Of the Epidemic G2 Rotavirus Strains Over a 25- Year Period (1984-2009) at Dr George Mukhari Hospital

SEQUENCE ANALYSIS OF VP7 (GENOME SEGMENT 9) OF THE EPIDEMIC G2 ROTAVIRUS STRAINS OVER A 25- YEAR PERIOD (1984-2009) AT DR GEORGE MUKHARI HOSPITAL

Lekgolo Lorens MAAKE

2012

SEQUENCE ANALYSIS OF VP7 (GENOME SEGMENT 9) OF THE EPIDEMIC G2 ROTAVIRUS STRAINS OVER A 25- YEAR PERIOD (1984-2009) AT DR GEORGE MUKHARI HOSPITAL

Lekgolo Lorens MAAKE

A dissertation in fulfilment of the requirements for the degree of MSc Med (Medical Virology)

Submitted

In the Department of Virology School of Pathology and Pre-clinical Sciences University of Limpopo (Medunsa Campus)

Supervisor Dr Mapaseka L. SEHERI; PhD University of Limpopo (Medunsa Campus)

Co-supervisor Dr Selokela G. SELABE; PhD University of Limpopo (Medunsa Campus)

DECLARATION

I, Lekgolo Lorens MAAKE, hereby declare that the work presented in this dissertation is original and does not incorporate any material previously submitted for purpose of degree to any other institution. This dissertation is being submitted in fulfilment for the requirements of the degree of Master of Medical Science (Medical Virology), in the Department of Virology, School of Pathology and Pre-Clinical Sciences, Faculty of Health Sciences, at the Medunsa Campus of the University of Limpopo. Works of other investigators where cited and have been duly acknowledged.

Signature of student Date

DEDICATION

I dedicate this dissertation to my parents Joas and Betty Maake who raised me this far, my brother Sunnyboy Maake who frequently supported me financially, my three sisters, Julia, Ruth and Refentshe whom I always miss, and finally my talkative young brother Petro.

ACKNOWLEDGEMENTS

I would like to thank the almighty God who gave me life, strength and potential to do this study.

I would also wish to convey my sincere gratitude to several people and organizations for their support, motivation, advice, comments, criticisms and contributions towards the development of this study.

In particular, I would like to thank:

 Dr LM Seheri for being a superb supervisor, sacrificing her time and for her dedication, willingness and editorial support.  Dr SG Selabe for editorial support, motivation and inspiration.  Mrs Ina Peenze for SOPs, QLPs, technical support, inspiration and motivation  The secretaries in the Department of Virology who always updated me about all the activities and programmes of the department.  Prof MJ Mphahlele for all the support, motivation, courage, inspiration and skills that he gave me throughout this project. It is nice to learn from you Prof, more especially the loyalty, tireless efforts and editorial part.  Mr Nare Rakgole and Mr Harry Ngobeni for technical support and assistance in analysis of the results.  Mr Martin Nyaga for being an academic friend and for training in laboratory techniques.  Mrs Gugu Maphalala, Miss Leah Nemarude, Miss Lufuno Netshifhefhe and Miss Relebogile Mapuroma for their inspiration and motivation.  Mr Muxe Muzeze, Miss Tsakane Sondlane, Miss Rudzani Malabi, and Miss Tebogo Seleise who have being my true friends from undergraduate degree.  The MRC-DPRU and the HHRU staff members at large.  Finally I would like to thank the National Research Foundation and the Poliomyelitis Research Foundation for financial assistance.

