUENCE: 84 tttgttcgte ttat 14 <210> SEQ ID NO 85 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_8 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate adenosine US 9,428,749 B2 199 200 -continued <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid thymidine <400> SEQUENCE: 85 tttgttcgte ttat 14 <210> SEQ ID NO 86 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_9 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) US 9,428,749 B2 201 -continued <223> OTHER INFORMATION: May be a locked nucleic acid thymidine <400> SEQUENCE: 86 tttgttegte ttat <210> SEQ ID NO 87 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_10 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13).. (13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). (14) . <223> OTHER INFORMATION: May be locked nucleic acid thymidine US 9,428,749 B2 203 204 -continued <400> SEQUENCE: 87 tttgttegte ttat 14 <210> SEQ ID NO 88 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_11 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be deoxy thymidine <400> SEQUENCE: 88 tttgttegte ttat 14 US 9,428,749 B2 205 206 -continued <210> SEQ ID NO 89 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_12 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be deoxy thymidine <400> SEQUENCE: 89 tttgttegte ttat 14 US 9,428,749 B2 207 208 -continued <210> SEQ ID NO 90 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_13 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be deoxy thymidine <400> SEQUENCE: 90 tttgttegte ttat 14 <210> SEQ ID NO 91 US 9,428,749 B2 209 210 -continued <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_14_14 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid thymidine <400> SEQUENCE: 91 tttgttegte ttat 14 <210> SEQ ID NO 92 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: US 9,428,749 B2 211 212 -continued <223> OTHER INFORMATION: 208b_14_15 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1) .. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13).. (13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). (14) . <223> OTHER INFORMATION: May be deoxy thymidine <400> SEQUENCE: 92 tttgttegte ttat 14 <210> SEQ ID NO 93 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: 208b_16_4 oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 213 214 -continued <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15)..(15) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be deoxy thymidine <400> SEQUENCE: 93 ettttgtteg tettat 16 <210> SEQ ID NO 94 <211> LENGTH: 16 US 9,428,749 B2 215 216 -continued <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Trunc 1é6mer_UnivMM oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). (10) . <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11).. (11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12).. (12) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13).. (13) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). (14) . <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15).. (15) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (16).. (16) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 94 US 9,428,749 B2 217 218 -continued tectagaaag agtaga 16 <210> SEQ ID NO 95 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Trunc 15mer_Univ oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2) .. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3) .. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4) .. (4) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5) .. (5) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6) .. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7) .. (7) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8) .. (8) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9) .. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). (10) . <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11).. (11) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12). .(12) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13). .(13) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). .(14) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be locked nucleic acid adenosine <400> SEQUENCE: 95 US 9,428,749 B2 219 220 -continued ectagaaaga gtaga 15 <210> SEQ ID NO 96 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: UnivCont2_1émer oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11). .(11) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 221 222 -continued <222> LOCATION: (16)..(16) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 96 acttttgtgt agtaca 16 <210> SEQ ID NO 97 <211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: UnivCont2_15mer oligonucleotide <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (1).. (1) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (2).. (2) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (3).. (3) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (4).. (4) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (5).. (5) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (6).. (6) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (7).. (7) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (8).. (8) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (9).. (9) <223> OTHER INFORMATION: May be a phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (10). .