PREVALENCE OF TICKS AND TICK-BORNE PATHOGENS FROM PUNJAB, PAKISTAN
By Marriam Batool 2011-GCUF-05235
Thesis submitted in partial fulfilment of the requirements for the degree of
DOCTOR OF PHILOSOPHY IN ZOOLOGY
DEPARTMENT OF ZOOLOGY GOVERNMENT COLLEGE UNIVERSITY, FAISALABAD.
March 2018
DEDICATION
I dedicate this thesis to my beloved Father and Mother
i
DECLARATION The work reported in this thesis was carried out by me under the supervision of Dr. Shabab Nasir, Assistant Professor, Department of Zoology, Government College University Faisalabad, Pakistan.
I hereby declare that the title of thesis “Prevalence of ticks and tick-borne pathogens from Punjab, Pakistan” and the contents of thesis are the product of my own research and no part has been copied from any published source (except the references, standard mathematical or genetic models / equations / formulas / protocols etc.). I further declare that this work has not been submitted for award of any other degree/ diploma. The university may take action if the information provided is found inaccurate at any stage.
Signature of the Student/Scholar Name of Student: Marriam Batool Registration No: 2011-GCUF-05235
ii
CERTIFICATE BY SUPERVISORY COMMITTEE
We certify that the contents and form of thesis submitted by Marriam Batool, Registration No. 2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed format. We recommend it to be processed for the evaluation by the External Examiner for the award of degree.
Signature of Supervisor ………………….
Name: Dr. Shabab Nasir
Designation with Stamp……………………….
Member of Supervisory Committee
Signature ………………………………….
Name: Prof. Dr. Farhat Jabeen
Designation with Stamp………………………. Member of Supervisory Committee
Signature ………………………………….
Name: Prof. Dr Tayyaba Sultana
Designation with Stamp……………………….
Chairperson
Signature with Stamp……………………………
Dean / Academic Coordinator
Signature with Stamp……………………………
iii
CERTIFICATE BY ETHICAL COMMITTEE, DEPARTMENT OF ZOOLOGY
We certify that the contents and form of thesis submitted by by Marriam Batool, Registration No. 2011-GCUF-05235 has been found satisfactory and in accordance with the prescribed format. We recommend it to be processed for the evaluation by the External Examiner for the award of degree.
Signature ………………….
Name: Prof. Dr. Salma Sultana
Designation with Stamp……………………….
Signature ………………….
Name: Dr. Azhar Rasul
Designation with Stamp……………………….
iv
Plagiarism Undertaking I solemnly declared that research work presented in the thesis titled “Prevalence of ticks and tick-borne pathogens from Punjab, Pakistan” is solely my research work with no significant contribution from any other person. Small contribution/help wherever taken has been duly acknowledged and that complete thesis has been written by me.
I understand the zero tolerance policy of the HEC and Govt. College University Faisalabad toward plagiarism. Therefore, I as an Author of above titled thesis declare that no portion of my thesis has been plagiarized and any material used as reference is properly referred/cited.
I undertake that if I am found guilty of any formal plagiarism in the above titled thesis even after the award of PhD degree, the University reserves the rights to withdraw/revoke my PhD degree and HEC and the University has the right to publish my name on the HEC/University website on which names of students are placed who submitted plagiarized thesis.
Student/Author Signature ------Name Marriam Batool
v
LIST OF CONTENTS
Declaration ii
Certificate by supervisory committee iii
Certificate by ethical committee, Department of Zoology iv
Plagiarism undertaking v
List of contents vi-viii
List of tables ix-xi
List of figures xii-xiii
List of abbreviations xiv-xvii
Acknowledgements xviii
Abstract xix
Chapter 1 Introduction 1-6
Chapter 2 Review of Literature 7-32
2.1 Prevalence and identification of ticks 7-14
2.2 Tick-borne pathogens and diseases 14-23
2.3 Use of acaricides and medicinal plants to control ticks 23-32
Chapter 3 Materials and Methods 33-45
3.1 Study area 32-35
3.2. Collection and preservation of ticks 36
vi
3.3. Identification of ticks 36
3.4. Collection and identification of plant materials 36
3.5. Preparation of plants extract 37
3.6. Phytochemical analysis 39
3.6.1 Test for the confirmation of Flavonoids 39
3.6.2 Test for the confirmation of Terpenoids 39
3.6.3 Test for the confirmation of Alkaloids 39
3.6.4 Test for the confirmation of Tannins 39
3.6.5 Test for the confirmation of Saponins 39
3.6.6 Test for the confirmation of Steroids 39
3.6.6.1 Liebermann Burchard test 39
3.6.6.2 Salkowskis test 40
3.6.7 Test for the confirmation of Phenols 40
3.7 Bioassay 40
3.7.1 Preparation of stock solution of selected plants 40
3.7.2 Percent mortality 40
vii
3.7.3 Stock solution of selected acaricides 42
3.7.4 Percent mortality 42
3.8 DNA extraction 42
3.9 Using PCR for amplification of DNA of tick borne 43 pathogens
3.9 Statistical analysis 45
Results & Discussion Chapter 4 46-107
4.1 Analytical characteristics of the population 46
4.2 Tick prevalence 46
4.3 Identification of tick species 61
4.4 Screening of ticks for tick-borne pathogens 74
4.5 Control of tick species 88
4.6 Phytochemical analysis 95
4.7 Prevalence of ticks in agro-ecological zones 96
4.8 Tick-borne pathogens 101
4.9 Tick control 106
viii
Summary 108-109
Conclusion 110
Recommendations 111
References 112-138
ix
LIST OF TABLES
Table # Title Page #
3.1. Classification of selected plants of study 37
Specific primers sequence, PCR conditions and targeted 3.2. 44 size of tick borne pathogens
4.1. Zone-wise tick prevalence (%) for overall data 47
4.2. . Animal-wise tick prevalence (%) for overall data 47
4.3. Season-wise tick prevalence (%) for overall data. 48
Animal-wise prevalence with respect to different seasons 4.4. 48 for Southern zone Animal-wise prevalence with respect to different seasons 4.5. 50 for Western zone Animal-wise prevalence with respect to different seasons 4.6. 51 for Central zone Animal-wise prevalence with respect to different seasons 4.7. for Northern zone 52
Area-wise prevalence with respect to different Animals for 4.8. 53 spring season
Zone-wise prevalence with respect to different animals for 4.9. 54 summer season
Zone-wise prevalence with respect to different animals for 4.10. 55 autumn season
Zone-wise prevalence with respect to different Animals for 4.11. 56 winter season
x
Season-wise prevalence with respect to different zones for 4.12. 57 buffalo
Season-wise prevalence with respect to different zones for 4.13. 58 cow
Season-wise prevalence with respect to different zones for 4.14. 59 goat
Season-wise prevalence with respect to different zones for 4.15. 60 sheep
Prevalence of identified tick species in different farm 4.16. animals in Southern zone Punjab, Pakistan 68
Prevalence of identified tick species in different farm 4.17. 69 animals in Western zone Punjab, Pakistan
Prevalence of identified tick species in different farm 4.18. 70 animals in Central zone Punjab, Pakistan
Prevalence of identified tick species in different farm 4.19. 71 animals in Northern zone Punjab, Pakistan
4.20. Analysis of variance for comparison of means 71
4.21. Means between animals, zones and tick species 72
Overall prevalence of tick-borne pathogens in agro- 4.22. 73 ecological zones of Punjab, Pakistan
The overall prevalence of tick-borne pathogens in Southern, 4.23. 74 Western, Central and Northern zones
xi
Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia 4.24. isolated from different tick species in Southern Zone 77 Punjab; Pakistan Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia 4.25. isolated from different tick species in Western Zone Punjab; 79 Pakistan Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia 4.26. isolated from different tick species in Central zone Punjab; 80 Pakistan Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia 4.27. isolated from different tick species in Northern zone 82 Punjab; Pakistan
Lethal concentration of selected plant extracts against tick 4.28. 87 species
4.29. Lethal time of selected plant extracts against tick species 89
Lethal concentration of selected acaricides against tick 4.30. 91 species
4.31. Lethal time of selected Acaricides against tick species 92
4.32. Qualitatively phytochemical analysis of selected plants 94
xii
LIST OF FIGURES Figure # Title Page #
Map of province Punjab in Pakistan and the districts from 1 where samples of tick were collected 35
(a) Calotropis procera, (b) Solanum nigrum, (c) Brassica 2 rapa (d) Trigonella foenum graecum (e) and Citrullus 37 colocynthis
3 Dorsal and ventral view of Hy. dromedarii 62
4 Dorsal and ventral view of Hy. truncatum (female) 63
5 Dorsal and ventral view of Hy. rufipes 63
6 Dorsal and ventral view of Hy. marginatum 64
7 Dorsal and ventral view Hylomma annatolicum 64
8 Dorsal and ventral view of Rhipicephalus appendiculatus 65
9 Dorsal and ventral view of Rhipicephalus sanguineus 65
10 Dorsal and ventral view of Boophilus microplus 66
11 Dorsal and ventral view Boophilus decoloratus 66
12 Dorsal and ventral view of Argas percicus 67
xiii
Agarose gel electropherosis for the presence of Anaplasma 13 84 and Ehrlichia spp.
Agarose gel electropherosis for the presence of Babesia and 14 85 Theileria spp
Agarose gel electropherosis for the presence of Babesia and 15 86 Theileria spp
Mortality (%) of tick species after 96 hrs in the different 16 concentration of plants extract 90
Mortality (%) of tick species after 72 hrs in the different 17 93 concentration of acaricides
xiv
LIST OF ABBREVIATIONS
Acronyms Unsynchronized form A. sativum Allium sativum A. ovis Anaplasma ovis A. centrale Anaplasma central A. conyzoides Ageratum conyzoides A Anus A. marginale Anaplasma marginale A. percicus Argus percicus A.indica Azadirachta indica
AA Anus Aperture
A.absinthium Artemisia absinthium AEZ Agro Ecological Zone AG Anal Groove AIT Adult Immersion Test AO Anal Orifice AP Adnal Plates APSE Adnal Plates Square Ends
B. bigemina Babesia bigemina
B. bovis Babesia bovis
B. caballi Babesia caballi
B. decolratus Boophilus decolratus B. microplus Boophilus microplus B. rapa Brassica rapa BLPRI Barani Livestock Production Research Institute BPA Broad Prose Areas
C. adenocucaulis Cissus adenocucaulis
xv
C. aurea Calpurnia aurea C. colocynthis Citrullus colocynthis
C. didymobotrya Cassia didymobotrya
C. procera Calotropis procera
CA Caudal Appendages
CCHF Congo Hemorrhagic Fever Virus
Celisa competitive Enzyme-linked Immuno Sorbent Assay
CG Cervical Grooves
CG Caudal Grooves
CI Confidence Interval
CP Caudal Process
CS Curved Scutum D. marginatus Dermacentor marginatus D. metel Datura metel
DC Dark Conscutum
DF Dark Festoons DMSO Dimethyl Sulfoxide DS Dark sScutum DSS Dark Setae on Spiracle E Eyes Present E. hirta Euphorbia hirta
EVPs Ethno-Veterinary Practices
GAS Genital Aperture Semicircular
GC–MS Gas Chromatography–Mass Spectrometry
GG Genital Groove
GO Genital Orifice
xvi
H. suaveolens Hyptis suaveolens
Hy. anatolicum Hyalomma anatolicum Hy. dromedarii Hylomma dromedarii Hy. marginatum Hyalomma marginatum Hy. Rufipes Hylomma . rufipes Hy. truncatum Hylomma truncatum I. cicinus Ixodes ricinus
ISG Irregular Scapular Grooves
K. africana Kigelia Africana
LC Lethal Concentration
LG Pale Parma LMP Long Mouth Part LPT Larval Packet Test
LT Lethal Time
MG Marginal grooves MG Maiden Groove NAE Number of Animals Examined NAI Number of Animals Infested
NARC National Agricultural Research Centre
NPP No of Poles Positive NPT No of Poles Tested NTC Number of Ticks Collected O. sanctum Ocimum sanctum
OR Odd‟s Ratio
P. harmala Peganum harmala PA Porose Area PBL Pale Banded Legs
xvii
PCV Packed Cell Volume Qpcr quantitative PCR RAP Rounded Adnal Plates
Rh. appendiculatus Rhipicephalus appendiculatus Rh. sanguineus Rhipicephalus sanguineus S. nigrum Solanum nigrum SC Sclerotized Conscutum SC Sharp Capituli SE Standard Error
SL Spurs on Legs
SMP Short Mouth Parts SP Spiracular Plate
SSAP Small Sub Anal Plates
SSP Sparse Spot Distribution
T. annulata Theleria annulata
T. foenum-graecum Trigonella foenum- graecum
T. orientalis Theleria orientalis
T. ovis Theleria ovis
(TBDs) Tick-borne Diseases
TBPs Tick-borne Pathogens
TEC Total Erythrocyte Count
TLC Total Leukocytes Count VSGA V Shape Genital Aperture
xviii
ACKNOWLEDGEMENTS First of all I would like to bow my head before “Almighty Allah” the Omnipotent, the Merciful, the Beneficial who presented me in a Muslim community and also bestowed and blessed me with such an intelligence to complete the research work successfully. Firstly, I would like to express my sincere gratitude to my supervisor Dr. Shabab Nasir Department of Zoology, Govt. College University Faisalabad, for the continuous support of my Ph.D study and related research, for his patience, motivation, and immense knowledge. His guidance helped me in all the time of research and writing of this thesis. Respectful thanks to my supervisory committee Prof. Dr. Farhat Jabeen; Chairperson Department of Zoology and Prof. Dr. Tayyaba Sultana Govt. College University Faisalabad for their insightful comments and encouragement, but also for the hard question which incented me to widen my research from various perspectives. I offer my heartfull thanks and gratitude to my teachers Prof. Dr Salma sultana and Dr. Azhar Rasul whose kind and remarkable suggestion help out to complete my thesis I am extremely grateful to my parents for their love, prayers, caring and sacrifices for educating and preparing me for my future. Also I express my thanks to my sisters, brothers and couzins for their support and valuable prayers. My Special thanks go to my friend Aasma Noureen who supported me in writing and incented me to complete this thesis successfully. I am also thankful to the Mr. Zahid and Muhammad Sufian for their cooperative behavior during my research work. Finally, my thanks go to all the people who have supported me to complete the research work directly or indirectly. May Allah bless all these people with happy and pleasant lives (Ameen).
Marriam Batool
xix
ABSTRACT Ticks are the second to mosquitoes as vectors of a number of human and animals pathogens like viruses, spirochetes, bacteria, rickettsia, protozoa and filarial nematodes etc. Important tick borne diseases are Crimean Congo hemorrhagic fever, anaplasmosis, theileriosis and babesiosis that cause mortality in humans and animals. So, this study was carried out to check the prevalence of ticks and tick borne diseases in the Punjab, Pakistan. Three districts were selected from each of four zones of Punjab. The total 120 livestock farms were randomly selected from 12 districts, 10 farms (05 urban and 05 rural) from each district. Tick species were collected in morning and evening during 2016 to 2017 systematically from head to tail directions with the help of small steel forceps. The tick samples were taken to research laboratory in clean and dry appropriately labeled plastic bottles with muslin at the top for proper aeration. In the laboratory, the process of preservation was carried out by keeping ticks into 70% methanol. On the basis of morphology the collected ticks were distinguished microscopically with the help of dichotomous key. For molecular studies, ticks from each species were individually used for the extraction of DNA. Extracted DNA of ticks was stored at ‒20⁰C. The tick pathogens were confirmed by PCR using specific primers. Different acaricides and plant extracts were used to control ticks. Prevalence of tick and tick-borne pathogens were tested by χ2 tests and multiple logistic regressions model which was performed in SPSS 21. To calculate the percent mortality the data were analyzed by probit analysis using Minitab-15 statistical software. The total prevalence of tick-infected animals was 36.52% (4382/12,000). The prevalence of tick was significantly least in the Northern zone (33.47%) as compared to the Southern (36.33%), Western (35.83%) and Central zones (40.43%). The total ten tick species i.e. Hylomma (Hy.) anatolicum (25.92%), Hy. marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy. rufipes (1.79%), Rhipicephalus (Rh.) sanguineus (16.33%), Rh. appendiculatus (12.39%), Boophilus (B.) microplus (14.2%), B. decolratus (5.15%) and Argus percicus (2.02%) were identified. Hy. anatolicum and Hy. marginatum were the most abundant ticks spcies in all selected zones. Argas percicus was found only in Central zone. The overall prevalence of ticks infestation in all animals were 36.52% and it was significantly different in all animal species, like buffaloes (37.53%), cows (42.41%), goats (36.14%) and sheep (29.00%). The prevalence of overall evaluations of tick-borne pathogens in all agro-ecological zones was significantly different. Highest prevalence was found in Ehrlichia spp. (16%) followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%). It was concluded that there is wider variety of ticks and tick-borne pathogens in Pakistan. In case of control experiments, extracts of selected plant (Calotropis procera, Citrullus colocynths, Brasica rapa, Solanum nigrum and Trigonella foenum-graceum) also showed promising results along with acaricides.
xx
Chapter 1
INTRODUCTION
Pakistan is basically an agricultural country with 21.2% contribution from agriculture sector as Gross Domestic Production. The agricultural sector is believed to be the strength of the rural economy as it provides employment to 45% of the workforce of the country. In Pakistan, more than 70% of the population lives in rural areas and the majority depends up on livestock for their subsistence (Mather & Abdullah, 2015). A variety of domesticated farm animal genetic resources are present, generally referred as livestock, e.g., animals, like poultry, camel, goat, sheep, buffaloes, cattle, horses and donkeys (Khan, 2004). In Pakistan‟s rural economy, the livestock plays major role. Rural population (about 30-35 million) is involved in livestock raising which helps them to obtain their earnings from it (Zulfiqar et al., 2012; Ashraf et al., 2013). In Pakistan the dairy sector includes three kinds of producers, based on location and herd size, small farmers producing more than 50% of the total milk, medium-sized producers recognized as gowalas producing 29% of the whole milk and an efficient agricultural scheme producing ~ 20% of the whole milk is known as large-scale producers (Jabbar et al., 2015; LDDDP, 2015).
The diseases which are related to parasites of different types are the prime disorder which badly affects the production of animals. Parasites that live inside the animals called as endo- parasites (hookworm and tapeworm) or ecto-parasites which attack on the body surface (ticks, fleas, midges, mites, flies) (Admassu et al., 2015). Reptiles, amphibians, birds and mammals are infected by ticks which are mandatory blood-sucking ectoparasites (Rajput et al., 2006; Aslam et al., 2015; Ali et al., 2016). The economic and medical significance of ticks had long been revealed due to their ability to transfer diseases to animals and humans. In order acarina ticks make up the largest collection of creatures and belong to phylum arthropoda (Rajput et al., 2006). Ticks are categorized into three families i.e. (Ixodidae, Argasidae and Nuttalliellidae) but Argasidae (soft ticks) and Ixodidae (hard ticks) are of veterinary importance (Latif et al., 2012). Hard ticks are the 80% of the world tick creatures, with the exemption of one tick specie in family Nuttalliellidae while the residual are soft ticks (Guglielmone et al, 2010; Latif et al., 2012; Ali et al., 2013). In domestic animals and humans, 10% of the total Ixodid and Argasid tick species are known to spread disease (Jongejan & Uilenberg, 2004; Ali et al., 2013). Ixodid and
1
Argasid ticks vary in range of their morphological and biological characters. Hard ticks possess sclerotized scutum, an apical hypostome, feed for prolonged periods in all life periods. Soft ticks have a leathery skin; feed for short periods, their hypostome is situated anterior ventrally and does not possess scutum (Mans & Neitz, 2004; Latif et al., 2012). Nuttalliella namaqua has been designated as the „„missing link‟‟ among the tick families because it shared characteristics of both Ixodid and Argasid tick families (Latif et al., 2012). According to a study from different regions of Pakistan, the most commonly reported species of ticks were Rhipicephalus (Boophilus) microplus (Rh.), Hyalomma (Hy.) anatolicum, Hy. marginatum, Rh. annulatus and Rh. sanguineus (Durrani et al., 2008; Ramzan et al., 2008; Sajid et al., 2008).
The host is damage by ticks in two ways; directly by tick bites and indirectly by disease spreading (Diyes & Rajakaruna, 2015). According to their life cycle, ticks are divided into three groups, one host ticks, two host ticks and three host ticks. One-host ticks are the tick species that persist on the host in two molting periods. In the two host species, the ecdysis of larvae to the nymph stage take place on the host but after blood sucking nymphs deattach from the host, sheds on the ground and then search a new host. Larvae and nymph leave the host for molting and again find the host for feeding in case of three host tick life cycle (Mtshali et al., 2004; Ali et al., 2013). The spreading of ticks is cosmopolitan, but occurs mostly in tropical and subtropical areas (Durrani et al., 2008). Ticks of Pakistan are rich in number of genera and species. Because Pakistan is a humid country which offers favourable environmental situations for multiplication and growth of ticks (Durrani et al., 2008). The total rate of tick infestation (about 50%) has been detected in Pakistan. Therefore, few studies showed the prevalence of tick taxonomy, infestation and acaricidal activity (Durrani, 2008; Sajid et al., 2008, 2009a, b; Ali et al., 2016). For impact the resistance and receptiveness of livestock to tick infestation numerous features like age, sex, species, breed, season, photoperiod and management are responsible (Asmaa et al., 2014). Grazing, muddy floor and tying of ruminants were found related with high infestation of tick in animals (Sajid et al., 2009a; Iqbal et al., 2013). Likewise, factors of the risk related with tick borne diseases (TBDs) have also been studied hardly (Ashraf et al., 2013; Iqbal et al., 2014; Jabbar et al., 2015). Generally, hidden parts of the animals are damaged by ticks and cause mortality and lower productivity. The incidence of TBD has increased and produced problems related to health, over past two decades (Kaur et al., 2015). Harmful impacts of ticks to livestock are irritation, stress, blood loss and depression of immune function. Because of the direct 2 diseases spread into the host, ticks are highly responsible for economic losses in term of reducing quality of cow skin from twenty to thirty percent (Sultana et al., 2015).
Now a days, the most emerging infectious diseases are caused by zoonotic pathogens and transmitted by tick vectors. As vectors of a number of human and cattle pathogens, ticks are second to mosquitoes (Satta et al., 2011; Gosh & Nagar 2014; Kaur et al., 2015). Tick borne infestation is a universal problem and an important hurdle in the health and production of livestock which cause significant financial losses (Taswar et al., 2014; Kemal et al., 2016). Ticks are important ectoparasites that are involved in transmition of different diseases e.g. trypanosomiasis, babesiosis, theileriosis, anaplasmosis and toxicosis (Kaur et al., 2015). They are the significant contributors of infectious diseases and cause mortality in livestock and humans (Kamboj & Pathak, 2013). Tick-borne disease, anaplasmosis formerly known as gall sickness is caused by a rickettsial microorganism (Kumar et al., 2015). The Symptoms of anaplasmosis include abortion in pregnant animals, pyrexia, jaundice, anorexia, depression, progressive anaemia, reduced milk production and death particularly in exotic breeds (Jabbar et al., 2015). The theileriosis is transmitted by certain Ixodid ticks such as Hy. anatolicum anatolicum, Hy. marginatum marginatum and Hy. anatolicum excavatum (Durrani et al., 2008; Kaur et al., 2015; Akbar et al., 2014). Clinical indices of oriental theileriosis frequently comprise, jaundice, lethargy, pyrexia, anaemia, weakness, mortality and miscarriage in female cattle (Aparna et al., 2011; Islam et al., 2011). Babesiosis is also called the red-water disease and is caused by different species of genus Babesia (Akbar et al., 2014; Jabbar et al., 2015). Major symptoms of babesiosis include haemoglobinuria, anorexia, high fever, depression, icterus, abortion in pregnant cows, and death may occur in serious cases (Durrani et al., 2008; Atif et al., 2012; Ali et al., 2013; Jabbar et al., 2015). Due to ticks and tickborne diseases (TTBDs) the global loss was expected to be between US$ 13.9 and 18.7 billion yearly (Gosh & Nagar, 2014). Economic losses to animals production caused by ticks which affects the hosts in numerous methods such as deterioration of the quality of skin, loss of blood and by transferring various viral and protozoan diseases to other livestock (Ashfaq et al., 2015). Very few studies related to tick-borne pathogens were done (Khan et al., 2013). So, there is a need to use modern tools like PCR for the recognition of TBDs (Karim et al., 2017).
3
In Pakistan especially in Punjab; being the largest province with respect to the population there is need to manage and control the ticks and TBPs (Nawaz et al., 2015; Adenubi et al., 2016). In the world different chemical acaricides i.e. chlorinated hydrocarbons, synthetic pyrethroids, organophosphates, formamidines and macrocyclic lactones have been used in order to control ticks. But there are many disadvantages of using acaricides such as long residual effect on milk and meat are risk for human health. These acaricides also contaminate environment and water, so effects the non-targeting organisms (Brito et al., 2011; Gosh et al., 2015; Nawaz et al., 2015). These issues urge the usage and promotion of substitute tick control resources. To control ticks, many plants have been traditionally used worldwidely. Medicinal plants represent the most prevalent and ancient form of medication (Nawaz et al., 2015). Because the plants are environment friendly and have no residual influence. Plants material are the cheap source of control and easily available to the poor owner of livestock.
Almost 80% of the world populations depend on old-style medicines for their health which was assessed by the World Health Organization (Kharb et al., 2004; Sindhu et al., 2012). Herbal drugs have commonly been used in the form of fruits and vegetables, and their extracts can cure the diseases and care for health (Ullah et al., 2016). Therefore, the following plant species were used in study to control ticks. Calotropis (C) procera L. is a perennial shrub, soft wooded and is present in Pakistan, India and in other countries such as tropical Africa, Egypt and Afghanistan (Najar & Khare, 2017; Shyma et al., 2014). It is usually recognized as “auk” in Pakistan. The leaves and flower of this plant contain phytochemical compounds such as alkaloids, flavonoids, terpenoids and saponins (Najar & Khare, 2017). The plants have been described to keep anti-culex and anti-anopheles activity of mosquito (Elimam et al., 2009), anti- mite, anti-acaricidal activity (Gosh et al., 2011; Iqbal et al., 2012; Shyma et al., 2014) and repellant effects (Iqbal et al., 2012). C. procera is recognized to comprise cardiac glycosides that are toxic to ticks (Al- Rajhy et al., 2003). Citrullus (C) colocynthis (L) is known as “bitter apple” (Gurudeeban et al., 2010). In Pakistan and India, it is identified as “tumba” (Mahajan & Kumawat, 2013; Hussain et al., 2014; da Silva & Hussain, 2017). The seeds of C. colocynthis have nutritive qualities while the fruit pulp has therapeutic properties. Its fruit has been commonly applied for the remedies of several infections comprising ulcer, diabetes, rheumatism, paronychia and cancer. Because it is a high source of functionally significant therapeutics and
4 bioactive composites like triterpenes, cucurbitacins, glycosides and polyphenols (Hussain et al., 2014) and anti-parasital (Farooq et al., 2008).
Trigonella (T) foenum-graecum L. belongs to the family Fabacecae. It is commonly known as “maithe” in Pakistan and India. It is a legume widely cultivated in most areas of the world due to its medicinal importance (Kor et al., 2013). This plant contains active components such as alkaloids, flavonoids, steroids, saponins (Ullah et al., 2016). It is recognized to have hypocholesterolaemic and hypoglycemic effects (Joshi & Rajni, 2007). It was also reported for anti-inflammatory, anti-cancer (Hibasami et al., 2003), anti-diabetic and antioxidant effects (Kor et al., 2013). Brassica (B) rapa commonly is known as “shaljam” in Pakistan. It belongs to cruciferae family. It contains phytochemical compounds such as alkaloids, carbohydrates, proteins and vitamins (Dinesh & Gopal, 2014). The stem and leaves are used in the treatment of cancer (Coventry, 1923) its root barks have a natural insecticide that is effective against red spider mites, aphids and flies (Allardice, 1993). Solanum (S) nigrum commonly is known as “makoi” in Pakistan. It is native to Eurasia but widely distributed in American continent, Asia, Australia, Europe and Africa. It has anti-inflammatory, anti-hyperlipidemic, antiseptic diuretic, diaphoretic and antioxidant effects (Sindhu et al., 2012; Gosh et al., 2011).
There is still a deficiency of effective effort to examine distribution and incidence of species of ticks causing livestock in Pakistan (Durrani et al., 2008). A number of the earlier revealed research were limited to a lesser zone and did not study agro-ecological areas, sampling strategies and manufacture organizations that are all aspects which can influence the ticks prevalence and tick borne diseases (Jabbar et al., 2015). Furthermore, till now, there is no research from Pakistan that discovered the recognized species of ticks from all over the Punjab, Pakistan. It is hard to acquire precise and specific facts to plot the current prevalence and spreading of ticks and TBPs. There is the lack of facts related to the prevalence of TBPs, population dynamics and control of ticks. Hypothesis “The prevalence of ticks and tick-borne diseases varies regionally and plant extracts have potential to control ticks and tick-borne diseases.”
5
Therefore, the present study was planned to investigate the prevalence of ticks, tick borne pathogens and their control through acaricides and medicinal plants to attain the following objectives
(i) Distribution of ticks across various topographical zones of the Province, Punjab.
(ii) Determination of potential of ticks in carrying pathogens of veterinary and public health significance using advanced molecular tools.
(iii) Testing the efficacy of different commercial acaricides and plant extracts.
6
Chapter 2
REVIEW OF LITERATURE Ticks are ectoparasites that are vectors of many animalas and human diseases. So, this project was prepared to know their prevalence after identification of different tick species on different animals, their control with acaricides and plant extracts and identification of pathogens they carry in various agro-ecological zones of Punjab, Pakistan. This chapter comprising of the following sections; 2.1 Prevalence and identification of ticks 2.2 Tick-borne pathogens and diseases 2.3 Use of acaricides and medicinal plants to control ticks 2.1 . Prevalence and identification of ticks Rehman et al. (2017) conducted a research to find out the risk causes related with abundant prevalence of tick in farms of animals and the distribution of ticks infesting ruminants in the dry and semi-dry agro-ecological zones of Pakistan. Ticks were collected from nine districts, 108 livestock farms and counted from 471 animals, comprising 194 buffaloes, 179 cattle, 18 sheep and 80 goats, including both arid and semi-arid agro-ecological regions. About 3,807 tick indicating four species were collected: Rh. microplus, Rh. turanicus, Hy. dromedarii and Hy. anatolicum. For the first time, these species were reported from the study area. In the arid regions Hy. anatolicum was the most plentiful species, while in the semi-dry regions Rh. microplus was the predominant species. The rate of tick infestation in ruminants was 78.3%. Examination of questionnaire statistics revealed that the higher tick prevalence in animals farms related with the lack of rural poultry, not use of any acaricides, grazing and rural housing systems were possible risk factors. They concluded that present study can be beneficial in the arrangement of incorporated control methods for ticks and TBDs in Pakistan.
Riaz et al. (2017) carried out a study to check the variety and seasonal spreading of hard ticks in goats and sheep by epidemiological survey in Multan (Pakistan). The collection of ixodid ticks was done from randomly selected animals and on the basis of their morphological characters identification of ticks was done. The results revealed that the rate of infestation of tick observed in small ruminants was 48.0%. Sheep were mainly affected by ticks (50.0%) than goats
7
(43.6%). The prevailing tick species were Hy. anatolicum (52.2%) and Rh. sanguineus (17.4%). The mixed infection in small ruminants observed was (30.4%). The tick prevalence in sheep and goats varies according to age, sex and breed. The result revealed that tick prevalence was noted maximum in Summer with respect to Winter season. They concluded from the study that more infested sites were internal ear and external ear in sheep similarly internal ear was the most infested site in goats.
Ali et al. (2016) carried out a study in river Ravi (Lahore) to illustrate epidemiological characteristics of bovine infestation of tick. To check the tick infestation in bovines, they examined about 532 buffaloes and 726 cattle. In cattle and buffaloes, the most prevalent tick genera are Hyalomma and Boophilus. In bovines, the observed more affected gender were females than males. According to age group the adults and youngs were more affected than old in cattle and buffaloes. They concluded from the result that in bovines, the most appropriate climatic conditions for ticks were Summer as compared to Winter, Spring and Autumn.
Kemal et al. (2016) carried out a study to find out the tick infestation rate and the related risk factors in district Arbegona (Southern Ethiopia). About 2024 adult ticks were collected and eight ticks species from three genera were recognized. A feedback form was also employed. The results revealed that the incidence of infestation of tick was found to be statistically significant in good, medium and poor body situation animal. They conclude from the result that the higher rate of tick infestation was responsible for decreasing output, economic losses and causes harsh effects on health of cattle.
Admassu et al. (2015) conducted a study in Dangila district (North West Ethiopia) to estimate the infestation and identification of major Ixodid tick genra of cows. The tick infestation rate was (56.2%) from randomly selected cattle. From the animal body parts, about 864 adult ticks were collected, preserved with 70% alcohol and stereo-microscope was used to identify upto genus level. Four genus namely; Hyalomma, Boophilus, Amblyomma, and Rhipicephalus were identified from the total collected ticks and account for 37.5, 25.0, 23.1 and 14.4%, respectively. Highest incidence of tick infestation was recorded in deprived body situation livestock (62.9%) as compared to medium (59.4%) and good body situation (41.2%). They
8 concluded from this study that the prevalence of ticks can also be responsible for spreading of TBDs and also cause physical damage to the skin.
Gharekhani et al. (2015) worked in Hamedan province, Iran on the identification of Ixodid tick species on cattle and sheep. In 3 rural regions during the year of 2010 to 2011 sampling of tick was done on the complete body of sheep and cow. A total of 1534 hard tick were collected in animals through which 62.1% were male and 37.9% female. The observed tick infestation rate was in cattle ascompared to sheep. The results revealed that the dominant hard tick species is Hy. marginatum.
Kaur et al. (2015) conducted a study on incidence of Ixodid ticks attacking cows and their control through extracts of plant. Out of 2150 cattle, 1262 cows were found infected with ticks. On the basis of seasonal trends, in rainy season rate of infestation of tick was higher as compared to Summer and Winter. The prevalence of infestation of tick was found greater in female cows than males. Ticks identification was carried out on the basis of their morphological characters, identified ticks are Rh. microplus and Hemaphysalis bispinosa out of which the Rh. microplus was rich. Due to acaricidal disadvantages like high cost, toxic to environment, non- biodegradable, left residuals in animal body and above all development of resistance in ticks. They concluded the importance of plant-based, effective anti-tick agent and less toxic, twenty plants were selected in the present study that was used as anti-tick agent.
