Oncogenic G Protein GNAQ Induces Uveal Melanoma and Intravasation in Mice Jenny Li-Ying Huang, Oscar Urtatiz, and Catherine D

Published OnlineFirst June 25, 2015; DOI: 10.1158/0008-5472.CAN-14-3229

Cancer Tumor and Stem Cell Biology Research

Oncogenic G Protein GNAQ Induces Uveal Melanoma and Intravasation in Mice Jenny Li-Ying Huang, Oscar Urtatiz, and Catherine D. Van Raamsdonk

Abstract

GNAQ and GNA11 are heterotrimeric G protein alpha sub- increased GNAQQ209L expression in human tumors. Intrigu- units, which are mutated in a mutually exclusive pattern in ingly, enforced expression of GNAQQ209L progressively elimi- most cases of uveal melanoma,oneofthemostaggressive nated melanocytes from the interfollicular epidermis in adults, cancers. Here we introduce the ﬁrst transgenic mouse model of possibly explaining the near absence of GNAQQ209 mutations uveal melanoma, which develops cancers induced by expres- in human epithelial melanomas. The mouse model also exhib- sion of oncogenic GNAQQ209L under control of the Rosa26 ited dermal nevi and melanocytic neoplasms of the central promoter. Disease penetrance is 100% by 3 months of age, with nervous system, accompanied by impaired hearing and bal- 94% of mice also developing lung tumors. In this model, the ance, identifying a novel role for GNAQ in melanocyte-like cells Yap protein of the Hippo pathway is activated in the eyes, and of the inner ear. Overall, this model offers a new tool to dissect blood vessels near the lesions in the head and lungs exhibit signaling by oncogenic GNAQ and to test potential therapeu- melanocytic invasion. While full transcription levels are not tics in an in vivo setting where GNAQQ209L mutations contribute necessary for GNAQQ209L to transform mouse melanocytes, we to both the initiation and metastatic progression of uveal obtained suggestive evidence of a selective advantage for melanoma. Cancer Res; 75(16); 3384–97. 2015 AACR.

Introduction alpha subunits are stimulated by ligand binding to GPCRs, which causes the alpha subunits to release GDP, bind GTP, and assume Uveal melanoma, a malignancy of melanocytes in the uveal the active conformation that can interact with downstream effec- tract of the eye, is a highly aggressive cancer without any effective tors. Using an intrinsic Ras-like GTP hydrolysis (GTPase) domain, treatment options once it metastasizes (1). Large-scale uveal the alpha subunit cleaves the gamma phosphate from the GTP melanoma sequencing projects have identified recurrent muta- molecule to produce GDP and return the alpha subunit to its tions in two G proteins (GNAQ and GNA11), BRCA1-associated inactive conformation (14). Q209 and R183 lie in the GTPase protein-1 (BAP1), X-linked eukaryotic translation initiation factor domain and directly position the gamma phosphate for cleavage 1A (EIF1AX), and Splicing factor 3B subunit 1 (SF3B1; refs. 2–8). (15). Substitution mutations at these two highly conserved resi- Of these, mutations in GNAQ and GNA11 occur with a mutually dues allow for GTP binding, but greatly reduce the rate of GTP exclusive, combined frequency of approximately 80% in both hydrolysis, therefore generating constitutive active signaling (16, class I and the more aggressive class II uveal melanomas (2, 7). 17). In uveal melanoma, mutations at Q209 are found 13 times There are two oncogenic hotspots in GNAQ/11: glutamine(Q)209 more frequently than mutations at R183 (2). Q209 mutations are and arginine(R)183 (2, 3). also slightly more potent in tumorigenesis assays in nude mice GNAQ and GNA11 encode heterotrimeric G protein alpha injected with transformed cells (2). subunits of the q class (Gaq/11; ref. 9). They are 90% identical Mutations in GNAQ and GNA11 are found in a striking distri- at the amino acid level and play redundant roles; knocking out bution pattern in different types of melanocytic neoplasms. They any three Gnaq and Gna11 alleles is lethal in mice (10). The are frequently found in uveal melanoma (83%), blue nevi function of Gaq/11 is to link various 7 transmembrane G pro- (benign intradermal lesions, 63%), and melanocytomas of the tein–coupled receptors (GPCR) to downstream signaling effectors central nervous system (50%; refs. 2, 18–21). They are very rare inside cells, canonically phospholipase C (9). Q209 and R183 among melanomas and nevi located in the epithelium. Initially, mutations also activate the MAPK pathway and the Hippo tumor we reported a single GNAQQ209L mutation among 27 cutaneous suppressor pathway (2, 3, 11–13). During signaling, GDP-bound melanomas on chronically sun damaged (CSD) skin (3); however, we found no additional mutations in a much larger CSD sample set, nor in any other type of cutaneous melanomas Department of Medical Genetics, University of British Columbia, (n ¼ 164; ref. 2). The COSMIC database v72 reports four addi- Vancouver, British Columbia, Canada. tional patients with GNAQQ209 mutations among 1,696 entries Note: Supplementary data for this article are available at Cancer Research for superficial spreading, lentigo maligna, nodular, and otherwise Online (http://cancerres.aacrjournals.org/). unspecified malignant melanomas of the skin (22–26). GNAQ Corresponding Author: Catherine D. Van Raamsdonk, University of British and GNA11 mutations have not been found in acral or conjunc- Columbia, 2350 Health Sciences Mall, Vancouver, British Columbia V6T1Z3, tival melanoma (2, 3, 27, 28). A GNAQQ209P mutation was Canada. Phone: 604-827-4224; Fax: 604-822-5348; E-mail: [email protected] recently reported in a single case of mucosal melanoma (29). doi: 10.1158/0008-5472.CAN-14-3229 Intrigued by this pattern, we wondered whether melanocytes in 2015 American Association for Cancer Research. the epithelium possess some natural resistance to the oncogenic