iii

TABLE OF CONTENTS

DECLARATION...... I DEDICATION...... II ACKNOWLEDGEMENTS ...... III TABLE OF CONTENTS ...... IV ABSTRACT ...... VIII LIST OF ABBREVIATIONS ...... XI LIST OF NUCLEOTIDES ...... XIX LIST OF AMINO ACIDS ...... XX LIST OF TABLES ...... XXI LIST OF FIGURES ...... XXII CHAPTER 1: EXPERIMENTAL PROPOSAL ...... 1 1.1 Study problem ...... 1 1.2 Aim ...... 2 1.3 Objectives...... 2 Primary objective ...... 2 Secondary objectives ...... 2 1.4 Expected significance of the study ...... 3 CHAPTER 2: LITERATURE REVIEW ...... 4 2.1 Introduction ...... 4 2.2 History ...... 4 2.3 Virology and classification ...... 5 2.4 Diversity of rotaviruses...... 10 2.4.1 Point mutations ...... 10 2.4.2 Reassortment ...... 11 2.4.3 Rearrangement ...... 11 2.4.4 Interspecies transmission ...... 12 2.5 Prevalence of rotavirus genotypes ...... 13 2.6 Prevalence of G2 worldwide ...... 14 2.7 Viral proteins ...... 16 2.7.1 Structural proteins ...... 16

2.7.2 Non-structural proteins ...... 19 2.8 Transmission ...... 23 2.9 Pathogenesis...... 24 2.10 Replication ...... 27 2.11 Signs and symptoms ...... 28 2.12 Epidemiology ...... 29 2.13 Rotavirus Seasonality ...... 30 2.14 Diagnosis ...... 30 2.15 Therapy and prognosis ...... 31 2.16 Immunity ...... 32 2.17 Vaccines ...... 33 CHAPTER 3: MATERIALS AND METHODS ...... 36 3.1 Ethical Consideration ...... 36 3.2 Study Site ...... 36 3.3 Study design ...... 36 3.4 Sampling and Study population ...... 37 3.5 Laboratory Methods ...... 39 3.5.1 Extraction of dsRNA from stool for PAGE ...... 39 3.5.2 Polyacrylamide gel electrophoresis (PAGE) ...... 40

3.5.3 Silver nitrate (AgNO3) staining ...... 40 3.5.4 Extraction of RNA for RT-PCR assay ...... 41 3.5.5 RT-PCR assay ...... 42 3.5.6 Methodology for RT-PCR assay ...... 42 3.5.7 Genotyping ...... 43 3.5.7.1 Genome segment 7 (VP7) ...... 43 3.5.7.2 Genomic segment 4 (VP4) ...... 45 3.5.7.3 Methodology for genotyping ...... 46 3.5. 8 Restriction Fragment Length Polymorphism (RFLP)...... 46 3.5.9 Sequencing ...... 47 3.6 Data Analysis ...... 47 CHAPTER 4: RESULTS ...... 50 4.1 Overview of the results ...... 50 4.2 PAGE Analysis ...... 53 4.3 RT-PCR and genotyping ...... 56

4.4 Genetic profiles of genome segment 9 (VP7 protein) ...... 60 4.4.1 Nucleotide sequence analysis of genome segment 9 ...... 60 4.4.2 Sequencing and nucleotide blast search results...... 61 4.4.3 Analysis of the antigenic regions and glycosylation sites of VP7 protein ...... 64 4.4.4 Analysis of proline and cysteine residues ...... 65 4.4.5 Phylogenetic analysis of genome segment 9 (VP7) ...... 70 4.5 Genetic profiles of Genome segment 4 (VP4 protein) ...... 73 4.5.1 Nucleotide sequence analysis of genome segment 4 ...... 73 4.5.2 Sequencing and nucleotide blast search results ...... 74 4.5.3 Analysis of the VP4 protein ...... 75 4.5.4 Phylogenetic analysis of genome segment 4 ...... 77 4.6 Genome segment 6 (VP6) ...... 79 4.6.1 Nucleotide sequence analysis of genome segment 6 ...... 79 4.6.2 Sequencing and nucleotide blast search results ...... 79 4.6.3 Amino acids and phylogenetic analysis of genome segment 6 (VP6) ...... 80 4.6.4 Analysis of VP6 RFLP...... 85 CHAPTER 5: DISCUSSION ...... 87 5.1 Overview of the study ...... 87 5.2 Worldwide epidemiological trends of G2 strains ...... 89 5.3 Analysis of the RNA profiles ...... 91 5.4 Association of G2 serotype with either P[4] or P[6] or mixed P types ...... 92 5.5 VP7 (Genomic segment 9) ...... 93 5.5.1 Identification of three populations of G2 strains over 25 year period ...... 93 5.5.2 Analysis of mutations on VP7 antigenic regions ...... 93 5.5.3 Analysis of glycosylation sites on VP7 protein ...... 96 5.5.4 Analysis of proline and cysteine residues on the VP7 protein...... 97 5.5.5 Assessment of variability of G2 strains over time and phylogenetic analysis ...... 98 5.6 VP4 (genomic segment 4) ...... 99 5.6.1 Investigation of genetic profiles...... 99 5.7 VP6 Protein...... 100 5.7.1 Phylogenetic analysis and investigation of genetic profiles ...... 100 5.7.2 RFLP analysis ...... 101 5.8 Implication of study finding to rotavirus vaccine efficacy ...... 101 CHAPTER 6: CONCLUSIONS ...... 103