Ganjali et al. (2014) worked on the diversity of tick family Ixodidae and their distribution in Iran. For this purpose, they randomly selected ticks from camels, cattle, sheep and goats. The collected ticks were stored in 70% ethanol and examined under stereomicroscope for identification. The results revealed that the presence of, Hy. Marginatum, Hy. dromedarii, Hy. Schulzei Hy. anatolicum excavatum, Hy. asiaticum asiaticum, Hy. anatolicum anatolicum, Rh. turacunis, Rh. bursa and Rh. sanguineus. They concluded that more investigations are important to reveal the contribution of above tick species as vectors of different diseases.
Musa et al. (2014) conducted a research in Maiduguri (Nigeria) to check the incidence of infestation of tick in different breeds of cows. The identified tick species from 205 cattle were Boophilus microplus, Hyalomma spp, Rh. sanguineous, Amblyomma variegatum and Ornithodorus spp. The tick infestation rate was significantly higher in males than females. In
9
Wadara and Kuri breed tick infestation was significantly higher. Under the tail/perineum, inner thigh, external genitalia and the udder were the most tick-infested predilection sites. The prevalence of tick infestation was lower in ears, eyes, neck, and all over the body. They concluded through this study that prevalence of tick infestation among indigenous cattle was high. It could hinder the rate of productivity and cattle production in Nigeria.
Soomro et al. (2014) carried out a study in the upper Sindh, Pakistan to estimate incidence of ticks in buffaloes. The research was conducted related to host (age and species) and study area to recognize and to calculate difference in the incidence of bovine infestation of tick. Random selection method was adopted to collect samples from Kundi buffaloes. Main tick genus was Hyalomma followed by Rhipicephalus. The rate of tick infestation in calves less than one year was significantly higher than the adult livestock one to two years and greater than two years livestock. Though, the location of the district was not related with the prevalence of tick infestation. They concluded from results that the prevalence of ticks helps to understand for development of the tactical and planned ticks control in local types of dairy animals.
Chhillar et al. (2014) conducted a research to check the prevalence of Ixodid ticks on domestic cows and buffaloes in Haryana, India. A number of 867 ticks were gathered and examined from 662 animals and the out of which 309 were affected with ticks of Ixodidae family which belonged to three different genera. Identification of tick species of the three genera were Rh. sanguineus (Latreille, 1806), Rh. (Boophilus) microplus, Rh. decoloratus, Hy. anatolicum anatolicum, Hy. anatolicum excavatum and Dermacentor spp. They concluded from the study that the most prevalent species of vector which affected cattle and buffaloes in this region were Hy. anatolicum anatolicum and Rh. microplus. The periodic ticks prevalence and the related management applications provided the basis for level of infestation.
Sharifinia et al. (2014) conducted a research in South West of Iran to show the existence of hard tick and CCHF. In both fields of veterinary and medicine, many important arthropod- borne diseases are caused by ticks, such as CCHF, Rocky Mountain spotted fever, lyme, tularemia and as well as some types of encephalitis. Ticks were collected to identify the viral infection and fauna of the hard ticks in livestock by random sampling. PCR method was subjected to a sample of ticks for detection of viral infection. Ixodidae ticks (592) were collected
10 during the study period and seven known species i.e. Rh. sanguineus, Rh. bursa, Hy. dromedarii, Hy. marginatum, , Hy. asiaticum, Hy. detritum and Hy. anatolicum were used for the detection of the genome of CCHF virus, more than 20% of these ticks were examined. Through which 6.6% species were found positive such as Hylomma. CCHF disease caused by hard ticks mainly infects the large number of livestock. It is concluded from the result that all five species of Hyalomma should act for the utmost CCHF vector. Precautionary measures could be used to overcome the animal infestation and to diminish the transmission of CCHF on the basis of seasonal activity of Ixodidae.
Patel et al. (2013) carried out a work on the economic effect of many tick species on livestock. The research was conducted from July 2010 to June 2011 for observing the common ticks.The overall prevalence of tick infestation rate was reported 60.07 % in cattle. The lowest prevalence was observed 46.07% in January while the highest was recorded 75 % in September. In Summer higher rate infestation of tick was observrd than in Winter season. According to age the incidence of tick infestation was examined more in the animals of one year as compared to the animals having age between one and three years. Similarly it was observed lowest in the animals of animals of more than 3 years. Two tick species were recognized on the source of morphological chracters i.e. Hy. anatolicum anatolicum and Boophilus microplus.
Katuri et al. (2013) worked on the investigation of site preference for the Ixodid ticks. They gathered ticks out of 927 buffaloes and 1473 Cattle of four distinct villages, growing up under unorganized farming and open grazing system. In both cattle and buffaloes, occurrence of Rh. microplus was more than 50% of the ticks which is mostly found in abdomen followed by neck in both cattle and buffalo. The dual infestation rate occurs 16% in cattle and 3 % in buffaloes.The results were useful to determine the tick infestation rate in bovines based on their site of predilection.
Singh and Rath (2013) planned a study in Punjab state (India) on epidemiology of hard ticks in (N=4459) cows population belonging to eighteen districts of five foremost agro-climatic areas from both sex and all age groups. The general prevalence of hard ticks and mix infestation were Rh. microplus 58.06% and Hy. anatolicum anatolicum 50.16%. Highest rate of prevalence Hy. anatolicum anatolicum and Rh. microplus were observed in sub mountain undulating region
11
(79.36%) and Western region (20.40%) correspondingly, between the several agro-climatic regions. The results showed that Rh. microplus mainly existed in hot and humid environment whereas, Hy. anatolicum anatolicum prefered arid and semi-arid environment. Through the age wise distribution of groups, in calves having less than six months of age tick infestation rate was maximum than six months to one year age group and minimum in greater as compared to one year age group (55.02%). The observed infestation rate of ixodidae ticks was significantly higher in males. They concluded that this study provides effective approach to control the ticks management in bovines of the area.
Khan et al. (2013) studied different areas of Khyber Pakhtunkhwa, Pakistan to check the prevalence of infestation of tick in buffalo and cattle. The present study was done on the basis of two groups of climate; cold mountainous zone at an elevation of 1110m and hot dry zone at an average of 500m beyond the sea level. In the same season at the different altitude, about 1223 (48.35%) cattle and 1306 (51.65%) buffaloes were observed and infestation of tick was examined. Through the observation, consequences revealed that in the hot dry zone, the infestation of ticks was higher at the lower elevations as compared to the cold hilly zones at higher altitudes.
Perveen (2011) carried a study in the Northern, Pakistan to detect the dissemination and identification of Ixodidae species on cattle. The most abundant species of tick was Amblyomma, Boophilus microplus, Hyalomma dromedarii and Hyalomma anatolicum. However, cows were subjected more at risk than buffaloes and ticks infestation rate was ranked third. Moreover, buffalos, cows, sheep and goats harbored had more than one type of ticks, similarly, camels and donkey harbored had only one type of tick. It is concluded from the result that this research will help the farmers to increase farm productivity and will be aided in taking effective methods to diminish infestation of tick and to improve controlling practices.
Durrani and Shakoori (2009) carried out a study to determine the optimum rearing temperature and relative humidity for cows ticks Hyalomma in Punjab, Pakistan. From each district they collected one hundred ticks of different genera. After identification the ticks of Hyalomma genera were raised in research lab under the impact of moisture and variable temperature. The incidence of Rhipicephalus (3.1%) and Hyalomma (12%) ticks in cattle were
12 observed. The bionomical study illustrated that during Spring pre oviposition period was longer but in Autumn it was lowest. The egg production rate was higher at 34 0C and lowest at 15 0C. The process of eggs hatching was maximum at 32 0C and 85% humidity. They concluded from this study that the maximum numbers of eggs were produced with the rise in temperature while the rate of development of ticks was not affected by variation in relative humidity.
Durrani et al. (2008) worked on bionomics of Hyalomma ticks in three different districts of Punjab, Pakistan. In cattle, the observed lowest prevalence of Rhipicephalus was 3.1% and highest prevalence of Hyalomma ticks was 12%. The study illustrated that preoviposition period was maximum in Summer and minimum in Autumn. Variation in the development period of the egg of Hyalomma occurred from season to season. At the temperature 1000C and 85% humidity no oviposition was recorded. The rate of egg production was higher at 34 and lower at 150C. At 320C and 85% humidity, the process of eggs hatching was maximum .PCR test was used to confirm Theileria infestation in the gut of ticks which demonstrated the lowest prevalence (20.8%) for Hyalomma marginatum while it was highest (86.6%) for Hyalomma anatolicum.
Sajid et al. (2008) worked on the rate of hard ticks infestation in local ruminants of lower Punjab, Pakistan. The purpose of this study in lower Punjab (Pakistan) was to find out the variety and concentration of tick population infecting domestic animals. Randomly selected 700 buffaloes, 1050 cattle, 250 camels and 1400 goats and sheep were observed for the infestation of tick. The recorded tick rate of infestation was greater in cows than in goat and buffaloes. Hyalomma anatolicum was found in large number than Rhipicephalus sanguineus. They concluded that effective measures were needed to control tick infestation rate to overcome the economic losses.
Manan et al. (2007) carried out a research in boundary part of Peshawar to find out the occurrence of Ixodid tick genra. In Parasitology Laboratory of Veterinary Research Institute, Peshawar ticks were recognized for their types. They recorded that the infestation of tick was influenced by status of body situation, month, age, effect of acaricides after treatment, housing and feeding systems. The most prevalence of ticks were from genus Boophilus as compared to Hyalomma, Rhipicephalus and Amblyomma. They concluded from the result that the infestation of tick was more in late Summer and less in Winter. But they found that there was non-
13 significant impact of age, status of body situation and effect of acaricides after treatment on the prevalence of ticks. Most of the ticks were found in tropical and subtropical areas during spring and summer season. Most abundant tick species were found Boophilus microplus, Hyalomma anatolicum and Hyalomma dromedarii. Highest prevalence was showed in cows followed by buffaloes and prevalence was associated with sanitation of animals.
2.2 Tick borne pathogens and diseases
Karim et al. (2017) carried out a work on ticks and TBPs in livestock Pakistan. Samples were morphologically recognized. Nineteen various species from three significant Ixodid tick genera (Hyalomma, Haemaphysalis and Rhipicephalus) and couple of soft tick genera (Argas and Ornithodorus) were detected. Out of these species of ticks, using a 454-sequencing stage the bacterial diversity was determined by bacterial 16S rRNA gene sequencing. The remarkable genera of bacteria were detected including, Corynebacterium, Rickettsia, Lactobacillus, Lactococcus, Ralstonia, Clostridium, Enterobacter, Enterococcus and Staphylococcus. They found 10% of total ticks were affected with rickettsial-specific amplicons. Evidence of infection was observed in only Hy. dromedarii, Hy. anatolicum and Rh. microplus by using a quantitative PCR (qPCR) assay. They concluded from the study that variety of pathogenic bacteria and ticks in different tick species were present in Pakistan. Their results revealed confirmation for T.annulata and Candidatus R. amblyommii infection in Hy. anatolicum, Hy. dromedarii and Rh. microplus.
Hossain et al. (2016) worked on the prevalence of ecto-parasitic infestation in cows from milk hut parts of Bangladesh. For this purpose they examined 400 cattle for ectoparasite from the study zone. The result showed that the rate of prevalence was maximum in Rhipicephalus sanguinus with respect to Boophilus microplus, Haematopinus eurysternus and Linognathus vituli. They studied that in female the rate of infestation was significantly higher than male. The ecto-parasitic infestation in weak animals was more common as compared to ordinary healthy cattle. They also found that the prevalence was significantly higher in rainy season than Summer and Winter.
Khan et al. (2016) carried out a research to find out the occurrence of Babesia (B.) bigemina and B. boves in house hold dairies of district Bannu and Lakki Marwat, Southern part
14 of Khyber Pakhtunkhwa, Pakistan. They collected blood samples for a period of one year. They examined thick and thin smear of blood in light microscope. The results revealed that total prevalence of babesiosis were positive for B. bigemina and B. boves. They concluded that this disease was more prone in Summer season than other season of the year.
Memon et al. (2016) conducted a research to check the epidemology of Theleria annulata and its influence on buffaloes by clinical findings and microscopic examination in semi-urban and city parts of Hyderabad, Pakistan. A number of 2400 buffaloes, 1845 were found infected with ticks, 970 in semi-urban and 875 in urban areas of Hyderabad. By Giemsa-stained method, out of 1845 tick infested bovine samples, 1680 were found positive for Theileria species. They observed that infected buffaloes have clinical signs such as temperature, anorexia, lymph node enlargement, loss of hair, open mouth with difficulty in breathing, projection of eyes, redness of skin and feebleness. But, during the survey suspected buffaloes showed normal feed intake, urination and defecation. In the peri-urban areas the incidence of the parasitic infection was significantly higher as compared to urban areas. The result revealed from the study that peri urban buffaloes were more vulnerable to theileriosis than the urban buffaloes. They concluded from the hematological studies that Theileria annulata in buffaloes produced significantly effect on erythrocyte and leukocyte indices, while, platelet indices remained unaffected from Theileria annulata in buffaloes.
Demessie and Derso (2015) reviewed different microorganisms and ticks that caused tick borne diseases. Babesiosis, anaplasmosis and theileriosis were most significant tick borne diseases in ruminants in tropics zones. The pathogens Anaplasma marginale causes anaplasmosis that is a rickettsial disease of blood. Babesiosis and theilerioses are tick- borne protzoal diseases produced by the genus Babesia and Theileria. These diseases have world-wide distribution affecting numerous species of mammals with a highest effect on cows. They observed that ruminants with tick borne diseases had problems like reduce meat and milk production, cattle type with greater genetics, mortality and vulnerable rise in miscarriage in addition to expenses for cure and control efforts are demolishing the profits of cattle owner and population. They concluded from the review that effective measures of tick borne diseases of animals were useful to apply suitable precautionary and control measures.
15
Kumar et al. (2015) conducted a research in Jalandhar District of Punjab (India to check the prevalence and seasonal occurrence of theleriosis in cows). For this study, 620 samples of blood were gathered and identified.The overall incidence of theileriosis (9.35%) was noted by Microscopic study of blood smears. They concluded from the study that the maximum prevalence was recorded in Summer season.
Jabbar et al. (2015) conducted a study on bovines tick-borne diseases in Pakistan. This present study briefly described a key on bovine TBDs and identified the breaks in knowledge of bovine TBDs in Pakistan and understanding of these diseases and provided information to improve instruments for the analysis and to regulate TBDs in this state.
Wamuyu et al. (2015) conducted a study for the molecular finding and characterization of theileria that infects Connochaetes taurinus in the Maasai Mara National reserve (Kenya). The main hosts of many species of Theleria are wild animal. In a few species including buffaloes, the molecular description and identification of theileria has been studied. To distinguish the relationship of the 18 small subunit of rRNA with known species of theleria, molecular-genetic and phylogenetic analysis are used. It is revealed through the results that Connochaetes taurinus were infected by three new theileria haplotypes. This research was conducted to check the probability of theleria transmission between small domestic ungulates (sheep and goats) and wildebeest.
Saad et al. (2015) worked on the zoonotic significance and prophylactic measure against babesiosis. Large number of mammals was being affected by babesiosis worldwide that is a vector borne infection produced by the different species of genus Babesia. All over the world, babesiosis has zoonotic significance causing health hazards in human population and huge loss to livestock industry. Ixodid ticks are the primary zoonotic vector of babesia. Prophylactic measure against babesiosis in early times was delayed but due to development in research, vaccines and the anti babesial drugs have been developed. This review highlights on rural communities, the awareness of public sector, owners of animal husbandry and health department about the risk of disease in KPK and control measure should be applied. Vaccines of low cost should be designed for the prevention of babesiosis in cattles and human population.
16
Iqbal et al. (2014) conducted a study to check the incidence and effects of ectoparasitic fauna on infesting goats in the district Toba Tek Singh, Punjab, Pakistan. They found the variety of ectoparasites like ticks, lice, fleas, mites and flies. The prevalent species of ectoparasites were Hy. anatolicum, Rh. microplus, Ctenocepahlides felis, Ctenocepahlides canis, Haematopinus spp. , Damalinia spp. , Linognathus spp. , Psoroptes ovis, Sarcoptes scabei and Hypoderma ovis. The prevalence of ectoparasites was not directly related with type of host, sex and age. During Spring and Summer season the maximum frequency distribution of ticks and flies was examined, while during the season of Winter the maximum prevalence of mites, fleas, and lice was observed. Evaluation of biochemical parameters exhibited higher values in positive animals, while a decrease was observed in hematological parameters due to infestation. They concluded that the current study has important role for organizing effective measures to control ectoparasites.
Javed et al. (2014) carried out a study in and around Lahore, Pakistan from March 2012 to February 2013 to check the prevalence and hematology of tick borne haemoparasitic diseases in equines. Theileriosis was the most prevalent TBHD followed by anaplasmosis, babesiosis and mixed infection in horses. Babesiosis was the most prevalent TBHD followed by mixed infection, anaplasmosis and theileriosis in mules. It was revealed through statistical analysis that species of TBHDs show significant difference among each other. All the equines showed that due to tick infestation there was a remarkable increase in total leukocytes count (TLC) values and slightly increase in total erythrocyte count (TEC) values from the healthy equines while packed cell volume (PCV) remained in the normal range in horses and mules with a significant association between them but PCV values slightly increased in donkeys with significant difference in the values. In mules and donkeys, there was an increase in haemoglobin values but decrease in horses than the healthy equines. The result revealed that there was a remarkable difference in TLC and Hb values of all equines than the normal values of equines according to the statistical analysis.
Sajid et al. (2014) carried out a research to find the occurrence in 700 buffaloes and 836 cows and risk issues for anaplasmosis in the populations of cows and buffaloes in the district Khanewal, Punjab, Pakistan. To check the epizootiology of anaplasmosis, conventional optical microscopy of Giemsa‟s stained blood films was used. The allocation of anaplasmosis, with an
17 overall prevalence was more in calves, females and buffaloes related to adults, cattle and males, correspondingly. In studied animal population, anaplasmosis was observed and related with the housing system, animal custody, breed, season and hygienic administration. Through this work evidence of first report of anaplasmosis was collected about this region. They concluded from the results that the data will not provide information to the dairy growers to adapt agricultural practices however also will not provide effective measures to control the problem in the cattle population of the district. To examine the anaplasma from haemoprotozoa such as Babesia and Theileria, modern molecular tools are recommended.
Chen et al. (2014) worked on TBPs and related co-infections in Central China from ticks of domestic animals. From April to December 2012, collection of ticks was done from domestic animals including sheep, cattle and dogs from 10 villages of Xinyang. PCR and sequence analysis were applied to check the TBPs and identifcation of ticks. About 308 ticks were collected for the identification of tick and tick-borne pathogens. They concluded from the results that ticks were abundant with both animals and humans pathogens. In these regions animals and humans were at a high risk of piroplasmosis.
Bursali et al. (2013) carried a research to study the infestation of tick rate in humans in the provinces of Kelkit Valley (Turkey). In this region, there was no taxanomic information available about the tick species that infests humans. During the survey, 1,460 ticks were gathered from humans who were infested by tick. In this region, a number of 19 species of ticks have been identified on humans comprising 7 Hyalomma, 3 Rhipicephalus, 2 Haemaphysalis, 2 Argas, 2 Ixodes and Dermacentor species. For the first time, the prevalence of Dermacentor reticulatus on humans was examined in Turkey.
Liyanaarachchi et al. (2013) worked on the particular zones of Sri Lanka to check the epidemiology of ticks in farm animals. The main purpose of this work was to screen out the variety of tick in farm livestock from particular parts of Sri Lanka. Moreover, the probability of the overview of species of ticks into livestock from wild animals was also studied. During the years 2009 and 2010, ticks were gathered in 30 places in the damp area and 30 places in the arid area. In this study 18 tick species were recorded, representing a reasonable increase in tick
18 species described in animals in Sri Lanka. They concluded that unusual species of ticks were found in livestock, which has been earlier stated only on wild livestock.
Ali et al. (2013) carried a research on cows and buffalo in Punjab, Pakistan to check the epidemology of Theileria Annulata (Ixodid ticks). The ticks were collected from 30 animal farms containing more than 25 animals (cow and buffaloes) in each. From 710 cattle and 320 buffaloes, about 6263 ticks were collected. The epidemology of Hyalomma species was considerably higher as compared to other genera of Ixodid ticks (p>0.05). The rate of infestation of ticks in buffaloes (34%) was considerably lower as compared to cattles (70%). PCR outcomes revealed that Theilleria annulata was identified in 40% Hy. dromedarii and 50% Hy. anatolicum ticks. They concluded that species of Hyalomma are chiefly responsible for spread of Theilleria in dairy animals.
Atif et al. (2013) conducted a research in three diverse districts of the Northern Punjab, Pakistan to investigate seroprevalence of Anaplasma marginale infection between cows. Multistage cluster random selection method was used to gather 1050 samples from selected small frames and private animals farms. The competitive enzyme-linked immuno sorbent assay (cELISA) was used to determine the prevalence of Anapalsma marginale infection. Between dissimilar age groups and breed a significant relationship was found. In all studied districts, the seroprevalence was significantly higher in small frames than private animals farms. They concluded that Anaplasma marginale infection was more vulnerable to small holder‟s hybridized cattle of more than four years of age in Summer season.
Shams et al. (2013) conducted a study in domesticated cattle of Khyber Pakhtunkhwa, Pakistan to illustrate the specificity and sensitivity of PCR & microscopy in recognition of babesiosis. From animal hospitals of district Karak and Kohat in Khyber Pakhtunkhwa Pakistan, six hundred blood specimens of clinically supposed cattle were collected. Examination of thick and thin smear slides was carried out through microscope. Through PCR using species specific primers, extracted DNA from serum was amplified. Analysis of augmented product was done after electrophoresis in ultra violet transilluminator. General incidence of Babesia was maximum in cows (34.4%) as compared to cattles (27.5%) and calves (20.6%). Similarly through microscopy overall prevalence was observed higher in cows as compare to cattle and calves.
19
They concluded from the study that PCR was more effective technique to detect babesiosis than microscopy and suggested it for practical usage in Khyber Pakhtunkhwa Pakistan. To increase the productivity of domesticated cattle definite measures shoud be taken out.
Atif et al. (2012) worked in Sargodha District, Pakistan to check the prevalence of Anaplasma marginale, Babesia bigemina and Theileria annulata infections between cows. In each month, samples were randomly gathered from particular small holders having 30 cows and private animal farms having more than 50 cattle. The samples were gathered of indigenous and hybridized cows of both sexes. A complete prevalence of haemoparasites 26.86% was revealed by microscopic observation of the Giemsa stained blood smears. The infestation of Anaplasma marginale was more than Theileria annulata and Babesia bigemina, respectively. Crossbred cattle (29.1%) were more at risk of tick-borne diseases than the indigenous cows (17.7%). Gender wise prevalence showed that female cows were more susceptible to TBDs as compared to males. The transmission of tick borne diseases was higher in small holders as compared to large animal farms. Through the Chi square analysis, association among selected tick borne diseases and different breeds, season and farm size was observed. This research showed that TBDs are predominant in the Sargodha district, Pakistan.
Moges et al. (2012) carried out a research in Chilga district, Northwest Ethiopia to show species composition of hard ticks, change in climatic conditions and their distribution on cattle. About 922 adult ticks were gathered and identified eight species from four genera. The most abundant species of tick was Amblyomm variegatum while Amblyomm lepidum being the least abundant. The quantity of ticks per cows was recorded smaller throughout the arid month while the highest number was observed in the rainy season. Ticks distribution was more in dissimilar body parts of the host like udder, groin, ear, mammary gland, neck, tail and anal part of which udder; dewlap and tail areas were the main infected areas of the body as compared to face and neck. Effective measures should take into account to diminish problems of tick infestation of cattle.
Naz et al. (2012) carried out a work in Lahore-Pakistan to find out the epidemology of theileriosis in small animals. To determine the incidence of theileriosis, a number of 529 animals were chosen. Samples 59/529 were positive for theileria on microscopic investigation. The
20 incidence of Theileria spp. was recorded higher in sheep as compared to goats. Theileria infection in goat was not affected by age sex and season. Age, season and sex had major effects on theileria infection in sheep. Pyrexia was detected in about 85.71% sheep and 78.95% goat.
Singh et al. (2012) conducted a research in and around Ludhiana district (Punjab) to check the prevalence of canine hepatozoonosis. From canines a number of 532 samples of blood were gathered and observed during current study with the historical continual of high fever existing at small veterniary clinics, Ludhiana, (Punjab). Gimsa stained technique was used to examine the blood samples, peripheral blood smears exposed that 1.13% (6/532) of canines was infested with hepatozoon canis that prevalence varies with dissimilar age groups. It was concluded that the infestation of the parasite was comparatively maximum in females as compared to male dogs.
Zulfiqar et al. (2012) worked in Southern Punjab for the identification of Babesia (B.) bovis in blood specimens and its influence on the large ruminants. From Southern Punjab, six districts including, Layyah, Multan, Bahawalnagar, Bhakar, Muzaffar Garh, and Vehari, from large animals (144), containing cows (105) and buffaloes (39) blood samples were collected. Through questionnaires, statistics on the qualities of animals and herds was gathered. Various samples of blood and serum of calves and cows were calculated and compared with positive and negative specimens for determination of the influence of B. bovis on the blood and serum profile of infested ruminants. For B. bovis, 541-bp specific fragment were produced from 5 out of 6 sampling districts. They concluded from this study that it reveals the incidence of B. bovis first time in large ruminant and this study will help to increase the livestock output by preventing the disease babesiosis in the region.
Alim et al. (2011) carried out a study in Chittagong division, Bangladesh to check the occurrence of hemoprotozoan diseases in cow population. In three consecutive seasons, samples of blood were randomly chosen from 216 hybridized and 432 native cattle of four typical areas. Giemsa's stained blood smear technique was used to examine the samples. In this study the observation of the effect of geography, season, age and sex was carried out in cattle during this study. In crossbred and indigenous cattle the overall prevalence of hemoprotozoan diseases was observed 16.18 and 12.02% correspondingly, where babesiosis and anaplasmosis were prevalent.
21
The highest prevalence of babesiosis (9.25%) was noted in hilly area but found to be reliable in all the four different areas. In Summer season the hemoprotozoan diseases were predominant than Winter and rainy seasons. Adult cows were considerably (P<0.05) at risk to babesiosis as compared to younger. Babesiosis in crossbred cow was statistically important so that female ruminants were more vulnerable to hemoprotozoan infestation as compared to male. They concluded that breed and season play important role to examine the hemoprotozoan diseases.
Satta et al. (2011) carried out a research to check the symbionts and pathogens in ticks. They conducted a research in Sardinia, (Italy) on the distribution of tick species and existence of tick transferred micro-organisms. From mammalian hosts, a number of 1485 adult ticks were gathered. Ticks identification was carried out to determine the existence of Rickettsia species of the spotted fever group, Leishmania species, Anaplasma phagocytophilum, Bartonella species, Coxiella burnetii and Ehrlichia canis by PCR analysis. Only Hyalomma marginatum marginatum produced negative results among all tick species examined. They revealed from the results that recorded data provided information on tick-borne diseases and could be helpful to understand the prevalence of ticks in Sardinia.
Irshad et al. (2010) studied on sheep and goats at National Agricultural Research Centre (NARC) Islamabad and Barani Livestock Production Research Institute (BLPRI) Kherimurat district Attock, Pakistan to check the epidemology of infestation of tick and theileriosis. For the presence of ticks, about 662 animals (443 goats and 219 sheep) were monitored. Of these, goats and sheep were observed infested with several tick species. Within two homesteads combined in sheep and goats, the difference in incidence of ticks was significant (P≤0.01). In different months of research, difference in the incidence at BLPRI was significant, while at NARC was non significant. On the basis of their morphological characters ticks were recognized. Both in sheep and goats the most plentiful tick infecting was found Rhipicephalus spp. They concluded from the results that the infestation of theileriosis in goats was 3.8%, while in sheep it was 7.36%.
Qamar et al. (2009) carried out a research in buffaloes at Rahim Yar Khan, Pakistan to illustrate the epidemology of blood protozoans. Five hundred blood samples were gathered to examine the incidence of different blood protozoans such as trypnosoma, theileria and babesia in
22 buffalo's blood. The study showed that the most abundant blood protozoans was babesia, while prevalence of theileria was second and trypnosoma was found to be least prevalent.
Prevalence of diseases and tick-borne pathogens were associated with season and geographical areas. Most prevalence diseases were theleriosis, babesiosis, anaplasmoisis and ehrlichiosis caused by Theleria, Babesia, Ehrlichia and Babesia species of pathogens. These were mostly identified through PCR.
2.3 Use of acaricide and medicinal plants to control ticks
Avinash et al. (2017) carried out a study to demonstrate the acaricidal activity of extracts of Azadirachta indica. On fresh larvae the acaricidal action of chloroform and hexane extracts of leaf of neem and deltamethrin were observed through the use of larval packet test (LPT). Azadirachta indica was very critical therapeutic plant. The most important ectoparasites of farm animals are Rhipicephalus (Boophilus) microplus. Conservative tick manipulate is specially based totally on the application of artificial chemical substances, but ticks are growing resistance against the acaricides and also have several negative outcomes. The LC50 and LC90 have been maximum for hexane leaf extract at 2139.34 and 8687.70 ppm, correspondingly. By means of contemporary sensitive gas chromatography–massspectrometry (GC–MS) the composition of chemical extracts was also evaluated. They concluded from the study that phytogenic mixtures contain the acaricidal action and also ecological.
Zaman et al. (2017) reviewed literature about the plants reported for having acaricidal and anthelmintic properties. Socio-economic and geo-climatic conditions provide a favorable climate for parasitic population of cows in Pakistan. Livestock industry is mainly affected by hard ticks and gastrointestinal nematodes. Hard ticks play vital role in destruction of livestock industry. To control these parasites, stockholders depend on synthetic drugs. This study was conducted to determine the effectiveness of the medicinal plants against ticks and gastrointestinal nematodes. Disposition of researchers to evaluate medicinal plants as anthelmintic was higher as compare to acaridicals. However, absorption of cutting verge skills in evaluation method of medicinal plants was suggested.
23
Adenubi et al. (2016) carried out a study on the extracts of plant to control ticks of medical and veterinary importance in developing countries. The present study carried out in laboratory to check the tick-repellent or acaricidal activities of medicinal plants. The extracts of plant were used to control the different stages of ticks. About 200 species of plants from different countries act as control strategy and have acaricidal or tick-repellent properties by vitro assays. The extracts of several plant parts were most effective such as control strategies. Species containing Azadirachta indica, Pelargonium roseum, Lavendula augustifolia, Gynandropsis gynandra and Cymbopogon spp. had virtuous larvicidal and acaricidal activity with 90–100% effectiveness as compared to those of presently use acricides. Various energetic composites like geraniol, citronellal, carvacrol, azadirachtin, and linalool have been separated. The rural livestock farmers mainly used large amount of plant extract to control tick infestation rate. The effective acricides are prepared by plant-based mixtures or it might be a good source of new acaricide compounds to perform active control strategy of ticks.
Nyahangare et al. (2016) studied the severe oral toxicity of mammal and impact of diluents on efficiency of Maerua edulis De Wolf against larvae of Rhipicephalus decoloratus species. Serial dilution of 5, 10, 20, and 25 % were made to form standard solution. To make standard solution 25%w/v cold water plus surface active agent, hot water plus surface active agent, methanol or hexane was used. These stock solutions were used to extract ground leaves separately. Twenty larvae of Rhipicephalus decoloratus tick were sited in filter papers saturated with excerpts for each concentration and the process of incubation was done after 24 h and 48 h to observe the mortality rate at 27∘C and 85–90% RH. It is observed that the rate of larval mortality was not dissimilar from the amitraz-based control which was maximum in methanol- extracted M. edulis treatments. The rate of mortality was also lower in cold water as compared to hot water plus surfactants treatments .They concluded from the results that methanol or hot water extract of M. edulis were effective medication to control tick.
Nyigo et al. (2016) carried out a study to evaluate the consequences of medicinal plant as acaricide against Boophilus species. To check the acaricidal impact of plant extract, adult and larval immersion tests had been used. The end result found out that methanol and ethanol extracts from leaves confirmed low adulticidal and larvicidal mortality, respectively. A non- extensive activity of mortality showed from different extracts of this plant. They concluded that
24 for subject trials it is not suggested, as a substitute to determine its opportunities mainly using sparkling plant material additional research is needed.
Mirania et al. (2016) carried out a research in Tharparker, Sindh; Pakistan on the records of ethno veterinary plants for the cure of several buffalo and cow diseases. In Sindh province, people living in Tharparkar depend on customary methods to solve health complications of their animals and have rich heritage of indigenous knowledge. Hence this research was carried out to demonstrate the application of therapeutic plants, their method of preparation and usage of these ways for the cure of several diseases in this part. Ethno veterinary data was generated by observation, semi-structural interviews and emphasis on group negotiations. To illustrate the kinds of herb used against specific disease and dose, way of drug management and drug preparation, observations were prepared. A number of 35 species of plants were recorded more effective against 15 common diseases. The widely used plants in the study part were Plantago lanceolata, Brassica campestris, Trachyspermum ammi, Capparis deciduas, Phoenix dactylifera, Nicotiana tabacum, Azadirachta indica and Capsicum annuum. The most frequently used botanical family of plants was Apiaceae followed by Fabaceae. Fruits, rhizomes, latex, seeds, leaves, bulbs and husk were the most commonly used plants parts. Most repeatedly methods used for drug preparation were pulverization. In the preparation of traditional drugs plants are the most widely used components. In the study area, farmer used the reported medicinal plant for the treatment of cattle and buffaloes in different health problems. This study suggested that the described species of plants can be exposed to scientific authentication in demand to commend more active treatments and preparations.