3384 Cancer Res; 75(16) August 15, 2015

Uveal Melanoma in Mice

effects of constitutively active GNAQ/GNA11, which could be photographed and the number of melanocytes, pixel intensity, harnessed for potential therapeutics. To test this, we engineered a and/or area of each sample was determined using ImageJ soft- floxed-stop GNAQQ209L conditional knock-in allele at the ubiq- ware. For all histologic examinations, at least three individuals of uitous Rosa26 locus to force expression in these cells, as well as in each genotype were examined. other types of melanocytes. We report here that the expression of fl the Rosa26-floxed stop-GNAQQ209L allele induced by the melano- Immuno uorescence and immunohistochemistry fi cyte driver, Mitf-cre, causes the rapid development of uveal mel- Whole eyes were xed in 4% paraformaldehyde for 1 hour, anoma, with local invasion of blood vessels and multiple tumors washed in 8%, 12%, 18%, and 20% sucrose (15 minutes each), developing in the lungs. incubated in 25% sucrose overnight, embedded in optimal cutting temperature, and sectioned at 8 to 12 mm. For immu- Materials and Methods nofluorescence, sections were blocked with 1:25 mouse on mouse immunoglobulin blocking reagent (M.O.M.; Vector Mouse husbandry Labs) and BSA, incubated with mouse anti-RPE65 antibody The research described in this article was conducted under the (Abcam 13826, 1:250 dilution) overnight at 4C, and then approval of the UBC Animal Care Committee. Strains were incubated for 1 hour at room temperature with Alexa594- crossed to the C3HeB/FeJ genetic background for at least 6 conjugated goat anti-mouse antibody (1:500 dilution, Invitro- generations before use. DNA from ear notches was isolated using gen). For immunohistochemistry,sectionswerebleachedwith fi DNeasy columns (Qiagen) and ampli ed using PCR. Mitf-cre (Tg 0.5% potassium permanganate for 20 minutes, 2% oxalic acid (Mitf-cre)7114Gsb), Tyrosinase-creER (Tg(Tyr-cre/ERT2)13Bos/J), for 3 minutes, and then incubated in 0.3% hydrogen peroxide and Dct-LacZ (Tg(Dct-LacZ)A12Jkn) mice were genotyped as for 30 minutes. These sections were blocked with serum con- – previously described (30 32). For intraperitoneal injection, taining 1:25 M.O.M. and BSA, incubated with mouse anti- tamoxifen (Sigma T5648) was dissolved in a corn oil/ethanol melanoma antibody cocktail (HMB45 þ DT101 þ BC199; (10:1) mixture at a concentration of 10 mg/mL. Mice were injected Abcam732, 1:50 dilution) overnight at 4C, and then incubated with 1 mg per dose. For topical treatment, tails were dipped in 30 minutes with goat-anti-mouse-horseradish peroxidase sec- 25 mg/mL 4-hydroxytamoxifen (Sigma H6278) in DMSO. ondary antibody (1:200, Life Technologies). Sections were washed and stained with DAB for 5 minutes. Production of Rosa26-floxed stop-GNAQQ209L mice For immunofluorescence of b-galactosidase in cultured mela- Using pROSA26-1, pSABgeo, and PGKneotpAlox2 plasmids and a nocytes, cells were grown on coverslips, washed with 10 mmol/L human GNAQQ209L cDNA (UMR cDNA Resource Center), a sodium phosphate (pH 7.3), fixed in 4% paraformaldehyde at construct was built that contains the minimal adenovirus type fl 4 C for 10 minutes, blocked with 1:25 M.O.M. and BSA, incu- 2 major late splice acceptor, a loxP- anked neo stop cassette, b Q209L bated with mouse anti- -galactosidase antibody (1:400, Pro- human GNAQ , and a bovine growth hormone polyadenyla- mega, Z3781) overnight at 4 C, and then incubated for 1 hour tion signal, all flanked by 1.08-kb and 4.34-kb Rosa26 homology at room temperature with Alexa594-conjugated goat anti-mouse arms, upstream and downstream of the cassette, respectively. The antibody (1:500 dilution, Invitrogen). targeting vector was linearized by SacII and then transfected by electroporation of BA1 (C57BL/6 129/SvEv) hybrid embryonic Western blotting stem (ES) cells. Following homologous recombination, positive Protein was extracted using the NE-PER Nuclear and Cyto- ES cell clones were identified by Southern blotting and PCR and plasmic Extraction kit and Halt Protease inhibitor cocktail were injected into C57BL/6 blastocysts to produce chimeras, (Thermo Scientific) and quantified using the Bicinchoninic Acid which successfully transmitted the mutant allele to the germline. Protein Assay Kit (Sigma Aldrich). After protein transfer to nitro- The PCR reaction components to genotype the Rosa26-floxed stop- cellulose, the membranes were blocked in 5% milk, divided into Q209L GNAQ allele are 0.25 mmol/L each dNTP, 1 U Hotstar Taq two sections, and either incubated with 1:1,000 anti-Yap (4912, (Qiagen), 1 Hotstar Taq buffer, and 0.5 mmol/L of each primer in Cell Signaling Technology) or 1:1,500 anti-GAPDH (14C10, Cell 25 mL total volume. The reaction consists of 40 cycles of 95 Signaling Technology) for 36 or 40 hours, respectively. Blots were 0 (30 seconds), 58 (1 minute), and 72 (1 minute), using 5 - washed two times in PBS for 5 minutes, then incubated with 0 CCGAAAATCTGTGGGAAGTC and 5 -TGGGCTCTATGGCTTCT- horseradish peroxidase-conjugated goat anti-rabbit (7074, Cell GAG as primers, which amplify a product of 180 base pairs. Signaling Technology) at either 1:1,000 or 1:2,000 dilution, respectively, for 3 hours at room temperature. Amersham ECL Histology Prime (GE Healthcare) and a CCD-based imaging system were fi Sections of intact cranium were taken after a 3-day xation in used to detect immunocomplexes. ImageJ was used to quantify fi 10% formalin, followed by decalci cation (10% formalin, 88% the signal intensity, relative to a specific wild-type sample that was formic acid). For LacZ analysis, tissue samples were stained for included in every experiment. 16 to 48 hours at room temperature in 100 mmol/L sodium phosphate, 2 mmol/L magnesium chloride, 0.01% sodium deox- Pyrosequencing ycholate, 0.02% NP-40, 5 mmol/L potassium ferricyanide, 5 Flash-frozen uveal melanomas from patients undergoing enu- mmol/L potassium ferrocyanide, 1 mg/mL 5-bromo-4-chloro- cleation as a part of normal patient care were obtained under 3-indolyl-b-D-galactopyranoside, and 2.5% dimethylformamide. the approval of the institutional review boards at the University Some samples were also then split into dermis and epidermis, or of British Columbia and the Vancouver General Hospital. Primary embedded, sectioned, and counterstained with eosin. To separate mouse melanocyte cultures were generated as previously the dermis and epidermis of whole mount skin samples, the skin described (33). DNA was extracted using DNeasy columns (Qia- was incubated in 2 mol/L sodium bromide for 30 minutes to 2 gen). RNA was extracted using RNAqueous-4PCR (Ambion), and hours at 37C and separated with forceps. These sheets were group reverse transcribed using random primers (Superscript VILO, Life

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3385

Huang et al.