6.1 Conclusions ...... 103 6.2 Limitations ...... 104 6.3 Recommendations ...... 105 CHAPTER 7: REFERENCES ...... 106 APPENDICES ...... 127

vii

ABSTRACT

Introduction: Rotavirus is one of the most common important etiological agents of severe dehydrating gastroenteritis worldwide. Annual surveillance reports estimate that every year more than 2 million children under five years are hospitalized and 453,000 mortality cases are reported due to rotavirus. Human group A rotavirus is reported to be the most common cause of rotavirus gastroenteritis, this include rotavirus associated with the five epidemiologically important genotypes which are: G1, G2, G3, G4, and G9. Among these genotypes, G2 bears a different gene constellation and is a member of a unique genogroup which appears to have a cyclic pattern of occurrence and is sometimes absent during rotavirus seasons. In South Africa, Dr George Mukhari Hospital, serotype G2 has been documented to appear after almost every three to four years since 1984, but from 2007 to 2009 it was detected annually. The current study aimed at investigating the genetic profiles of G2 rotavirus strains over a 25-year period at Dr George Mukhari Hospital.

Materials and Methods: This was an exploratory study, where archived diarrhoeal stool samples were analysed. The samples were collected from children presenting with mild to severe diarrhoea at Dr George Mukhari Hospital from 1984 to 2009 during rotavirus seasons. Depending on the availability of samples the following total numbers of samples were selected for the analyses of genome segment 9: year 1984(1), 1985(1), 1986(1), 1987(2), 1993(1), 1997(1), 2003(2), 2004(2), 2006(1), 2007(2), 2008(2), 2009(2). The samples were classified into groups I and II. Group I were samples from 1980s-90s which were sequenced previously and the raw stool samples were depleted; hence only their GenBank genomic segment 9 sequences were used for comparative analysis. Group II samples, collected between 2003-2009, were available for de novo genetic characterization of genome segment 9. Group II samples were characterized by PAGE, RT-PCR, genotyping, RFLP and sequencing. In addition, one sample from each year (n=6) was selected for the characterization of genome segment 4 by sequencing and one to three samples (n=9) was selected for the characterization of genome segment 6 by sequencing. For PAGE, rotavirus dsRNA was extracted from 450µl of 10% stool suspensions by using sodium dodecyl sulfate (SDS) and phenol chloroform and precipitating with ethanol. The rotavirus RNA segments were separated by PAGE and subsequently stained with silver nitrate for visualization. Rotavirus genome segment 9 (1062bp), genome segment 4 (876bp) and genome segment 6 [both full length (1356bp) and (379bp fragment) ] were amplified by RT-PCR assay from