Chawech et al. (2015) studied on Citrullus colocynthis (L.) Schrad to check the antibacterial activity and chemical composition of extracts and compounds separated from it. The main purpose of this work was the phytochemical analysis of several extracts of stems and leaves. It was made with three increasing quantity of polar solvents such as (methanol, ethyl acetate and n-hexane) of Citrullus colocynthis. The key objective of this study was application of the agar disc well-diffusion process to examine the antibacterial action of several extracts and ethyl acetate extract of leaves. It is revealed through the results that latent antibacterial was observed in ethyl acetate extracts of leaves and stems related to other excerpts in counter to verified Gram-positive and negative microbial strains. Leaf extract of C. colocynthis (Ethyl
25 acetate) recommended the recognition of eight other cucurbitacins through LC-MS analysis. The importance of sugar moiety was characterized by antibacterial activities of the isolated compounds. The highest significant minimum inhibitory concentrations (MIC) standards were found for Gluco cucurbitacin E 1.25 mg/mL against both Bacillus cereus and Enterococcus faecalis and the ethyl acetate excerpt 0.625 mg/mL against Bacillus cereus.
Gosh et al. (2015) conducted a study to manipulate the acaricided resistant in animals ticks, Rhipicephalus microplus from medicinal plant extracts. For trying out distinctive extracts, the adult immersion test turned into adopted. Screening criterion primarily based on 72 h, 95 % ethanolic extracts of Argemone mexicana complete plant and of Datura metel fruits had been discovered powerful displaying extra as compared to fifty percent mortality of handled ticks. The ninty five % ethanolic excerpts of both plants showed reproductive inhibitory and acaricidal consequences on handled ticks. The LC90 values of Datura metel have been 7.13 and Argemone mexicana 11.3 % had been determined, respectively. Phytochemical research confirmed the existence of phenolics, flavonoids and terpenoids and alkaloids in Argemone mexicana complete plant extracts and alkaloids and glucosides in Datura metel fruits. The effects discovered that those botanicals may also play a big function to control ticks by decreasing the use of chemicals and may be to achieve resistant tick population in surroundings responsive way.
Ohimain et al. (2015) research on the acaricidal activities of simple extracts of Ocimum (O.) sanctum and Hyptis (H.) suaveolens towards Rhipicephalus sanguinneus. Solvent extract of
H. suaveolens precipitated LC50 at 175.00, 81.25 and 225.00 ppm, correspondingly from chloroform, methanol and n-hexane extracts however O. sanctum showed mortalities for chloroform, methanol and n-hexane extracts at 200.00, 137.50 and 287.50 ppm, respectively. In the meantime, at 1 ppm the positive control became poisonous, while within the negative control the tick turned into survived. The findigs discovered that solvent excerpts of H. suaveolens and O. sanctum may be applied as acaricides for the management of canine tick Rhipicephalus sanguinneus.
Nithya et al. (2015) carried a study on the activity of acaricide of shoot extracts of Annona (A) squamosa, Azadirachta (A.) indica and Calotropis (C.) procera in vivo situation. With methanol and water plants had been extracted and under in vivo circumstance the extracts
26 had been tested towards the cattle ticks. As tested individually the alcoholic and aqueous extracts of A. indica showed highest mortality rate of ticks observed with the aid of A. squamosa and C. procera. In combination of plant excerpts, on 5th day hot water excerpts of dried leaf powder exhibited a hundred percent mortality of ticks even as ethanol and methanol excerpts confirmed eighty three and eighty percent mortality, correspondingly. They concluded from the above experimental results that the selected plant constituents have greater acaricidal pastime towards farm animals ticks. They also conclude that the plant extracts in combinations are extra powerful than single drug used.
Ullah et al. (2015) carried a research to assess the acaricidal efficacy of the aqueous methanolic excerpts of fruit of C. colocynthis, rhizome of Curcuma longa and seed of Peganum (P.) harmala. The activity of acaricidal plant excerpts was tested by larval immersion test in lab against Rhipicephalus microplus. Acaricidal activity of every plant differs with specific exposure times i.e., 24 hours and 6 days after exposure. Acricidal activities of plants were time and dose dependent. The herbal components were appropriate for the poor farmers as a reasonably-priced and wide spectrum antiparasitic. The mixture of flowers might be endorsed for use at farm stage based on empirical suggestion of its anti-parasitic activity.
Nawaz et al. (2015) carried out a study to assess anti-tick activity of aquous extract of Azadirachta indica, Morus alba and Dalbergia sisso against the larvae of Rhipicephalus microplus. Acaricidal properties of vegetation and ivermectin were tested after 24h and six days of remedy by using syringe test. LC50, LC90 and LC99 values had been observed for extract and ivermectin. This considerable difference among LC50 values after 24 h and 6 days implied these plants extract were greater poisonous after 6 days of treatment. Likewise, substantial difference was found between LC90 and LC99 of plants extract and ivermectin. Time structured reaction of water extract of plant was detected. They concluded from the results that extract of these plants could be used to control ticks and for development as herbal acaricide.
Krishna et al. (2014) studied the activity of acaricide of the petroleum ether excerpt of leaves of Tetrastigma leucosta through adult immersion test (AIT) against Rhipicephalus (Boophilus) annulatus. At distinctive concentrations the percent mortality of adult, blocking off of hatching of eggs and inhibition of fecundity were studied. The 10% concentration of the
27 extract confirmed 32% of adult tick mortality, 88.96% inhibition of fecundity and 50% inhibition of hatching. After five days of remedy peak mortality rate was found. The rates of ticks mortality were concentration dependent. Against Rhipicephalus annulatus, the LC50 of the extract were 10.46%. At least seven polyvalent compounds had been present in the HPTLC profiling of the petroleum ether excerpt. They concluded from the result that the mortality of ticks and inhibition of the fecundity were indication of synergistic effect of the bioactive additives.
Shyma et al. (2014) conducted a study on the methanolic extract of Azadirachta (A.) indica, Datura (D.) stramonium, leaves of Calotropis (C.) procera, cloves of Allium (A.) sativum, and Carica (C.) papaya for acaricidal activities against Rh. microplus. The rate of mortality in adults was 12.5% within 15 days. The mortality of adult tick was maximum at the highest concentration 66.67% for C. procera, 73.33% for D. stramonium, 80.00 % for A. sativum, and 93.33 % C. papaya extracts. The Rate of inhibition of fertility of treated groups was concentration dependent and differed mainly from the control group. However, calotropis, neem, and datura were able to decreasing hatchability by 20, 50, and 70 %, correspondingly. They concluded from the results that the excerpts of cloves of A. sativum and seed of C. papaya have very significant acaricidal activities and could be alternative of Rh. microplus a potential component of tick control strategy.
Mkangara et al. (2014) assessed the outcomes of medicinal plant Commiphora swynnertonii stem bark extracts as acaricide against adult Amblyomma variegatum and Rhipicephalus appendiculatus. Petroleum ether, ethyl acetate and methanol have been used as solvent for plant extraction. The concentrations of extracts had been examined at 60, 70, 80, 90 and 100 mg/mL. All extracts showed acaricidal activity that was concentration and time dependent. After 156 hours of exposure, the result confirmed that the petroleum ether extract showed distinctly excessive acaricidal activity with LC50 of 72.31 and 71.67 mg/mL causing mortality of Amblyomma variegatum was 100% and against Rhipicephalus appendiculatus was 87%. They concluded from the outcomes that Commiphora swynnertonii could be used for the control of tick.
Parveen et al. (2014) studied the effectiveness of ethanolic excerpts acquired from the aerial components of Ageratum (A.) conyzoides and Artemisia (A.) absinthium against Rh.
28 microplus through AIT in vitro. Five different treatments of the excerpt (1.25%, 2%, 5%, 10%, and 20%) were used for bioassay. For every treatment, three replications had been used. In AIT, the most mortality was observed for A. conyzoides (40%) and A. absinthium (66.7%) at 20% concentration. The highest acricidal activity was observed in the excerpt of A. absinthium with
LC50 and LC95, respectively. Special concentrations of the excerpts were used to handle the egg of the live ticks that became appreciably lower as compared to control ticks; subsequently, the oviposition values and generative index of the handled ticks had been reduced extensively. They concluded that A. absinthium has efficent activity of acaricide as compared to A. conyzoides and can be beneficial in monitoring Rh. microplus.
Opiro et al. (2013) investigated the repellencey of four plant species extracts Cissus (C.) adenocucaulis, Cassia (C.) didymobotrya, Kigelia (K.) africana and Euphorbia (E.) hirta on the larvae of Rhipicephalus appendiculatus. The outcomes had been evaluated that three different organic solvents of different polarities i.e hexane, methanol and dichloromethane have been used to obtained extracts by way of the fingertip repellence bioassay. The research verified that each one excerpts assessed showed a repellence impact that fluctuated from fourty three to eighty eight percent. The application of dissimilar extraction solvents did not significantly vary repellence impact, for all four plant species. The satisfying repellence percentages exhibited by C. didymobotrya and K. africana. These shows the strong capacity of these flora for tick manipulate in an incorporated tick management system for farm animals owned with the aid of resource-terrible farmers in Northern Uganda.
Leschnik et al. (2013) carried out a research in Eastern Austria to illustrate the effect of acaricidal action on tick prevalence and immunal response in tickborne pathogens in naturally infected dogs. In this study, about thirty dogs were cured with fipronil plus S-methoprene, permethrin, or supported as untreated control. Dogs were medically inspected and tested for antibody reactions against Anaplasma phagocytophilum, Babesia canis and Borrelia burgdorferi, over a period of 11 months. About 2/3 of all dogs had showed an optimistic immune reaction for one or more pathogens. For canine babesiosis, only three dogs showed positive response whereas the other dogs remained healthy. Application rate does not correlate with individual number of ticks per dog. If owner did not use acaricides frequently, no effect on the number of contagions could be observed while total of ticks was noticeably decreased through applying drugs. Clinical
29 disease caused by tick borne pathogens are rare in dogs exposed to tick-borne pathogens is rare to make application of acaricide more effective, Extra educational teaching for dog owners about the avoidance of TBDs was recommended.
Petro et al. (2012) conducted a study to illustrate the effectiveness of cypermethrin against cow ticks in Tanzania. The laboratory evaluation was accompanied recommended by FAO using laboratory reared tick species through larval packet test .The results showed that the three weeks old larvae of Rhipicephalus appendiculatus were vulnerable to the technical grade of cypermethrin. Two herds which were 3 kms apart from each other were treated with recommended dose rate (0.01%) of vapco cypermethrin 10 EC once fortnightly while the other herd was untreated. They concluded from the results that number of ticks reduced enormously in the treatment group the vapco cypermethrin while the number of ticks remained less in the control group throughout the study period. The maximum effectiveness was observed after fourteen day dipping.
Sindhu et al. (2012) documented study to find out the ethno-veterinary applications to cure parasitic infections in livestock. Visits of area, interviews and group negotiations were planned to accumulate the records over a period of six months. A complete of 96 ethno- veterinary practices (EVPs) has been recognized through which 66 had been primarily dependent on medicinal plants and thirty on other natural and inorganic substances. About thirty five plants from twenty three families had been recognized for the remedy of diverse sponging infections. The pinnacle ten maximum often applied plants were: Ocimum basilicum, Aloe vera, Azadirachta indica, Citrullus colocynthis, Brassica rapa, Nicotiana tabacum, Withania coagulans, Ferula asafetida, Eruca vesicaria and Allium cepa. There was variety in the usage of plants in their dose, way of instruction, portion used and signs. The maximum often revealed remedies had been for the treatment observed by means of fly infestation, helminthiasis and tick infestation. On a general foundation, farmers articulated their approval for the documented EVPs. The present study provides information about these plants and its powerful use for controlling parasitic infections regularly occurring inside the region by means of the local animal husbandry. It was revealed through the result that regular usage of doses of plants and the use of medical tactics would be helpful to the farmers, medical community and pharmaceutical enterprise.
30
Brito et al. (2011) worked on the evaluation of the performance of acaricides utilized in dairy herds elevated in the Brazilian SouthWestern Amazon to control the Rhipicephalus microplus. A complete of 106 populations had been gathered from five cities, to evaluate the efficacy of acaricide molecules. The adult immersion test (AIT) was used for control of Rhipicephalus microplus. They concluded that the acaricide preparations had various impacts at the tick populations observrd.
Zorloni et al. (2010) studied the efficacy of Calpurnia (C.) aurea extracts against the tick infestation. In Southern Ethiopia; water, hexane and acetone leaf extracts of C. aurea had been established for acaricidal and repellent properties against unfed adult ticks Rhipicephalus pulchellus. In comparision to several other plants, the C. aurea excerpts did not have repulsive possessions but alternatively it had moderate attractant ability. By twenty and ten percent acetone excerpts, all ticks were either destroyed or their movement was harshly assigned after one μl of excerpt changed into typically carried out on the stomach. At five% concentration, 85% of ticks had been nevertheless influenced. A 10% aqueous solution additionally had an obvious influence. The outcomes showed the efficiency of the conventional usage of this excerpt and might lead to a product that could be applied commercial to prevent tick prevalence.
Durrani et al. (2009) carried out a research to check the behavior of therapeutic trials of natural plant Calotropis procera and buparvaquone in hybrid cows after trial contagion with Theileria annulata during the months of May to August, 2007. Extreme clinical reactions had been recorded after experimental contamination. An association between medical responses and piroplasm parasitemia and schizont parasitosis was also noted. The livestock were beared from excessive fever, sub scapular lymph nodes and swelling of sub mandibular, weak spot, improved respiratory and rhythm, anorexia, corneal opaqueness, condition loss and difficult hair covering. By applying T. annulata particular primers N516/N517, 721-bp fragment of SSU rRNA was changed into augmented from DNA of salivary glands and the inner organs of Hyalomma ticks. The effects of therapeutic findings showed that the macrocytic hypochromic anaemia in experimentally infested animals was improved by C. procera therapy. The end result revealed that through the treatment of liver and kidney features with C. procera did not confirm poisonousness at the dosage of 0.3 mg/Kg orally. They concluded from the study that the effectiveness of C. procera was greater with respect to buparvaquone.
31
Kone et al. (2008) carried out a study to illustrate the use of medicinal plants for veterinary purposes by rural communities of Northern West Africa. Ethno veterinary medicine is the foremost alternative for the treatment of several diseases and disorders of their livestock. Medicinal plants (55) were reported by breeders that belong to 40 genera and 30 families. Herbal medication was mostly used as decoctions, crushed fresh plants or powdered plant material to treat disorders of the eyes, gastrointestinal and respiratory tracts.
No doubt chemical control method is quick but it is harmful for animals and human beings too. It is also a main cause of tick resistance, so now days most researchers are trying to control with botanicals that are environment friendly and do not cause any harm to animals.
32
Chapter 3
MATERIALS AND METHODS
The study entitled “prevalence of ticks and tick borne pathogens from Punjab, Pakistan” was conducted in Research Laboratory of the Department of Zoology, Government College University Faisalabad.
3.1. Study Area
The research was focused to find the ticks prevalence, their management with plant extract and acaricides and tick borne pathogens in livestock farms. The research work was conducted from 2016 to 2017 in four different seasons (Autumn, Winter, Spring and Summer). This study was carried out from four agro-ecological zones of Punjab, Pakistan, i. e.
Southern zone a. Muzaffargarh b. Bahawalpur c. Rajan pur Western zone a. Khushab b. Bhakar c. Layyah Central zone a. Jhang b. Gujranwala c. Faisalabad Northern zone a. Rawalpindi b. Attock c. Chakwal
33
The study coveres four periods that are Autumn (August to October), Winter (November to January), Spring (February to April) and Summer (May to July). The hottest month is June having maximum temperature of 50°C. The coldest month of these areas is December having minimum temperature of 0°C. From 12 districts as listed above the total 120 cattle farms were chosen. Three districts were selected from each zone of Punjab. All the randomly selected districts from all four zones of Punjab are important livestock farming zones. In province Punjab the larger populations of livestock are found as compared to the other provinces of the country. The total population of livestock in Punjab was estimated to be 175 million i.e. (cows, goats, sheep and buffaloes) (Livestock Census, 2006). Mostly economy of the Southern zone of Punjab is based on agriculture, the Cholistan desert falls in this zone. The districts of Western zone of Punjab lying nearby to the Indus River. The geography is defined by the sand obtained from the shifting flood bare deposits of the Indus. This zone consists of Layyah, Khushab and Bhakkar districts which mostly covers the Thal desert. This area has a sizeable cement, sugar and textiles industry and also rich in salt and coal. Though, poverty levels are much greater in this zone as compared to Northern or Central Punjab. Central Punjab states to the flat surface that are inhibited by the Southern verge of the Jhelum river down till the Sutlej river. Northern Punjab is generally categorized as the mountainous, highland and hilly areas in the north of the province. Bahawalpur is the biggest district of Punjab with a whole part of 24,830 Km, almost two-thirds of the district is concealed by the Cholistan desert, which prolongs into the Thar Desert of India. Bahawalpur and Rajun pur have the highest small animal population. Attock is the significant cattle trade zone that links the Northern areas of country with the Southern areas.
34
Figure 1. Chart of Punjab region in Pakistan and the districts from where samples of tick were gathered.
35
3.2. Collection and preservation of ticks
During four seasons of the year in morning and evening ticks were collected. From goats, sheep, buffaloes and cows species of ticks were collected. Total ten (five urban and five rural) livestock farms were haphazardly chosen from each designated district of the regions of Punjab. In urban areas, every farm was at least ten kilometer apart from the other farm. Whereas in rural parts, every farm was chosen from various villages which were at least 5km away from each other. The designated 5-10 animals (if any animal was not available at the farms, then it was observed from nearly farm) were systematically checked from farms through nearby analysis, parting the furs in contrast to their usual way for the ticks identification. Species of tick were gathered analytically from head to tail orders with the aid of tiny steel pincers with blunt tops devoid of injuring their orifice. Ticks were placed in clean and dry appropriately labeled plastic bottles covered with muslin cloth for proper aeration. Tick specimens were brought to research laboratory for identification and PCR analysis. Complete record of the area, animal species, time and season was maintained. In the laboratory, preservation process was done by keeping ticks into 70% methanol for further investigation
3.3. Identification of ticks Under low power and then high power amplification of microscope, collected ticks were observed. According to the keys given by Mc Carthy (1967), Madder et al. (2004), Walker et al. (2003) and Estrada-Pena et al. (2006) identification of various adult ticks were accomplished by the aid of the structural and morphology features in the lab by dichotomizing and light microscopes. Moreover, original explanations and representations of associated tick were also checked (Apanaskevich & Horak, 2005). At the species level species of ticks were recognized below a stereoscopic (OPTICA SZM-1 Italy) using 40-fold amplification. For the recognized tick types, abbreviations were used as earlier recommended by Dantas-Torres (2012).
3.4. Collection and identification of plant materials
Five different plants i.e Trigonella foenum-graecum, Solanum nigrum, Calotropis procera, Citrullus colocynthis and Brassica rapa were designated for the research (Table 3.1). These plants were designated because these are easily available to the the owner of livestock
36 farms. From Department of Botany, Government College University, Faisalabad, the whole parts of these plants were collected from the different areas of Jhang and identified. Fresh plant materials were brought into the laboratory washed all plants with distilled water and dehydrated under shade at room temperature for one month. After complete drying, the dried plants material were crushed in mortar pestle, and then ground into fine powder by electric blender. The powder was sifted by a mesh.
Table 3.1. Classification of selected plants of study Sr No Scientific name Common Family Genus Species English name name 1 Calotropis procera Auk Apocynaceae Calotropis Procera Milk weed
2 Brassica rapa Sarson Brassicaceae Brassica Rapa Mustard
3 Trigonella foenum- Methi Fabaceae Trigonella foenum- Fenugreek graecum graecum 4 Solanum nigrum Makoi Solanaceae Solanum Nigrum Black nightshade 5 Citrullus colocynthis Khurtumma Cucurbitacea Citrullus colocynthis Bitter apple
3.5. Preparation of plants extract
To check the efficacy of the above mentioned plants, the plant extracts were prepared by following process described by Gosh et al. (2015) with slight modifications. Five hundred (500) grams of powdered material of all selected plants were individually added to methanol (1000ml) in the beaker, covered it with aluminum foil and kept for seven days at room temperature. After seven days was sifted through Whatman No.1 filter paper and dehydrated by rotatory evaporator. The crude extract was measured separately and stored in glass jar at room temperature for the application of acaricidal activity to control ticks.
37
(a) (b) (c)
(d) (e)
Figure 2. Medicinal plants used for plant extracts i.e (a) Calotropis procera, (b) Solanum nigrum, (c) Brassica rapa (d) Trigonella foenum-graecum (e) and Citrullus colocynthis.
38
3.6. Phytochemical analysis
Plant extracts were further subjected to qualitative phytochemical analysis. This analysis was carried out with the following standard methods;
3.6.1 Test for the confirmation of Flavonoids
One ml of ten percent solution of lead acetate was mixed in 1ml of methanolic plant extract. The establishment of yellow precipitate showed the presence of flavonoids (Jabin & Nasreen, 2016).
3.6.2 Test for the confirmation of Terpenoids
Methanolic extract (2 ml) of given plant was added in 2 ml of chloroform and vaporized to desiccation. Then two ml of concentrated sulphuric acid was mixed and heated the solution for two minutes. Establishment of grayish color showed the existence of terpenods (Bargah, 2015).
3.6.3 Test for the confirmation of Alkaloids
Two ml of methanolic extract was mixed with 2 ml of concentrated hydrochloric acid on steam wash. Then few drops of Dragendroffs reagent were added. The formation of orange red precipitate indicated the presence of alkaloids (Bargah, 2015).
3.6.4 Test for the confirmation of Tannins
Two ml of excerpt was stimulated in 2 ml of dH2O and then few drops of FeCl3 solution were mixed. Occurrence of green swift was taken as positive test for tannins (Bargah, 2015).
3.6.5 Test for confirmation of Saponins
In a test tube 5 ml of distilled water and 5 ml of extract was shaken vigorously and heated. The formation of smooth foam was considered as a positive for saponins (Bargah, 2015).
3.6.6 Test for confirmation of Steroids
3.6.6.1 Liebermann Burchard test
Two ml of methanolic extract was dissolved in 2 ml of chloroform CHCl3 and treated with concentrated H2SO4 and CH3COOH. The formation of green color shows the existence of steroids (Bargah, 2015).
39
3.6.6.2 Salkowskis test
Methanolic extract (2ml) of given plant was mixed in 2 ml of CHCl3 and added 2 ml of concentrated H2SO4. A red color was formed in the lower CHCl3 layer that shows the existence of steroids (Bargah, 2015).
3.6.7 Test for confirmation of Phenols
In 5 ml of distilled water 500 mg of extract was dissolved. Then few drops of 5 % ferric chloride were added. The formation of green color shows the existence of phenols (Bargah, 2015).
3.7. Bioassay
3.7.1 Preparation of stock solution of selected plants
Stock solution was prepared by dissolving the plants extracts in dimethyl sulfoxide (DMSO). Five different concentrations i.e. 0.75% (0.75 mg extract was mixed in 2.25 ml dist. Water, then 0.075 ml of this solution is added in 9.925 DMSO), 1.5% (1.5 mg extract was mixed in 2.25 ml dist. Water, then 0.15 ml of this solution is added in 9.85 DMSO), 3.00% (3 mg of extract was mixed in 2.25 ml dist. Water, then 0.3 ml of this solution is added in 9.7 ml DMSO), 6.00% (6 mg of extract was mixed in 2.25 ml dist. Water, then 0.6 ml of this solution is added in 9.4ml DMSO)and 12.00% (12 mg of extract was mixed in 2.25 ml dist. Water, then 1.2 ml of this solution is added in 8.8ml DMSO)of each extract were prepared in distilled water.
3.7.2 Percent mortality
The livestock farms were examined for the infestation of ticks and from the infested buffaloes the adult ticks were separated for bioassays. All the plants extract were used against adult ticks in the laboratory using standardized adult immersion test (AIT) with slight modifications made by Gosh et al. (2015). Twenty tick species were immersed in 10 ml of respective concentration in beaker with the help of small forceps and each group was tested in replicate. Stirring the ticks with rod vigorously and after five minutes of immersion, the ticks were removed from the beaker and put into the test tube and cover all these treated ticks with the muslin cloth. Alive and dead ticks were counted after 24 hour (hr), 48 hr, 72 hr and 96 hrs. In control group, ticks were dipped in distilled water and checked for mortality after each time 40 interval of 24 hrs. The percentage mortality was observed after each time interval of 24 hrs and consecutively for four days.
41
3.7.3 Stock solution of selected acaricides
Acaricides cypermethrin (40% EC), emamectin (1.9% EC) and fiprnoil (5% SC) were purchased from local market (Faisalabad). Five different concentrations 0.25%, 0.50%, 1.00%, 2.00% and 4.00% were prepared in distilled water to determine the mortality of ticks. The solutions were homogenized by shaking.
3.7.4 Percent mortality
The number of twenty ticks was used in each group, and each group was tested in triplicate (giving a total of 20 individuals per group). Before the application of each test, the tick species were washed in a mesh with tap water and dehydrated on indulgent spongy paper. To check the mortality of selected acaricides i.e. cypermethrin, emamectin and fipronoil adult immersion test was used. The ticks were then randomly allotted to a treatment group and then immersed in beaker for 5 min that contained a preset concentration of each acaricide. In the control group ticks were dipped in distilled water only. After five minutes the ticks were removed from the respective concentration, then dry in absorbent paper and placed into recognized test tubes covered with muslin cloth. After four days the percent mortality of ticks was calculated, only those ticks were considered alive that were still capable of movement (Avinash et al., 2017).
3.8 DNA extraction
After identification of tick species on the bases of their morphological characters, the ticks were stored and divided on the basis of locality of collection and host. The ticks of same species and same host were placed together. Ticks from every species were individually used for the DNA extraction. Filter paper were used to dry the tick species and homogenized in 1.5 ml nontoxic ependorf then add 25µl proteinase K by using pasteurized pestle. The tubes incubated in T mix shaking incubator (EHRET) at 60C0 temperature for one hour. For proper mixing used adjustable speed RS-VA 10 vortexer (Bench Mixer). By using a commercial pure link mini kit (Invitrogen), the DNA was extracted by following kit protocol. Extracted DNA of ticks was kept at -20Co (Chen et al., 2014). The quality of extracted DNA was analyzed on agarose gel by electropherosis. Ethidium bromide has been used to see DNA in gel. Extracted DNA samples were loaded on 1% agarose gel and run for 60 minutes at 100 voltages. After one hour, gel was
42 examined under ultra violet light transilluminator and photographed using Syngene documentation system.
3.9 Using PCR for magnification of DNA of tick borne pathogens
To amplify the DNA of Theleria and Babesia and other for Ehrlichia and Anaplasma spp. two sets of PCR were performed. The total reaction volume for PCR was 25µl, which was formed by adding 9.2 µl d3H2O, 2.5 µl dNTPs, 2.5 ul Taq buffer, 2 ul MgCl2, 3 ul F primers, 3 ul R primers (working primer solutions were formed by adding 10ul from primers stock solution and 190 ul d3H2O) and at the end Taq DNA 0.3 ul was added. Then added 2.5 ul templates in 22.5 µl master mix. A PCR was performed for Theleria and Babesia; two cycles of denaturation (95 oC for 5 minutes and 2nd for 1 minute), annealing (57 oC for 40 s) and extention at (72 oC for fifteen second), followed by continuous two cycles with same situations of earlier cycle. The annealing temperature abridged until approached 58oC. An additional 35 cycles were completed during amplification process. All the conditions were the same, for Anaplasma and Ehrlichia, only the temperature of initial annealing was changed (95°C-98°C) by following the PCR. Negative and positive controls were used to check the results. A Thermal Cycler a C1000™ was used for amplification of DNA (Ependroff). To determine and analyze the PCR results, agarose gel electropherosis was performed. Agarose gels (1.5%) (WEALTEC Corp: mini GES) with ethidium bromide dye were used for visualization of amplicon, below Ultra Violet light by GeneSnap from SynGene version 7.12. For comparison of amplicon sizes, Gene Ruler (100-1000 bp) DNA molecule (Thermo Scientific™ Karlsruhe) was applied.
DNA amplification using specific primers
For each group (genus), individual PCR amplification reaction was carried out in 25 µl with 100 ng of DNA, 10 pmol of onward and reverse primer for every species, 1U Taq DNA polymerase, 2.5 mM MgCl2 & 200 µM of dNTPs. All amplification reactions were performed in a thermal cycler. Specific primers and PCR situations were given in the table 3.2. PCR products (10 µl) were loaded on agarose gel (1.5%), with DNA ladder electrophoresis was done at 120 V for one hour. Gel was stained with ethidium bromide and photographed (Barghash et al., 2016).
43
Table 3.2. Specific primer sequences, PCR situations and targeted size of tick borne pathogens.
Pathogens Primer order (5’-3’) PCR situation Product size (bp) Theileria F: ACTTTGGCCGTAATGTTAAAC 95°C for 5 min., 33 cycle at 94°C 312 annulata and for 30 sec., touchdown from R: CTCTGGACCAACTGTTTGG 62°C-50°C for 30 sec., 72°C for 30 (Bilgic et al., 2010) sec. and f. ext. at 72°C for 5 min. T. ovis F: TCGAGACCTTCGGGT 95°C for 5 min., 33 cycle at 94°C 520 and for 30 sec., touchdown from R: TCCGGACATTGTAAAACAAA 62°C-50°C for 30 sec., 72°C for 30 (Altay et al., 2008) sec. and f. ext. at 72°C for 5 min. T. orientalis F: CTTTTGCCTAGGATACTTCCT 95°C for 5 min., 33 cycle at 94°C 776 and for 30 sec., touchdown from R: ACGGCAAGTGGTGAGAACT 62°C-50°C for 30 sec., 72°C for 30 (Ota et al., 2009) sec. and f. ext. at 72°C for 5 min. Babesia F: TAGTTGTATTTCAGCCTCGCG 95°C for 3 min., 35 cycle at 94°C 639 bigemina and for 30 sec., 57°C for 30 sec., R: AACATCCAAGCAGCTAHTTAG 72°C for 30 sec. and f. ext. at 72°C (Ellis et al., 1992) for 6 min. B. bovis F: TTTGGTATTTGTCTTGGTCAT 95°C for 3 min., 35 cycle at 94°C 448 and for 30 sec., 57°C for 30 sec., R: ACCACTGTAGTCAAACTCACC 72°C for 30 sec. and f. ext. at 72°C (Chansiri & Bagnara, 1995) for 6 min. B. caballi F:CGACACCAAGGATTTATTCGAGAA 95°C for 3 min., 35 cycle at 94°C 539 and for 30 sec., 57°C for 30 sec., R: ATTCCAAAGATTCACCCACAGC 72°C for 30 sec. and f. ext. at 72°C (Guclu & Karaer, 2007) for 6 min. A. marginale F: GCTCTAGCAGGTTATGCGTC 95°C for 3 min., 35 cycle at 94°C 265 and for 30 sec., 57°C for 30 sec., R: CTGCTTGGGAGAATGCACCT 72°C for 30 sec. and f. ext. at 72°C (Bilgic et al., 2013) for 7 min. A. ovis F: TGAAGGGAGCGGGGTCATGGG 95°C for 3 min., 35 cycle at 94°C 347 and for 30 sec., 57°C for 30 sec., R: GGTAATTGCAGCCAGGGACTCT 72°C for 30 sec. and f. ext. at 72°C (Yousefi et al., 2017) for 7 min. A.Centrale F: CATAACTTTGTTGTTGTAAAGCCT 95°C for 3 min., 35 cycle at 94°C and for 30 sec., 57°C for 30 sec., 403 R: TTCCAGACCTTCCCTAACTA 72°C for 30 sec. and f. ext. at 72°C (Shkap et al., 2002) for 7 min Ehrlichia spp. F: GGTTTATGGTGCTTTTCCTAGTGTTGA 95°C for 3 min., 33 cycle at 94°C 480 R: for 30 sec., touchdown from TTACAGATTTCTCAGGAGTATATGCCTCC 64°C-50°C for 30 sec., 72°C for 30 (Qiu et al., 2016) sec. and f. ext. at 72°C for 5 min. E. spp. F: GGAATTCAGAGTTGGATCMTGGYTCAGR 95°C for 3 min., 33 cycle at 94°C Omatjenne biotin- R: for 30 sec., touchdown from CGGGATCCCGAGTTTGCCGGGACTTYTTCT 64°C-50°C for 30 sec., 72°C for 30 460 (Bilgic et al., 2017) sec. and f. ext. at 72°C for 5 min. Rickettsia F: GGGGGCCTGCTCACGGCGG and 95°C for 3 min., 33 cycle at 94°C 380 16S rRNA for 30 sec., touchdown from R: ATTGCAAAAAGTACAGTGAACA 64°C-50°C for 30 sec., 72°C for 30 (Regnery et al., 1991) sec. and f. ext. at 72°C for 5 min.
44
3.9 Statistical analysis
The prevalence of ticks and tick-borne pathogens was determined in all planned agro- ecological regions of Punjab, Pakistan by using logistic regressions and odd‟s ratio (OR) at 95% confidence intereval (CI). All statistical analysis was determined using SPSS software package (SPSS, 21). Analysis of variance technique was applied to find out the significant differences between zone animals and tick species. Comparison of means was done using Least Significant Difference (LSD) test at 5% level of significance. The percent mortality was analyzed by probit analysis (Abbott, 1925; Finney, 1971), using Minitab-17 statistical software for determining
LC50, LT50 and related parameters.
45
Chapter 4 RESULTS & DISCUSSION
4.1. Analytical Characteristics of the Population
A number of 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows) were observed from 120 livestock farms in four different agro-ecological zones (Southern, Western, Central and Northern) of Punjab, Pakistan differentiated by urban and rural locality. Ticks were collected, identified and analyzed for the presence of pathogens.
The research work was divided in to four steps 1. Prevalence of species of tick from the selected zones of Punjab, Pakistan 2. Identification of collected tick species on the basis of their physiological characters 3. Detection and identification of tick-borne pathogens by PCR analysis 4. Management of tick species with acaricides and medicinal plants extract
4.2 Tick Prevalence
From buffaloes, cows, goats and sheep ticks were collected during four seasons of the year. From each selected district of the regions of Punjab total 10 cattle farms (five urban and five rural) were randomly designated. During the present study the selected livestock farms were randomly examined for collection of ticks. All the cattle farms, regardless of their topographic site, were observed infested with one or multiple ticks species. The overall prevalence of tick- infested livestock was observed 36.52% (4382/12,000) as shown in table 4.1.