Technologies). For PCR, primers were designed to amplify Q209 mentary Fig. S2A). Separation of the dermis and the epidermis at 3 in both human and mouse GNAQ/Gnaq alleles (Supplemental weeks of age indicated that the dermis is hyperpigmented (Sup- Materials and Methods). In the first round of PCR, Q209-contain- plementary Fig. S2B). Dermal hyperpigmentation is progressive, ing products were amplified, while in the second round, biotin leading to extremely dark skin by 3 months, with visibly thickened was tailed to the PCR products for subsequent immobilization. ears (Fig. 2A). Hyperpigmentation can be observed extending into PCR reactions consisted of 0.25 mmol/L each dNTP, 1 U Hotstar the hypodermis in histologic sections (Fig. 2B). The trunk dermis Taq (Qiagen), 1 Hotstar Taq buffer, and 0.5 mmol/L of each also contains abundant melanin, even though this area is usually primer in 25 mL total volume, with roughly 100 ng of template. sparsely pigmented (Fig. 2A and C). Reactions conditions were 95C (30 seconds), 58.3C (1 minute), In addition, we observed a melanocytic lesion on the trunk and 72C (1 minute) for 15 or 20 cycles (first and second rounds, of two Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ animals respectively). Pyrosequencing was performed with the PyroMark (Fig. 2D). Another lesion was found on the head of one Q96 MD pyrosequencer (Qiagen; ref. 34). Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (Supplemen- tary Fig. S2C). Although rare, these lesions were never observed in Auditory brainstem response any other mice in our colony. We note that the location of these Auditory brainstem response tests were performed by the lesions on the trunk and head is different from transgenic mice Mouse Biology Program at UC Davis (Davis, CA). overexpressing the G protein–coupled Glutamate 1 receptor, Grm1, which might activate Gnaq/11 (37). Instead, Dct-Grm1 mice exhibit lesions on the tail and ears. Statistical analysis Q209L Data were analyzed with either ANOVA, Student t test, or Welch We next examined the effect of GNAQ expression in fl two-sample t test. melanocytes located in the epidermis. In young Rosa26- oxed stop-GNAQQ209L/þ; Mitf-cre/þ animals, the amount of melanin Results in the tail epidermis appeared to be normal (Supplementary Fig. S2B). To quantify the number of melanocytes in the epidermis, we Q209L Creation of the Rosa26-floxed stop-GNAQ allele obtained the melanocytic reporter line, Dopachrome tautomerase Q209L We engineered a conditional allele in which GNAQ is (Dct)-LacZ, and crossed it to Rosa26-floxed stop-GNAQQ209L/þ; expressed from the ubiquitous Rosa26 locus following the remov- Mitf-cre/þ mice. (Dct)-LacZ labels melanocytes beginning at al of a loxP flanked stop cassette that prevents transcription (35). E10.5 (38). In the epidermis, (Dct)-LacZ labels melanocytes in We built a construct that contains a splice acceptor, a loxP-flanked both the tail scales and hair follicles (38). At 3 weeks of age, we Q209L stop cassette, human GNAQ , and a bovine growth hormone found no significant difference in the number of LacZ-positive polyadenylation signal (Fig. 1). This allele drives continuous cells in Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ tail scales as expression of constitutively active GNAQ in cells that undergo compared with Mitf-cre/þ, supporting our observations of the Cre-mediated recombination and in all of the descendents of melanin content at this time point (Fig. 3A). Q209L these cells. The resulting Rosa26-floxed stop-GNAQ mice were However, in older animals, melanin content in the tail crossed to the C3HeB/FeJ genetic background for 6 generations scales was significantly reduced (Fig. 3C). We used the Q209L before analysis. Rosa26-floxed stop-GNAQ mice are healthy, Rosa26-floxed stop-LacZ reporter allele to identify cells in which breed with normal efficiency, and are pigmented normally (Sup- Cre had been expressed in sufficient levels to mediate recom- plementary Fig. S6). bination of loxP sites (35). At 5 weeks of age, LacZ-positive cells were present, but there were 39% fewer in the Rosa26- Skin pigmentation changes driven by GNAQQ209L induced by floxed stop-LacZ/Rosa26-floxed stop-GNAQQ209L;Mitf-cre/þ tail Mitf-cre scales as compared with the Rosa26-floxed stop-LacZ/þ; Mitf-cre/ To examine the effects of GNAQQ209L expression initiated in þ controls (P ¼ 0.018, Student t test;Fig.3B).Thisindicates melanoblasts (immature melanocytes) during embryogenesis, that the expression of GNAQQ209L negatively impacts the we obtained Mitf-cre transgenic mice, which express Cre recom- ability of melanocytes to persist in the interfollicular epider- binase under the control of the melanocyte-specificpromoter mal environment. of the Microphthalmia gene (31). Mitf-cre is the earliest Cre Hair follicles are epidermal appendages. Melanocytes actively driver expressed specifically in melanocytes. Mitf-cre has an producing pigment are located at the base of hair follicles, where efficiency of 25% at E15.5 (36) and 68% at P40 (Supplemen- they transfer pigment producing organelles called melanosomes tary Table S1). On the C3HeB/FeJ genetic background, Mitf-cre to specialized keratinocytes of the growing hair. We found that in animals are smaller than nontransgenic animals (Supplemen- hair follicles, melanocytes respond to GNAQQ209L by overgrowth. tary Fig. S1) and 60% exhibit microphthalmia (n ¼ 35; Sup- The hair follicle bulbs of Rosa26-floxed stop-GNAQQ209L/þ; Mitf- plementary Fig. S4). The cause of these phenotypes is unknown cre/þ trunk (Fig. 2C) and tail (Fig. 3C) develop dark, ectopic (31). Mitf-cre is expressed in epidermal, dermal, and follicular pigmentation. Despite this, the coat starts to gray by 5 months, melanocytes of the tail and trunk skin (31, 36). Expression in suggesting that GNAQQ209L expression directly or indirectly dis- uveal, otic, and leptomeningeal melanocytes of the central rupts normal melanosome transfer to keratinocytes (Fig. 3D, nervous system (CNS) and spinal cord has not been previously Supplementary Fig. S3). reported. We crossed Rosa26-floxed stop-GNAQQ209L/þ animals to Mitf- Uveal melanoma driven by GNAQQ209L induced by Mitf-cre cre/þ animals and obtained the expected percentage of double We selected Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ heterozygous progeny. Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/ mice without severe microphthalmia for histologic analysis at þ animals can be distinguished from their littermates 5 days after various time points. At 3 months of age, obvious melanocytic birth, because they exhibit early stages of tail darkening (Supple- neoplasms were present with 100% penetrance in Rosa26-floxed

3386 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

Figure 1. A conditional GNAQQ209L allele. A, the targeted allele contains a splice acceptor, loxP-ﬂanked stop cassette (PGKneo3xpAlox2), GNAQQ209L, and polyadenylation signal. After loxP recombination, GNAQQ209L is expressed (activated allele). PCR genotyping amplicon (green). B and C, Southern blot analysis using EcoRI and probing with PB3/4 (B), and EcoRV and probing with AT1/AT2 (C). ES cell clones 114, 132, 133, 242, and 263 are positive. H, HindIII; pA, polyadenylation signal; R, EcoRI; RV, EcoRV; SA, splice acceptor; triangles, loxP sites.

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3387

Huang et al.