viii

RNA templates which were extracted from 140µl of 10% stool suspensions using the QIAamp viral RNA Mini Kit, according to manufacturer’s protocol. Genome segment 9 was amplified using SBeg (nt1-21, forward) and End 9 (nt-1062, reverse) primers. Genome segment 4 was amplified using Con3 (nt 11-32, forward) and Con2 (nt 868-887, reverse) primers. The full length of genome segment 6 was amplified using VP6F (nt1-20, forward) and VP6R (nt1356-1339, reverse), while the 379bp fragment was amplified using VP6F (nt 747-766, forward) and VP6R (nt 1126-1106, reverse) primers. The G genotyping was carried out using a pool of G specific primers. Similarly P genotyping was performed using a pool of P specific primers. Finally, one to three samples from each year (n=9) in group II were selected for the characterization of genome segment 6 by restriction fragment length polymorphism (RFLP). The 379bp cDNA genome segment 6 amplicons were analysed by RFLP using the restriction endonuclease AciI. For sequencing 11 samples were sequenced on genome segment 9, 6 on genome segment 4 and 9 on genome segment 6.

Results: Analysis of PAGE results revealed that all the analysed strains were associated with short RNA profiles. Interestingly, all the RNA segments displayed a standard profile of 4,2,3,2, which were further discriminated based on the migration of 7,8 and 9th segments. Some strains displayed co-migration of 7 and 8th segment (S3), some displayed co-migration of 8 and 9 (S1), some displayed 7, 8 and 9 migrating in isolation (S2). Surprisingly, all the 2004 and the 2008 strains displayed only one pattern of segment migration which is (S2) and (S1), respectively. Amino acids sequence alignment of genome segment 9 (VP7) has triggered the classification of the G2 strains into three distinct populations. These deductions were based on observed similarity and difference of amino acids on the antigenic regions and glycosylation regions which distinguished these groups. Furthermore the phylogenetic tree has classified these strains into three different lineages (1,2 and 5c). All the strains from 1984-1987 grouped into lineage 1, were all conserved at antigenic region A, B and C but displayed I239V substitution at region F, similarly almost all of them were conserved at glycosylation regions (aa 69-71,146-148 and 238-240) except that the 1984, 1985 and the 1986 strains displayed N69D substitution. All the strains from 1997-2009 were grouped into lineage 5c. They displayed A87T and D96N mutations at antigenic region A, N213D and N242S substitutions at antigenic regions C and F, respectively, except that one strain from 2007, 2008 and 2009 were conserved at antigenic region F. Furthermore, all the 1997-2009 strains were conserved at glycosylation regions. The 1993 strain was grouped into lineage 2, conserved at antigenic region A, but displayed T147A, N213D and N242S substitutions at

ix antigenic regions B, C and F, respectively. Analysis of glycosylation region revealed that the 1993 strain displayed N69D and T147A substitutions. Sequence analysis of genome segment 4 revealed that all the 6 selected study strains are highly homologous at both nucleotide and amino acid level. They shared nucleotide identities of 98.9-99.8%. Phylogenetic analysis grouped them into lineage V. Sequence analysis of genome segment 6 revealed that all 9 selected study strains were highly conserved. Hence, four conserved regions were identified. The strains shared 98.7-100% nucleotide sequence identities. Phylogenetic analysis has grouped these strains into genotype I2. Analysis of RFLP suggests that all the selected study strains are of subgroup I specificity; hence the restriction endonuclease AciI could not cut the 379bp VP6 amplicons.

Conclusion: The current study has revealed three populations of G2 rotavirus strains that were infecting the infant population at Dr George Mukhari Hospital over a period of 25 years. Anti-genically, the three populations were different. The strains that were circulating during 1984-1987 seem to be highly identical to the G2 prototype at amino acid level. Based on this study, it is highly tempting to stipulate that this group of strains are no longer circulating. Virtually, they are replaced by a group of strains that were circulating since 1997. This group display A87T and D96T mutations at antigenic region A. Furthermore, this group of strains are highly similar to most of the contemporary circulating G2 strains worldwide. The already known cyclic pattern of rotavirus G2 strain warrants the need for a continuous monitoring of circulating rotavirus strains. Most importantly because of the worldwide inception of the rotavirus vaccines, it is very crucial to perform molecular characterization of the current strains in order to detect possible escape mutants, that may lead to vaccine escape mutants because of the probable development of selection pressure induced by the vaccine.