46
Table 4.1. Zone-wise ticks prevalence (%) from Punjab.
Zones Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%)
Lower limit Upper limit
Southern 3000 1090 36.33 1.135 1.020 1.262 0.020
Western 3000 1075 35.83 1.110 0.998 1.235 0.054
Central 3000 1213 40.43 1.349 1.215 1.499 0.000
Northern 3000 1004 33.47
(P<0.05) significant
The utmost prevalence (40.43%) was noticed from Central zone whereas lowest (33.47%) from Northern zone and data of prevalence for two other zones was displayed in 4.1 table. The highly significant (p<0.00) differences were noticed in Central zone whereas significant (p<0.05) differences in Southern zone and the non-significant (p>0.05) differences in Western zone.
Table 4.2. Animal-wise ticks prevalence (%) from Punjab.
Animal Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%)
Lower limit Upper limit
Buffalo 3200 1201 37.53 1.471 1.320 1.640 0.000
Cow 3200 1357 42.41 1.803 1.619 2.007 0.000
Goat 2800 1012 36.14 1.386 1.239 1.550 0.000
Sheep 2800 812 29.00
(P<0.05) significant
In the current research a number of 12,000 cattles i.e. 2800 goats, 2800 sheep 3200 buffaloes and 3200 cows were haphazardly observed for tick collection. From 12,000 cattles 4382/12,000 (36.52%) livestock were identified infestation with ticks. The ticks prevalence in buffaloes, cows, goats and sheep were observed (37.53, 42.41, 36.14 and 29.00%),
47 correspondingly as described in table 4.2. The highly significant (p<0.00) differences were showed in the prevalence of all animals. Table 4.3. Season-wise ticks prevalence (%) from Punjab.
Season Total Infected Prevalence Odds Confidence Interval 95% P-value (%) Ratio Lower limit Upper limit
Spring 3000 1239 41.30 2.936 2.614 3.297 0.000
Summer 3000 1676 55.87 5.282 4.704 5.930 0.000
Autumn 3000 887 29.57 1.752 1.554 1.974 0.000
Winter 3000 580 19.33
(P<0.05) significant
Table 4.3 revealed (prevalence %) season-wise for complete data. In this research the highest prevalence was noticed in Summer, (55.87%) followed by Spring (41.30%), Autumn (29.57) and lowest in Winter seasons (19.33%). The highly significant (p<0.00) differences were detected in the ticks prevalence in all several seasons.
Table 4.4. Animal-wise prevalence with respect to different seasons for Southern zone.
Season Animal Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%)
Lower limit Upper limit
Spring Buffalo 200 87 43.50 1.514 0.995 2.304 0.053
Cow 200 92 46.00 1.675 1.102 2.546 0.016
Goat 175 67 38.29 1.220 0.788 1.889 0.373
Sheep 175 59 33.71
Summer Buffalo 200 102 51.00 0.918 0.611 1.378 0.679
Cow 200 121 60.50 1.350 0.896 2.036 0.151
Goat 175 99 56.57 1.149 0.754 1.750 0.519
Sheep 175 93 53.14
48
Autumn Buffalo 200 57 28.50 1.224 0.772 1.941 0.391
Cow 200 73 36.50 1.765 1.127 2.764 0.013
Goat 175 47 26.86 1.127 0.698 1.821 0.625
Sheep 175 43 24.57
Winter Buffalo 200 37 18.50 0.977 0.580 1.644 0.929
Cow 200 41 20.50 1.110 0.666 1.850 0.690
Goat 175 39 22.29 1.234 0.734 2.075 0.428
Sheep 175 33 18.86
(P<0.05) significant
Table 4.4 showed the ticks prevalence in several seasons in Southern zone. The overall prevalence was highest during Summer season in all animals. The prevalence of tick species in buffaloes in this zone was highest in Summer season (51.00%) followed by Spring (43.50%), Autumn (28.50%) and Winter (18.50%). In this zone the prevalence of ticks in cows was highest in Summer season (60.50%) followed by Spring (46.00%), Autumn (36.50%) and was least in Winter (20.50%). In case of goats and sheep, the tick prevalence in this zone was maximum in Summer season (56.57 and 53.14%) followed by Spring (38.29 and 33.71%), Autumn season (26.86 and 24.57%) and Winter (22.29 and 18.86%) respectively. The prevalence of ticks showed highly significant (p<0.01) differences in Spring season in cows while non-significant (p>0.05) differences were showed in case of buffaloes and goats. In Winter season non- significant (p>0.05) differences in case of both buffaloes and goats whereas the highly significant (p<0.01) differences were showed in cows. Therefore, in Summer and Autumn seasons non-significant (p>0.05) differences were showed in all ruminants.
49
Table 4.5. Animal-wise prevalence with respect to different seasons for Western zone.
Season Animal Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 91 45.50 1.922 1.255 2.942 0.003 Spring Buffalo 200 97 48.50 2.168 1.417 3.317 0.000 Cow 175 77 44.00 1.809 1.166 2.807 0.008 Goat 175 53 30.29 Sheep 200 111 55.50 1.003 0.667 1.508 0.989 Summer Buffalo 200 127 63.50 1.399 0.924 2.117 0.112 Cow 175 88 50.29 0.813 0.534 1.238 0.335 Goat 175 97 55.43 Sheep 200 65 32.50 2.072 1.281 3.350 0.003 Autumn Buffalo 200 69 34.50 2.266 1.405 3.655 0.001 Cow 175 43 24.57 1.402 0.840 2.338 0.196 Goat 175 33 18.86 Sheep 200 37 18.50 1.362 0.783 2.370 0.274 Winter Buffalo 200 33 16.50 1.186 0.674 2.085 0.554 Cow 175 29 16.57 1.192 0.666 2.132 0.554 Goat 175 25 14.29 Sheep (P<0.05) significant
Overall highest tick prevalence was detected during Summer on all animals. The highest prevalence in buffaloes was observed during Summer (55.50%) while lowest in Winter (18.50%) seasons. In case of goats and sheep, the prevalence of ticks species in this zone was detected least in Winter season (16.57 and 14.29%) and highest in Summer season (50.29 and 55.43%), followed by Spring (44.00 and 30.29%) and Autumn season (24.57 and 18.86%), respectively. The prevalence of ticks showed in Summer and Winter seasons non-significant (p>0.05) differences were detected in all animals while highly significant (p<0.00) differences in Spring season in case of all observed animals. The ticks prevalence in Autumn season showed highly significant (p<0.00) differences in case of observed buffaloes and cows but non-significant (p>0.05) differences were showed in goats (table 4.5).
50
Table 4.6. Animal-wise prevalence with respect to different seasons for Central zone.
Season Animal Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 101 50.50 2.480 1.617 3.805 0.000 Spring Buffalo 200 109 54.50 2.912 1.897 4.471 0.000 Cow 175 81 46.29 2.095 1.348 3.257 0.001 Goat 175 51 29.14 Sheep 200 127 63.50 1.606 1.062 2.428 0.025 Summer Buffalo 200 131 65.50 1.753 1.156 2.656 0.008 Cow 175 101 57.71 1.260 0.826 1.921 0.283 Goat 175 91 52.00 Sheep 200 73 36.50 2.004 1.268 3.168 0.003 Autumn Buffalo 200 81 40.50 2.374 1.507 3.739 0.000 Cow 175 66 37.71 2.112 1.321 3.376 0.002 Goat 175 39 22.29 Sheep 200 45 22.50 1.349 0.809 2.247 0.251 Winter Buffalo 200 49 24.50 1.507 0.910 2.496 0.111 Cow 175 37 21.14 1.245 0.732 2.119 0.418 Goat 175 31 17.71 Sheep (P<0.05) significant
The overall tick prevalence in buffaloes and cows in this zone was detected maximum in Summer season (63.50% and 65.50%) followed by Spring (50.50% and 54.50%), Autumn (36.50% and 40.50%) and was least in Winter (22.50% and 24.50%). In this zone the prevalence of ticks in goats was noted highest in Summer season (57.71%) followed by Spring (46.29%), Autumn (37.71%) and was least in Winter (24.50%). In case of sheep the tick species prevalence in this zone was observed maximum in Summer season (52.00%) and was least in Winter season (17.71%), respectively. The prevalence of ticks in Central zone non-significant (p>0.05) differences were noticed in Winter seasons in all observed animals while in Spring and Autumn season highly significant (p<0.00) differences were noticed in all examined animals as shown in table 4.6.
51
Table 4.7. Animal-wise prevalence with respect to different seasons for Northern zone.
Season Animal Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 75 37.50 1.543 0.997 2.388 0.052 Spring Buffalo 200 87 43.50 1.980 1.285 3.051 0.002 Cow 175 63 36.00 1.446 0.921 2.273 0.109 Goat 175 49 28.00 Sheep 200 109 54.50 1.674 1.111 2.521 0.014 Summer Buffalo 200 117 58.50 1.970 1.305 2.973 0.001 Cow 175 89 50.86 1.446 0.948 2.205 0.087 Goat 175 73 41.71 Sheep 200 53 26.50 2.383 1.389 4.086 0.002 Autumn Buffalo 200 73 36.50 3.799 2.248 6.419 0.000 Cow 175 49 28.00 2.570 1.485 4.449 0.001 Goat 175 23 13.14 Sheep 200 31 15.50 1.506 0.817 2.775 0.189 Winter Buffalo 200 57 28.50 3.273 1.857 5.768 0.000 Cow 175 37 21.14 2.201 1.210 4.006 0.010 Goat 175 19 10.86 Sheep (P<0.05) significant
For the ticks prevalence in Spring season, highly significant (p<0.00) differences in cows and significant (p>0.05) differences were observed in buffaloes. In case of goats in Spring season non-significant (p>0.05) differences were found. In Summer and Autumn the highly significant (p<0.00) differences were noticed in all animals except goats the non-significant (p>0.05) differences were noticed in Summer season. In winter season the non-significant (p>0.05) differences were observed in buffaloes while the highly significant (p<0.00) differences were recorded in case of cows and goats table 4.7. The overall prevalence of tick species in buffaloes in this zone was observed maximum in Summer season (54.50%) followed by Spring (37.50%), in Autumn (26.50%) and was least in Winter (15.50%). In this zone the prevalence of ticks in cows was highest in Summer season (58.50%) as shown in table 4.7.
52
Table 4.8. Area-wise prevalence with respect to different Animals for Spring season.
Animal Zone Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 87 43.50 1.283 0.860 1.915 0.222 Buffalo Southern 200 91 45.50 1.391 0.933 2.074 0.105 Western 200 101 50.50 1.700 1.142 2.533 0.009 Central 200 75 37.50 Northern 200 92 46.00 1.106 0.746 1.641 0.615 Cow Southern 200 97 48.50 1.223 0.825 1.813 0.316 Western 200 109 54.50 1.556 1.049 2.308 0.028 Central 200 87 43.50 Northern 175 67 38.29 1.103 0.715 1.702 0.658 Goat Southern 175 77 44.00 1.397 0.909 2.146 0.127 Western 175 81 46.29 1.532 0.998 2.351 0.051 Central 175 63 36.00 Northern 175 59 33.71 1.308 0.830 2.062 0.248 Sheep Southern 175 53 30.29 1.117 0.704 1.772 0.638 Western 175 51 29.14 1.058 0.665 1.682 0.813 Central 175 49 28.00 Northern (P<0.05) significant
Table 4.8 shows the prevalence of tick in buffaloes from Southern, Western, Central and Northern zones were 43.50%, 45.50%, 50.50% and 37.50%, respectively. In case of buffaloes non-significant (p>0.05) differences were noted in Southern, Western and Northern zones while the highly significant (p<0.00) differences in Central zone. In case of cows the ticks prevalence in Southern, Western, Central and Northern zones were observed (46.00, 48.50, 54.50 and 43.50%), respectively. In cows the non-significant (p>0.05) differences were observed in Southern, Western and Northern zones whereas the significant (p<0.05) differences were recorded in Central zone. The tick prevalence in case of goats and sheep were observed (38.29 and 33.71%), (44.00% and 30.29%), (46.29% and 29.14%), (36.00% and 28.00%), respectively in Southern, Western, Central and Northern zones.
53
Table 4.9. Zone-wise prevalence with respect to different animals for Summer season.
Animal Zone Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 102 51.00 0.869 0.587 1.287 0.483 Buffalo Southern 200 111 55.50 1.041 0.702 1.544 0.841 Western 200 127 63.50 1.452 0.973 2.168 0.068 Central 200 109 54.50 Northern 200 121 60.50 1.087 0.729 1.620 0.684 Cow Southern 200 127 63.50 1.234 0.825 1.846 0.306 Western 200 131 65.50 1.347 0.898 2.020 0.150 Central 200 117 58.50 Northern 175 99 56.57 1.259 0.826 1.918 0.284 Goat Southern 175 88 50.29 0.977 0.643 1.486 0.915 Western 175 101 57.71 1.319 0.865 2.011 0.198 Central 175 89 50.86 Northern 175 93 53.14 1.585 1.039 2.418 0.033 Sheep Southern 175 97 55.43 1.738 1.138 2.653 0.011 Western 175 91 52.00 1.514 0.992 2.309 0.054 Central 175 73 41.71 Northern (P<0.05) significant
In case of sheep significant (p<0.05) differences were recorded in Southern, Central, Western and Northern zones whereas in buffaloes, cows and goats the non-significant (p>0.05) differences were detected in Southern, Central, Western and Northern zones. Moreover, the prevalence of ticks in buffaloes and cows in Southern (51.00 and 60.50%), Western (55.50 and 63.50%), Central (63.50% and 65.50%) and Northern zones (54.50 and 58.50%) were observed, respectively. Therefore, in goats the ticks prevalence in Southern, Western, Central and Northern zones were observed (56.57, 50.29, 57.71 and 50.86%), respectively. Ticks prevalence of in case of sheep in Southern, Western, Central and Northern zones was observed (53.14, 55.43, 52.00 and 41.71%) respectively as showed in table 4.9.
54
Table 4.10. Zone-wise prevalence with respect to different animals for Autumn season.
Animal Zone Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 57 28.50 1.106 0.713 1.715 0.654 Buffalo Southern 200 65 32.50 1.335 0.867 2.056 0.189 Western 200 73 36.50 1.594 1.041 2.441 0.032 Central 200 53 26.50 Northern 200 73 36.50 1.000 0.666 1.502 1.000 Cow Southern 200 69 34.50 0.916 0.608 1.380 0.676 Western 200 81 40.50 1.184 0.791 1.772 0.411 Central 200 73 36.50 Northern 175 47 26.86 0.944 0.590 1.510 0.811 Goat Southern 175 43 24.57 0.838 0.520 1.349 0.466 Western 175 66 37.71 1.557 0.993 2.441 0.054 Central 175 49 28.00 Northern 175 43 24.57 2.153 1.233 3.759 0.007 Sheep Southern 175 33 18.86 1.536 0.860 2.742 0.147 Western 175 39 22.29 1.895 1.077 3.334 0.027 Central 175 23 13.14 Northern (P<0.05) significant (p>0.05) non-significant differences
For prevalence of ticks in buffaloes, the significant (p<0.05) differences in Central zone while the non-significant (p>0.05) differences were observed in Southern and Western zones. In Central zone significant (p<0.05) differences in goats however in Southern and Western zone non-significant (p>0.05) differences were observed. Ticks prevalence in buffaloes and cow in Southern (28.50 and 36.50%), Western (32.50 and 34.50%), Central (36.50 and 40.50%) and Northern zones (26.50 and 36.50%) were observed respectively. Moreover, in goats the ticks prevalence in Southern, Western, Central and Northern zones were found (26.86%, 24.57%, 37.71% and 28.00%), respectively as showed in table 4.10.
55
Table 4.11. Zone-wise prevalence with respect to different Animals for Winter season.
Animal Zone Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit 200 37 18.50 1.237 0.733 2.089 0.425 Buffalo Southern 200 37 18.50 1.237 0.733 2.089 0.425 Western 200 45 22.50 1.583 0.954 2.627 0.076 Central 200 31 15.50 Northern 200 41 20.50 0.647 0.408 1.025 0.064 Cow Southern 200 33 16.50 0.496 0.306 0.804 0.004 Western 200 49 24.50 0.814 0.522 1.271 0.365 Central 200 57 28.50 Northern 175 39 22.29 1.070 0.643 1.778 0.795 Goat Southern 175 29 16.57 0.741 0.432 1.270 0.275 Western 175 37 21.14 1.000 0.599 1.671 1.000 Central 175 37 21.14 Northern 175 33 18.86 1.908 1.038 3.506 0.037 Sheep Southern 175 25 14.29 1.368 0.724 2.588 0.335 Western 175 31 17.71 1.768 0.956 3.267 0.069 Central 175 19 10.86 Northern (P<0.05) significant
Highly significant (p<0.00) differences were recorded in Western zone in cows while non-significant (p>0.05) differences were detected in Southern, Central, Western and Northern zones for tick prevalence in buffaloes and non-significant (p>0.05) differences were observed in Southern and Central zones. In goats, non-significant (p>0.05) differences were recorded in all Southern, Central, Western and Northern zones. Significant (p<0.05) differences in Southern zone while non-significant (p>0.05) in Western and Central zones were observed in sheep. In buffaloes, the prevalence of ticks in Southern and Western zones were recorded (18.50%), in Central and Northern zones (22.50 and 15.50%), respectively. In case of cows, 20.50, 16.50, 24.50 and 28.50% ticks were observed in different zones as showed in table 4.11.
56
Table 4.12. Season-wise prevalence with respect to different zones for buffaloes.
Zone Season Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit
Southern Spring 200 87 43.50 3.392 2.155 5.337 0.000
Summer 200 102 51.00 4.585 2.918 7.205 0.000
Autumn 200 57 28.50 1.756 1.097 2.812 0.019
Winter 200 37 18.50
Western Spring 200 91 45.50 3.678 2.339 5.783 0.000
Summer 200 111 55.50 5.494 3.493 8.642 0.000
Autumn 200 65 32.50 2.121 1.334 3.372 0.001
Winter 200 37 18.50
Central Spring 200 101 50.50 3.514 2.280 5.415 0.000
Summer 200 127 63.50 5.992 3.862 9.298 0.000
Autumn 200 73 36.50 1.980 1.276 3.072 0.002
Winter 200 45 22.50
Northern Spring 200 75 37.50 3.271 2.028 5.276 0.000
Summer 200 109 54.50 6.530 4.067 10.483 0.000
Autumn 200 53 26.50 1.966 1.198 3.225 0.007
Winter 200 31 15.50
(P<0.05) significant
The highest prevalence was detected in Central zone (63.5%) during Summer season and lowest in Northern zone (15.50%) during Winter season as showed in table 4.12. The ticks prevalence in buffaloes in all seasons and zones were observed highly significant (p<0.00).
57
Table 4.13. Season-wise prevalence with respect to different zones for cows.
Zones Season Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit
200 92 46.00 3.304 2.124 5.139 0.000 Southern Spring
200 121 60.50 5.940 3.805 9.271 0.000 Summer
200 73 36.50 2.229 1.424 3.489 0.000 Autumn 200 41 20.50 Winter
200 97 48.50 4.766 2.993 7.588 0.000 Western Spring
200 127 63.50 8.804 5.494 14.107 0.000 Summer
200 69 34.50 2.666 1.660 4.281 0.000 Autumn
200 33 16.50 Winter
200 109 54.50 3.691 2.411 5.650 0.000 Central Spring 200 131 65.50 5.851 3.789 9.035 0.000 Summer 200 81 40.50 2.098 1.367 3.219 0.001 Autumn
200 49 24.50 Winter
200 87 43.50 1.932 1.275 2.926 0.002 Northern Spring 200 117 58.50 3.536 2.332 5.363 0.000 Summer 200 73 36.50 1.442 0.947 2.197 0.088 Autumn 200 57 28.50 Winter
(P<0.05) significant
Table 4.13 showed the highest prevalence was observed in Central zone (65.50%) during Summer season and lowest in Western zone (16.50%) during Winter season. Moreover, the prevalence of ticks in cows in all seasons Spring, Summer, Winter and Autumn and in zones including Southern, Central and Western were observed highly significant (p<0.00) except Northern zone in Autumn season non-significant (p>0.05) differences were detected.
58
Table 4.14. Season-wise prevalence with respect to different zones for goats.
Zone Season Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit
Southern Spring 175 67 38.29 2.163 1.354 3.457 0.001
Summer 175 99 56.57 4.543 2.854 7.231 0.000
Autumn 175 47 26.86 1.280 0.786 2.087 0.321
Winter 175 39 22.29
Western Spring 175 77 44.00 3.956 2.404 6.508 0.000
Summer 175 88 50.29 5.092 3.099 8.367 0.000
Autumn 175 43 24.57 1.640 0.969 2.777 0.066
Winter 175 29 16.57
Central Spring 175 81 46.29 3.214 2.011 5.137 0.000
Summer 175 101 57.71 5.091 3.179 8.151 0.000
Autumn 175 66 37.71 2.258 1.405 3.630 0.001
Winter 175 37 21.14
Northern Spring 175 63 36.00 2.098 1.303 3.378 0.002
Summer 175 89 50.86 3.860 2.416 6.166 0.000
Autumn 175 49 28.00 1.450 0.888 2.369 0.137
Winter 175 37 21.14
(P<0.05) significant The highest prevalence was detected in Central zone (57.71%) during Summer season and lowest in Western zone (16.57%) during Winter season as showed in table 4.14. Moreover, the ticks prevalence in goats highly significant (p<0.00) differences were detected in Southern, Central, Western and Northern zones with respect to Spring and Summer seasons whereas in Autumn season in Southern, Western and Northern zones non-significant (p>0.05) differences were noted.
59
Table 4.15. Season-wise prevalence with respect to different zones for sheep.
Zone Season Total Infected Prevalence Odds Ratio Confidence Interval 95% P-value (%) Lower limit Upper limit
Southern Spring 175 59 33.71 2.189 1.339 3.578 0.002
Summer 175 93 53.14 4.880 3.016 7.897 0.000
Autumn 175 43 24.57 1.402 0.840 2.338 0.196
Winter 175 33 18.86
Western Spring 175 53 30.29 2.607 1.531 4.438 0.000
Summer 175 97 55.43 7.462 4.446 12.523 0.000
Autumn 175 33 18.86 1.394 0.790 2.461 0.251
Winter 175 25 14.29
Central Spring 175 51 29.14 1.911 1.151 3.172 0.012
Summer 175 91 52.00 5.032 3.088 8.201 0.000
Autumn 175 39 22.29 1.332 0.787 2.255 0.286
Winter 175 31 17.71
Northern Spring 175 49 28.00 3.193 1.789 5.699 0.000
Summer 175 73 41.71 5.876 3.346 10.319 0.000
Autumn 175 23 13.14 1.242 0.650 2.374 0.511
Winter 175 19 10.86
(P<0.05) significant
The prevalence of ticks in goats highly significant (p<0.00) differences were noted during Spring and Summer in all zones whereas during Autumn season from all zones non-significant (p>0.05) differences were detected. The highest prevalence was observed in Western zone (55.43%) during Summer season and lowest in Northern zone (10.86%) during Winter season as shown in table 4.15.
60
4.3 Identification of tick species
Livestocks containing sheep, goats, buffaloes and cows were detected infected with several ticks species, from four agro ecologic regions of Punjab. From four genera (Hylomma, Rhiciphalus, Boophilus and Argas) ten species were identified. Identified species from the selected regions from Punjab, Pakistan were Hy. anatolicum (Koch, 1844), Hy. dromedarii (Koch, 1844), Hy. truncatum (Koch, 1844), Hy. marginatum (Koch, 1844) Hy. rufipes (Koch, 1844), Rh. (Boophilus) microplus (Canestrini, 1888), Boophilus decoloratus (Koch, 1844), Rh. appendiculatus (Neuman, 1901), Rh. sanguineus (Latreille, 1806), and Argas percicus (Oken, 1818). In the all four zones Hy. anatolicum was the most common tick species, while the second common tick species was Hy. marginatum in all the zone in ruminants except sheep. Hy. dromedarii were present in the Southern, Central and Western except Northern zone. Hy. truncatum and Hy. rufipes not present in Southern, Central and Northern zones but were existing only in Western zone of Punjab, Pakistan. Rh. sanguineus and Rh. appendiculatus both were existing in three zones but in Northern zone only Rh. sanguineus was found while Rh. appendiculatus was not observed. Both species Boophilus decoloratus, Boophilus microplus were observed in all three zones while Boophilus microplus was present in other zone but Boophilus decoloratus was not observed in Northern zones. Argas percicus was not detected in all three regions except Central region. The chracters on the basis of which identification was made of ticks of different genera are followings. Hylomma
Mouth parts elongated, 2nd segments of palps elongate Scutum light to dark brown Eyes present and convex Hooped legs Coxae of first pair of legs with long, protruding posteriorly directed spurs Boophilus
Mouth parts very short Eyes present but not visible
61
Conscutum frequently so poorly sclerotized that the dark pattern of caeca can be seen from above Rhipicephalus
Mouth parts short to medium length Scutum usually uniformally brown Eyes present Coxae of first pair of legs with long, protruding posteriorly directed spurs Argas
Mouth parts are small, ventral and not evident from above . They comprise a Central toothed hypostome and a pair of pulps. Camerstomal fold is unclear. On dorsal side of the body the various symmetrically organized discs are present. The lateral side sharp by row of quadrangular cells on both dorsal and ventral sides.
SSD ISG GO CS LMP
DS GG
PBL AG S
AO
Dorsal view Ventral view Figure 3. Dorsal view of Hy. dromedarii (female) which representing ISG (Irregular Scapular Grooves), DS (Dark Scutum), PBL (Pale Banded Legs), SSP (Sparse Spot Distribution), CS (Curved Scutum). Ventral view representing SL (Spurs on first pair of legs), GO (Genital Orifice), AG (Anal Groove), LMP (Long Mouth Part), GG (Genital Groove), S (Spiracle), AO (Anal Orifice).
62
DS LM CS DS
BL S GAS BL A A CD AP
Dorsal view Ventral view 1 Figure 4. Dorsal view of Hy. truncatum (female) representing the LM (Long Mouth Part), DS 2 (Dark Scutum), CS (Curved Scutum), BL (Banded Legs), and CD (Caudal Depression). Ventral view representing the GAS (Genital Aperture Semicircular), A (anus) and AP (Adnal Plates).
LM DS VSGA CS
BL A
DF DSS AG
Dorsal view Ventral view Figure 5. dorsal view Hy. rufipes representing DS (Dark Scutum), BL (Banded Legs), LM (Long Mouth),CS ( Curved Scutum), DSS (Dark Setae on Spiracle) and DF (Dark Festoons) and ventral view representing the VSGA (V Shape Genital Aperture), A (anus), AG (Anal Groove).
63
LMP PA
E GA CS BL
SP
F AA APSE
Dorsal view Ventral view Figure 6. Dorsal view of Hy. marginatum representing the PA (Porose Area), E (Eyes Present), BL (Banded Legs), LMP (Long Mouth Part), CS (Curved Scutumn), F (Festoons Present) and ventral view representing the GA (Genital Aperture), SP (Spiracular Plate), AA (Anus Aperture) and APSE ( Adnal Plates Square Ends).
E
GA
LG CG A RAP SSAP PP
Dorsal view Ventral view
Figure 7. Hylomma annatolicum dorsal view representing the E (Eyes Present), CG (Cervical Grooves), LG (Lateral Grooves), PP (Pale Parma) and ventral view representing the GA (Genital Aperture), A (Anus), RAP (Rounded Adnal Plates) and SSAP (Small Sub Anal Plates).
64
SMP
GO
SC A CA
Dorsal view Ventral view Figure 8. Dorsal view of Rhipicephalus appendiculatus representing SMP (Short Mouth Parts), SC (Sclerotized Conscutum) and ventral view representing CA (Caudal Appendages), GO (Genital Orifice) and A(Anus).
SC BPA GA
GG
MG AO
CG AP CP
Dorsal view Ventral view Figure 9. Dorsal view of Rhipicephalus sanguineus representing SC (Sharp Capituli), CG (Caudal Grooves), BPA (Broad Prose Areas), MG (Marginal Grooves) and ventral view representing GA (Genital Aperture), AO (Anal Opening), GG (Genital Grooves), AP (Adnal Plates) and CP (Caudal Process).
65
SM
E DC GA
GG
AG
CA
Dorsal view Ventral view Figure 10. Boophilus microplus dorsal view representing SM (Short Mouth), E (Eyes Present), DC (Dark Conscutum), CA (Caudal Appendages) and ventral view representing the GG (Genital Grooves), GA (Genital Aperture), AG (Anal Groove).
SM
CG
SP MG LAP
AO
Dorsal view Ventral view Figure 11. Boophilus decoloratus dorsal view representing SM (Short Mouth), CG (Cervical Groove), MG (Maiden Groove) and ventral view representing LAP (Long Adnal Plates), SP (Spiracle Plates), AO (Anal Orifice).
66
Dorsal view Ventral view
Figure 12. Dorsal view of Argas percicus representing Soft tick belonging to family Argasidae Oval shape, Mouth are present on ventral side, Leathry integument, Eyes absent and on dorsal side of the body various symmetrical arranged discs are prese and vental view representing ventraly small mouth parts, Genital orifice, Anus
67
Table 4.16. Prevalence of identified tick species in different farm animals in Southern zone Punjab, Pakistan. Buffaloes Cows Goats Sheep NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC Tick species Ticks species 800/283/1265 800/327/1690 700/252/1375 700/228/790 (%)
Hy. anatolicum 265 534 376 215 27.14
Hy. marginatum 196 432 324 0 18.59
Hy. dromeddari 210 0 144 0 6.91
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. sanguineus 234 256 154 153 15.56
Rh. appendiculatus 170 237 190 0 11.66
B. microplus 125 155 187 243 13.86
B. decolaratus 65 76 0 179 6.25 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
In case of Southern zone, the most common tick species was Hy. anatolicum (27.14%) followed by Hy. marginatum (18.59%) while the least was B. decolaratus (6.25%) as shown in the table 4.16. Hy. trunctaum, and Hy. rufipes were not found in this zone. Hy. marginatum, Hy. dromedarii were not found on sheep in this zone.
68
Table 4.17. Prevalence of identified tick species in different farm animals in Western zone Punjab, Pakistan. Ticks species Buffaloes Cows Goats Sheep Tick NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC species 800/304/1685 800/326/3005 700/237/2680 700/208/1312 (%)
Hy. anatolicum 356 678 687 381 24.21
Hy. marginatum 234 329 346 0 10.46
Hy. dromedarii 0 155 312 0 5.37
Hy. trunctaum 178 354 0 0 6.12
Hy. rufipes 193 198 0 0 4.5
Rh. Sanguineus 256 554 467 354 18.78
Rh.appendiculatus 237 473 394 189 14.89
B. microplus 155 155 336 265 10.49
B. decolaratus 76 109 138 123 5.13
NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
The highest prevalence of Hy. anatolicum (24.21%) followed by Rh. sanguineus (18.78%), Rh. appendiculatus (14.89%) and the least was Hy. rufipes (4.5%) as shown in table 4.16. Hy. trunctaum, Hy. marginatum, Hy. dromedarii and Hy. rufipes were not found in sheep in this zone. Hy. trunctaum and Hy. rufipes were not found in case of goats in this zone.
69
Table 4.18. Prevalence of recognized tick species in several farm animals in Central zone Punjab, Pakistan. Ticks species Buffaloes Cows Goats Sheep Tick NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC species 800/364/1265 800/370/1690 700/285/1475 700/212/790 (%)
Hy. anatolicum 356 478 158 149 21.85
Hy. marginatum 232 229 123 0 11.18
Hy. dromedarii 123 155 123 0 7.68
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. Sanguineus 178 215 234 154 14.96
Rh. appendiculatus 219 172 254 159 15.4
B. microplus 155 155 236 165 13.62
B. decolaratus 0 54 138 163 6.8
Argas percicus 0 232 209 0 8.45
NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
The highest prevalence of Hy. anatolicum (21.85%) followed by Rh. appendiculatus (15.4%) and Rh. sanguineus (14.96%) and the least was B. decolaratus (6.8%) as shown in table 4.18. Hy. trunctaum, Hy. marginatum, Hy. dromedarii, Hy. rufipes and Argus percicus were not found in sheep in this zone.
70
Table 4.19. Prevalence of recognized tick species in several farm animals in Northern zone Punjab, Pakistan. Ticks species Buffaloes Cows Goats Sheep Tick NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC NAE/NAI/NTC species 800/268/702 800/334/925 700/238/659 700/164/430 (%)
Hy. anatolicum 206 378 237 181 36.89
Hy. marginatum 210 229 171 0 22.46
Hy. dromedarii 0 0 0 0 0
Hy. trunctaum 0 0 0 0 0
Hy. rufipes 0 0 0 0 0
Rh. Sanguineus 131 126 0 84 12.55
Rh. appendiculatus 0 0 0 0 0 B. microplus 155 192 251 165 28.09 NAE= Number of animals examined, NAI= Number of animals infested, NTC= Number of ticks collected
Table 4.19 showed the prevalence of recognized species of ticks in several farm ruminants in Northern zone Punjab, Pakistan. Even a single tick of Hy. dromedarii, Hy. trunctaum, Hy. rufipes and Rh. appendiculatus were not recorded from the animals of Northern zone. The highest prevalence of Hy. anatolicum (36.89%) and Hy. marginatum (22.46%) were detected from Northern zone.
Table 4.20. Analysis of variance for comparison of means.
Source of variation Degrees of Sum of squares Mean squares F-value freedom Animal 3 244981 81660 9.76** Zones 3 452267 161828 19.35** Species 9 1434041 159338 19.05** Error 128 1070741 8365 Total 143 3202030
** = Highly significant (P<0.01) Table 4.20 showed the highly significant diffrences in between all ticks species which were collected from the studied agroecological zones on different animals.