Figure 2. Melanocyte overgrowth in the dermis and hair follicles of Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice. A, hyperpigmentation of ears, footpad, trunk, and tail of 3-month-old Rosa26-floxed stop "fs" -GNAQQ209L/þ; Mitf-cre/þ mice (right animal of each subpanel). B, hyperpigmentation of the tail dermis at 3 months of age (hematoxylin and eosin). C, X-gal and eosin staining of Rosa26-floxed stop-GNAQQ209L/þ; Dct-LacZ/þ; Mitf-cre/þ 5-month-old trunk skin reveals hyperpigmentation of the hair follicles and dermis (white arrowheads) and LacZ-positive cells (blue). D, a dermal lesion (red arrowhead) on the trunk. D, dermis; E, epidermis; HF, hair follicle.

stop-GNAQQ209L/þ; Mitf-cre/þ animals (n ¼ 15), but not in þ/þ; try with an anti-melanoma cocktail that stains human uveal Mitf-cre/þ controls. In younger animals, the uveal tract (com- melanomas (refs. 39, 40; Fig. 4C). The tumors were positive posed of the iris, ciliary body, and choroid) was thickened, with a for the anti-melanoma antibody and negative for the RPE anti- mass forming at the anterior of the eye (Fig. 4A). Older animals body. Furthermore, the RPE antibody labeled a single layer of cells exhibited bulging eyes (Supplementary Fig. S4) and bigger tumors above the lesion, with the sclera, the outermost layer of the that largely filled the vitreous space (Fig. 4C). We performed eye, lying below the lesion. This indicates that the lesions are immunofluorescence using an antibody specific to the retinal derived from the uveal tract. By 3 months of age, Rosa26-floxed stop- pigmented epithelium (RPE; Fig. 4B), and immunohistochemis- GNAQQ209L/þ; Mitf-cre/þ animals weighed significantly less than

3388 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

Figure 3. Melanocyte loss in the interfollicular epidermis of Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice. A, no significant difference in the number of LacZ-positive cells in Rosa26-floxed stop"fs"-GNAQQ209L/þ; Dct-LacZ/þ; Mitf-cre/þ mice at P21 (mean SEM; P ¼ 0.702 by t test). n, number of animals examined. Representative whole mount stained scales are shown (right). B, fewer LacZ-positive cells in Rosa26-floxed stop-GNAQQ209L/Rosa26-floxed stop-LacZ; Mitf-cre/þ animals at P40 (mean SEM; P ¼ 0.018 by t test). C, extensive depigmentation in epidermal sheet of a 5-month-old Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (right). Alterations in hair follicles are visible (compare red arrowheads). D, lighter colored coat of a 5-month-old Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (right).

þ/þ; Mitf-cre/þ controls, as their overall health was impacted cultures from the dermis of three different Rosa26-floxed stop-LacZ/ (Supplementary Fig. S1). We conclude that Rosa26-floxed stop- Rosa26-floxed stop-GNAQQ209L; Mitf-cre/þ animals. After 2 weeks, GNAQQ209L drives uveal melanoma with a very short latency we performed immunofluorescence on the cells using a LacZ period when induced by Mitf-cre. antibody to calculate the percentage of cells expressing Human melanocyte cell lines expressing GNAQQ209L exhibit GNAQQ209L. We found that 100% of the cells in the cultures activated YAP within the Hippo tumor suppressor pathway (12, were LacZ-positive, likely through an increased growth advantage 13). Yap activation can be detected by examining the amount of provided by the GNAQQ209L allele, combined with culture con- Yap in the cell nucleus, where it is translocated upon phosphor- ditions that select for melanocyte growth (Supplementary ylation. To examine whether Yap is hyperactivated in uveal Fig. S5A; refs. 3, 33). melanomas of Rosa26-floxed stop-GNAQQ209L mice, we extracted We then extracted RNA from the cells, reverse transcribed it, protein from whole eyes dissected from Rosa26-floxed stop- and used PCR to amplify the region spanning codon Q209, GNAQQ209L/þ; Mitf-cre/þ mice and wild-type controls at 3 with primers designed to match both the transgenic human months of age. Using Western blotting, we found a single band allele and the endogenous mouse alleles, which are highly corresponding to the expected Yap protein size (65–75 kDa). Yap conserved. The PCR products were pyrosequenced using a protein was increased 2.5-fold in Rosa26-floxed stop-GNAQQ209L/ single sequencing primer complementary to the forward strand. þ; Mitf-cre/þ eyes as compared with wild-type controls (P ¼ 0.02, On average, at the variant position, 97% of the pyrosequencing Welch two-sample t test; Fig. 5A and B). This validates Rosa26- signal was T (from the endogenous wild-type mouse alleles), floxed stop-GNAQQ209L mice as a tool for dissecting pathways while 3% of the signal was A (from the transgenic Rosa26- activated downstream of constitutively active GNAQ. GNAQQ209L allele; Supplementary Fig. S5). This suggests that there is 16-fold less expression from the Rosa26 promoter Expression of GNAQQ209L in mice and humans than the Gnaq promoter in mice and that full transcription To estimate the expression level of Rosa26-floxed stop- might not be necessary for transformation. Of course, the ideal GNAQQ209L compared with endogenous Gnaq, we cultured mel- mouse model would use the endogenous Gnaq promoter, as anocytes from 8.5 day-old mouse tails. We developed primary has been done for BrafV600E (41). However, as explained in the

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3389

Huang et al.

Figure 4. Uveal melanoma in Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice. A, progression of uveal melanoma in 3-week-old (left bottom) and 5-week-old (right bottom) Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice. B, structures of the eye (top). Anti-RPE (red) stains a single layer of retinal pigmented epithelial cells above the developing melanoma in a 3-week-old Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (right subpanel; bottom). Corresponding light microscopy images (left and middle). Red box, area of enlargement. C, a uveal melanoma from a 5-month-old mouse stains positive for the antimelanoma antibody cocktail (DAB, brown; top right). Melanoma before bleaching (left) and counterstained with hematoxylin (middle). Red arrow, extraocular extension of the melanoma. Hg, harderian gland; Nc, nasal cavity; red asterisks, uveal melanomas.

3390 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

Figure 5. Yap activation and enhanced GNAQQ209L allele expression in uveal melanomas. A, representative Western blot analysis against Yap and Gapdh using nuclear protein extracted from Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ and þ/þ; þ/þ or Rosa26-floxed stop-GNAQQ209L/þ; þ/þ eyes ("wild-type"). B, increased nuclear Yap is detected in Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ eyes (P ¼ 0.02, Welch two-sample t test). Signal was normalized to Gapdh and a wild-type sample included in each experiment. C, four of five human uveal melanoma samples contain more GNAQQ209L transcript than wild-type transcript, measured by pyrosequencing. Signal is corrected for the amount of each allele in the DNA of each sample. D, bilateral eye bulging (red arrowheads, left) and skin hyperpigmentation (red arrowheads, right) in a 4-month-old tamoxifen-treated Rosa26-floxed stop"fs"-GNAQQ209L/þ; Tyr-creER/þ mouse, compared with treated control littermate. E, melanocytic hyperplasia (red arrowhead), but not uveal melanoma, in the eye of the same mouse.