(10) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (11)..(11) <223> OTHER INFORMATION: May be a phosphorothioate guanosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate thymidine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: May be a phosphorothioate adenosine <220> FEATURE: <221> NAME/KEY: MOD_RES <222> LOCATION: (14). . (14) <223> OTHER INFORMATION: May be a locked nucleic acid phosphorothioate cytidine <220> FEATURE: <221> NAME/KEY: MOD_RES US 9,428,749 B2 223 224 -continued <222> LOCATION: (15). .(15) <223> OTHER INFORMATION: May be a locked nucleic acid adenosine <400> SEQUENCE: 97 ettttgtgta gtaca 15 <210> SEQ ID NO 98 <211> LENGTH: 16 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208a antisense oligonucleotide <400> SEQUENCE: 98 uaagacgage aaaaag 16 <210> SEQ ID NO 99 <211> LENGTH: 16 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208b antisense oligonucleotide <400> SEQUENCE: 99 uaagacgaac aaaaag 16 The invention claimedis: 10. The method of claim 1, wherein the subject is human. 1. A method of treating obesity, hypercholesterolemia, 30 11. The method of claim 1, wherein the inhibitor is type 2 diabetes, hepatic steatosis, hyperlipidemia, insulin administered to the subject by an intradermal, subcutaneous, resistance, a glycogen storage disease, or aberrant glucose intramuscular, intraperitonealor intravenous route of admin- uptake and/or utilization in a subject in need thereof com- istration. prising administering to the subject an inhibitor of miR-208a 12. The method of claim 1, wherein the antisense oligo- 35 and/or miR-208b, wherein the inhibitor is an antisense nucleotide contains at least 9 locked nucleotides. oligonucleotide, wherein the antisense oligonucleotide com- 13. A method of regulating fatty acid or glucose metabo- prises a sequencethat is at least partially complementary to lism in a subject in need thereof comprising administering a mature sequence of miR-208a and/or miR-208b, and an inhibitor of miR-208a and/or miR-208b expression or wherein the expression or activity of miR-208a and/or activity to the subject, wherein the inhibitor of miR-208a miR-208b is reduced in the cells of the subject following 40 and/or miR-208bis an antisense oligonucleotide comprising administration. a sequence that is at least partially complementary to a 2. The method of claim 1, wherein the antisense oligo- mature sequence of miR-208a and/or miR-208b. nucleotide comprises a sequence that is at least partially complementary to SEQ ID NO: 9 or SEQ ID NO:11. 14. The method of claim 13, wherein fatty acid or glucose 45 metabolism is increased in the subject following adminis- 3. The method of claim 1, wherein the antisense oligo- nucleotide comprises at least one sugar and/or backbone tration of the inhibitor as compared to a subject not admin- istered the inhibitor. modification. 4. The methodof claim 3, wherein the sugar modification 15. The method of claim 13, wherein the cell is a cardiomyocyte, a skeletal muscle cell, a preadipocyte, an is a locked nucleic acid, a 2'-O-alkyl modification, or a 50 adipocyte, or a hepatocyte. 2'-halo modification. 5. The method of claim 4, wherein the 2'-halo modifica- 16. The method of claim 13, wherein the cell is in vitro or in vivo. tion is a 2'-fluoro modification. 6. The method of claim 3, wherein the backbone modi- 17. The method of claim 13, wherein the antisense oli- gonucleotide contains at least 9 locked nucleotides. fication is a phosphorothioate linkage. 7. The method of claim 1, wherein the antisense oligo- 55 18. A method of enhancing mitochondrial function or redox-homeostasis in a subject in need thereof comprising nucleotide is about 6 to about 22 nucleotides in length. administering to the subject an antisense oligonucleotide 8. The method of claim 1, wherein the antisense oligo- nucleotide has a sequence of SEQ ID NO:3 or SEQ ID comprising a sequencethat is at least partially complemen- tary to a miR-208a or miR-208b sequence, wherein the NO:4. 9. The method of claim 8, wherein the antisense oligo- 60 expression or activity of milt-208a or miR-208b is reduced in the cells of the subject following administration of the nucleotide has the structure of Compound 10101 (SEQ ID antisense oligonucleotide. NO:13), 10673 (SEQ ID NO:18), 10674 (SEQ ID NO:19), 19. The method of claim 18, wherein the antisense oli- 10677 (SEQ ID NO:20), 10679 (SEQ ID NO: 21), 10707 gonucleotide contains at least 9 locked nucleotides. (SEQ ID NO:26), 10680 (SEQ ID NO: 22), 10681 (SEQ ID NO: 23), or 10683 (SEQ ID NO: 25). *****