71
Table 4.21. Means betwwen animals, zones and tick species
Animal Mean SD SE Buffaloes 136.53 B 108.79 18.13 Cows 203.06 A 182.96 30.49 Goats 171.92 AB 163.31 27.22 Sheep 92.28 C 111.84 18.64 Zone
Southern 142.22 B 138.77 23.13 Western 241.17 A 186.47 31.08 Central 130.45 B 113.01 17.87 Northern 84.88 C 107.87 19.07 Species
Argas percicus 110.25 BC 127.65 63.83 B. decolaratus 93.42 C 58.53 16.90 B. microplus 193.44 B 56.71 14.18 Hy. anatolicum 352.19 A 171.00 42.75 Hy. dromeddari 76.38 C 99.05 24.76 Hy. marginatum 190.94 B 135.79 33.95 Hy. rufipes 24.44 C 66.78 16.70 Hy. trunctam 33.25 C 96.37 24.09 Rh. Appendiculatus 168.38 B 142.77 35.69 Rh. Sanguineus 221.88 B 139.54 34.89 Means sharing similar letter are statistically non-significant (P>0.05).
Table 4.21 showed the comparison of means of animals, zones and tick species. In case of animals, the highest numbers of tick species were found from cows followed by buffaloes, goats and sheep. While in case of zones the highest number of tick species were observed in Western zone. The most commonly found tick species was Hy. anatolicum and least tick species was Hy. rufipes.
72
4.4. Selection of ticks for tick-borne pathogens
Through PCR assay, 675 samples (Southern zone 271, Western zone 98, Central zone 186 and Northern 120) were screened for the existing of DNA TBPs i.e. Theileria, Babesia, Anaplasma, and Ehrlichia species.
Table 4.22. Complete prevalence of tick-borne pathogens in agro-ecologic zones of Punjab, Pakistan. AEZ NPP/NPT Theileria Babesia Anaplasma Ehrlichia Prevalence 95% spp. spp. spp. spp. (%) Confidence Interval Southern 113/271 26 8 16 63 41.69% 35.76-47.82
Western 34/98 13 6 9 6 34.69% 25.36-44.98
Central 67/186 13 8 22 24 36.02% 29.13-43.37
Northern 45/120 9 6 15 15 37.5% 28.83-46.80
Total 259/675 61 (9.0%) 28 (4.1%) 62 (9.1%) 108 (16%) 38.37% 34.68-42.16 NPP= No of poles positive, NPT= No of poles tested. Fisher’s exact test shown significant difference among four agro-ecologic zones.
The prevalence of overall evaluations of TBPs in all agro-ecologic zones was significantly different. Highest prevalence was found of Ehrlichia spp (16%) followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%) as showed in table 4.22.
73
Table 4.23. The complete prevalence of TBPs in Southern, Western, Central and Northern zones.
AEZ Name of species NPP/NPT Theileria Babesia Anaplasma Ehrlichia Prevalence (95% CI) spp. spp. spp. spp. Southern 113/271 26 8 16 63 41.69%, 35.76-47.82
Hy.anatolicum 95/201 23 5 12 55
Hy .marginatum 0/5 0 0 0 0
Hy. dromedarii 5/18 1 0 1 3
Rh. Sanguineus 3/11 0 1 2 0
Rh. appendiculatus 0/3 0 0 0 0
B. microplus 9/29 2 1 1 5
B. decolaratus ¼ 0 1 0 0
Western 34/98 13 6 9 6 34.69%, 25.36-44.98
Hy. anatolicum 14/37 7 2 5 0
Hy. marginatum 2/10 1 1 0 0
Hy. dromedarii 4/12 0 0 1 3
Rh. Sanguineus 5/14 2 1 2 0
Rh. appendiculatus 1/3 1 0 0 0
B. microplus 7/15 2 1 1 3
B. decolaratus 1/7 0 1 0 0
Central 67/186 13 8 22 24 36.02%, 29.13-43.37 Hy.anatolicum 24/79 4 3 2 15
Hy.marginatum 0/3 0 0 0 0
Hy. dromedarii 1/6 1 0 0 0
Rh. Sanguineus 1/5 1 0 0 0
Rh. appendiculatus 0/4 0 0 0 0
B. microplus 41/87 7 5 20 9
B. decolaratus 0/6 0 0 0 0
Northern 45/120 9 6 15 15 37.5%, 28.83-46.80 Hy.anatolicum 14/29 2 2 1 9
74
Hy.marginatum 0/2 0 0 0 0
Hy. dromedarii 1/3 0 1 0 0
Rh. Sanguineus 1/5 0 0 1 0
Rh. appendiculatus 0/4 0 0 0 0
B. microplus 29/73 7 3 13 6
B. decolaratus 0/4 0 0 0 0
Total 259/675 61 28 62 108 38.37%, 34.68-42.16 AEZ= Agro ecological zone, NPP= Number of poles positive, NPT= Number of poles tested
The overall infection ratio of (i.e. the infected tick pools proportion) TBPs (Table 4.23) was maximum in Hy. anatolicum (43.10%), followed by B. microplus (42.15%), Rh. Sanguineus (28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B. decolaratus (9.5%) and Rh. appendiculatus (7.15%). In the Southern zone, the percentage of infected ticks was maximum in Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh. sanguineus (27.27%) and B. decolaratus (2.5%), however in the Western zone, B. microplus ticks were found more frequently infected (46.67%) followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%), Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus (14.28%). In the Central zone, the percentage of infected ticks was maximum in B. microplus (47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii (16.67%), however in the Northern zone, Hy. anatolicum ticks were observed more frequently infected (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh. sanguineus (20%).
Hy. dromedarii ticks were mostly infested with Ehrlichia spp. (15.38%), followed by Theileria (5.12%), Anaplasma (5.12%) and Babesia spp. (2.51%). Ticks Hy. anatolicum were mostly infested with Ehrlichia spp. (23.16%), followed by Theileria (10.55%), Anaplasma (5.86%) and Babesia spp. (3.51%), however Hy. marginatum were similar infested with Theileria and Anaplasma (5%). Rh. sanguineus was infested with Theileria (8.57%) followed by Babesia spp. (5.71%) and Anaplasma (4.28%) whereas Rh. appendiculatus was only infested with Theleria spp. (7.14%). Ticks B. microplus were mostly infested with Anaplasma spp. (17.15%), followed by Ehrlichia (11.27%), Theileria (8.8%) and Babesia spp. (4.9%) whereas B. decolaratus ticks were only infested with Babesia spp (9.52%). Hy. dromedarii ticks were infected with Ehrlichia (33.3%) and Anaplasma spp. (11.1%). But Hy. marginatum, and Rh.
75 appendiculatus and B. decolaratus ticks were not found infested with Anaplasma and Ehrlichia spp. Complete prevalence of TBPs in agro-ecologic zones of Punjab, Pakistan. In the Southern zone, the percentage of infested ticks was maximum in Hy. anatolicum (47.26%) followed by Boophilus (B.) microplus (31.03%), Rh. sanguineus (27.27%) and B. decolaratus (2.5%), however in the Western zone, B. microplus ticks were found more frequently infested (46.67%) followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%), Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus (14.28%). The ticks of Southern zone were mostly infested with Ehrlichia spp. (23.24%) followed by Theileria spp. (9.59%), Anaplasma spp. (5.90%) and Babesia spp. (2.95%). The complete prevalence of TBPs in the Southern zone at 95% confidence interval was recorded 41.69% (35.76-47.82). %). The ticks of Western zone were mainly infested with followed by Theileria spp. (13.26%), Anaplasma spp. (9.18%), Ehrlichia spp. (6.12%) and Babesia spp. (6.12%). The complete prevalence of TBPs in the Western zone at 95% confidence interval was observed 34.69% (25.36-44.98). In Central and Northern zone the prevalence of tick borne pathogens were recorded at 95% confidence interval (36.02% and 37.50% at 29.13-43.37 and 28.83-46.80), respectively.
In the Central zone, the percentage of infested ticks (Table 4.23) was observed higher in B. microplus (47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii (16.67%), however in the Northern zone, Hy. anatolicum ticks were detected further frequently infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh. sanguineus (20%). %). The ticks of Central zone were mainly infested with Ehrlichia spp. (12.90%) followed by Anaplasma spp. (11.82%), Theileria spp. (6.98%), and Babesia spp. (4.30%). The overall tick-borne pathogens prevalence in the Northern zone at 95% confidence interval was observed 36.02% (29.13-43.37). The ticks of Western zone were mainly infested with Ehrlichia spp. and Anaplasma spp. (12.5%), Theileria spp. (7.50%), and Babesia spp. (5.0%). The complete tick-borne pathogens prevalence in the Northern zone at 95% confidence interval was recorded 37.5% (28.83-46.80). The complete prevalence of TBPs in all the zones at 95% confidence interval was observed 38.37% (34.68-42.16).
76
Table 4.24. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Southern Zone Punjab; Pakistan. Diseases TBP species Hy. Hy. Hy. Rh. Rh. B. B. Prevalence anatolicum marginatum dromeddari sanguineus appendiculatus microplus decolaratus (%) Theleriosis T. annulata 18 0 1 0 0 2 0 21 (7.74%) T. ovis 0 0 0 0 0 0 0 0 (0.36) T. orientalis 5 0 0 0 0 0 0 5 (1.84%) Babesiosis B. bigemina 2 0 0 0 0 0 0 2 (0.73%) B. bovis 0 0 0 1 0 0 0 1 (0.36) B. caballi 5 0 0 0 0 0 0 5 (1.84%) B. occultans 0 0 0 0 0 0 0 0 Anaplasmoisis A. Centrale 5 0 0 0 0 0 0 5 (1.84%) A. marginale 5 0 0 2 0 1 0 8 (2.95%) A. ovis 3 0 0 0 0 0 0 3 (1.10%) Ehrlichiosis E. sp. 1 27 0 2 0 0 3 0 32 (11.80) E. sp. 25 0 1 0 0 5 0 31 (11.43) Omatjenne The estimates of overall prevalence of several Theleria species were significant while estimates prevalence of Babesia species were not significantly different in Southern zone, Punjab (Table 4.24). Among Theleria species, highest prevalence was found in T. annulata (7.74%) as compared to T. orientalis (1.84%). T. annulata was found only in Hy. anatolicum, Hy. dromedarii and B. microplus whereas T. orientalis was identified only in Hy. anatolicum. T. annulata was primarily found in (7.74%) Hy. anatolicum. B. bigemina and B. caballi were observed only in Hy. anatolicum whereas B. bovis was detected only in Rh. sanguineus. The estimates of overall prevalence of several Anaplasma species were significantly different in this zone. The prevalence of A. marginale (2. 95%) was observed maximum followed by A. Centrale (1.84%) and A. ovis (1.10%) in this zone among Anaplasma spp. Prevalence of A. Central and A. marginale was found highest in Hy. anatolicum and A. marginale was identified in Rh. sanguineus and B. microplus too. A. ovis was detected only in Hy. anatolicum. Ehrlichia species prevalence estimate in this zone was found significantly different.
77
Table 4.25. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Western Zone Punjab; Pakistan. Diseases TBP species Hy. Hy. Hy. Rh. Rh. B. B. Total anatolicum marginatum dromedarii sanguineus appendiculatus microplus decolaratus Theleriosis T. annulata 5 2 0 1 0 3 0 11(11.22%) T. ovis 0 0 0 0 0 0 0 0 T. orientalis 2 0 0 1 0 0 0 3 (3.06%) Babesiosis B. bigemina 0 0 0 0 0 0 1 1 (1.02%) B. bovis 2 1 0 1 0 0 0 4 (4.08%) B. caballi 0 0 0 0 0 0 0 0 Anaplasmoisis A. Centrale 0 0 0 0 0 0 0 0 A. marginale 5 0 0 2 0 1 0 8 (8.16%) A. ovis 0 0 1 0 0 0 0 1 (1.02%) Ehrlichiosis E. spp. 0 0 2 0 0 3 0 5 (5.10%) ERm58 E. spp. Firat 0 0 0 0 0 0 0 0 E. spp. 0 0 1 0 0 0 0 1 (1.02%) Omatjenne
Among Theleria species, highest prevalence was found in T. annulata (10.20%) as compared to T. orientalis (3.06%). T. annulata was found in Hy. anatolicum, Hy. marginatum, Rh. sanguineus and B. microplus whereas T. orientalis was identified in Hy. anatolicum and Rh. sanguineus. Theleria species was mainly present in Hy. anatolicum. The estimates of overall prevalence of several Babesia species were significantly different in this zone B. bovis was found highest (4.08%) as compared to B. bigemina and B. occultans (1.02%). B. bovis was mainly present in Hy. anatolicum. B. bigemina was found only in B. decolaratus. The estimates of overall prevalence of several Anaplasma species were significantly different in this zone; Punjab. The prevalence of A. marginale (8.16%) was maximum than A. ovis (1.02%). Prevalence of A. marginale was noted highest in Hy. anatolicum and A. ovis was only identified in Hy. dromedarii. Ehrlichia species prevalence estimate in this zone was also found significantly different as shown in table 4.25.
78
Table 4.26. Species of Babesia, Theleria, Anaplasmoisis and Ehrlichia isolated from different tick species in Central zone Punjab; Pakistan. Diseases TBP Hy. Hy. Hy. Rh. Rh. B. B. Total species anatolicum marginatum dromeddari sanguineus appendiculatus microplus decolaratus Theleriosis T. 2 0 1 0 0 0 0 3 (1.6%) annulata T. ovis 0 0 0 0 0 2 0 2 (1.075%) T. 2 0 0 1 0 5 0 8 (4.30%) orientalis Babesiosis B. 3 0 0 0 0 3 0 6 (3.22%) bigemina B. bovis 0 0 0 0 0 2 0 2 (1.075%) B. caballi 0 0 0 0 0 0 0 0 Anaplasmoisis A. 0 0 0 0 0 3 0 3 (1.6%) Centrale A. 2 0 0 0 0 15 0 17 marginale (9.13%) A. ovis 0 0 0 0 0 2 0 2 (1.075%) Ehrlichiosis E. spp.1 7 0 0 0 0 5 0 12 (6.45%) E. spp. 8 0 0 0 0 4 0 12 Omatjenne (6.45%)
79
The estimates of overall prevalence of several Theleria species were significantly different in Central zone, Punjab (Table 4.26). Among Theleria species highest prevalence was found in T. orientalis (4.44%) followed by T. annulata (1.66%) and T. ovis (1.11%). T. ovis was found only in B. microplus. T. annulata was observed in Hy. anatolicum and Hy. dromedarii whereas T. orientalis was identified in Hy. anatolicum, Rh. sanguineus and B. microplus. Theleria species was highly found in B. microplus.The prevalence of Babesia species was highest in B. bigemina (3.33%) as compared to B. bovis (1.11%). The species of B. bigemina was found in Hy. anatolicum and B. microplus while B. ovis were found only in B. microplus . B. coballi was not detected in this zone. The estimates of overall prevalence of several Anaplasma species were significantly different in this zone, Punjab (Table 4.26). The prevalence of A. marginale (9.44%) was maximum, followed by A. Centrale (1.66%) and A. ovis (1.11%) in this zone. Prevalence of Anaplasma species was found highest in B. microplus. Both A. ovis and A. Centrale was only detected in B. microplus. Ehrlichia species prevalence estimate in this zone was found significantly different. The prevalence of both E. spp. 1 and E. spp. Omatjenne was similar (6.45%) and these were mainly present in Hy. anatolicum.
80
Table 4.27. Species of Babesia, Theleria, Anaplasmosis and Ehrlichia isolated from different tick species in Northern zone Punjab; Pakistan. Diseases TBP Hy.anatolicum Hy.marginatum Hy. Rh. Rh. B. B. Total species dromeddari sanguineus appendiculatus microplus decolaratus Theleriosis T. 1 0 0 0 0 1 0 2 (1.66%) annulata T. ovis 0 0 0 0 0 1 0 2 (1.66%) T. 1 0 0 0 0 5 0 6 (5.00%) orientalis Babesiosis B. 2 0 1 0 0 2 0 5 (3.33%) bigemina B. bovis 0 0 0 0 0 1 0 1 (0.83%) B. caballi 0 0 0 0 0 0 0 0 Anaplasmosis A. 0 0 0 0 0 2 0 2 (1.66%) Centrale A. 1 0 0 1 0 10 0 12 marginale A. ovis 0 0 0 0 0 1 0 1 (0.83%) Ehrlichiosi E. spp. 1 4 0 0 0 0 3 0 7 (5.83%)
E. spp. 5 0 0 0 0 3 0 8 (6.66%) Omatjenne
81
The estimates of overall prevalence of several Theleria species were significantly different in Northern zone, Punjab (Table 4.27). Among Theleria species highest prevalence was found in T. orientalis (5%) followed by T. annulata (1.66%) and T. ovis (1.66%). T. ovis was found only in B. microplus. T. annulata and T. orientalis were identified in Hy. anatolicum and B. microplus. Theleria species was highly found in B. microplus. The prevalence of Babesia species was highest in B. bigemina (3.33%) as compared to B. bovis (0.83%). The species of B. bigemina was observed in Hy. anatolicum, Hy. dromedarii and B. microplus while B. ovis were found only in B. microplus. B. coballi was not detected in this zone. The estimates of overall prevalence of several Anaplasma species were significantly different in this zone, Punjab (Table 4.27). The prevalence of A. marginale (10%) was maximum, followed by A. Centrale (1.66%) and A. ovis (0.83%) in this zone. Prevalence of Anaplasma species was found highest in B. microplus. A. marginale was detected in Hy. anatolicum and Rh. sanguineus. Prevalence of Ehrlichia species estimate in this zone was found significantly different (p> 0.01). The highest prevalence was detected in E. spp. 1 (6.66%) as compared to E. spp. Omatjenne (5.83%). Both species were found in Hy. anatolicum and B. microplus.
82
Figure 13. showed the Anaplasma and Ehrlichia spp. M represent the molecular marker. 1-4 samples were loaded in agarose gel for the analysis of pathogens. A. marginale, A. ovis and Ehrlichia spp were observed in loaded samples.
In figure 13 365bp showed A. marginale, 347bp showed A. ovis and 480bp showed Ehrlichia species.
83
Figure 14. Agarose gel electropherosis for the presence of Babesia and Theileria spp.
In figure 14 480bp showed Babesia, and 470bp showed Theileria.
84
Figure 15. shows the Babesia and Theleria species M represent the molecular marker. 1-7 samples were loaded in agarose gel for the analysis of pathogens. B. bigemina, B. bovis, B. caballi, T. annulata, A. ovis and T. orientalis were observed in loaded samples. Lane 7 was negative control.
85
4.5. Control of tick species
Table 4.28. Lethal concentration of selected plant extracts against Hy. anatolicum
Plant extracts Time LC50±SE Confidence interval at P value (hrs) 95% Lower limit Upper limit C. procera 24 12.25±2.26 9.14 21.39 0.04 48 10.77±2.53 7.42 24.98 0.39 72 5.91±1.02 3.97 8.62 0.25 96 2.57±0.92 0.11 4.26 0.07 B. rapa 24 11.87±2.04 8.99 19.56 0.02 48 9.60±1.93 6.83 17.87 0.26 72 5.66±1.07 3.54 8.5 0.07 96 2.47±0.81 0.39 3.95 0.05 S. nigrum 24 9.28±1.30 7.25 13.27 0.03 48 6.26±0.86 4.68 8.42 0.00 72 3.75±0.93 1.50 5.68 0.07 96 2.02±0.02 0.94 3.80 0.16 T. foenum-graecum 24 16.79±4.34 11.57 44.62 0.12 48 10.95±1.89 8.24 18.03 0.02 72 7.27±1.15 5.81 11.1 0.00 96 3.88±0.98 1.5 50.96 0.03 C. colocynthis 24 12.15±2.05 9.25 19.78 0.06 48 10.41±1.26 7.31 21.49 0.32 72 6.55±1.25 4.29 10.44 0.17 96 3.26±0.79 1.38 4.81 0.14 LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval
86
Different concentrations (0.75 or 1.5 or 3.00 or 6.00 or 12.00%) of selected plant extracts were used to check the LC50 for tick species Hy. anatolicum. The table 4.28 shows that LC50 values of C. procera were 12.25, 10.77, 5.91and 2.57% for 24, 48, 72 and 96 hrs, respectively. Above mentioned same concentrations of B. rapa were showed 11.87, 9.60, 5.66 and 2.47%
LC50 values after 24, 48, 72 and 96 hrs. S. nigrum showed the 9.28, 6.26, 3.75and 2.02% LC50 values were after 24, 48, 72 and 96 hrs time interval. Similar concentrations and time interval were used for T. foenum graceum to evaluate LC50 values which were 16.79, 10.95, 07.27, 3.88% and 12.55, 10.41, 06.55and 3.26% for C. colocynthis. The result revealed that S. nigrum showed the highest mortality in tick species and the time and dose dependent toxicological effects on tick species.
87
Table 4.29. Lethal time of selected plant extracts against Hy. anatolicum . Confidence interval at Conc. LT ±SE 95% Plant extracts 50 P value (%) (hrs) Lower limit Upper limit
C. procera 0.75 134.58±2.28 103.7 332.08 0.28 1.50 99.04±1.89 77.92 189.75 0.91 3.00 72.88±1.28 52.78 119.74 0.87 6.00 58.40±1.21 38.54 76.92 0.03 12.00 39.88±0.92 9.44 54.48 0.02 B. rapa 0.75 134.58±2.28 103.7 332.08 0.28 1.50 101.92±1.97 81.19 182.66 0.13 3.00 66.79±1.26 46.94 96.76 0.92 6.00 51.08±1.08 27.91 66.79 0.81 12.00 38.99±0.71 9.89 53.21 0.68 S. nigrum 0.75 107.90±1.34 94.96 145.6 0.22 1.50 92.65±1.76 68.96 294.99 0.96 3.00 61.91±1.28 35.43 92.17 0.84 6.00 32.99±0.88 36.41 52.18 0.89 12.00 5.42±0.60 263.08 34.36 0.95
T. foenum-graecum 0.75 100.58±1.84 0.00 0.00 1.00 1.50 97.45±1.24 79.02 156.47 0.97 3.00 89.40±1.04 71.59 144.37 0.82 6.00 65.06±0.88 45.17 91.48 0.83 12.00 54.55±0.10 36.35 69.23 0.97 C. colocynthis 0.75 134.58±2.28 103.7 332.08 0.28 1.50 107.77±1.34 83.58 226.16 0.97 3.00 84.35±1.71 61.09 258.84 0.96 6.00 55.57±0.57 35.86 71.88 0.81 12.00 41.77±0.49 9.43 57.19 0.63 LT: Lethal Time; SE: Standard Error; CI: Confidence Interval
88
Table 4.29 displays the lethal concentration of selected plant extracts against tick species.
Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50 for tick species Hy. anatolicum. The table 4.29 shows that LT50 values of C. procera at 0.75, 1.5, 3.00, 6.00 or 12.00 % were 134.58, 99.04, 72.88, 58.40and 39.88 hrs, respectively. Above mentioned same concentrations of B. rapa were showed 134.58, 101.92, 66.79, 51.08 and 38.99 hrs LT50 values after 24, 48, 72 and 96 hrs. S. nigrum showed the 107.90, 92.65, 61.91, 32.99 and 5.42 hrs
LT50 values were at 0.75, 1.5, 3.00, 6.00 or 12.00 %. Similar concentrations and time interval were used for T. foenum-graceum to evaluate LT50 values which were 100.58, 97.45, 89.40, 65.06 and 54.55 hrs and 134.58, 107.77, 84.35, 55.57and 41.77 hrs for C. colocynthis. The result showed that S. nigrum exhibited the highest mortality in tick species and the time and concentration dependent toxicological effects on tick species.
100 90 24 hours 48 hours 72 hours 96 hours 80
70 60 50 40
% Mortality % 30 20 10
0
1.50% 0.75% 0.75% 3.00% 6.00% 0.75% 1.50% 3.00% 6.00% 0.75% 1.50% 3.00% 6.00% 0.75% 1.50% 3.00% 6.00% 1.50% 3.00% 6.00%
12.00% 12.00% 12.00% 12.00% 12.00% Control C. procera B. rapa S.nigrum T. foenum C. colocynthis graecum Used Plants
Figure 16. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different concentration of plants extract
89
The percent mortality of tick species Hy. anatolicum with different concentration (0.75, 1.5, 3.00, 6.00 and 12.00 %) of plants extract at different post treatment time intervals i.e. 24, 48, 72 and 96 hrs were shown in figure 16. As the time and concentration of extract increased, the mortality of tick also increased. Percent mortality of tick species were time and concentration dependent. After 96 hrs the percent mortality of tick species Hy. anatolicum was seen about 85% for B. rapa and S. nigrum at 12.00 % concentration of extract. In C. procera percent mortality was observed 83% after 96hrs at 12.00 % concentration of extract while in case of T. foenum- graecum (74%) and C. colocynthis (83%) percent mortality was observed after 96hrs at 12.00 % concentration of plants extract.
Table 4.30. Lethal concentration of selected acaricides against Hy. anatolicum.
Acaricides Time LC50±SE Confidence interval at 95% P value (hrs) Lower limit Upper limit Cypermethrin 24 2.38±0.41 1.68 3.64 0.28 48 1.77±0.88 6.47 3.81 0.00 72 2.70±2.47 56.79 0.002 0.00 96 2.10±1.23 7.75 0.51 0.00 Emamectin 24 2.64±0.64 1.64 6.11 0.42 48 0.74±0.32 0.16 1.32 0.17 72 0.178±0.244 0.56 0.56 0.06 96 0.176±0.118 0.28 0.34 0.96 Fipronoil 24 83.59±12.42 64.65 147.12 0.73 48 0.76±0.19 0.28 1.12 0.50 72 0.31±0.14 0.12 0.55 0.91 96 0.15±0.12 0.33 0.33 0.85 LC: Lethal Concentration; SE: Standard Error; CI: Confidence Interval
Different concentrations (0.25 or.5 or 1.00 or 2.00 or 4.00%) of selected acaricides were used to check the LC50 for tick species Hy. anatolicum. The table 4.30 shows that LC50 values of Cypermethrin were 2.38, 1.77, -2.70, and -2.10% for 24, 48, 72 and 96 hrs, respectively. Above mentioned same concentrations of Emamectin were showed 2.64, 0.74, 0.178 and 0.176 % LC50 values after 24, 48, 72 and 96 hrs. Fipronoil showed the 83.59, 0.76, 0.31 and 0.15 % LC50
90
values were after 24, 48, 72 and 96 hrs time interval. The result revealed that cypermethrin showed the highest mortality in tick species Hy. anatolicum and the time and dose dependent toxicological effects on tick species.
Table 4.31. Lethal time of selected Acaricides against Hy. anatolicum
Concen. LT50±SE Confidence interval at 95% P value Acaricides % hrs Lower limit Upper limit Cypermethrin 0.25 99.43±1.35 78.84 180.75 0.92 0.5 51.52±0.14 39.48 61.5 0.63 1.00 35.87±0.02 22.84 44.56 0.17 2.00 25.98±0.29 7.28 35.96 0.34 4.00 16.50±0.37 12.95 28.7 0.48 Emamectin 0.25 88.64±1.42 68.17 178.7 0.00 0.5 54.55±1.10 36.35 69.23 0.00 1.00 30.81±0.76 1.78 44.34 0.04 2.00 25.53±0.38 9.73 14.19 0.01 4.00 19.92±0.67 1.95 30.01 0.91 Fipronoil 0.25 88.64±1.42 68.17 178.7 0.01 0.5 53.74±0.38 38.02 66.59 0.01 1.00 8.20±0.09 43.04 28.87 0.60 2.00 23.62±0.94 5.48 32.95 0.72 4.00 0.28±0.18 240.77 17.18 0.95 LT: Lethal Time; SE: Standard Error
Different time intervals (24 hrs or 48 hrs or 72 hrs or 96 hrs) were used to check the LT50 for tick species Hy. anatolicum. The table 4.31 showed that LT50 values of cypermethrin at 0.25, .50, 1.00, 2.00 or 4.00 % were 99.43, 51.52, 35.87, 25.98 and 16.50 hrs, respectively. Similar concentrations and time interval were used for Emamectin to evaluate LT50 values which were 88.64, 54.55, 30.81, 25.53 and 19.92 hrs and 88.64, 53.74, 8.20, 23.62 and 0.28 hrs for Fipronoil The result showed that Fipronoil exhibited the highest mortality in tick species Hy. anatolicum and the mortality is time and concentration dependent toxicological effects on tick species.
91
120 24 hours 48 hours 72 hours 96 hours 100
80
60
% Mortality % 40
20
0
0.25% 0.50% 1.00% 2.00% 4.00% 0.25% 0.50% 1.00% 2.00% 4.00% 0.25% 0.50% 1.00% 2.00% 4.00% Control Cypermethrin Emamectin Fipronoil Acaricides tested in the study
Figure 17. Mortality (%) of Hy. anatolicum after 24, 48, 72 and 96 hrs against different concentration of acaricides
Percent mortality of Hy. anatolicum tick species were recorded with the application of different concentrations (.25, .5, 1.00, 2.00 & 4.00%) of acaricides i.e. cypermethrin, emamectin and fipronoil. Mortality was recorded after different time intervals 24 hrs, 48 hrs, 72 hrs and 96 hrs. In case of all used acaricides i.e. cypermethrin, fipronoil and emamectin mortality was recoded 100% after 96hrs of time interval and at 4.00% concentration of used acaricides. We observed from the results that percent mortality was concentration and time dependent.
92
4.6. Phytochemical analysis Phytochemical analysis of five selected plants i.e C. procera, B. rapa, T. foenum- graecum, S. nigrum and C. colocynthis presented in (table 4.26). The results revealed the presence of medically active constituents in the studied plants. Flavonoids, terpenoids and alkaloids were present in all studied plants while steroids were found in all except C. procera. Phenols, saponins and tanins have been recognized for many biological effects. The methanolic extracts of these plants are evaluated in-vitro for their acaricidal activity against ticks.
Table 4.32. Qualitative phytochemical analysis of selected plants. Sr. Selected Common Plant Alkaloids Flvonoids Steroids Terpenoids Tannins Saponins Phenols No plant Name Part species 1 C. Auk Leaves, + ++ - + - + + procera flowers and stem 2 B. rapa Surso Leaves, ++ +++ + ++ + - + flowers and stem 3 T. foenum Leaves, + ++ + + - ++ - -graecum Maithe flowers and stem 4 S. nigrum Makoi Leaves, ++ +++ + - ++ ++ - fruit and stem 5 C. Kurtuma Fruit + ++ + + + + + colocynthis
Sign; + weak positive, ++ low weak, +++ strong positive; - absent
93
DISCUSSION In tropical and subtropical zone of the world ticks are the most significant pest of ruminants (Admassu et al., 2015). On animal and human health ticks and TBDs have a vast effect. Animals condition is effected from ticks by biting stress that is responsible for the production loss, physical injury, poisoning, and pathogens distribution comprising rickettsia, protozoa, viruses, spirochetes, bacteria and filarial nematodes (Satta et al., 2011; Gosh & Nagar 2014; Jabbar et al., 2015; Kaur et al., 2015). However, financial crisis associated with ticks are generally due to the diseases which they spread to the host (Sultana et al., 2015). Economic losses related with niggling irritation which results in reduction of the value of skins and furs (up to 20-30%) are also important (Sultana et al., 2015). The current study was conducted to evaluate the tick prevalence, their control and the tick borne pathogens in four agro-ecological regions of Punjab, Pakistan.
4.6. Prevalence of ticks in agro-ecologic zones The results of current research showed that all the animals farms which studied were observed infested with one or many species of ticks. Differences were existing in the ticks prevalence infestation within farms of similar research zones. The ticks prevalence in Western (35.83%), Central (40.43%), Southern (36.33%) and Northern zones (33.47%) was observed. These differences in prevalence of ticks were because of the topographical situation, temperature and weather situations of several research part of Province, Punjab (Iqbal et al., 2014). The ticks prevalence in earlier study from Pakistan did not study the agro-ecologic regions and were centered on specific area merely (Jabbar et al., 2015) or variations in the ticks prevalence had been described in several parts of the related region (Iqbal et al., 203). The data with respect to the ticks prevalence in several animals species were noted in various seasons of the year. The ticks Prevalence of infestation on different animals species in dissimilar seasons of the year in Summer, Spring, Autumn and Winter was found 55.30%, 41.30%, 29.57% and 19.33% respectively. The results of the present research showed the utmost prevalence of ticks infestation in Summer season because in Summer the climate was warm and moist that maintained the existence of infestation of tick. Though, all over the year the animals remained infested with ticks. Difference in tick infestation might be because of topographical situations and weather
94
circumstances of several research areas. Dissimilar environmental effects comprising humidity, rainfall and temperature support the survival of tick in any zone (Greenfield et al., 2011), several additional factors such as season, status of nutrition in animals, host availability (Teel et al., 1996; Alonso et al., 2007) and agricultural aplications (Sajid et al., 2011) also influence ticks infestation rate. The outcomes of present study were in similar with the previous studies of Ghosh et al. (2007), Durrani and Shakoori, (2009), Rony et al. (2010), Sultana et al. (2015) and Ali et al. (2016) who also reported highest ticks infestation in Summer season. The outcomes of present study was also in line with Mustafa et al. (2014) who described the prevalence of ticks highly from June to August and Atif et al. (2012) who observed the maximum ticks infestation in the research zones of Sargodha district Punjab, Pakistan, in the months of June and July. The results of current study were also in agreement with the results of Kabir et al. (2011) who found more prevalence of ticks in Summer (41.66%) followed by Winter season (31.5%) in Bangladesh.
In the present study total 12,000 animals (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows) were observed in 120 livestock farms in twelve districts of Punjab, Pakistan. The results showed that the total ticks prevalence in animals was 36.52% (4382/12,000). The present research had been carried out in four different seasons in various agro-ecologic zones of Punjab to observe the ticks prevalence in livestock. The prevalence results of present study were in agreement with the results of Iqbal et al. (2013) who reported prevalence of tick species 31% from Pakistan. Though, the findings of this research were in contradicted with the findings of Mustafa et al. (2014) who observed tick prevalence 85% in Sargodha district Punjab, Pakistan. This variance in the ticks prevalence could be due to the difference in weather and topographical conditions of the research regions, research times, target populations and husbandry rehearses (Iqbal et al., 2014). In Africa and Asia, ticks prevalence in livestock was plentiful than the other continents (Sajid et al., 2011). Higher tick infestation in these continents is due to the warmer weather which supports favorable situations for the ticks development, difference in housing panaches, farming rehearses and tactics for tick management. It was noted that the prevalence of ticks in the province Punjab had been growing quickly in previous few years, which could be because of the resistance of acaricides (Sajid et al., 2008; Sajid et al., 2009a; Ali et al., 2013; Mustafa et al., 2014; Tasawar et al., 2014). The
95
acaricides resistance had been reported by Abbas et al. (2014) in tropical and subtropical areas of the world however; in Pakistan no study has yet reported resistance of acaricides (Jabbar et al., 2015). The prevalence was significantly maximum in the Central region in present research because of highly temperature that presented optimal conditions for the tick growth as compared to the Northern area where temperature was low.