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3391

Huang et al.

introduction, we were interested in forcing GNAQQ209L expres- GNAQQ209L/þ; Mitf-cre/þ mice (n ¼ 28). This was due to sion in melanocytes of the epidermis. melanocytic overgrowth within the leptomeninges (Fig. 6B). We next asked what relative level of GNAQQ209L to wild-type We observed invasion of pigmented cells within the orbital– transcripts is present in human uveal melanomas with a somatic frontal cortex (Fig. 6A) and cerebellum and medulla oblongata GNAQQ209L mutation. We obtained flash-frozen uveal melanoma (Fig. 6B). In one animal, a large darkly pigmented lesion was samples removed as a part of normal patient care, extracted DNA also recovered from the brain surface (Fig. 6C). Spinal cord and RNA from each sample, reverse transcribed the RNA, and used meninges were heavily pigmented in all animals (Supplemen- pyrosequencing to measure the ratio of the GNAQQ209L allele to tary Fig. S7). These findings are consistent with the previously the wild-type allele in each cDNA sample, relative to the ratio in reported presence of GNAQ and GNA11 mutations in human the corresponding genomic DNA sample. In 4 of 5 uveal mela- melanocytomas of the CNS (18–21). nomas, the GNAQQ209L allele was expressed at a higher level than The stria vascularis of the cochlea of the inner ear is the wild-type allele, as much as 1.7-fold more (Fig. 5C). Thus, composed of basal cells, intermediate cells, and marginal greater levels of GNAQQ209L transcription may provide a selective cells. Intermediate cells are similar to melanocytes and arise advantage. from the neural crest, requiring Pax3, Sox10, c-Kit,andMitf þ þ (43–47). Through Na /K /2Cl ion transportation, the stria Tyr-creER is not sufficient to drive uveal melanoma in mice vascularis produces an endocochlear potential in the endo- when initiated in adulthood lymph. Changes in the potentialinresponsetosoundtriggers To determine whether Rosa26-floxed stop-GNAQQ209L drives hair cells to release neurotransmitters that excite afferent uveal melanoma when induced in adulthood, we obtained nerves. Because we noticed that some older Rosa26-floxed Tyrosinase(Tyr)-creER mice (32). In this transgene, Cre recom- stop-GNAQQ209L/þ; Mitf-cre/þ micefailedtostartlein binase is fused to the estrogen receptor and requires tamoxifen response to loud noises, we tested the auditory brainstem for the CreER protein to be transported to the nucleus for response (ABR) of 5 Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/ activity. Tyr-creER expression initiates in melanoblasts at þ animals and 5 þ/þ; Mitf-cre/þ control littermates at two around E17.5 of mouse development (32). To administer time points, P34 and P76. We found that at P76, there is a tamoxifen, we treated 8-week-old mice with 1 mg tamoxifen significant increase in the threshold needed to produce a by intraperitoneal injection and also dipped the bottom half of brainstem response in Rosa26-floxed stop-GNAQQ209L/þ; Mitf- the tail in a solution of 25 mg/mL 4-hydroxytamoxifen in cre/þ mice compared with þ/þ; Mitf-cre/þ mice over a broad DMSO for 5 seconds. This treatment was repeated daily for range of frequencies (ABR click test, Fig. 6D), with individual 5days.Inadditiontobeingabsorbedthroughtheskin,top- Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice worsening in ically applied tamoxifen is also known to be consumed by mice their ability to respond to auditory stimulus with age (Sup- during grooming. The efficiency of cre-mediated recombination plementary Table S2). in epidermal melanocytes of the tail using these combined Melanocyte-like cells are also present in the vestibular system of methods was 39% as determined 7 days following the last dose the inner ear, which regulates balance. Beginning between 1 and 3 of tamoxifen (Supplementary Table S3). months of age, Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice Three Rosa26-floxed stop-GNAQQ209L/þ; Tyr-creER/þ and 3 develop abnormal behaviors that are suggestive of balance defi- þ/þ; Tyr-creER/þ littermates were treated with tamoxifen (as ciencies (e.g., see Supplementary Movie S1). These behaviors described above) at 8 weeks of age. The Rosa26-floxed stop- include head tossing, head tilting, and flipping onto the back. GNAQQ209L/þ; Tyr-creER/þ mice exhibited skin darkening and We preformed histologic analysis of the ears at 3 months of age bilateral bulging of the eyes 2 months after tamoxifen treat- and discovered an extensive overgrowth of pigmented cells, which ment(Fig.5D).Histologicanalysis at this time point revealed filled the spaces in the cochlea and vestibular system (Fig. 6E). We uniform melanocytic hyperplasia in 4 of 4 tamoxifen-treated note that there were no behavioral abnormalities observed in Rosa26-floxed stop-GNAQQ209L/þ; Tyr-creER/þ eyes. We found Rosa26-floxed stop-GNAQQ209L/þ; Tyr-creER/þ animals treated thesameresultinbotheyesofoneRosa26-floxed stop- with tamoxifen. These experiments indicate that Mitf-cre drives GNAQQ209L/þ; Tyr-creER/þ animal aged 6.5 months after Cre expression in the melanocyte-like cells of the inner ear and treatment (Supplementary Fig. S6B). At the two time points, that unregulated activity of GNAQ significantly impacts normal treated þ/þ; Tyr-creER/þ and untreated Rosa26-floxed stop- inner ear function. GNAQQ209L/þ; Tyr-creER/þ controls were normal (Fig. 5D; Supplementary Fig. S6). We did not judge this melanocytic Evidence of GNAQQ209L-driven metastasis hyperplasia to be melanoma, because there were no masses Ninety-four percent of the Rosa26-floxed stop-GNAQQ209L/þ; extending into the interior of the eye, and the phenotype was Mitf-cre/þ mice (n ¼ 19) exhibited at least four pigmented stable over time. The bulging eye phenotype might be due to lesions within the lungs at 3 monthsofage(Fig.7A).Thesizeof dispersed melanin, which, if it accumulates within the ocular the lung neoplasms ranged from 200 mmto6mmindiameter, drainage structures, causes elevated intraocular pressure (42). with 4 to 18 tumors per affected mouse. These tumors could be These experiments show that the expression of GNAQQ209L primary, or be the result of metastasis. While examining the initiated by Tyr-creER in adulthood can promote melanocytic vasculature around the eyes, we found tracks of pigmented overgrowth in the eye and skin. However, it is not sufficient to cells extending toward blood vessels (Fig. 7C) and invading drive uveal melanomagenesis within the time frame examined. vessel walls to grow within the lumen (Fig. 7D). An extension of a uveal lesion outside the eye can be seen in Fig. 4C. The lung CNS and inner ear overgrowth induced by Mitf-cre lesions themselves exhibited blood vessel intravasation In addition to the uveal melanomas, we found extensive (Fig. 7E). In addition, heavily pigmented and enlarged lymph hyperpigmentation within the cranium of Rosa26-floxed stop- nodes were present in every animal in the neck and trunk

3392 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

Figure 6. Melanocytic hyperplasia in the CNS and inner ears. A, hyperpigmentation on the brain surface of a 3-month-old Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (middle). Invasion of pigmented cells into the orbital frontal cortex (red asterisk), visible in coronal section (right bottom). B, thickened and hyperpigmented leptomeninges (white arrows in enlargement, top right). Invasion of pigmented cells into the cerebellum and medulla oblongata (white arrowheads in enlargement, right bottom). C, lesion found on the surface of the brain (right). Deep indentation (red arrowhead) left on brain after the lesion was removed. D, hearing loss in Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ animals at P76 (right), but not P34 (left; mean SEM; P ¼ 0.249 at P34; P ¼ 0.044 at P76; ABR click test). E, melanocytic hyperplasia in the cochlea and vestibular system of a Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ animal (hematoxylin and eosin). CB, cerebellum; Co, cochlea; dB SPL, decibels of sound pressure level; LM, leptomeninges; MO, medulla oblongata; OB, olfactory bulb; OFC, orbital–frontal cortex; V, vestibular system.