LIST OF ABBREVIATIONS

ABI 3130XL Applied Biosystems 3130XL Genetic Analyzers

AgNO3 Silver nitrate

AMP Adenylate monophosphate

AMV Avian myeloblastosis virus

APS Ammonium persulphate

ARG Argentina

AR’S Antigenic regions

ATP Adenosine triphosphate

AUS Australia

BEL Belgium

BFA Burkina Faso

BGD Bangladesh

BLAST Basic Local Alignment Search Tool

Bp base pairs

BRA Brazil

BSA Bovine serum albumin

°C Degree Celsius

Ca+ Calcium ion

CAN Canada

CCD Coiled –coil domain

CCR9+ Chemokine receptor 9

CD62L+ Cluster of differentiation 62 Ligand

CDC Centre for Disease Control and Prevention cDNA complementary DNA

CHN China

CI Confidence Interval

CLPs Core like particles

CIV Ivory Cost

CMR Cameroon

CNS Central nervous system

Con 2 and Con 3 VP4 Primers

DRC Demogratic Republic of Congo

dH2O Distilled water

DLPs Double layered particles dNTPs deoxyribonucleotide triphosphates dATP deoxyadenosine triphosphate dCTP deoxycytidine triphosphate dGTP deoxyguanosine triphosphate dTTP deoxythymidine triphosphate