Ticks prevalence in the current study areas were observed in animals in following order cows>buffaloes>goats>sheep (42.41>37.53>36.14>29.00%), respectively. It was obvious with the findings that the tick prevalence was considerably different between species of animal in the present study which was in similar with the earlier studies of Ghosh et al. (2007) and Sajid et al. (2008) who described the ticks prevalence higher in cows as compared buffaloes from lower Punjab, Pakistan. The outcomes of current study revealed that in animals the prevalence of ticks was highest in cows as compared to buffaloes, that was in agreement with the earlier studies of Rehman et al. (2004), Sajid et al. (2009a) and Ali et al. (2013) who also reported the higher prevalence of ticks in cows than buffaloes in Pakistan. The higher ticks prevalence in cows than buffaloes may be related with the drier residences and thinner skin of cow than the marshy habitations and denser buffaloes skin (Sajid et al., 2009a), and heredities of host could also show a part (Jonsson et al., 1998). The ticks prevalence in cows was found 42.41 % in the current study areas of Punjab, Pakistan which was statistically in line with the results of Perveen et al. (2011) and Khan et al. (2013) which reported prevalence of ticks in cows was 48.35%, in Pakistan. The outcomes of current research were indisagreement with the outcomes of Sajid et al. (2008), Sajid et al. (2009a), Soomro et al. (2014), Sultana et al. (2015) and Ali et al. (2016) who reported the prevalence of ticks in Pakistan 75.1%, 72.9%, 22.38%, 55.5%, 71.9%, correspondingly. In the present research, the ticks prevalence was 37.53% in buffaloes which is statistically at per with the findings of Sajid et al. (2008), who described 40.1%, Sajid et al. (2009a) who reported 47.3% & Perveen et al. (2011) who also described 43.85% respectively in Pakistan. The results of this findings were contradict with Mustafa et al. (2014) and Rehman et al. (2017), who described prevalence of ticks in buffaloes 84.3% & 81.44% respectively, in Punjab, Pakistan while the results of current study were somewhat different from Ali et al. (2016), Sultanta et al. (2015), Soomro et al. (2014), Tasawar et al. (2014) and Khan et al. (2013),
96
who reported prevalence of ticks 62.03%, 51.03%, 52.5%, 24.75%, and 51.65%, respectively in Pakistan. The ticks prevalence in goats was observed 36.14% which was statistically in similar with the findings of Irshad et al. (2010) who described 41.43% ticks prevalence in goats in Islamabad and Riaz et al. (2017) who reported (43.6%) ticks prevalence in goats in Multan districs Punjab, Pakistan. The findings were not in contract with the result of Manan et al. (2007) 12.1%, Sajid et al. (2008) 51.6%, Perveen et al. (2011) 14.8%, Mustafa et al. (2014) 86.5% and Rehman et al. (2017), 60% respectively in Pakistan. Ticks prevalence in sheep was observed 29.00% which was in contrast by the results of Manan et al. (2007), Irshad et al. (2010), Perveen et al. (2011), Riaz et al. (2017) and Rehman et al. (2017) which described the prevalence of ticks in sheep 12.8%, 43.37%, 3.3%, 11.1% and 50.0% respectively, in Pakistan. Aasma et al. (2014) observed the prevalence of ticks infestation in cattle followed by goats buffaloes and sheep which was (60.5%, 25.9%, 17.8% and 14.8%), respectively in Egypt.
In the current study total 10 different ticks species were identified i.e. Hy. anatolicum (25.92%), Hy. marginatum (14.05%), Hy. dromedarii (5.62%), Hy. truncatum (2.44%), Hy. rufipes (1.79%), Rh. sanguineus (16.33%), Rh. appendiculatus (12.39%), B. microplus (14.2%), B. decolratus (5.15%) and A. percicus (2.02%) respectively. On the basis of morphologic characters the ticks were recognized. The identification of ticks in present study revealed that Hy. anatolicum species was most plentiful in study areas. It parasitized all the sheep, goats, buffaloes and cows in all four agro ecological zones. The findings of current study were in agreement with Sajid et al. (2008), Sajid et al. (2009a), Perveen et al. (2011), Ali et al. (2013), Iqbal et al. (2014), Sultana et al. (2015), Karim et al. (2017), Riaz et al. (2017) and Rehman et al. (2017) who observed the high infestation rate of Hy. anatolicum in Punjab, Pakistan. The results of present research were also in agreement from the neighboring states such as in Iran (Ganjali et al., 2014; Hosseini-Chegeni et al., 2013; Nasiri et al., 2010) and in India (Chhillar et al., 2014) that the most abundant tick species was Hy. anatolicum. The results of current research revealed that the species of tick B. microplus was observed from all the livestock species in all agro-ecological regions which is in line with the results of khan et al. (1993), Gosh et al. (2007), Sajid et al. (2009a), Irshad et al. (2010), Perveen et al. (2011), Iqbal et al. (2014), Mustafa et al. (2014), Tasawar et al. (2014) and Karim et al. (2017) who also observed B. microplus in the region of Punjab, Pakistan.
97
Hy. marginatum was also detected from the study area Punjab; Pakistan. The outcomes of present research were in agreement with the outcomes of Gosh et al. (2007), Mustafa et al. (2014) and Iqbal et al. (2015) who also observed the presence of Hy. marginatum in Punjab, Pakistan. The result of current research was also in agreement by the results of Hosseini-Chegeni et al. (2013) and Gharekhani et al. (2015) who observed Hy. marginatum from Iran. Hy. dromedarii was observed in the present study but Hy. dromedarii is limited to Bhakar and Bahawalpur district in the Southern and Western zone. The most part of Bhakar and Bahawalpur district comprises on deserts where the production of camel was common and Hy. dromedarii species of tick is particular to fodder on camel. Therefore, the existence of Hy. dromedarii in cows, buffaloes and goats except sheep might be transferred from camel. The results of my findings were similar with the findings of Hussain and Kumar, (1985), Siddiqi and Jan, (1986) Gosh et al. (2007), Perveen et al. (2011), Rehman et al. (2017 & Karim et al. (2017) who reported Hy. dromedarii species in Pakistan. In Western Punjab, Pakistan, only Hy. truncatum and Hy.rufipes were found which was not reported in other zones these results were in line with the study of Gosh et al. (2007) who described Hy. truncatum and Hy.rufipes from Pakistan and also in contract with the results of Karim et al. (2017) who described Hy. truncatum in Punjab, Pakistan. The findings of our research were also in agreement with the outcomes of Paul et al. (2017) who observed this in Nigeria from cattle population and Hosseini-Chegeni et al. (2013) who observed from Iran. In present study Rh. sanguineous specie was identified which was in line with the findings of Khan et al. (1993), Durrani et al. (2008), Sajid et al., (2008), Sajid et al. (2009a), Mustafa et al. (2014), Karim et al. (2017) and Riaz et al. (2017) who also reported that presence in Punjab, Pakistan. The outcomes of this research were also in agreement with the outcomes of Islam et al., (2006) who observed from Bangladesh, Kabir et al. (2011), Musa et al. (2014) described from Nigeria, Monfared et al. (2015), Gharekhani et al. (2015) who reported from Iran, and Hossain et al. (2016) from Bangladesh who reported Rh. sanguineous species from the livestock population. The Rh. appendicluatus was identified from the 3 zones expect Northern zone which may be due to the difference in weather and geographical conditions. Earlier this species was reported only in one study Gosh et al. (2007) in Pakistan. The Rh. decolratus was identified from the current study areas but in previous study this species was not described. The Argas percicus was identified from the infested cow and goats from Central
98
Punjab. The findings of the current research were in line by the results of Khan et al. (2001) who described Argas percicus from Faisalabad. The outcomes were also in line with the outcomes of Qamar et al. (2009) and Shahnaz et al. (2016) who observed Argas percicus from poultry in Punjab, Pakistan. Our findings were in line with the results of Singh and Chhabra (1973) and Chhabra and Donora (1994) who reported Argas percicus in the other countries of world. 4.7. Tick-borne Pathogens
A wider range of contagious agents are transferred in livestock and humans by ticks as well as they cause direct harms to domestic animals than other parasites (blood suckling arthropod) (Munderloh et al., 2005). The pathogens i.e. fungi, protozoa, bacteria and viruses were transmitted by ticks (de La Fuente et al., 2015). In animals, ticks and TBPs become the cause of global economic loss annually which was estimated in dollars in billions (13.9 billion- 18.7 billion US$) (de Castro, 1997; Jongejan and Uilenberg, 2004). During last few years, a number of TBDs (> 16) of humans and animals (about 19) had been identified (Sonenshine & Roe, 2014), the variety of TBDs had been reported like ehrlichiosis, borreliosis, anaplasmosis and rickettsiosis (Dantas-Torres et al., 2012). For the recognition of various new pathogens, currently recognized molecular biological tools (Doudier et al., 2010; Dantas-Torres et al., 2012; Ehounoud et al., 2016) and latest molecular diagnostic methods, like PCR are known to be effective technique to accurately evaluate prevalence of pathogen and to recognize co-infected hosts (Lorusso et al., 2016; Bilgic et al., 2017). In the current study, total 675 species of ticks i.e. (Hy. anatolicum= 341, Hy. marginatum= 20, Hy. dromedarii= 39, Rh. sanguineus= 35, Rh. appendiculatus= 14, B. microplus= 204 and B. decolaratus= 21) tick pools (Southern 271, Western 98, Central 186 and Northern 120) were analysed by PCR methods for the existence of DNA TBPs i.e. Theileria, Babesia, Anaplasma, and Ehrlichia species. The PCR primers in 16S rRNA gene, V1 hyper-variable region was targeted by Anaplasma/Ehrlichia and in 18S rRNA gene, V4 hyper-variable region was targeted by Babesia/Theileria, and all members of these genera to date have been found to be conserved (Gubbels et al., 1999; Bekker et al., 2002).
Tick-borne pathogens were found in 259 pools out of complete 675 tick pools DNA from one or more ticks. In the current study the total prevalence of tick-borne pathogens were (38.37%) in the study areas in Punjab, Pakistan. Highest prevalence of pathogens was found in Ehrlichia spp. (16%), followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia
99
spp. (4.14%) respectively. The findings of current research showed that the prevalence of Ehrlichia spp. in the Southern (23.24%) was significantly higher than in the Western (2.21%), Central (8.85%) and Northern zone (5.53%). In all agro-ecologic zones of Punjab, Babesia spp. was the minimum prevalent tick-borne pathogens both in buffaloes and cows the study area was endemic for TBDs, also reported by (Durrani et al., 2008). For the diagnosis of tick borne diseases in the previous studies mostly researchers in Pakistan depend on blood smear analysis. Like this, the blood smear method was used for the detection of TBPs and their genetics which was based on morphologic analysis (Jabbar et al., 2015). However, the more specific and sensitive advanced molecular methods like PCR assay was used to differentiate multiple pathogens instantaneously. Therefore, in the current study the molecular techniques were used for the identification of tick-borne pathogens to develop more dependable record for upcoming studies. In the present study, three Anaplasma species were detected i.e. A. Centrale, A. ovis and A. marginale in seven species of ticks from four agro-ecological zones of the study zones. The findings of the current research showed the highest prevalence of A. marginale as compared to the other Anaplasma species. In this research A. marginale was identified in Hy. anatolicum, Rh. microplus and Rh. sanguineus ticks through PCR from study area. The results of the present research was in line with the results of Ashraf et al. (2013) and Atif et al. (2013) who reported A. marginale in bovines by blood smears method in Pakistan, and also by PCR-restriction fragment length polymorphism (RFLP)-based study and serological process (complement-enzyme linked immuno sorbent assay) (cELISA). The outcomes of current research were also similar with other areas of the world pathogen has been identified in Rh. microplus ticks reported by (Pesquera et al., 2015; Ehounoud et al., 2016). In Pakistan a latest research explained that the Hyalomma and Rhipicephalus ticks might be the possible vectors in the diffusion of Anaplasma species and was also reported by (Jabbar et al., 2015). A. marginale has a universal spreading in subtropical and tropical areas in buffaloes and cattle. It is considered that one of the utmost abundant TBPs causing high mortality and morbidity (Kocan et al., 2010). All around the world, including Pakistan the majority of clinical cases are due to pathogens (Sajid et al., 2014). In the current research a considerably maximum prevalence of A. marginale is in the Central zone as compared to other zones (Southern, Western and Northern) could be related to B. microplus with the maximum prevalence, which is mainly
100
accountable for the diffusion of A. marginale. The outcomes of current research were in line with the findings of Rehman et al. (2017) who described A. marginale in Hy. anatolicum and B. microplus in Punjab, Pakistan. The results of present research indicated that DNA of A. ovis was existing in 7 (1.03%) tick pools. The findings of this research were in agreement with the study of Talat et al. (2005) who observed the presence of A. ovis in small animals from KPK province and Rehman et al. (2017) who reported A. ovis in Punjab, Pakistan. The outcomes of current research was in linet with the results of Noaman (2012), Jalali et al. (2013) and Aktas (2014) who described A. ovis in other parts of the world such as in Turkey and Iran. A. ovis infestions had been molecularly confirmed. In this research, A. ovis was observed in Hy. dromedarii, Hy. anatolicum, and B. microplus ticks. However, in Iran Hy. anatolicum had been latest revealed as one of the significant vectors in charge for the diffusion of bovine anaplasmosis (Noaman, 2012; Jalali et al., 2013). In the current study, two Ehrlichia species, i.e. Ehrlichia sp. 1 and Ehrlichia sp. Omatjenne were detected in three tick species (Hy. anatolicum, Hy. dromedarii and B. microplus). In domestic animals, life-threatening diseases were caused by emerging and re- emerging tick-borne pathogens i.e Ehrlichia species (Cabezas-Cruz et al., 2015). The outcomes of the current study are statistically at per with results of Rehman et al. (2017) who reported Ehrlichia species from Pakistan. Currently, an occasion report designated that Ehrlichia canis ensued as a co-infection in a canine blood sample with Babesia gibsoni, but, the researchers used only the blood smear analysis and for further confirmation of the species had not used any molecular method (Abbas et al., 2015). The disease ehrlichiosis was not observed due to lack of clinical and laboratory-based diagnostic method. However, the result of current study was also in line with the border countries which reported many Ehrlichia species in tick samples in China (Wen et al., 2002; Wen et al., 2003) and in India (Rani et al., 2011; Das & Konar, 2013). However, Ehrlichia species was first time discovered in Canadian cattle blood samples (Gajadhar et al., 2010) and later in Brazil was found in haemolymph of Rh. microplus ticks (Cruz et al., 2012; Aguiar et al., 2014). The results of the present study showed that DNA from Ehrlichia spp. was existing in Hy. anatolicum (79 tick pools), Hy. dromedarii (6) and B. microplus (23). Additionally, in Pakistan this new Ehrlichia genetic factor was widely circulated in all the agro-ecologic zones. The initial sequencing findings attained for the Ehrlichia spp. recommend the existence of a potential novel Ehrlichia spp. Though, further research is
101
necessary to check whether this new genetic type relates to a new Ehrlichia species or if it is a type of an earlier described species. The findings of current study that Ehrlichia spp. 1 was the most mutual Ehrlichia species followed by Ehrlichia spp. Omatjenne. The findings of this research were in agreement with the findings of Rehman et al. (2017) who observed Ehrlichia spp fom Pakistan. The result of this study was also in agreement with the results of Aktas et al. (2011) who described Ehrlichia spp. Firat was primarily found from Hy. anatolicum ticks together from an animal housing in Turkey. However, Ehrlichia spp. Omatjenne was detected from Hy. anatolicum, Hy. dromedarii and B.microplus ticks from all zone except Western zone. In previous study Ehrlichia spp. Omatjenne was reported from Namibia, Ehrlichia spp. Omatjenne first time detected from Hy. truncatum tick (Allsopp et al., 1997). Our outcomes were also in line with the results of Mtshali et al. (2004) and Aktas and Özübek, (2015) who reported Ehrlichia spp. Omatjenne in blood samples from naturally infested cow. The results of present study revealed that Hy. anatolicum ticks could be a strong vector responsible for the diffusion of Ehrlichia spp. The results of this research revealed the existence of three babesia species i.e. B. caballi, B. bigemina and B. bovis in five species of ticks (Hy. anatolicum, Hy. marginatum, Hy. dromedarii, B. microplus and Rh. sanguineus) from Punjab province. The results of this research were in line with the results of Chaudhry et al. (2010), Atif et al. (2012), Zulfiqar et al. (2012), Ahmad et al. (2014) and Hussain et al (2014) who reported B. bovis and B. bigemina in blood samples of bovine in Pakistan. The major influence of animal babesiosis was on dairy production, though, it was also reported from other animal species, comprising dogs, horses, goats, sheep and pigs (Chaudhry et al., 2010; Carter & Rolls, 2015). B. bovis is predominant in Asia, Central and South America, Africa, Australia and Europe, however B. bigemina has been described from the Far East Africa too (Bram, 2016). In the current study B. bovis and B. bigemina were least observed in the Northern zone. The findings of this resarch were in agreement with the results of Rehman et al. (2017) who observed B. microplus in Pakistan. The outcomes of this research was also in agreement with the outcomes of Figueroa et al. (2010) and OIE (2010) who reported that Rh. microplus ticks was the main vector for the transmission of B. bovis and B. bigemina pathogens. Though, earlier findings from Pakistan sure the danger of babesiosis in several species of animals with difference in prevalence approximate within various areas of the country. The results of this work were in agreement with the findings of Rehman et
102
al. (2017) who observed B. bovis and B. bigemina in Pakistan. Previously is reported in China (Yu et al., 2016) through the sequence analysis. In South Africa in 1981 Babesia occultans was first time identified from Hyalomma marginatum rufipes (Gray & De Vos, 1981). Subsequently, for a long time, the topographical dissemination of this species was only found to sub-Saharan African countries (Dipeolu & Amoo, 1984; Ros-García et al., 2011), but previously this species had been recognized in Hyalomma ticks and cattle blood from Tunisia - Northern Africa (Ros- García et al., 2011), Southern part of Italy (Decaro et al., 2013), the Balearic Islands, Spain (Ros- García et al., 2012), and Turkey (Aktas & Ozubek, 2015). Furthermore, in India the parasite had been found in blood samples gathered from dogs (Mandal et al., 2014). In the current study B. bigemina and B. caballi were most in the Southern region which may be because of the presence of Hylomma ticks. The results of this study were in agreement with the results of Ros-García et al. (2011), Ros-García et al. (2012), Aktas et al. (2014) and Orkun et al. (2014), who described Hylomma ticks as the significant vector of B. bigemina and B. caballi pathogens. In Pakistan the most studied bovine tick-borne disease was theileriosis. In the current research three species of Theileria (T. ovis, T. annulata and T. orientalis) were observed from five species of tick (Hy. anatolicum, Hy. dromedarii, Hy. marginatum, B. microplus and Rh. sanguineus) from Punjab province. The findings of current study were in line by the results of Durrani et al. (2012), Khattak et al. (2012), Ali et al. (2013) and Shahzad et al. (2013) who observed T. ovis and T. annulata pathogens except T. orientalis in animal and tick species in Pakistan. The findings of current study revealed the prevalence of T. annulata was maximum (5.33%), followed by T. orientalis (3.25%), and T. ovis (0.59%). Between these species, T. annulata was the most infectious and has many types which are largely dispersed in dissimilar topographical areas of the globe. T. annulata yielded a serious and hypothetically lethal disease in cows, consequential in significant losse of economy in the dairy sector in Asia and Africa (Bishop et al., 2009; Jabbar et al., 2015). In exotic and hybridized cows the disease was more severe, where the case-mortality level could range up to 80%, than the local cows, where the death ratio was commonly about 20% (Jabbar et al., 2015). The results of current research were in agreement with the results of Ali et al. (2013), Karim et al. (2017) and Rehman et al. (2017) who described T. annulata in Hy. dromedarii and Hy. anatolicum ticks detached from cows. The outcomes of this research were in similar with the outcomes of Ali et al. (2013) who observed T. annulata in Hy. dromedarii and Hy. anatolicum ticks in cattle and buffaloes in Punjab, Pakistan.
103
The findings of this research were in similar with the findings of Durrani and Kamal, (2008) who reported T. annulata in Punjab, Pakistan. The results of this study showed that Hyalomma spp. is primarily responsible for dispersion of Theileria infestions in the animals population in Pakistan. The current research characterizes the indication of the existence of T. orientalis in Pakistan. While T. orientalis infestions have been recognized in cow, water buffaloes and African buffaloes from all the main regions of the world (Chaisi et al., 2013; Sivakumar et al., 2014), as well as bordering countries of Pakistan, e.g. Sri Lanka (Sivakumar et al., 2014) and India (Aparna et al., 2011; Kakati et al., 2015). In previous studies T. orientalis was reported in several countries comprising in India (Aparna et al., 2011), in Korea (Baek et al., 2003), in China (Liu et al., 2011), in Japan (Yokoyama et al., 2012), in New Zealand (McFadden et al., 2011) and in Australia (Islam et al., 2011; Eamens et al., 2013). It is indistinct how T. orientalis was presented into Pakistan, but it might be wondered that this could have followed by the introduction of cows from the Government of Victoria in Australia (Jabbar et al., 2015), wherever the pathogen prevaled (Perera et al., 2014).
Thousands of dairy livestock were introduced to Pakistan and samples of blood from these livestock are not observed by applying molecular techniques to check the piroplasms earlier to transfer (Jabbar et al., 2015). Furthermore, it had earlier been recommended that in cattle the prevalence and concentration of T. orientalis should be considered upon entrance to Pakistan (Jabbar et al., 2015). Including this, there is a substantial prohibited live animal transportation between India and Pakistan where it had been earlier observed (Appleby et al., 2008; Kakati et al., 2015). In exotic animals the unintentional introduction of ticks in the worldwide movement of live livestockhas also played a vital part for the transmission of species of tick and tick-borne diseases (de La Fuente et al., 2015). The outcomes of current research were in line with the results of Durrani and Kamal, (2008) who observed that T. orientalis was mostly transferred by Haemaphysalis ticks that have been observed from bovines in Pakistan. Therefore, the T. orientalis pathogen has been observed in Rh. microplus in Vietnam (Khukhuu et al., 2011), in India (Kakati et al., 2015) and Dermacentor nuttalli in Mongolia (Altangerel et al., 2011).
104
4.8. Tick control
Ticks are the important ectoparasite in many tropical and sub-tropical countries of the world. In Pakistan the livestock is also at risk from being infected with several species of tick as well as tick borne diseases that cause important economic loses. It shows one of the foremost restrictions to cost-effective production. It is the vector of significant pathogens due to its direct parasitic actions. Primary process of tick control is the use of synthetic acaricides so, it would be vital to develop tactics to reserve the efficiency of existing acaricides. An extensive variety of acaricides, such as arsenical, organophosphates, chlorinated hydrocarbons, synthetic pyrethroids and carbamates are being applied for controlling cattle ticks (George et al., 2008). As acaricides cause resistance development in ticks, environmental pollution, health hazards in animals and human beings, so this study was proposed to check the efficacy of medicinal plants along with acaricides. In the current study acaricides and medicinal plants were used to control species of tick Hy. anatolicum. The acaricides which used were cypermethrin, emamectin, fipronoil and medicinal plants including C. procera, B. rapa, S. nigrum, C. colocynthis and T. foenum-graecum. These are most abundantly used worldwide. In this study the results in vitro bioassays by adult immersion test showed an efficacy of 100% cypermethrin, fipronoil and emamectin against the ticks. Cypermethrin act on the membrane of nerve cells through re-polarization and close the Na+ channel gates. This action powerfully interrupts the nervous impulses transmission. Emamectin and fipronoil works as a chloride channel activator by binding gamma aminobutyric acid (GABA) receptor and glutamate-gated chloride channels disrupting nerve signals within arthropods (Tingel et al., 2003; Barbara et al., 2005; Singh et al., 2012). At low concentrations insects undergo hyperactive and at high concentrations paralyzed and die. The result obtained strongly suggests that as the concentration of solution and time interval increased the percent mortality also increased. These findigs are in similar with the previous researchers (Petro et al., 2012 & Brito et al., 2011). But with chemical acaricides, control of ticks had become difficult due to the development of resistance (Rajput et al., 2006). However, these chemicals were also lethal and costly (Abbas et al., 2014). Insecticide resistance and toxicity problems had forced researchers to find an alternate to use plants as acaricides. Numerous secondary metabolites are produced from plants to defend themselves from the constant attack of naturally occurring pathogens, pests and
105
insects. (Nithya et al., 2015). Over the earlier few years, the extracts of plant had been extensively used to control ticks, mosquitoes and pests etc. It also kept several bio-efficacies such as ovicidal, repellent and acaricidal activities. In developing countries about 80% populations depend out on traditional medicines for treatment of various abnormartilies in domestic animals as well in humans (FAO, 2004). In Asia more than 6500 species of medicinal plants have been recognized (Rahuman, 2008). In contrast to artificial acaricides, natural herbal mixtures have no residual effect, friendly flora and fauna, can easily biodegradable. The plants have a variety of chemically active components which can disturb the life cycle of the insects, and the plants recognize as an incorporated measure of ethno-veterinary rehearses (Habeeb 2010; Zaman et al. 2012). The probability of using medicinal plants for the control of insects of veterinary significance has been reviewed that a few plants were recognized as most encouraging acaricide against ticks (Ghosh & Ravindran, 2014). The results of current study of phytochemical analysis in selected plants i.e. C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-graceum showed significant phytochemical compounds includings flavonoids, alkaloids, terpenoids, steroids, tanins and saponins.
The previous readings also described the presence of phytochemical or bioactive compounds in selected plants (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum- graceum) (Mishra et al., 2016; Nora et al., 2015; Patil et al., 2015; Tiwari et al., 2014; Benariba et al., 2013; Saddiqe et al., 2013; Shrivastava et al., 2013; Najafi et al., 2010 & Ahmad et al., 2001). The results of current study of plant extract of selected plants C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum-graceum showed significant mortality against the cattle ticks Hy. anatolicum. These selected plants were included in the study on the source of their described acaricidal actions, easily available in the studied area and cost of their usage. The extract of all these plants contained strong anti-tick activity. The mortality data of selected plants showed percent mortality in following order S. nigrum>B. rapa>C. procera> C. colocynthis> T. foenum graecum. The findings of present study showed that mortality of tick was time and concentration dependent. The findings of present study were in line with the results of Morsy et al. (2001) who observed the efficacy of B. rapa and C. procera extracts.
Hydroethanolic extract of root showed up to 20 % mortality in Rh. microplus after 72 hrs of treatment reported by Gosh et al. (2011). Al-Rajhy et al. 2003 described the acaricidal activity
106
of C. procera against camel tick Hy. dromedarii and they observed that the acaricidal activity is due to the inhibition of Na+, K+-ATPase in ticks. The findings of this study were in agreement with the findings of Nithya et al. (2015) and Shyma et al. (2014) who observed the acaricidal activity of C. procera against the tick B. microplus and this activity were related with time and concentration dependent. The results of this study were in line with the results of Durrani et al. (2009) who described that the animals infested with Theleria annulata also treated with C. procera and animals were recovered from the treatment of C. procera. They observed the activity of this plant against all forms of diseases. The latex of C. procera were contained the anthelmintic activity reported by Iqbal et al. (2012). Reported the anthelmintic efficacy and for the cure of parasitic infection (Murti et al., 2015) and (Cavalcante et al., 2016) also described C. procera for the cure of parasites in small ruminants.
In Pakistan the previous studies reported that B. rapa and C. colocynthis had anti- microbial and anti-parasitic activity through (Jabbar et al., 2006; Farooq et al., 2008; Hussain et al., 2008; Sindhu et al., 2010 and Dilshad et al,. 2008). Mirania at al. (2016) reviewed that C. colocynthis were also used to control ecto and endo-parasites of cattle and buffaloes. C. colocynthis B. rapa were used to control the helminthiasis and infestation of different parasites such as ticks, fly and lice described by Sindhu et al. (2012) and Babar et al. (2012) from Bhaker, Pakistan reported B. rapa and C. colocynthis as parasitic activity to control ticks and gastrointestinal parasites from animals. (Ullah et al., 2015) reprted that C. colocynthis have anti- tick and parasitic activity and also assess its acaricidal activity to control Rh. microplus. The results of current study were also in agreement with the results of Sindhu et al. (2012) who described that T. foenum-graecum is used to control infestation of tick.
107
Chapter 5
SUMMARY
Ticks are cosmopolitan in spreading but mostly present in tropical and subtropical areas of world. Pakistan is a tropical country which offers favourable environmental circumstances for growth and development of ticks. Tick animals of Pakistan are rich in number of genera and species. A total of 12,000 ruminants (2800 goats, 2800 sheep, 3200 buffaloes and 3200 cows) were observed from 120 livestock farms from selected 12 districts, covering four agro-ecological zones of Punjab, Pakistan comprised in the study differentiated by urban and rural locality. Ticks were collected from selected animals during four seasons (Spring, Summer, Autumn and Winter) of the year and stored in 70% methanol. Gathered ticks were observed under low power and then highest power amplification of microscope. Identification of different adult ticks was accomplished with the aid of the anatomical and morphologic features in the research lab using dichotomizing and compound microscopes with respect to the guide. Ticks were identified at the species level under a stereoscopic (OPTICA SZM-1: Italy) with 40-fold amplification. The total prevalence of tick-infected animals was 36.52% (4382/12,000). Tick prevalence was considerably least in the Northern zone (33.47%) than the 36.33% Southern, 35.83% Western and 40.43% Central zones, respectively. The overall ten species of ticks were identified i.e. Hy. anatolicum 25.92%, Hy. marginatum 14.05%, Hy. dromedarii 5.62%, Hy. truncatum 2.44%, Hy. rufipes 1.79%, Rh. sanguineus 16.33%, Rh. appendiculatus 12.39%, B. microplus 14.2%, B. decolratus 5.15% and A. percicus 2.02%. Hy. anatolicum and Hy. marginatum were the most pravelent ticks spcies in all selected zones. Argas percicus was found only in Central zone. Hy. truncatum and Hy. rufipes were observed only in Western zone. In all the selected districts multiple species of ticks were found. . The total prevalence of infestation of ticks in all ruminants was 36.52% and it was considerably dissimilar in all species of animal. It was obsrved in buffaloes, cows, goats and sheep 37.53%, 42.41%, 36.14%, 29.00%, respectively. After identification of ticks, 675 species of ticks i.e. (Hy. anatolicum= 341, Hy. marginatum= 20, Hy. dromedarii= 39, Rh. sanguineus= 35, Rh. appendiculatus= 14, B. microplus= 204 and B. decolaratus= 21) tick pools (Southern zone 271, Western zone 98, Central zone 186 and Northern 120) were screened for the existence of DNA TBPs by PCR assay i.e. Theileria, Babesia, Anaplasma, and Ehrlichia species. The prevalence of overall evaluations of TBPs in all
108
agro-ecologic zones was significantly different. Highest prevalence was found in Ehrlichia spp (16%) followed by Anaplasma spp. (9.1%), Theileria spp. (9.03%) and Babesia spp. (4.14%). There was no arithmetical significant difference detected between the Southern zone (41.69%, CI: 35.76-47.82), Western zone (34.69%, CI: 25.36-44.98), Central zone 36.02%, CI: 29.13- 43.37) and Northern zone 37.5%, CI: 28.83-46.80) in the overall tick-borne pathogens prevalence. The 3 species of anaplsma (A. Centrale, A. marginale and A. ovis) and 3 species of babesis namely (B. bigemina, B. bovis and B. caballi) were identified. Moreover, 3 species of theleria (T. annulata, T. ovis and T. orientalis) and 2 species of ehrlichia (E. sp 1 and E. sp. Omatjenne) were identified from four agro-ecologic zones of Punjab, Pakistan. The infection ratio of overall of TBPs was maximum in Hy. anatolicum (43.10%), followed by B. microplus (42.15%), Rh. Sanguineus (28.57%), Hy. dromedarii (28.20%), Hy. marginatum (10%), B. decolaratus (9.5%) and Rh. appendiculatus (7.15%). In the Southern zone, the percentage of infested ticks was higher in Hy. anatolicum (47.26%) followed by B. microplus (31.03%), Rh. sanguineus (27.27%) and B. decolaratus (2.5%), however in the Western zone, B. microplus ticks were found more frequently infested (46.67%) followed by Hy. anatolicum (37.83%), Rh. sanguineus (35.71%), Hy. dromedarii (33.3%), Hy. marginatum (30%) and B. decolaratus (14.28%). In the Central region, the percentage of infested ticks was highest in B. microplus (47.12%) followed by Hy. anatolicum (30.37%), Rh. sanguineus (20%) and Hy. dromedarii (16.67%), however in the Northern region, Hy. anatolicum ticks were observed more frequently infested (48.27%) followed by B. microplus (39.72%), Hy. dromedarii (33.34%) and Rh. sanguineus (20%). It was concluded that there is broad diversity of ticks and TBPs is existent in Pakistan as compared to especially in previous studies reported. The ticks were mostly controlled by chemicals but in present study the significantly results showed that ticks can be controlled by the extracts of selected plant (C. procera, C. colocynths, B. rapa, S. nigrum and T. foenum- graceum) used in the study. It is estimated that the consequences of this research will be suitable in the development of incorporated control policies for ticks and TBDs in Pakistan.
109
Conclusion
The research was aimed to check the prevalence of ticks and tick-borne pathogens in Punjab, Pakistan.