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3393

Huang et al.

Figure 7. Melanocytic lesions in the lungs and blood vessel intravasation. A, multiple pigmented lesions in the lungs of a 3-month-old Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mouse (red arrowheads). Front and back of lungs are shown. B, enlarged and darkly pigmented lymph nodes from a 3-month-old Rosa26-floxed stop"fs"-GNAQQ209L/þ; Mitf-cre/þ mouse (left). C and D, tracks of pigmented cells extending from eye lesion toward blood vessels (open arrowheads in C), invading vessel walls (black arrow in D), or growing within the lumen (white arrow in D) in 3-month-old Rosa26-floxed stop"fs"-GNAQQ209L/þ; Mitf-cre/þ mice (hematoxylin and eosin). Enlarged areas on the right are indicated by white boxes on left. E, lung lesion closely associated with blood vessels showing signs of intravasation (black arrow) in a 3-month-old Rosa26-floxed stop"fs"-GNAQQ209L/þ; Mitf-cre/þ mouse (hematoxylin and eosin). BV, blood vessel.

3394 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

(Fig. 7B). These data indicate that GNAQQ209L expression could also immediately help underpin the different frequen- promotes melanoma metastasis. cies of oncogene and tumor suppressor mutations found in different types of melanoma. The Rosa26-floxed stop-GNAQQ209L mice are the first geneti- Discussion cally modified mice to develop uveal melanoma. We note that Gnaq and Gna11 were first identified as melanocyte regulators the expression of Rosa26-floxed stop-GNAQQ209L induced by during a forward genetic screen of darker skinned mice (48, 49). Mitf-cre is more potent than Rosa26-floxed stop-GNAQQ209L Hyperactive, but not constitutively active, germline mutations in induced by Tyr-creER. This might either be due to differences Gnaq and Gna11 were identified in three independent mouse in the target population of melanocytes that express these two mutants with a darker dermis and a normal epidermis. Similarly, transgenes, or maybe to the difference in the time of initiation somatic mutations in GNAQ and GNA11 have been frequently of expression. The transcription factor, Mitf, is a critical deter- found in melanoma and nevi located in the dermis, but are rare in minant of melanocyte cell fate (54), while Tyrosinase, a mel- human melanoma and nevi that are located in the epithelium (2). anogenic enzyme, is expressed only in differentiated melano- It is not known why lesions located in the epidermis and dermis cytes (55). Therefore, Mitf might be expressed in cells with a exhibit different mutational signatures, although there are several higher potential for transformation. Recently, the promoter of possibilities. First, there could be intrinsic or developmental another melanogenic enzyme, Dopachrome tautomerase (Dct), differences among melanocytes colonizing different parts of the wasusedtodrivetransgenicGNAQQ209L expression in a tetra- skin (36, 50). Second, there could be different paracrine signals cycline-inducible mouse model (13). Despite expression begin- emanating from keratinocytes versus fibroblasts, surrounding ning during embryogenesis, no ocular or skin lesions devel- melanocytes in the epidermis and dermis, respectively. Third, oped. Pigmentation could not be assessed because the mice melanocytes in the dermis and epidermis could be exposed to were on the FVB genetic background, which is albino. When the different types and/or intensities of environmental mutagens, tumor suppressors, p16 and p19, were also knocked out, 50% such as UV light. of these mice developed lesions on the trunk by 9 months of We were curious as to whether the absence of GNAQQ209L age, but there were still no reported effects on the eye. Thus, mutations in lesions located in the epithelium was a result of a Mitf-cre may better target uveal melanocytes or melanocytes lack of expression of GNAQ or a differential response down- with a higher melanomagenic capacity than Tyr-creER or Dct- stream of it. To test this, we used the ubiquitous Rosa26 cre. Another intriguing possibility that remains to be tested is promoter to force expression of GNAQQ209L in all melanocytes. whether the Mitf-cre BAC transgene somehow alters Mitf pro- This normalized GNAQQ209L expression levels among melano- tein levels, which could theoretically contribute to melanoma- cytes and prevented built-in feedback mechanisms that could genesis (56). suppress its expression. We found that GNAQQ209L expression In summary, we have developed the first mouse model of appears to be incompatible for melanocyte residence in the uveal melanoma driven by oncogenic GNAQ. The three known interfollicular epidermis. Furthermore, GNAQQ209L is extreme- human lesions driven by GNAQ/11 mutations are recapitulated ly oncogenic for uveal melanocytes, but is far less so for dermal in the mice (blue nevi, uveal melanoma, and melanocytomas of melanocytes. We conclude from these observations that the the CNS). We have established that GNAQQ209L has multiple downstream effects of GNAQQ209L vary greatly depending upon effects depending upon the location of the melanocytes. The the location of the melanocyte. As it is reasonable to assume rapid localized invasion of blood vessels and multiple lung that cultured melanocytes receive no positional cues in a typical tumors by 3 months of age suggests that GNAQQ209L mutations in vitro environment, their response to GNAQ and GNA11 may may not only help initiate uveal melanoma, as previously be different than that of uveal melanocytes in the eye. Going hypothesized, but also contribute to disease progression. forward, Rosa26-floxed stop-GNAQQ209L/þ; Mitf-cre/þ mice could serve as a valuable tool to validate the pathways activated fl Q209L Disclosure of Potential Con icts of Interest downstream of GNAQ intheeye,aswehavedoneherefor No potential conflicts of interest were disclosed. the Hippo pathway. TheroleofGNAQQ209L appears to be highly conserved in that there are similar effects in the same populations of Authors' Contributions melanocytes in both mice and humans; however, this is not Conception and design: J.L.-Y. Huang, C.D. Van Raamsdonk Development of methodology: J.L.-Y. Huang, C.D. Van Raamsdonk always the case. Just considering the skin, melanocytic hyper- Acquisition of data (provided animals, acquired and managed patients, proliferation occurs exclusively in the dermis in Hgf, Grm1,and provided facilities, etc.): O. Urtatiz, C.D. Van Raamsdonk Edn3 mouse models, which is expected, but also in Braf- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, mutant mice, which is not, given that BRAF mutations are computational analysis): J.L.-Y. Huang, O. Urtatiz, C.D. Van Raamsdonk abundant in nevi and melanoma located in the epidermis Writing, review, and/or revision of the manuscript: J.L.-Y. Huang, O. Urtatiz, (37, 41, 51–53). The dermal location of BrafV600E melanocytic C.D. Van Raamsdonk Administrative, technical, or material support (i.e., reporting or organizing lesions has been suggested to be the result of a rarity of data, constructing databases): J.L.-Y. Huang interfollicular epidermal melanocytes in mice; however, these Study supervision: C.D. Van Raamsdonk cells are numerous in the mouse tail and could respond to a Braf mutation if there was not some unknown difference Acknowledgments between them and human interfollicular epidermal melano- fi The authors thank Drs. Gregory Barsh (Mitf-cre), Valerie White (uveal cytes. To de ne these differences, a genome-wide characteri- melanomas), Philippe Soriano (pROSA26-1), Marcus Bosenberg (Tyrosinase- zation of the genes and pathways that are active in melanocytes creER), and Ian Jackson (Dct-LacZ) for generously providing reagents, Dr. Ailan in different locations would be very helpful. In humans, this Lu for mouse engineering, Bradley P. Balaton, Christine Yang, and Samantha

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3395

Huang et al.