xii

DPRU Diarrheal Pathogens research unit

Dr Doctor

DsRNA double stranded Ribonucleic acid

DTT Dithiothreitol

EDTA Ethylenediaminetetraacetic acid

EIA Enzyme immuno assay elF-4G1 Eukaryotic Translation initiation factor

EM Electron microscope

End 9 VP7 primer

ENS Enteric nervous system

ER Endoplasmic Reticulum

ESP Spain g gram

G VP7 genotype

GAVI Global Alliance for vaccine and Immunization

GBR Great Britain

GER Germany

GTP Guanosine triphosphate

HCl Hydrochloric acid

ICP Intracellular particle

xiii

ICTV International Committee on Taxonomy of Viruses

IgA Immunoglobulin A

IgG Immunoglobulin G

IND India

IP3 Inositol trisphosphate

INF Interferon

IRL Ireland

ITA Italy

JPN Japan kDa kilodalton

KEN Kenya

Km Kilometer

M Molar

MAW Malawi ml millilitre

MEGA Molecular Evolutionary Genetics Analysis mEq/L milliequivalent per liter

MEX Mexico

Mg2+ Magnessium ion

MgCl2 Magnesium chloride

xiv mg/ml milligram per milliliter mM millimolar

MRC Medical research council

MRC-DPRU Medical Research Council Diarrheal Pathogens Research Unit

MREC Medunsa Research Ethics Committee mRNA messenger ribonucleic acid

MRT Mauritius

MW Molecular Weight

Na+ Sodium ion

NaAc Sodium acetate

Nacl Sodium Chloride

NCBI National Center for Biotechnology Information

ND Not included

NDP Nucleoside Diphosphate Kinase

NGA Nigeria

NIH National Institute of Health nM nanomolar

NS28 Non-structural 28

NSP Non-structural protein

NTPase Nucleoside triphosphatase

ORF Open reading frame

P VP4 genotype

PAGE Polyacrylamide gel electrophoresis

PAR Paraguay

PCR Polymerase chain reaction

PLC Phospholipase C pmol pico moles

PT Pretoria

Poly(A) Polyadenylation

RCWG Rotavirus classification working group

RFLP Restriction Fragment Length Polymorphism

RNA Ribonucleic acid

RPHA Reverse passive haemagglutination rpm revolutions per minute

RTPase The Ribonucleic acid Phosphatase

RT-PCR Reverse transcription polymerase chain reaction

RUS Russia

® Original

RV Rotavirus

RRV Rhesus Rotavirus

xvi

SBeg VP7 primer

SDS Sodium dodecyl sulphate

SG Subgroup

SREC School research ethics committee

SB Stellenbosch

TAE Tris base, acetic acid and EDTA

TEMED Tetramethylethylenediamine

THA Thailand

TLPs Triple layered particles

Tris-HCI Tris-hydrochloric acid

TUN Tunisia

USA United States of America

V Volts

VEN Venezuela

Vi Viroplasm

VP Viral Protein

VP6F VP6 forward primer

VP6R VP6 reverse primer

WC3 Wistar calf 3

WHO World Health Organisation

xvii

ZAF South Africa

α4β7+ Alpha4beta7+

% Percent

µl microlitre

5u/µl Unit per micro litre

xviii

LIST OF NUCLEOTIDES

A Adenine

C Cytosine

G Guanine

T Thymine

xix

LIST OF AMINO ACIDS

Nonpolar amino acids (Hydrophobic)

Single Amino acid Three letter letter Glycine Gly G Alanine Ala A Leucine Leu L Isoleucine Ile I Methionine Met M Phenylalanine phe F Tryptophan Trp W Proline pro P

Polar (Hydrophilic)

Serine Ser S Threonine Thr T Cysteine Cys C Tyrosine Tyr Y Asparagines Asn N Glutamine Gln Q

Electrically charged (negative and hydrophilic) aspartic acid Asp D glutamic acid Glu E

Electrically charged (Positive and hydrophilic)

Lysine Lys K Arginine Arg R Histidine His H

LIST OF TABLES

Table Content Page

Table 2.1 Nucleotide (amino acid) percentage identity cut-off values 8 defining genotypes for 11 rotavirus gene segments

Table 2.2 Summary of the 11 rotavirus structural and non-structural 22 proteins with their respective, size, molecular weight, function and their location on the virion

Table 3.1 Total number of rotavirus positive samples and total number of 37 samples typed as G2 serotype per year from 1984-2009

Table 3.2 VP7 oligonucleotide primers for RT-PCR and genotyping assays 44

Table 3.3 VP4 oligonucleotide primers list for RT-PCR and genotyping 46 assays

Table 3.4 Representation of all the study samples (Group I and II) and the 49 underlying assays performed on each sample

Table 4.1 Representation of all the study samples (Groups I and II), 52 summary of samples selected for sequencing per specific gene

Table 4.2 Overall summary of PAGE patterns among the study strains 53 (Group II, 2003-2009)

Table 4.3 Characterisation of study samples from (2003-2009) in terms of 54 PAGE patterns

Table 4.4 Nucleotide sequence identity matrix of the strains analysed for 63 genome segment 9

Table 4.5 A summary of all substitution mutations from the antigenic 66 regions and the glycosylation regions

Table 4.6 Distance matrix of the strains analysed for genome segment 4 74

Table 4.7 Summary of the identified amino acids substitutions on VP4 75 proteins of study G2 strains (Group II)

Table 4.8 Distance matrix of the strains analysed for genome segment 6 79

xxi

LIST OF FIGURES

Figure Content Page

Figure 2.1 Structural organisation of Rotavirus 9

Figure 2.2 Structure of rearranged rotavirus genome segments containing partial ORF 12 duplications

Figure 2.3 Illustration of the proportion of G and P combination from regional and 13 worldwide surveillance data between 1994 and 2003

Figure 2.4 Schematic representation of the ER-anchored NSP4 21

Figure 2.5 Schematic representation of the different domains of rotavirus NSP4 21

Figure 2.6 Pie charts comparing prevalence of aetiological agents of diarrhoea 23 between developed and developing countries

26 Figure 2.7 Illustration of model of rotavirus-induced diarrhoea

28 Figure 2.8 Diagrammatic representation of the rotavirus replication cycle

Figure 2.9 Estimated annual distribution of 527,000 deaths due to rotavirus disease 30 among children 5 years of age by country Figure 3.1 Schematic illustration of the Human rotavirus VP7 genotyping products 43