Following conclusions were drawn from this study
From the different animal species i.e. buffaloes, cows, goats and sheep of Punjab, ten tick species belonging to four genera i.e. Hy. anatolicum followed by B. microplus, Hy. marginatum, Hy. dromedarii, Rh. sanguineus, Rh. appendiculatus and B. decolaratus, Hy. rufipes, Hy. truncatum and Argas percicus were found. From the study results, we revealed that Argas percicus was found only in Central zone of Punjab, while Hy. rufipes, Hy. truncatum were found only in Western zone. We concluded that Hy. anatolicum followed by B. microplus, Hy. marginatum were most dominant ticks on infected animals of these zones. The results revealed that the prevalence of tick infestation was related with ruminants types, season and research zone. Highest tick prevalence was observed in Summer season followed by Spring, Autumn and Winter. The results of PCR assay confirmed the presence of Theleria, Babesia, Anaplasmoisis and Ehrlichia species isolated from several species of ticks from all selected zones of Punjab. Hy. anatolicum and B. microplus are the main vectors of these pathogens. The use of acaricides (cypermethrin, emamectin and fipronoil) revealed 100% mortality against Hy. anatolicum. The use of extracts of selected plants (C. procera, B. rapa, C. colcynthis, S. nigrum and T. foenum-graceum) showed significant mortality (85%) against Hy. anatolicum. Phytochemical analysis of selected plants showed significant presence of phytochemical compounds (flavonoids, alkaloids, terpenoids, steroids, tanins and saponins). It is concluded that the chance of drug resistance against plants extract is lower than the chemical acaricides. Consequently, medicinal plants extract are used for the management of livestock parasitism. In developing countries this method is appropriate to control ticks and much more economical as compared to using acaricides.
110
Recommendations
After a comprehensive study on the ticks prevalence, tick-borne pathogens and control measure it could be recommended that
More sensitive analytical techniques (RLB) should be used to investigate epidemiological research. Awareness about the ticks and tick-borne pathogens should be given to livestock owners to reduce infestation. The mode of transmission of different pathogens should be investigated through experimental studies. The combined livestock husbandry with an open farming system and rural poultry should be stimulated in small dairy owners to meet the challenge of optimum environmental conditions in Pakistan. In Pakistan CCHF virus is prevalent and its main vector i.e. Hyalomma ticks, is spread throughout the country. Hence, however eradicating ticks physically, attention should be assumed to the possible danger to humans due to the potential existence of CCHF virus in the ticks. More significantly, alertness programs should be arranged to notify farmers about the prospect of CCHF transmission through ticks. Furthermore, ticks should be observed for the existence of CCHF virus. Since the most of the recognized Ehrlichia species cause human diseases, it is recommended that more research should be conducted to identify about their vector- competence of different tick species, the pathogenicity of the identified Ehrlichia species and latent suggestions to the health of animal and human. Moreover, human and veterinary sciences should deliberate ehrlichiosis between the differential diagnoses when tick-borne diseases are doubted. The acaricidal resistance in ticks should be evaluated in Pakistan. The alternative sources like medicinal plants (whole arial parts at flowering stage) should be used to control infestation of ticks in animals The farmer can also use concentrated aqueous extract of these plants to control ticks. The movement of animals particularly from bordering areas into the country should be prohibited. The imported animals should be screened out for the presence of TBD before entering in Pakistan. 111
REFERENCES Abbas, R. Z., Zaman, M. A., Colwell, D. D., Gilleard, J., & Iqbal, Z. (2014). Acaricide resistance in cattle ticks and approaches to its management: The state of play. Veterniary Parasitology, 203(1-2), 6-20. Abbas, G., Mughal, M. N., Munir, A., & Azeem, W. (2015). Lahore canine fever in a racing greyhound. Advances in Animal and Veterinary Sciences, 3, 332-333.
Abbott, W. S. (1925). A method of computing the effectiveness of an insecticide. Journal of Economic Entomology, 18(2), 265-267. https://doi.org/10.1093/jee/18.2.265a
Adenubi, O. T., Fasina, F. O., McGawa, L. J., Eloff, J. N., & Naidoo, V. (2016). Plant extracts to control ticks of veterinary and medical importance: A review. South African Journal of Botany, 105, 178-193. Admassu, B., Yeneneh, H., Shite, A., Haile, B., & Mohammed, S. (2015). Prevalence and identification of major Ixodid tick genera of cattle in Dangila district, Awi Zone, North West Ethiopia. Acta Parasitologica Globalis, 6(2), 129-135. Aguiar, D. M., Ziliani, T. F., Zhang, X., Melo, A. L. T., Braga, I. A., Witter, R., Freitas, L. C., Rondelli, A. L. H., Luis, M. A., Sorte, E. C. B., Jaune, F. W., Santarém, V. A., Horta, M. C., Pescador, C. A., Colodel, E. M., Soares, H. S., Pacheco, R. C., Onuma, S. S. M., Labruna, M. B., & McBride, J. W. (2014). A novel Ehrlichia genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. Ticks Tick Borne Diseases, 5, 537-44. Ahmad, I., Khawja, A., Shams, S., Ayaz, S., Khan, S., & Akbar, N. 2014. Detection of babesiosis and identification of associated ticks in cattle. International Journal Bioassays, 3, 3195-3199.
Ahmed A. H., Kamal I. H., & Ramzy, R. M. (2001). Studies on the molluscicidal and larvicidal properties of Solanum nigrum L. leaves ethanol extract. Journal of the Egyptian Society of Parasitology, 31(3), 843-52.
Akbar, H., Rashid, M. I., Shehzad, W., Saeed, K., & Oneeb, M. (2014). Parasitic Challenges to booming dairy industry of Pakistan. Science International, (Lahore), 26(3), 1201-1204.
112
Aktas, M., & Ozubek, S. (2015). Molecular and parasitological survey of bovine piroplasms in the black sea region, including the first report of babesiosis associated with Babesia divergens in Turkey. Journal of Medical Entomology, 52, 1344-50. Aktas, M., Altay, K., & Dumanli, N. (2011). Molecular detection and identification of Anaplasma and Ehrlichia species in cattle from Turkey. Ticks and Tick Borne Diseases, 2, 62-65. Aktas, M., Vatansever, Z., & Ozubek, S. (2014). Molecular evidence for trans-stadial and transovarial transmission of Babesia occultans in Hyalomma marginatum and Rhipicephalus turanicus in Turkey. Veterniary Parasitology, 204, 369-371. Ali, S., Ijaz, M., Durrani, A. Z., Maqbool, A., Ali, M. M., & Mehmood, K. (2016). Epidemiological aspects of bovine tick infestation in the river Ravi region, Lahore. Pakistan Journal of Zoology, 48(2), 563-567. Ali, Z., Maqbool, A., Muhammad, K., Khan, M. S., & Younis, M. (2013). Prevalence of Theileria annulata infected hard ticks of cattle and buffalo in Punjab, Pakistan. Journal of Animal and Plant Sciences, 23(1), 20-26.
Alim, M. A., Das, S., Roy, K., Masuduzzaman, M., Sikder, S., Hassan, M. M., Siddiki, A. Z., & Hossain, M. A. (2011). Prevalence of hemoprotozoan diseases in cattle population of Chittagong division, Bangladesh. Pakistan Veterinay Journal, 32(2), 221-224.
Allardice. P. (1993). A - Z of Companion Planting. Cassell Publishers Ltd. Allsopp, M., Visser, E. S., du Plessis, J. L., Vogel, S. W., & Allsopp, B. A. (1997). Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences. Veterniary Parasitology, 71, 283-300. Alonso, D. M. A., Lopez, S. B. J., Leme, D. L. A. C., & Rodriguez, V. R. I. (2007). Infestacion natural de hembras de Boophilus microplus Canestrini, 1887 (Acari: Ixodidae) en dos genotipos de bovinos en el tropico humedo de Veracruz, Mexico. Veterniary Mexico, 38, 503-509. Al-Rajhy, D. H., Alahmed, A. M., Hussein, H. I., & Kheir, S. M. (2003). Acaricidal effects of cardiac glycosides, azadirachtin and neem oil against the camel tick, Hyalomma dromedarii (Acari: Ixodidae). Pest Management Sciences, 59, 1250-1254.
113
Altangerel, K., Battsetseg, B., Battur, B., Sivakumar, T., Batmagnai, E., Javkhlan, G., Tuvshintulga, B., Igarashi, I., Matsumoto, K., Inokuma, H., & Yokoyama, N. (2011). The first survey of Theileria orientalis infection in Mongolian cattle. Veterniary Parasitology, 182, 343-348. Altay, K., Aktas, M., Dumanli, N., & Aydin, M. F. (2008). Evaluation of a PCR and comparison with RLB for detection and differentiation of Theileria sp. MK and other Theileria and Babesia species of small ruminants. Parasitology Research, 103, 319-23. Aparna, M., Ravindran, R., Vimalkumar, M. B., Lakshmanan, B., Rameshkumar, P., Kumar, K. G. A., Promod, K., Ajithkumar, S., Ravishankar, C., Devada, K., Subramanian, H., George, A. J., & Ghosh, S. (2011). Molecular characterization of Theileria orientalis causing fatal infection in crossbred adult bovines of South India. Parasitology International, 60, 524-529. Apanaskevich, D., & Horak, I. (2005). The genus Hyalomma Koch, 1844. II. Taxonomic status of H. (Euhyalomma) anatolicum Koch, 1844 and H. (e.) excavatum Koch, 1844 (Acari, Ixodidae) with redescriptions of all stages. Acarina 13, 181-197. Appleby, M., Cussen, V., Garcés, L., Lambert, L., & Turner, J. (Eds.). (2008). Long distance transport and welfare of farm animals. CAB International, London, 480p. Ashfaq M., Razzaq, A., Shamsheer-ul-Haq., & Muhammad, G. (2015). Economic analysis of dairy animal diseases in Punjab: a case study of Faisalabad district. The Journal of Animal & Plant Sciences, 25(5), 1482-1495. Ashraf, Q. U. A., Khan, A. U., Khattak, R. M., Ali, M., Shaikh, R. S., Ali, M., & Iqbal, F. (2013). A report on the high prevalence of Anaplasma spp. in buffaloes from two provinces in Pakistan. Ticks and Tick-borne Diseases, 4, 395-398.
Aslam, B., Hussain, I., Zahoor, M. A., Mahmood, M. S., & Rasool, M. H. (2015). Prevalence of Borrelia anserina in Argas ticks. Pakistan Journal of Zoology, 47, 1125-1131.
Asmaa, N. M., ElBably, M. A., & Shokier, K. A. (2014). Studies on prevalence, risk indicators and control options for tick infestation in ruminants. Beni-suef University Journal of Basic and Applied Chemistry, 3, 68-73. Atif, F. A., Khan, M, S., Iqbal, H. J., Arshad, G. M., Ashraf, E., & Ullah, S. (2012). Prevalence of Anaplasma marginale, Babesia bigemina and Theileria annulata infections among
114
cattle in Sargodha district, Pakistan. African Journal of Agricultural Research, 7(22), 3302-3307.
Atif, F. A., Khan, M. S., Roheen, T., Muhammad, F., Younus, M., Avais, M., & Ullah, S. (2013). Seroprevalence of anaplasma marginale infection among cattle from three districts of the Northern Punjab, Pakistan. Journal of Animal and Plant Sciences, 23(4), 995-998.
Avinash, B., Supraja, N., Prasad, T. N. V. K. V., & Priya, C. S. (2017). Evaluation of acaricidal activity of Azadirachta indica extracts against Rhipicephalus (Boophilus) microplus and its GC-MS analysis. International Journal of Science, Environment and Technology, 6(1), 980-992. Babar, W., Iqbal, Z., Khan, M. N., & Muhammad, G. (2012). An inventory of the plants used for parasitic ailments of animals. Pakistan Veterniary Journal, 32(2), 183-187.
Baek, B. K., Soo, K. B., Kim, J. H., Hur, J., Lee, B. O., Jung, J. M., Onuma, M., Oluoch, A. O., Kim, C. H., & Kakoma, I. (2003). Verification by polymerase chain reaction of vertical transmission of Theileria sergenti in cows. Canadian Journal of Veterinary Research journal, 67, 278-82. Barbara, G. S., Zube, C., Rybak, J., Gauthier, M., & Grünewald, B. (2005). Acetylcholine, GABA and glutamate induce ionic currents in cultured antennal lobe neurons of the honeybee, Apis mellifera. Journal of comparative physiology, 191, 823-836. Bargah, R. K. (2015). Preliminary test of phytochemical screening of crude ethanolic and aqueous extract of Moringa pterygosperma Gaertn. Journal of Pharmacognosy and Phytochemistry, 4(1), 07-09.
Barghash, S. M., Darwish, A. M., & Abou-ElNaga, T. R. (2016). Molecular Characterization and Phylogenetic Analysis of Trypanosoma evansi from Local and Imported Camels in Egypt. Journal of Phylogenetics & Evolutionary Biology 4, 3. DOI: 10.4172/2329- 9002.1000169
Bekker, C. P., de Vos, S., Taoufik, A., Sparagano, O. A., & Jongejan, F. (2002). Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Veterinary Microbiology, 89, 223-238..
115
Benariba, N., Djaziri, R., Bellakhdar, W., Belkacem, N., Kadiata, M., Malaisse, W. J., & Sener, A. (2013). Phytochemical screening and free radical scavenging activity of Citrullus colocynthis seeds extracts. Asian Pacific Journal of Tropical Biomedicine, 3(1), 35-40. Bilgic, H. B., Bakırcı, S., Kose, O., Unlu, A. H., Hacılarlıoglu, S., Eren, H., Weir, W., & Karagenc, T. (2017). Prevalence of tick-borne haemoparasites in small ruminants in Turkey and diagnostic sensitivity of single-PCR and RLB. Parasites & Vectors, 10, 211. Bilgic, H. B., Karagenc, T., Shiels, B., Tait A., Eren, H., & Weir, W. (2010). Evaluation of cytochrome b as a sensitive target for PCR based detection of T. annulata carrier animals. Veterniary Parasitology, 174, 341-347.
Bilgic, H. B., Karagenc, T., Simunza, M., Shiels, B., Tait A., Eren, H., & Weir, W. (2013). Development of a multiplex PCR assay for simultaneous detection of Theileria annulata, Babesia bovis and Anaplasma marginale in cattle. Experimental Parasitology, 133(2), 222-229.
Bishop, R., Odongo, D., Mann, D., Pearson, T., Sugimoto, C., Haines, L., Al., E. (2009). Theileria. In: Nen, V., Kole, C. (Eds.), Genome Mapping and Genomics in Animal- Associated Microbes. Berlin Heidelberg: Springer, pp. 191-231. Bram, R. A. (2016). World Animal Review. URL http://www.fao.org/docrep/004/x6538e/x6538e02.htm (accessed 5.2.16). Brito, L. G., Barbieri, F. S., Rocha, R. B., Oliveira, M. C. S., & Ribeiro, E. S. (2011). Evaluation of the efficacy of ecaricides used to control the cattle tick, Rhipicephalus microplus, in dairy herds raised in the Brazilian SouthWestern Amazon. Veterinary Medicine International, 6 pages. Bursali, A., Keskin, A., & Tekin, S. (2013). Ticks (Acari: Ixodida) infesting humans in the provinces of Kelkit Valley, a Crimean-congo hemorrhagic fever endemic region in Turkey, Experimental & Applied Acarology, 59(4), 507-15. Cabezas-Cruz, A., Zweygarth, E., Broniszweska, M., Passos, L. M. F., Ribeiro, M. F. B., Manrique, M., Tobes, R., & de la Fuente, J. (2015). Complete Genome Sequence of Ehrlichia mineirensis, a Novel Organism Closely Related to Ehrlichia canis with a New Host Association. Genome Announcement, 3(1), e01450-14. doi: 10.1128/genomeA.01450-14
116
Carter, P. D., & Rolls, P. (2015). Babesiosis: Blood Parasites: The Merck Veterinary Manual, 5, 2-16. Cavalcante, G. S., De Morais, S. M., Andre, W. P., Ribeiro, W. L., Rodrigues, A. L., De Lira, F. C., Viana, J. M., & Bevilaqua, C. M. (2016). Chemical composition and in vitro activity of Calotropis procera (Ait.) latex on Haemonchus contortus. Veterniary Parasitology, 226, 22-25.
Chaisi, M. E., Collins, N. E., Potgieter, F. T., & Oosthuizen, M. C. (2013). Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer), Veterinary Parasitology, 191, 132-137. Chansiri, K., & Bagnara, A. S. (1995). The structural gene for carbamoyl phosphate synthetase from the protozoan parasite. Babesia bovis. Molecular Biochemistry Parasitology, 74,
239-43. Chaudhry, Z. I., Suleman, M., Younus, M., & Aslim, A. (2010). Molecular detection of Babesia bigemina and Babesia bovis in crossbred carrier cattle through PCR. Pakistan Journal of Zoology, 42(2), 201-204. Chawech, R., Mhalla, D., Trigui, M., Mihoubi, M., Fabre, N., & Jarraya, R. (2015). Chemical composition and antibacterial activity of extracts and compounds isolated from Citrullus colocynthis (L.) Schrad. Journal of Pharmacognosy and Phytochemistry, 4(4), 197-203. Chen, Z., Liu, Q., Liu, J., Xu, B., Lv, S., Xia, S., & Zhou, X. (2014). Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in central China. Parasites & Vectors, 7, 237. Chhabra, R. E., & Donora. N. (1994). Ectoparasites of poultry in Zimbabwe and their control. Zimbabwe Veterniary Journal, 25, 26-32.
Chhillar, S., Chhilar, J. S., & Kaur, H. (2014). Investigations on some hard ticks (Acari: Ixodidae) infesting domestic buffalo and cattle from Haryana, India. Journal of Entomology and Zoology Studies, 2(4), 99-104.
Coventry. B. O. (1923). Wild Flowers of Kashmir Raithby, Lawrence and Co. London. A nice little pocket guide to 50 wildflowers of Kashmir. Cruz, A. C., Zweygarth, E., Ribeiro, M. F. B., da Silveira, J. A. G., de la Fuente, J., Grubhoffer, L., Valdés, J. J., & Passos, L. M. F. (2012). New species of Ehrlichia isolated from
117
Rhipicephalus (Boophilus) microplus shows an ortholog of the E. canis Major immunogenic glycoprotein gp36 with a new sequence of tandem repeats. Parasite & Vectors, 5, 291. da Silva, J. A. T., & Hussain, A. I. (2017) Citrullus colocynthis (L.) Schrad. (colocynth): Biotechnological perspectives. Emirates Journal of Food and Agriculture, 29(2), 83-90. Dantas-Torres, F., Chomel, B. B., & Otranto, D. (2012). Ticks and Tick-borne diseases: a One Health perspective. Trends Parasitology, 28, 437-446. Das, M., & Konar, S. (2013). Clinical and hematological study of canine Ehrlichiosis with other hemoprotozoan parasites in Kolkata, West Bengal, India. Asian Pacific Journal of Tropical Biomedicine, 3, 913-915. de Castro, J., 1997. Sustainable tick and tickborne disease control in livestock improvement in developing countries. Veterniary Parasitology, 71, 77-97. de La Fuente, J., Kocan, K. M., & Contreras, M. (2015). Prevention and control strategies for ticks and pathogen transmission. Revue Scientifique Et Technique, 34, 249-64. Decaro, N., Larocca, V., Parisi, A., Losurdo, M., Lia, R. P., Greco, M. F., Miccolis, A., Ventrella, G., Otranto, D., & Buonavoglia, C. (2013). Clinical bovine piroplasmosis caused by Babesia occultans in Italy. Journal of Clinical Microbiology, 51, 2432-4. Demessie, Y., & Derso, S. (2015). Tick borne hemoparasitic diseases of ruminants: A Review. Advances in Biological Research, 9 (4), 210-224.
Dilshad, S. M. R., Rehmana, N. U., Iqbal, Z., Muhammad, G., Iqbal, A., & Ahmad, N. (2008). An inventory of the ethnoveterinary practices for reproductive disorders in cattle and buffaloes, Sargodha district of Pakistan. Journal Ethnopharmacology, 117, 393-402
Dinesh, S., & Gopal, G. (2014). A comparative phytochemical screening of various plants of India. Journal of Medical Pharmaceutical and Allied Sciences, 02, 37-46. Dipeolu, O. O., & Amoo, A. (1984). The presence of kinetes of a Babesia species in the haemolymph smears of engorged hyalomma ticks in Nigeria. Veterniary Parasitology, 17, 41-46. Diyes, G. C. P., & Rajakaruna, R. S. (2015). Diversity and distribution of tick species infesting goats with two new host records from Sri Lanka. Journal of National Science Foundation of Sri Lanka, 43(3), 225-234.
118
Doudier, B., Olano, J., Parola, P., & Brouqui, P. (2010). Factors contributing to emergence of Ehrlichia and Anaplasma spp. as human pathogens. Veterniary Parasitolog, 167, 149- 154. Durrani, A. A., Maqbool, A., Mahmood, N., Kamal, N., & Shakoori, A. R. (2009). Chemotherapeutic trials with Calotropis procera against experimental infection with Theileria annulata in Cross Bred Cattle in Pakistan. Pakistan Journal of Zoology, 41(5), 389-397.
Durrani, A. Z., & Shakoori, A. R. (2009). Study on ecological growth conditions of cattle Hyalomma ticks in Punjab, Pakistan. Iranian Journal Parasitology, 4(1), 19-25.
Durrani, A. Z., Ahmad, M., Ashraf, M., Khan, M. S., Khan, J. A., Kamal, N., & Mumtaz, N. (2008). Prevalence of theileriosis in buffaloes and detection through blood smear examination and Polymerase Chain Reaction test in district Lahore. Journal of Animal and Plant Sciences, 18, 2-3.
Durrani, A. Z., & Kamal, N., 2008. Identification of ticks and detection of blood protozoa in friesian cattle by polmerase chain reacton test and estimation of blood parameters in district Kasur, Pakistan. Journal of Animal Health and Production, 40, 441-447. Durrani, A. Z., Shakoori, A. R., & Kamal, N. (2008). Bionomics of Hyalomma ticks in three districts of Punjab, Pakistan. Journal of Animal and Plant Sciences, 18(1), 17-23.
Eamens, G. J., Gonsalves, J. R., Jenkins, C., Collins, D., & Bailey, G. (2013). Theileria orientalis MPSP types in Australian cattle herds associated with outbreaks of clinical disease and their association with clinical pathology findings. Veterinary Parasitology, 191, 209-217. Ehounoud, C. B., Yao, K. P., Dahmani, M., Achi, Y. L., Amanzougaghene, N., Kacou, N., Douba, A. N., Guessan, J. D., Raoult, D., Fenollar, F., & Mediannikov, O. (2016). Multiple Pathogens Including Potential New Species in Tick Vectors in Côte d‟Ivoire. PLOS Neglected Tropical Diseases, 10(1), e0004367. doi: 10.1371/journal.pntd.0004367. Elimam, A. M., Elmalik, K. H., & Ali, F. S. (2009). Larvicidal, adult emergence inhibition and oviposition deterrent effects of foliage extract from Ricinus communis L. against
119
Anopheles arabiensis and Culex quinquefasciatus in Sudan. Tropical Biomedicine, 26, 130-139. Ellis, J., Hefford, C., Baverstock, P. R., Dalrymple, B. P, Johnson, A. M. (1992). Ribosomal DNA sequence comparison of Babesia and Theileria. Molecular and Biochemical Parasitology, 54, 87-96. Estrada-Peña, A., Bouattour, A., Camicas, J. L., Guglielmone, A., Horak, I., Jongejan, F., Latif, A., Pegram, R., & Walker, A. R. (2006). The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodidae) in Africa and Latin America. Experimental and Applied Acarology, 38, 219-235. Estrada-Pena, A., Bouattour, A., Camicas, J., Walker, A., 2004. Ticks of Domestic Animals in the Mediterranean Region. A Guide to Identification of species. University of Zaragoza, Spain. FAO, (2004). Pakistan Livestock Sector Survey Report No. 32/74/Pak/7, pp: 11-14. FAO/World Bank Cooperative Programme, Italy. Farooq, Z., Iqbal, Z., Mushtaq, S., Muhammad, G., Iqbal, M. Z., & Arshad, M. (2008). Ethnoveterinary practices for the treatment of parasitic diseases in livestock in Cholistan desert (Pakistan). Journal Ethnopharmacology, 118, 213-219. Figueroa, J., L‟Hostis, M., Camus, E., 2010. Bovine babesiosis. In: Lefevre, P.-C., Blancou, J., Chermette, R., Uilenberg, G. (Eds.), Infectious and Parasitic Diseases of Livestock: Bacterial Diseases, Fungal Diseases, Parasitic Diseases. Lavoisier, Paris, France, pp. 1819-38. Finney, D. J. (1971) Probit Analysis. 3rd Edition, Cambridge University Press, Cambridge.
Gajadhar, A. A., Lobanov, V., Scandrett, W. B., Campbell, J., & Al-Adhami, B. (2010). A novel Ehrlichia genotype detected in naturally infected cattle in North America. Veterniary Parasitology, 173, 324-9. Ganjali, M., Dabirzadeh, M., & Sargolzaie, M. (2014). Species diversity and distribution of ticks (Acari: Ixodidae) in Zabol Country, Eastern Iran. Journal of Arthropod-Borne Diseases, 8(2), 219-223. George, J., Pound, J., & Davey, R. (2008). Acaricides for controlling ticks on cattle and the problem of acaricidal resistance. In: Bowman, A., Nuttall, P. (Eds.), Ticks: Biology, Disease and Control. Cambridge, UK, pp. 408-423.
120
Gharekhani, J., Gerami-Sadeghian, A., Sadeghi-Dehkordi, Z., & Youssefi, M. (2015). Determination of hard tick species (Acarina: Ixodidae) on sheep and cattle in Hamedan Province, Iran. Journal of Coastal Life Medicine, 3(8), 612-615.
Ghosh, S., & Nagar, G. (2014). Problem of ticks and tick-borne diseases in India with special emphasis on progress in tick control research. Journal of Vector Borne Diseases, 51, 259-270.
Ghosh, S., & Ravindran, R. (2014). Progress in the development of plant bopesticides for the control of arthropods of veterinary importance. Advances in Plant Biopesticides, 207- 241. Ghosh, S., Bansal, G. C., Gupta, S. C., Ray, D., Khan, M. Q., Irshad, H., Shahiduzzaman, M., Seitzer, U., & Ahmed, J. S. (2007). Status of tick distribution in Bangladesh, India and Pakistan. Parasitology Research, 101 Suppl, S207-16. Ghosh, S., Sharma, A. K., Kumar, S., Tiwari, S. S, Rastogi, S., Srivastava, S., Singh, M., Kumar, R., Paul, S., Ray, D. D., Chaudhri, P., & Rawat, A. K. S. (2011) In vitro and in vivo efficacy of Acorus calamus extract against Rhipicephalus (Boophilus) microplus. Parasitology Research, 108, 361-370. Gosh, S., Tiwari, S. S., Kumar, B., Srivastava, S., Sharma, A. K, Kumar, S., Bandyopadhyay, A., Julliet, S., Kumar, R., & Rawat, A. K. (2015). Identification of potential plant extracts for anti-tick activity against acaricide resistant cattle ticks, Rhipicephalus (Boophilus) microplus (Acari: Ixodidae). Experimental and Applied Acarology, 66(1), 159-71.
Gray, J. S., & De Vos, A. J. (1981). Studies on a bovine Babesia transmitted by Hyalomma marginatum rufipes Koch, 1844. Onderstepoort. Journal of Veterniary Research, 48, 215-23. Greenfield, B. P. J. (2011). Environmental parameters affecting tick (Ixodes ricinus) distribution during the Summer season in Richmond Park, London. The International Journal of Student Research, 4(2, 1), 140-148. Gubbels, J. M., de Vos, A. P., van der Weide, M., Viseras, J., Schouls, L. M., de Vries, E., & Jongejan, F. (1999). Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. Journal of Clinical Microbiology, 37, 1782-9.
121
Guclu, H. Z., & Karaer, K. Z. (2007). Detection of Babesia caballi (Nuttall, 1910) and Theileria equi (syn Babesia equi, Laveran, 1901) by polymerase chain reaction (PCR) in show and sport horses in the region of Ankara. Turkish Journal of Parasitology, 31(2), 89-93. Guglielmone, A. A., Robbins, R. G., Apanaskevich, D. A., Petney, T. N., & Estrada-Pena A. (2010). The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list of valid species names. Zootaxa, 2528, 1-28.
Gurudeeban, S., Satyavani, K., & Ramanathan, T. (2010). "Bitter Apple (Citrullus colocynthis): An Overview of Chemical Composition and Biomedical Potentials". Asian Journal of Plant Sciences, 9(7), 394-401.
Habeeb, S. M. (2010) Ethno-veterinary and medical knowledge of crude plant extracts and its methods of application (traditional and modern) for tick control. Journal of World Applied Sciences, 11, 1047-1054.
Hibasami, H., Moteki, H., Ishikawa, K., Katsuzaki, H., Imai, K., Yoshioka, K., Ishii, Y., & Komiya, T. (2003). "Protodioscin isolated from fenugreek (Trigonella foenumgraecum L.) induces cell death and morphological change indicative of apoptosis in leukemic cell line H-60, but not in gastric cancer cell line KATO III." International Journal of Molecular Medicine, 11(1), 23-26.
Hossain, M., Bhuiyan, M. D. U., & Digonto, M. T. H. I. (2016). Epidemiology of Ecto-Parasitic Infestation of Cattle in Milk Shed Areas of Baghabari of Shahjadpur Upazila of Sirajgonj District, Bangladesh. The Journal of Advances in Parasitology, 3(2), 56-60.
Hosseini-Chegeni, A., Hosseini, R., Tavakoli, M., Telmadarraiy, Z., & Abdigoudarzi, M. (2013). The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species. Persian Journal of Acarology, 2(3), 503-529. Hussain, A. I., Rathore, H. A., Sattar, M. Z. A., Chatha, S. A. S., Sarker, S. D., & Gilani, A. H. (2014). Citrullus colocynthis (L.) Schrad (bitter apple fruit): A review of its phytochemistry, pharmacology, traditional uses and nutritional potential. Journal of Ethnopharmacology, 155(1), 54-66.
122
Hussain, S. I., & Kumar, G. A. (1985). The incidence of ticks (Ixodidea: Ixodidae) infesting sheep and goats in Sind province, Pakistan. Pakistan Journal of Zoology, 17, 89-97. Iqbal, A., Sajid, M. S., Khan, M. N., & Khan, M. K. (2013). Frequency distribution of hard ticks (Acari: Ixodidae) infesting bubaline population of district Toba Tek Singh, Punjab, Pakistan. Parasitology Research, 112, 535-541. Iqbal, A., Siddique, F., Fatima, N., & Saleem, I. (2015). Tick infestation in sheep: prevalence, associated determinants and in vivo chemotherapeutic control in Central Punjab, Pakistan. Scholar’s Advances in Animal and Veterinary Research, 2(1), 41-54.
Iqbal, A., Siddique, F., Mahmood, M. S., Shamim, A., Zafar, T., Rasheed, I., Saleem, I., & Ahmad, W. (2014). Prevalence and impacts of ectoparasitic fauna infesting goats (Capra hircus) of district Toba Tek Singh, Punjab, Pakistan. Global Veterinaria, 12(2), 158-164.
Iqbal, F., Khattak, R. M., Ozubek, S., Khattak, M. N. K., Rasul, A., & Aktas, M. (2013). Application of the reverse line blot assay for the molecular detection of Theileria and Babesia sp. in sheep and goat blood samples from Pakistan. Iranian Journal of Parasitology, 8, 289-295. Iqbal, Z., Babar, W., Sindhu, Z. D., Abbas, R. Z., & Sajid, M. S. (2012). Evaluation of anthelmintic activity of different fractions of Azadirachta indica A. Juss seed extract. Pakistan Veterinary Journal, 32, 579-583
Irshad, N., Qayyum, M., Hussain, M., & Khan, M. Q. (2010). Prevalence of tick infestation and theileriosis in sheep and goats. Pakistan Veterniary Journal, 30(3), 178-180.
Islam, M. K., Alim, M. A. Tsuji, N., & Mondal, M. (2006). An investigation into the distribution, host- preference and population density of ixodid ticks affecting domestic animals in Bangladesh. Tropical Animal Health Production, 38, 485-490. Islam, M. K., Jabbar, A., Campbell, B. E., Cantacessi, C., & Gasser, R. B. (2011). Bovine theileriosis an emerging problem in south-eastern Australia. Infection Genetic Evoloution, 11, 2095-2097. Jabbar, A., Abbas, T., Sandhu, Z. U. D. U., Saddiqi, H. A., Qamar, M. F., & Gasser, R. B. (2015). Tick-borne diseases of bovines in Pakistan: major scope for future research and improved control. Parasites & Vectors, 8, 283.
123
Jabbar, A., Raza, M. A., Iqbal, Z., & Khan, N. (2006). An inventory of the ethnobotanicals used as anthelmintics in the Southern Punjab (Pakistan). Journal Ethnopharmacology, 108, 152-4. Jabin, F., & Nasreen, S. (2016). Phytochemical analysis of some medicinal plants. International Journal of Applied Research, 2(8), 293-295. Jalali, S. M., Khaki, Z., Kazemi, B., Bandehpour, M., Rahbari, S., Razi Jalali, M., & Yasini, S. P. (2013). Molecular detection and identification of Anaplasma species in sheep from Ahvaz, Iran. Iranian Joural Veterniary Research, 14, 50-56. Javed, K., Ijaz, M., Ali,M. M., Khan, I., Mehmood, K., & Ali, S. (2014). Prevalence and hematology of tick borne hemoparasitic diseases in equines in and around Lahore. Pakistan Journal of Zoology, 46(2), 401-408.
Jongejan, F., & Uilenberg, G. (2004). The Global importance of ticks. Parasitology, 129, 3-14.
Jonsson, N. N., Mayer, D. G., Matschoss, A. L., Green P. E., & Ansell, J. (1998). Production effects of cattle tick (Boophilus microplus) infestation of high yielding dairy cows. Veterniary Parasitology, 78, 65-77.
Joshi, R., & Rajni, M. (2007). "Lipid profile of rats fed on domestically processed fenugreek. Journal of Food Science and Technology, 44(5), 542-544.