B. Peeters for assistance with pyrosequencing, and Franco K. Li for advice on The costs of publication of this article were defrayed in part by the payment Western blotting. of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Grant Support This work was supported by grants from CIHR (MOP-79511) and Received November 5, 2014; revised June 4, 2015; accepted June 5, 2015; MSFHR. published OnlineFirst June 25, 2015.

References 1. Singh AD, Turell ME, Topham AK. Uveal melanoma: trends in incidence, 20. Murali R, Wiesner T, Rosenblum MK, Bastian BC. GNAQ and GNA11 treatment, and survival. Ophthalmology 2011;118:1881–5. mutations in melanocytomas of the central nervous system. Acta Neuro- 2. Van Raamsdonk CD, Griewank KG, Crosby MB, Garrido MC, Vemula S, pathol 2012;123:457–9. Wiesner T, et al. Mutations in GNA11 in uveal melanoma. N Engl J Med 21. Gessi M, Hammes J, Lauriola L, Dorner E, Kirfel J, Kristiansen G, et al. 2010;363:2191–9. GNA11 and N-RAS mutations: alternatives for MAPK pathway activating 3. Van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O'Brien GNAQ mutations in primary melanocytic tumours of the central nervous JM, et al. Frequent somatic mutations of GNAQ in uveal melanoma and system. Neuropathol Appl Neurobiol 2013;39:417–25. blue naevi. Nature 2009;457:599–602. 22. Forbes SA, Bindal N, Bamford S, Cole C, Kok CY, Beare D, et al. COSMIC: 4. Abdel-Rahman MH, Pilarski R, Cebulla CM, Massengill JB, Christopher BN, mining complete cancer genomes in the Catalogue of Somatic Mutations in Boru G, et al. Germline BAP1 mutation predisposes to uveal melanoma, Cancer. Nucleic Acids Res 2011;39(Database issue):D945–50. lung adenocarcinoma, meningioma, and other cancers. J Med Genet 23. Turajlic S, Furney SJ, Stamp G, Rana S, Ricken G, Oduko Y, et al. Whole- 2011;48:856–9. genome sequencing reveals complex mechanisms of intrinsic resistance to 5. Furney SJ, Pedersen M, Gentien D, Dumont AG, Rapinat A, Desjardins L, BRAF inhibition. Ann Oncol 2014;25:959–67. et al. SF3B1 mutations are associated with alternative splicing in uveal 24. Beadling C, Heinrich MC, Warrick A, Forbes EM, Nelson D, Justusson E, melanoma. Cancer Discov 2013;3:1122–9. et al. Multiplex mutation screening by mass spectrometry evaluation of 820 6. Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, et al. cases from a personalized cancer medicine registry. J Mol Diagn 2014; Frequent mutation of BAP1 in metastasizing uveal melanomas. Science 13:504–13. 2010;330:1410–3. 25. Wilson MA, Zhao F, Letrero R, D'Andrea K, Rimm DL, Kirkwood JM, et al. 7. Martin M, Masshofer L, Temming P, Rahmann S, Metz C, Bornfeld N, et al. Correlation of somatic mutations and clinical outcome in melanoma Exome sequencing identifies recurrent somatic mutations in EIF1AX and patients treated with Carboplatin, Paclitaxel, and sorafenib. Clin Cancer SF3B1 in uveal melanoma with disomy 3. Nat Genet 2013;45:933–6. Res 2014;20:3328–37. 8. Dono M, Angelini G, Cecconi M, Amaro A, Esposito AI, Mirisola V, et al. 26. Bastian BC. The molecular pathology of melanoma: an integrated taxon- Mutation frequencies of GNAQ, GNA11, BAP1, SF3B1, EIF1AX and omy of melanocytic neoplasia. Annu Rev Pathol 2014;9:239–71. TERTinuvealmelanoma:detectionofanactivatingmutationinthe 27. Lamba S, Felicioni L, Buttitta F, Bleeker FE, Malatesta S, Corbo V, et al. TERT gene promoter in a single case of uveal melanoma. Br J Cancer Mutational profile of GNAQQ209 in human tumors. PLoS ONE 2009;4: 2014;110:1058–65. e6833. 9. Hubbard KB, Hepler JR. Cell signalling diversity of the Gqalpha family of 28. Dratviman-Storobinsky O, Cohen Y, Frenkel S, Pe'er J, Goldenberg-Cohen heterotrimeric G proteins. Cell Signal 2006;18:135–50. N. Lack of oncogenic GNAQ mutations in melanocytic lesions of the 10. Offermanns S, Zhao LP, Gohla A, Sarosi I, Simon MI, Wilkie TM. Embry- conjunctiva as compared to uveal melanoma. Invest Ophthalmol Vis Sci onic cardiomyocyte hypoplasia and craniofacial defects in G alpha q/G 2010;51:6180–2. alpha 11-mutant mice. EMBO J 1998;17:4304–12. 29. Kim CY, Kim DW, Kim K, Curry J, Torres-Cabala C, Patel S. GNAQ 11. Chen X, Wu Q, Tan L, Porter D, Jager MJ, Emery C, et al. Combined PKC and mutation in a patient with metastatic mucosal melanoma. BMC Cancer MEK inhibition in uveal melanoma with GNAQ and GNA11 mutations. 2014;14:516. Oncogene 2013;33:4724–34. 30. Takemoto Y, Keighren M, Jackson IJ, Yamamoto H. Genomic localization 12. Yu FX, Luo J, Mo JS, Liu G, Kim YC, Meng Z, et al. Mutant Gq/11 promote of a Dct-LacZ transgene locus: a simple assay for transgene status. Pigment uveal melanoma tumorigenesis by activating YAP. Cancer Cell Cell Res 2006;19:644–5. 2014;25:822–30. 31. Alizadeh A, Fitch KR, Niswender CM, McKnight GS, Barsh GS. Melanocyte- 13. Feng X, Degese MS, Iglesias-Bartolome R, Vaque JP, Molinolo AA, Rodri- lineage expression of Cre recombinase using Mitf regulatory elements. gues M, et al. Hippo-independent activation of YAP by the GNAQ uveal Pigment Cell Melanoma Res 2008;21:63–9. melanoma oncogene through a trio-regulated rho GTPase signaling cir- 32. Bosenberg M, Muthusamy V, Curley DP, Wang Z, Hobbs C, Nelson B, et al. cuitry. Cancer Cell 2014;25:831–45. Characterization of melanocyte-specific inducible Cre recombinase trans- 14. Markby DW, Onrust R, Bourne HR. Separate GTP binding and GTPase genic mice. Genesis 2006;44:262–7. activating domains of a G alpha subunit. Science 1993;262:1895–901. 33. Sviderskaya EV, Bennett DC, Ho L, Bailin T, Lee ST, Spritz RA. Comple- 15. Sondek J, Lambright DG, Noel JP, Hamm HE, Sigler PB. GTPase mecha- mentation of hypopigmentation in p-mutant (pink-eyed dilution) mouse nism of Gproteins from the 1.7-A crystal structure of transducin alpha- melanocytes by normal human P cDNA, and defective complementation GDP-AIF-4. Nature 1994;372:276–9. by OCA2 mutant sequences. J Invest Dermatol 1997;108:30–4. 16. Landis CA, Masters SB, Spada A, Pace AM, Bourne HR, Vallar L. GTPase 34. Royo JL, Hidalgo M, Ruiz A. Pyrosequencing protocol using a universal inhibiting mutations activate the alpha chain of Gs and stimulate adenylyl biotinylated primer for mutation detection and SNP genotyping. cyclase in human pituitary tumours. Nature 1989;340:692–6. Nat Protoc 2007;2:1734–9. 17. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. 35. Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter Activating mutations of the stimulatory G protein in the McCune-Albright strain. Nat Genet 1999;21:70–1. syndrome. N Engl J Med 1991;325:1688–95. 36. Deo M, Huang JL, Fuchs H, de Angelis MH, Van Raamsdonk CD. Differ- 18. Kusters-Vandevelde HV, Klaasen A, Kusters B, Groenen PJ, van Engen-van ential effects of neurofibromin gene dosage on melanocyte development. Grunsven IA, van Dijk MR, et al. Activating mutations of the GNAQ gene: a J Invest Dermatol 2013;133:49–58. frequent event in primary melanocytic neoplasms of the central nervous 37. Pollock PM, Cohen-Solal K, Sood R, Namkoong J, Martino JJ, Koganti A, system. Acta Neuropathol 2010;119:317–23. et al. Melanoma mouse model implicates metabotropic glutamate signal- 19. Kusters-Vandevelde HV, van Engen-van Grunsven IA, Kusters B, van Dijk ing in melanocytic neoplasia. Nat Genet 2003;34:108–12. MR, Groenen PJ, Wesseling P, et al. Improved discrimination of melanotic 38. Mackenzie MA, Jordan SA, Budd PS, Jackson IJ. Activation of the receptor schwannoma from melanocytic lesions by combined morphological and tyrosine kinase Kit is required for the proliferation of melanoblasts in the GNAQ mutational analysis. Acta Neuropathol 2010;120:755–64. mouse embryo. Dev Biol 1997;192:99–107.