Kabir, M. H. B., Mondal, M. M. H., Eliyas, M., Mannan, M. A., Hashem, M. A., & Debnath, N. C. (2011). An epidemiological survey on investigation of tick infestation in cattle at Chittagong district, Bangladesh. African Journal Microbiology Research, 5, 346-352. Kakati, P., Sarmah, P. C., Ray, D., Bhattacharjee, K., Sharma, R. K., Barkalita, L.M., Sarma, D. K., Baishya, B. C., Borah, P., & Stanley, B. (2015). Emergence of oriental theileriosis in cattle and its transmission through Rhipicephalus (Boophilus) microplus in Assam, India. Veterniary world, 8, 1099-104. Kamboj, A., & Pathak, H. (2013). Crimean-Congo hemorrhagic fever: a comprehensive review. Veterinary World, 6(10), 812-817. Karim, S., Budachetri, K., Mukherjee, N., Williams, J., Kausar, A., Hassan, M. J., Adamson, S., Dowd, S. E., Apanskevich, D., Arijo, A., Sindhu, Z., Kakar, M. A., Khan, R. M. D.,
124
Ullah, S., Sajid, M. S., Ali, A., & Iqbal, Z. (2017). A study of ticks and tick-borne livestock pathogens in Pakistan. PLOS Neglected Tropical Diseases, 11(6), 1-17. Katuri R. N., Das, G., Chalhotra S. K., & Singh A. K. (2013). Analysis of site of prediliction for the ticks of family ixodidae. International Journal of Food, Agriculture and Veterinary Sciences, 3(2), 42-46.
Kaur, D., Jaiswal, K., & Mishra, S. (2015). Studies on Prevalence of ixodid ticks infesting cattle and their control by plant extracts. Journal of Pharmacy and Biological Sciences. 10(6), 01-11.
Kemal, J., Tamerat, N., & Tuluka, T. (2016). Infestation and identification of ixodid tick in cattle: the case of Arbegona district, Southern Ethiopia. Journal of Veterinary Medicine, 8 pages. doi.org/10.1155/2016/9618291 Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., & Khan, A. (2013). Tick infestation rate in cattle and buffalo in different areas of Khyber Pakhtunkhwa. Journal of Veterinary Animal Sciences, 3, 31-35. Khan, A., Mushtaq, M. H., Ahmad, M., Tipu, Y., Khan, A., & Munibullah. (2016). Tick infestation rate in cattle and buffalo in different areas of Khyber Pakhtunkhwa, Pakistan. Journal of Animal and Plant Sciences, 3(1-2), 31-35.
Khan, A., Rehman., A. U., Hisham, M., Khan, A. Z., Rehman., H. U., Khan, M. I., Quershi, M. F., & Ameen, M. A. (2016). Burden of babesiosis among domestic cattle of Southern Khyber Pakhtunkhwa, Pakistan. Journal of Entomology and Zoology Studies, 4(5), 305- 307.
Khan, M. N., Hayat, C. S., Iqbal, Z., Hayat, B., & Naseem, A. (1993). Prevalence of ticks on livestock in Faisalabad. Pakistan Veterniary Journal, 13, 182-184. Khan, M. N., Khan, L. A., Mahmood, S., & Qudoos, A. (2001). Argas persicus infestation: prevalence and economic Significance in poultry. Pakistan Journal of Agricultural Sciences, 38, 3-4. Khan, M., Zahoor, A., Jahangir, M. & Mirza, M. A. (2004). Prevalence of blood parasites in cattle and buffaloes. Pakistan Veterinary Journal, 24, 193-194.
125
Kharb, S., & Singh, V. (2004) Nutriceuticals in health and disease prevention. Indian Journal Clinical Biochemical, 19(1), 50-3. Khattak, R. M., Rabib, M., Khan, Z., Ishaq, M., Hameed, H., Taqddus, A., Faryal, M., Durranis, S., Gillani, Q. U. A., Allahyar, R., Shaikh, R. S., Khan, M. A., Ali, M., & Iqbal, F. (2012). A comparison of two different techniques for the detection of blood parasite, Theileria annulata, in cattle from two districts in Khyber Pukhtoon Khwa Province (Pakistan). Parasite, 19, 91-95. Khukhuu, A., Lan, D. T. B., Long, P. T., Ueno, A., Li, Y., Luo, Y., Macedo, A. C. C. de, Matsumoto, K., Inokuma, H., Kawazu, S.-I., Igarashi, I., Xuan, X., & Yokoyama, N. (2011). Molecular epidemiological survey of Theileria orientalis in Thua Thien Hue Province, Vietnam. Journal of Veterinary Medicine Science, 73, 701-5. Kocan, K. M., de la Fuente, J., Blouin, E. F., Coetzee, J. F., & Ewing, S. A. (2010). The natural history of Anaplasma marginale. Veterniary Parasitology, 167, 95-107. Koné, W. M., & Atindehou, K. K. (2008). Ethnobotanical inventory of medicinal plants used in traditional veterinary medicine in Northern Côte d'Ivoire (West Africa). South African Journal of Botany, 74(1), 76-84. Krishna, T. P. A., Krishna, T. P. A., Chithra, N. D., Deepa, P. E., Darsana, U., Sreelekha, K. P., Juliet, S., Nair, S. N., Ravindran, R., Kumar, K. G. A., & Ghosh, S. (2014). Acaricidal activity of petroleum ether extract of leaves of Tetrastigm leucostaphylum (Dennst.) Alston against Rhipicephalus (Boophilus) annulatus. The Scientific World Journal, 6 pages. doi.org/10.1155/2014/715481
Kumar, V., Kaur, P., Wadhawan, V. M., Pal, H., Sharma, H., & Kumar, P. (2015). Theileriosis in cattle: prevalence and seasonal incidence in Jalandhar district of Punjab (India). International Journal of Recent Scientific Research, 6(3), 2998-2999.
Latif, A. A., Putterill, J. F., de Klerk, D. G., Pienaar, R., & Mans, B. J. (2012). Nuttalliella namaqua (Ixodoidea: Nuttalliellidae): first description of the male, immature stages and re-description of the female. PLOS ONE, 7(7), e41651. doi: 10.1371/journal.pone.0041651
126
Leschnik, M., Feiler, A., Duscher, G. G., & Joachim, A. (2013). Effect of owner-controlled acaricidal treatment on tick infestation and immune response to tickborne pathogens in naturally infested dogs from Eastern Austria. Parasites & Vectors, 6, 62. doi: 10.1186/1756-3305-6-62 Liu, A. H., Guan, G. Q., Liu, J. L., Liu, Z. J., Leblanc, N., Li, Y. Q., Gao, J. L., Ma, M. L., Niu, Q. L., Ren, Q. Y., Bai, Q., Yin, H., & Luo, J. X. (2011). Polymorphism analysis of Chinese Theileria sergenti using Allele-Specific Polymerase Chain Reaction of the major piroplasm surface protein gene. http://dx.doi.org/10.1645/GE-2444.1.
Livestock and Dairy Development Department Punjab. (2015). Punjab Livestock Policy paper. Lahore.
Liyanaarachchi, D. R., Jinadasa, H. R. N., Dilrukshi, P. R. M. P., & Rajapakse, R. P. V. J. (2013). Epidemiological study on ticks in farm animals in selected areas of Sri Lanka. Tropical Agricultural Research, 24(4), 336-346.
Lorusso, V., Wijnveld, M., Majekodunmi, A. O., Dongkum, C., Fajinmi, A., Dogo, A. G., Thrusfield, M., Mugenyi, A., Vaumourin, E., Igweh, A. C., Jongejan, F., Welburn, S. C., & Picozzi, K. (2016). Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle. Parasites & Vectors, 9, 217. doi: 10.1186/s13071-016-1504-7 Madder, M., Horak, L., & Stoltsz, H. (2004). Ticks: Tick identification. Licensed under a creative commons attributes license.
Mahajan, S. S., & Kumawat, R. N. (2013). Study of seed dormancy in colocynth (Citrullus colocynthis L.) with after-ripening of fruits, seed extraction procedures and period of seed storage. National Academy Science Letters, 36(4), 373-378.
Manan, A., Khan, Z., Ahmad, B., & Abdullah. (2007). Prevalence and identification of ixodid tick genera in frontier region Peshawar. Journal of Agricultural and Biological Science, 2(1), 21-25.
Mandal, M., Banerjee, P. S., Garg, R., Ram, H., Kundu, K., Kumar, S., & Kumar, G. V. (2014). Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1
127
region of small form of canine Babesia spp. from India. Infection Genetic Evoloution, 27, 325-331. Mans, B. J., & Neitz, A. W. (2004). Adaptation of ticks to a blood-feeding environment: evolution from a functional perspective. Insect Biochemistry and Molecular Biology, 34, 1-17.
Mather, T. N., & Abdullah, G. A. (2015). Building molecular biology capacity for preventing tick-transmitted diseases in Pakistan. Pakistan – United States Science and Technology Cooperation Program, 11, 23-15.
McFadden, A. M. J., Rawdon, T. G., Meyer, J., Makin, J., Morley, C. M., Clough, R. R., Tham, K., Mullner, P., & Geysen, D. (2011). An outbreak of haemolytic anaemia associated with infection of Theileria orientalis in naive cattle. Veterniary Journal, 59, 79-85. McCarthy, V.C. 1967. Ixodid Ticks (Acarina, Ixodidae) of West Pakistan. University of Maryland. Memon, M. I., Memon, N., Kachiwal, A. B., Memon, M. R., & Bhutto, B. (2016). Prevalence of theileriosis and its impact on haemotological values in naturally infected buffaloes at Hyderabad. Pakistan Journal of Agricultural Engineering and Veterinary, 32(1), 85-94.
Mirania, A. H., Akhtara, N., Shaha, M. G., Memona, A. A., & Jatoib, A. S. (2016). Documentation of ethnoveterinary plants for the treatment of different cattle and buffalo ailments in Tharparker, Sindh, Pakistan. The Journal of Ethnobiology and Traditional Medicine, 120, 1219-1230. Mishra, D. R., Mandloi, S., Yadav, N., & Choithani, J. (2016). Phytochemical analysis of Trigonella foenum-graecum and its antibacterial activity against Staphylococcus aureus. World Journal of Pharmacy and Pharmaceutical Sciences, 5(6), 1408-1423. Mkangara, M., Erasto, P., & Chacha, M. (2014). Acaricidal Activity of Commiphora Swynnertonii (Burtt) stem bark extracts against adult Rhipicephalus Appendiculatus Newman and Amblyomma Variegatum. American Journal of Research Communication, 2(9), 82-92.
128
Moges, N., Bogale, B., & Fentahun, T. (2012). Hard ticks (Ixodidae): species composition, seasonal dynamics and body site distribution on cattle in Chilga district, Northwest Ethiopia. Asian Journal of Agricultural Sciences, 4(5), 341-345.
Monfared, A. L., Mahmoodi, M., & Fattahi, R. (2015). Prevalence of ixodid ticks on cattle, sheep and goats in Ilam County, Ilam Province, Iran. Journal of Parasitic Diseases, 39(1), 37-40. Kor, M. N., Didarshetaban, M. B., & Pour, H. R. S. (2013). Fenugreek (Trigonella foenum- graecum L.) As a Valuable Medicinal Plant. International journal of Advanced Biological and Biomedical Research, 1(8), 922-931. Morsy, T. A., Rahem M. A., & Allam, K. A. (2001). Control of Musca domestica third instar larvae by the latex of Calotropis procera (Family: Asclepiadaceae). Journal of the Egyptian Society of Parasitology, 31(1), 107‐110. Mtshali, M. S., DeWall, D. T., & Mbati, P. A. (2004). A sero epidemiological survey of blood parasites in cattle in the north-eastern Free State, South Africa. Journal of Veterinary Research, 71, 67-75.
Munderloh, U. G., Jauron, S. D., & Kurtti, T. J. (2005). The tick: a different kind of host for human pathogens. In: Goodman, J. L., Dennis, D. T., Sonenshine, D. E. (Eds.), Tick- Borne Diseases of Humans. ASM Press, Washington, DC, pp. 37-64. Murti, Y., Sharma, S., & Mishra, P. (2015). In vitro anthelminthic activity of calotropis procera (AIT.) R. BR. leaves. Asian Journal Pharmacology Clinical Research, 8, 188-190.
Musa, H. I., Jajere, S. M., Adamu, N. B., Atsanda, N. N., Lawal, J. R., Adamu, S. G., & Lawal K. (2014). Prevalence of tick infestation in different breeds of cattle in Maiduguri, Northeastern Nigeria. Bangl. Journal of Veterniary Medicine, 12(2), 161-166.
Mustafa, I., Shabbir, R. M. K., Subhani, M., Ahmad, I., Raza, A., Jamil, S., Muqaddas, H., Shabbir, R. G., Ghani, A., Mahmood, T., Aslam, M., Khan, M. R., Asif, S., Malik, I. U., Raza, A. B. M., Aqeel, M. A., Qayyum, M., Waqas, A., & Ahmed, H. (2014). Seasonal activity of tick infestation in goats and buffalo of Punjab Province (District Sargodha), Pakistan. Kafkas Üniversitesi Veteriner Fakültesi Dergisi, 20(5), 655-662.
129
Najafi, S., Sanadgol, N., Nejad, B. S., Beiragi, M. A., & Sanadgol, E. (2010). Phytochemical screening and antibacterial activity of Citrullus colocynthis (Linn.) Schrad against Staphylococcus aureus. Journal of Medicinal Plants Research, 4(22), 2321-2325. Najar, A. A., & khare, S. (2017). Improvement of quality control parameters for the Standardization of calotropis procera L. Leaf and flower. International Journal of Pharma and Bio Sciences, 8(1), 433-439. Nasiri, A., Telmadarraiy, Z., Vatandoost, H., Chinikar, S., Moradi, M., Oshaghi, M., Salim Abadi, Y., & Sheikh, Z. (2010). Tick infestation rate of sheep and their distribution in abdanan county ilam province, iran, 2007-2008. Iran. Journal of Arthropod-Borne Diseases, 4, 56-60. Nawaz, M., Sajid, S. M., Ahmed, Z., Waqas, M., Ahmed, T., Hussain, A., Mohi-ud-Din, A., Shamim, A., Zubair, M., & Khalid, I. (2015). Anti-tick activity of leaves of Azadirachta indica, Dalbergia sisso and Morus alba against Rhipicephalus microplus (Acari: Ixodidae). Acta Parasitologica Globalis, 6(1), 60-64. Naz, S., A. Maqbool, A., Ahmed, S., Ashraf, K., Ahmed, N., Saeed, K., Latif, M., Iqbal, J., Ali, Z., Shafi, K., & Nagra, I. A. (2012). Prevalence of theileriosis in small ruminants in Lahore. Pakistan. Journal of Veterniary Animal Sciences, 2, 16-20.
Nithya, V., Kamalam, M., & Umakanthan, T. (2015). Screening of indigenous medicinal plants for their acaricidal activity against cattle ticks under in vivo condition. International Journal of Pharmaceutical Sciences and Research, 6(7), 3049-3052.
Noaman, V. (2012). Identification of hard ticks collected from sheep naturally infected with Anaplasma ovis in Isfahan province, Central Iran. Comparative Clinical Pathology, 21, 367-369. Nora, N. B., Hamid, K., Snouci, M., Boumediene, M., & Abdellah, M. (2015). Phytochemical and antibacterial screening of Citrullus colocynthis of South-west Algeria. Journal of Chemical and Pharmaceutical Research, 7(5), 1344-1348. Nyahangare, E. T., Mvumi, B. M., & Maramba, T. (2016). Acute oral mammalian toxicity and effect of solvents on efficacy of Maerua edulis (Gilg. & Ben.) De Wolf against Rhipicephalus (Boophilus) decoloratus Koch, 1844 (Acarina: Ixodidae), Tick Larvae. BioMed Research International, 8 pages.
130
doi.org/10.1155/2016/7078029 Nyigo, V. A., Mdegela, R. H., Malebo, H. M., Mabiki, F. P., & Fouche, G. (2016). Evaluation of acaricidal efficacy of Synadenium glaucescens (Euphorbiaceae) against Boophilus species. Journal of Medicinal Plants Research, 10(21), 278-285. Ohimain, E. I., Angaye, T. C. N., Bassey, S. E., & Izah, S. C. (2015). Acaricidal activities of Hyptis suaveolens and Ocimum sanctum against African dog tick (Rhipicephalus sanguinneus). European Journal of Medicinal Plants, 8(3), 149-156.
OIE, 2010. Bovine babesiosis. In: OIE Terrestrial Manual. World Organisation for Animal Health (OIE), Paris, France, pp. 1-15. Opiro, R., Osinde, C., Okello-Onen, J., & Akol, A. M. (2013).Tick-repellent properties of four plant species against Rhipicephalus appendiculatus Neumann (Acarina: Ixodidae) tick species. E3 Journal of Agricultural Research and Development, 3(2), 017-021. Orkun, O., Karaer, Z., Çakmak, A., & Nalbantoğlu, S. (2014). Identification of tick-borne pathogens in ticks feeding on humans in Turkey. PLOS Neglected Tropical Diseases, 8(8), e3067. doi.org/10.1371/journal.pntd.0003067 Ota, N., Mizuno, D., Kuboki, N., Igarashi, I., Nakamura, Y., Yamashina, H., Hanzaike, T., Fujii, K., Onoe, S., Hata, H., Kondo, S., Matsui, S., Koga, M., Matsumoto, K., Inokuma, H. & Yokoyama, N. (2009). Epidemiological survey of Theileria orientalis infection in grazing cattle in the eastern part of Hokkaido, Japan. Journal of Veterinary Medical Science 71(7), 937-944.
Parveen, S., Godara, R., Katoch, R., Yadav, A., Verma, P. K., Katoch, M., & Singh, N. K. (2014). In vitro evaluation of ethanolic extracts of Ageratum conyzoides and Artemisia absinthium against cattle tick, Rhipicephalus microplus. The Scientific World Journal, Article ID 858973, 6 pages. doi.org/10.1155/2014/858973 Patel, G., Shanker, D., Jaiswal, A. K., Sudan, V., & Verma, S. K. (2013). Prevalence and seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. Journal of parasitic diseases, 37(2), 173-176. Patil, D., Patil, A., Vadera, K., & Ansari, A. (2015). Standardization and quality control parameters of aerial parts (Leaves and Stem) of Trigonella foenum- graecum L.-An
131
important medicinal plant. Journal of Chemical and Pharmaceutical Research, 7(3), 163- 170. Paul, B. T., Mustapha, K. U., Musa, N., Gadzama, M. A., Ali, M., Mbaya, A. W., & Biu, A. A. (2017). Experimental studies on the reproductive biology of Hyalomma truncatum (Acari: Ixodidae) in Maiduguri, Nigeria. Journal of Parasitology and Vector Biology, 9(5), 57-63. Perera, P. K., Gasser, R. B., Firestone, S. M., Anderson, G. A., Malmo, J., Davis, G., Beggs, D. S., & Jabbar, A. (2014). Oriental theileriosis in dairy cows causes a significant milk production loss. Parasite & Vectors, 7, 73. doi: 10.1186/1756-3305-7-73 Perveen, F. (2011). Distribution and identification of ixodid tick species on livestock in Northern Pakistan. Journal of Agricultural Science and Technology, 1, 73-80.
Pesquera, C., Portillo, A., Palomar, A. M., & Oteo, J. A. (2015). Investigation of tick-borne bacteria (Rickettsia spp., Anaplasma spp., Ehrlichia spp. and Borrelia spp.) in ticks collected from Andean tapirs, cattle and vegetation from a protected area in Ecuador. Parasite & Vectors, 8, 46. doi.org/10.1186/s13071-015-0662-3 Petro, Y., Kasege, P., Kilasara, D., Kawiche, E., Temba, V., Kaunda, E., & Sungi, I. (2012). The efficacy of cypermethrin (vapco cypermethrin against cattle ticks in Tanzania. Journal of Biology, Agriculture and Healthcare, 2(11). Qamar, M. F., Sulehria, A. Q. K. & Zahra, N. (2009). Prevalence of Argas persicus in rural poultry at Lodhran, Pakistan. Biologia (Pakistan), 55 (1&2), 87-92. Qamar, M. F., Sulehria, A. Q. K., Raza, I., Abass, S. & Maqbool, A. (2009). Prevalence of blood protozoans in buffaloes at Rahim Yar Khan, Pakistan. Biologia (Pakistan), 55(1&2), 73- 77.
Qiu, H., Kelly, P. J., Zhang, J., Luo, Q., Yang, Y., Mao, Y., Yang, Z., Li, J., Wu, H., & Wang, C. (2016). Molecular Detection of Anaplasma spp. and Ehrlichia spp. in Ruminants from Twelve Provinces of China. Canadian Journal of Infectious Diseases and Medical Microbiology, 9 pages. doi: 10.1155/2016/9183861
Rahuman, A. A., & Venkatesan, P. (2008). Larvicidal efficacy of five cucurbitaceous plant leaf extracts against mosquito species. Parasitology Research, 103(1), 133-139.
132
Rajput, Z. I., Hu, S., Chen, W., Arijo, A. G., & Xiao, C. (2006). Importance of ticks and their chemical and immunological control in livestock. Journal of Zhejiang University- Science B, 7(11), 912-921.
Ramzan, M., Khan, M. S., Avais, M., Khan, J. A., Pervez, K., & Shahzad, W. (2008). Prevalence of ecto parasites and comparative efficacy of different drugs against tick infestation in cattle. Journal of Animal and Plant Sciences, 18, 17-19.
Rani, P. A. A., Irwin, P. J., Coleman, G. T., Gatne, M., & Traub, R. J. (2011). A survey of canine tick-borne diseases in India. Parasite and Vectors, 4, 141. doi.org/10.1186/1756-3305-4-141 Ravindran, R., Juliet, S., Gopalan, A. K. K., Kavalimakkil, A. K., Ramankutty , S. A., Nair, S. N., Narayanan, P. M., & Ghosh, S. (2011). Toxicity of DMSO, Triton X 100 and Tween 20 against Rhipicephalus (Boophilus)annulatus. Journal of parasitic diseases, 35(2), 237– 239. DOI 10.1007/s12639-011-0054-3
Regnery, R., Spruill, C. L., & Plikaytis, B. D. (1991). Genotypic identification of Rickettsiae and estimation of intraspecies sequence divergence for portions of two Rickettsial Genes. Journal of Bacteriology, 173(5), 1576-1589. Rehman, A., Nijhof, A. M., Sauter-Louis, C., Schauer, B., Staubach, C., & Conraths, F. J. (2017). Distribution of ticks infesting ruminants and risk factors associated with high tick prevalence in livestock farms in the semi arid and arid agro-ecological zones of Pakistan. Parasites & Vectors, 10(1), 190. Rehman, W. U., Khan, I. A., Qureshi, A. H., & Hussain, S. (2004). Prevalence of different species of ixodidae (hard-tick) in Rawalpindi and Islamabad, Pakistan. Journal of Medicine Research, 43, 52-55. Riaz, M., Tasawar, Z., & Ullah, M. Z. (2017). An epidemiological survey on diversity and seasonal distribution of hard ticks in sheep and goats in Multan, Pakistan. Journal of Biodiversity and Environmental Sciences, 10(3), 50-61. Rony, S. A., Mondal, M. M. H., Begum. N., Islam, M. A., & Affroze, S. (2010). Epidemiology of ectoparasitic infestations in cattle at Bhawal forest area, Gazipur. Bang. Journal Veterniary Medicine, 8, 27-33.
133
Ros-García, A., García-Pérez, A. L., Verdera, J., Juste, R. A., & Hurtado, A. (2012). Monitoring piroplasms infection in three cattle farms in Minorca (Balearic Islands, Spain) with previous history of clinical piroplamosis. Veterniary Parasitology, 190, 318-325. Ros-García, A., M‟Ghirbi, Y., Bouattour, A., & Hurtado, A. (2011). First detection of Babesia occultans in Hyalomma ticks from Tunisia. Parasitology, 138, 578–82. Saad, F., Khan, K., Ali, S., & Akbar, N. U. (2015). Zoonotic significance and prophylactic Measure against babesiosis. International Journal of Current Microbiology and Applied Sciences, 4(7), 938-953.
Saddiqe, Z., Maimoona, A., & Khalid, S. (2013). Phytochemical analysis and anthelmintic activity of extracts of aerial parts of Solanum nigrum L. Biologia (Pakistan), 59(2), 205- 211. Sajid, M. S., Iqbal, Z., Khan, M. K. N., Muhammad, G., Needham, G., & Khan, M. K. N. (2011). Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks (Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan. Parasitology Research, 108, 601-609. Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2008). Point prevalence of hard ticks (Ixodids) infesting domestic ruminants of lower Punjab, Pakistan. International Journal of Agriculture and Biology, 10, 349-51.
Sajid, M. S., Iqbal, Z., Khan, M. N., & Muhammad, G. (2009a). In vitro and in vivo efficacies of Ivermectin and Cypermethrin against the cattle tick Hyalomma anatolicum anatolicum (Acari: Ixodidae). Parasitology Research, 105, 1133-1138.
Sajid, M. S., Iqbal, Z., Khan, M. N., Muhammad, G., & Khan, M. K. (2009b). Prevalence and associated risk factors for bovine tick infestation in two districts of lower Punjab, Preventive Veterinary Medicine, 92, 386-391.
Sajid, M. S., Siddique, R. M., Khan, S. A., Iqbal, Z., & Khan, M. N. ( 2014). Prevalence and risk factors of anaplasmosis in cattle and buffalo populations of district Khanewal, Punjab, Pakistan. Global Veterinaria, 12(1), 146-153.
134
Satta, G., Chisu, V., Cabras, P., Fois, F., & Masal, G. (2011). Pathogens and symbionts in ticks: a survey on tick species distribution and presence of tick- transmitted micro-organisms in Sardinia, Italy. Journal of Medical Microbiology, 60, 63-68.
Shahnaz, Z., Chaudry, F. R., Shamim, A., Zafar, M. A., Hasan, M., Iqbal, M. F., & Riaz, A. (2016). Research soft tick (Argas persicus) infestation at government layer farms of Pothwar region of Punjab, Pakistan. Journal of Entomology and Zoology Studies, 4(4), 664-667. Shahzad, W., Noor, H., Ahmad, M., Munir, R., Saghar, M. S., Mushtaq, M. H., Ahmad, N., Akbar, G., & Mehmood, F. (2013). Prevalence and Molecular Diagnosis of Babesia ovis and Theileria ovis in lohi sheep at livestock experiment station (LES), Bahadurnagar, Okara, Pakistan. Iranian Journal of Parasitology, 8, 570-578. Shams, S., Ayaz, S., Ali, I., Khan, S., Gul, I., Gul, N., & Khan, S. N. (2013). Sensitivity and Specificity of PCR & Microscopy in detection of Babesiosis in domesticated cattle of Khyber Pakhtunkhwa, Pakistan. International Journal of Advancements in Research & Technology, 2(5), 37-41.
Sharifinia, N., Rafinejad, J., Hanafi-Bojd, A. A., Chinikar, S., Piazak, N., Baniardalani, M., Biglarian, A., & Sharifinia, F. (2014). Hard ticks (Ixodidae) and Crimean-Congo Hemorrhagic Fever Virus in South West of Iran. Acta Medica Iranica, 53(3), 177-181.
Shkap, V., Molad, T., Fish, L., & Palmer, G. H. (2002). Detection of the Anaplasma Centrale vaccine strain and specific differentiation from Anaplasma marginale in vaccinated and infected cattle. Parasitology Research, 88, 546-552. Shrivastava, A., Singh, S., & Singh, S. (2013). Phytochemical investigation of different plants parts of Calotropis procera. International Journal of Scientific and Research Publications, 3(8), 1-4. Shyma, K. P., Gupta, J. P., Ghosh, S., Patel, K. K., & Singh, V. (2014). Acaricidal effect of herbal extracts against cattle tick Rhipicephalus (Boophilus) microplus using in vitro studies. Parasitology Research, 113(5), 1-8. Siddiqi, M. N., & Jan, A. H. (1986). Ixodid ticks Ixodidae of N.W.F.P. Pakistan. Pakistan Veterniary Journal, 6, 124-6.
135
Sindhu, Z. U. D., Iqbal, Z., Khan, M. N., Jonsson, N. N., & Siddique, M. (2010). Documentation of ethno-veterinary practices used for treatment of different ailments in selected a hilly area of Pakistan, International Journal of Agriculture & Biology, 12, 353-358.
Sindhu, Z. U. D., Ullah, S., Abbas, R. Z., Iqbal, Z., & Hameed, M. (2012). Inventory of ethno- veterinary practices used for the control of parasitic infections in district Jhang, Pakistan. International Journal of Agriculture & Biology, 14, 922-928.
Singh, A. K., Tiwari, M. N., Prakash, O., & Singh, M. P. (2012). A current review of cypermethrin-induced neurotoxicity and nigrostriatal dopaminergic neurodegeneration. Current Neuropharmacology, 10(1), 64-71. Singh, A., & Chhabra, R. E. (1973). Incidence of arthropod pests of domesticated animals and birds Indian. Animal Sciences, 43, 393-397.
Singh, H., Singh, N. K., & Rath, S. S. (2012). Occurrence of canine hepatozoonosis in and around Ludhiana district (Punjab). Indian Journal of Canine Practice, 4(1), 64-66.
Singh, N. K. & Rath, S. S. (2013). Epidemiology of ixodid ticks in cattle population of various agro-climatic zones of Punjab, India. Asian Pacific Journal of Tropical Medicine, 947- 951. Sivakumar, T., Hayashida, K., Sugimoto, C., & Yokoyama, N. (2014). Evolution and genetic diversity of Theileria. Infection Genetic Evoloution, 27, 250-263. Sonenshine, D. E., & Roe, R. M. (Eds.), 2014. The biology of ticks. Oxford University Press, New York. Soomro, M. H., Soomro, S. P., Bhutto, M. B., Akbar, Z., Yaqoob, M., & Arijo, A. G. (2014). Prevalence of Ticks in Buffaloes in the Upper Sindh Pakistan. Buffalo Bulletin, 33(3), 323-327.
Sultana, N., Shamim, A., Awan, M. S., Ali, U., Hassan, M. U., & Siddique, R. M. (2015). First pilot study on the prevalence of tick infestation in livestock of tehsil Hajira, Rawalakot, Azad Kashmir. Advances in Animal and Veterinary Sciences, 3(8), 430-434.
Talat, R., Khanum, T., & Hayat, A. (2005). Studies on mammalian haematozoan parasites of NWFP Pakistan. Pakistan Journal of Biological Sciences, 8, 726-729.
136
Tasawar, Z., Nasim, S., & Lashari, M. S. (2014). The Prevalence of ixodid ticks on buffaloes at private animal farm Bibipur, Multan. Global Veterinaria, 12(2), 154-157. Teel, P. D., Marin, S. L., & Grant, W. E. (1996). Simulation of host parasite landscape interactions: influence of season and habitat on cattle fever tick (Boophilus sp.) population dynamics. Ecological Modeling, 84, 19-30. Tingle, C. C. D., Rother, J. A., Dewhurst, C. F., Lauer, S., & King, W. J. (2003). Fipronil: environmental fate, ecotoxicology and human health concerns. Reviews of Environmental Contamination and Toxicology, 176, 1-66. Tiwari, D. A., Singh, S., & Singh, S. (2014). Chemical analysis of leaf extracts of Calotropis procera. International Journal of Scientific and Research Publications, 4(1), 1-3.
Ullah, A., Hassan, S., Khan, M. I., Rizwan, M., Ullah, Z., & Shah, M. (2016). Antioxidant, phytotoxic and cytotoxic activity of methanolic extract of Trigonella foenum-graecum. Journal of Coastal Life Medicine; 4(5), 386-389. Ullah, S., Khan, M. N., Sajid, M. S., Iqbal, Z., & Muhammad, G. (2015). Comparative efficacies of Curcuma longa, Citrullus colocynthis and Peganum harmala against Rhipicephalus microplus through modified larval immersion test. International Journal of Agriculture & Biology, 17, 216-220. Walker, A., Bouattour, A., Camicas, J., Estrada- Pena, A., Horak, I., Latif, A., Pegram, R., & Preston, P. (2003). Ticks of Domestic Animals in Africa. A Guide to Identification of Species. Bioscience Reports, London, UK. Wamuyu, L., Obanda, V., Kariuki, D., Gakuya, F., Makanda, M., Otiende, M., & Ommeh, S. (2015). Molecular detection and characterization of theileria infecting wildebeest (Connochaetes taurinus) in the Maasai Mara National Reserve, Kenya. Pathogens, 4, 626-638. Wen, B., Cao, W., & Pan, H. (2003). Ehrlichiae and Ehrlichial diseases in China. Animals of the New York Academy of Sciences, 990, 45-53. Wen, B., Jian, R., Zhang, Y., & Chen, R. (2002). Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. Journal of Clinical Microbiology, 40, 3286-90.
137
Yokoyama, N., Sivakumar, T., Ota, N., Igarashi, I., Nakamura, Y., Yamashina, H., Matsui, S., Fukumoto, N., Hata, H., Kondo, S., Oshiro, M., Zakimi, S., Kuroda, Y., Kojima, N., Matsumoto, K. & Inokuma, H. (2012). Genetic diversity of Theileria orientalis in tick vectors detected in Hokkaido and Okinawa, Japan. Infection, Genetics and Evolution, 12, 1669-1675. Yousefi, A., Rahbari, S., Shayan, P., Sadeghi-dehkordi, Z., & Bahonar, A. (2017). Molecular detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west highland pasture of Iran. Asian Pacific Journal of Tropical Biomedicine, 7(5), 455-459. Yu, P. F., Niu, Q. L., Liu, Z. J., Yang, J. F., Chen, Z., Guan, G. Q., Liu, G. Y., Luo, J. X., & Yin, H. (2016). Molecular epidemiological surveillance to assess emergence and re- emergence of tick-borne infections in tick samples from China evaluated by nested PCRs. Acta Tropical, 158, 181-188. Zaman, M. A., Iqbal, Z., Sandhu, Zia-ud-Din., Abbas, R. Z., & Qamar, M. F. (2012). International Journal of Agriculture & Biology, 00: 000-000 Zorloni, A., Penzhornb, B. L., & Eloffa, J. N. (2010). Extracts of Calpurnia aurea leaves from Southern Ethiopia attract and immobilise or kill ticks. Veterinary Parasitology, 168(1-2), 160-4. Zulfiqar, S., Shahnawaz, S., Ali, M., Bhutta, A. M., Iqbal, S., Hayat, S., Qadir, S., Latif, M., Kiran, N., Saeed, A., Ali, M., & Iqbal, F. (2012). Detection of Babesia bovis in blood samples and its effect on the hematological and serum biochemical profile in large ruminants from Southern Punjab. Asian Pacific Journal of Tropical Biomedicine, 2(2), 104-8.
138