3396 Cancer Res; 75(16) August 15, 2015 Cancer Research

Uveal Melanoma in Mice

39. Heegaard S, Jensen OA, Prause JU. Immunohistochemical diagnosis of 47. Navarrete CM, Ruah CB, Schachern P, Paparella MM. Normal and meta- malignant melanoma of the conjunctiva and uvea: comparison of the static melanin in the temporal bone. Am J Otolaryngol 1995;16:33–9. novel antibody against melan-A with S100 protein and HMB-45. Mela- 48. Fitch KR, McGowan KA, van Raamsdonk CD, Fuchs H, Lee D, Puech A, et al. noma Res 2000;10:350–4. Genetics of dark skin in mice. Genes Dev 2003;17:214–28. 40. Steuhl KP, Rohrbach JM, Knorr M, Thiel HJ. Significance, specificity, and 49. Van Raamsdonk CD, Fitch KR, Fuchs H, de Angelis MH, Barsh GS. Effects of ultrastructural localization of HMB-45 antigen in pigmented ocular G-protein mutations on skin color. Nat Genet 2004;36:961–8. tumors. Ophthalmology 1993;100:208–15. 50. Deo M, Huang JL, Van Raamsdonk CD. Genetic interactions between 41. Dhomen N, Reis-Filho JS, da Rocha Dias S, Hayward R, Savage K, Delmas V, neurofibromin and endothelin receptor B in mice. PLoS One 2013;8: et al. Oncogenic Braf induces melanocyte senescence and melanoma in e59931. mice. Cancer Cell 2009;15:294–303. 51. Takayama H, La Rochelle WJ, Anver M, Bockman DE, Merlino G. Scatter 42. Anderson MG, Libby RT, Mao M, Cosma IM, Wilson LA, Smith RS, et al. factor/hepatocyte growth factor as a regulator of skeletal muscle and neural Genetic context determines susceptibility to intraocular pressure elevation crest development. Proc Natl Acad Sci U S A 1996;93:5866–71. in a mouse pigmentary glaucoma. BMC Biol 2006;4:20. 52. Benaduce AP, Batista D, Grilo G, Jorge K, Cardero D, Milikowski C, et al. 43. Kim H, Ankamreddy H, Lee DJ, Kong KA, Ko HW, Kim MH, et al. Pax3 Novel UV-induced melanoma mouse model dependent on Endothelin3 function is required specifically for inner ear structures with melanogenic signaling. Pigment Cell Melanoma Res 2014;27:839–42. fates. Biochem Biophys Res Commun 2014;445:608–14. 53. Saldanha G, Purnell D, Fletcher A, Potter L, Gillies A, Pringle JH. High BRAF 44. Wakaoka T, Motohashi T, Hayashi H, Kuze B, Aoki M, Mizuta K, et al. mutation frequency does not characterize all melanocytic tumor types. Int J Tracing Sox10-expressing cells elucidates the dynamic development of the Cancer 2004;111:705–10. mouse inner ear. Hear Res 2013;302:17–25. 54. Levy C, Khaled M, Fisher DE. MITF: master regulator of melanocyte 45. Hozumi H, Takeda K, Yoshida-Amano Y, Takemoto Y, Kusumi R, Fuku- development and melanoma oncogene. Trends Mol Med 2006;12:406–14. zaki-Dohi U, et al. Impaired development of melanoblasts in the black- 55. Beermann F, Schmid E, Schutz G. Expression of the mouse tyrosinase gene eyed white Mitf(mi-bw) mouse, a model for auditory-pigmentary disor- during embryonic development: recapitulation of the temporal regulation ders. Genes Cells 2012;17:494–508. in transgenic mice. Proc Natl Acad Sci U S A 1992;89:2809–13. 46. Cable J, Huszar D, Jaenisch R, Steel KP. Effects of mutations at the W locus 56. Garraway LA, Widlund HR, Rubin MA, Getz G, Berger AJ, Ramaswamy S, (c-kit) on inner ear pigmentation and function in the mouse. Pigment Cell et al. Integrative genomic analyses identify MITF as a lineage survival Res 1994;7:17–32. oncogene amplified in malignant melanoma. Nature 2005;436:117–22.

www.aacrjournals.org Cancer Res; 75(16) August 15, 2015 3397

Oncogenic G Protein GNAQ Induces Uveal Melanoma and Intravasation in Mice

Jenny Li-Ying Huang, Oscar Urtatiz and Catherine D. Van Raamsdonk

Cancer Res 2015;75:3384-3397. Published OnlineFirst June 25, 2015.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-14-3229

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2015/06/25/0008-5472.CAN-14-3229.DC1

Cited articles This article cites 56 articles, 10 of which you can access for free at: http://cancerres.aacrjournals.org/content/75/16/3384.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/75/16/3384.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/75/16/3384. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.