Figure 3.2 Schematic illustration of the Human rotavirus VP4 (VP8* fragment) 45 genotyping products

55 Figure 4.1 PAGE gel representing different RNA migration patterns

57 Figure 4.2 RT-PCR products run on a 1% agarose gel stained in ethidium bromide

58 Figure 4.3 Genome segment 9 (VP7) genotyping gel

59 Figure 4.4 Genome segment 4 (VP4) genotyping gel

67-69 Figure 4.5 VP7 amino acids alignments of G2 strains

72 Figure 4.6 Genome segment 9 (VP7) dendrogram

76 Figure 4.7 VP4 amino acids alignments of P[4] genotypes

Genome segment 4 (VP4) dendrogram 78 Figure 4.8

xxii

Figure 4.9 VP6 amino acids alignments, DS-1, Wa, and AU-1 genogroups 81-83

84 Figure 4.10 Genome segment 6 (VP6) dendrogram

86 Figure 4.11 Genome segment 6 (RFLP) gel

xxiii

CHAPTER 1: EXPERIMENTAL PROPOSAL

1.1 Study problem Rotavirus gastroenteritis is one of the most significant causes of mortality in infants and children less than 5 years of age. Although the disease is ubiquitous, the rate of mortality remains higher in developing countries (Widdowson et al, 2009). To date, eight groups (A to H) have been identified, although groups F-H are not yet firmly confirmed. Groups (A to C) infect both humans and animals, whereas groups (D to G) infect animals only (Yolken et al, 1988). Among all these groups, group A is the most prevalent and it has been studied in details because most of the diarrhoeal episodes have been attributed to rotaviruses belonging to this group (Santos and Hoshino, 2005).

The classification of group A rotaviruses is based on three proteins which are: VP6, VP4 and VP7. The VP6 is used to define the virus groups and subgroups, while the VP4 and the VP7 are used to define the P-type (P for protease sensitive) and the G-type (G for glycoprotein). Association of the G-type and the P-type is called binary classification. The most commonly detected human group A strains that are detected globally are G1P[8], G2P[4], G3P[8], G4P[8] and G9P[8] (Hoshino and Kapikian, 2000; Estes and Kapikian, 2007).

The global prevalence of these five major serotypes is inconsistent and any strain can be detected at any particular time in any location during rotavirus season. Generally, numerous rotavirus genotypes surveillance studies have documented that G1 has been the most prevalent strain in many countries (Santos and Hoshino, 2005). The epidemiological studies of rotavirus infections in South Africa at the Dr George Mukhari Hospital have shown that there is a great diversity of rotavirus strains circulating. The major rotavirus genotypes circulating in the region have shown the fluctuations of the worldwide “common” rotavirus strains circulating with the presence of uncommon, untypeable strains and the emergence of a novel rotavirus within the community (Steele et al, 2003; Page et al, 2009; Seheri et al, 2010). It is not easy to predict which rotavirus genotype will be circulating each year since the detection of these common rotavirus strains is fluctuating, but surprisingly the prevalence of the G2P[4] strains at Dr George Mukhari Hospital has been observed after every 3 to 4 years, while in some other years, the G2P[4] was detected at lower frequency. The

1 documented years of cyclic detection of the G2P[4] strains were: 1984, 1987, 1990, 1993, 1997, 2003 and 2007 (Steele et al, 2003; Page and Steele, 2004; Seheri et al, 2010).

Since 2007 through 2009, the G2P[4] rotavirus strains were detected each year in succession, these observations contradicted with what has been observed from 1984 to 2007 period whereby the strains were detected after almost every 3 to 4 years. Based on these observations, this study identified a gap, whereby the genetic profiles and the evolutionary mechanisms of these strains need to be investigated in order to identify the genetic relationship (if any) of these strains with those circulating in the past years (i.e. 1984-2007).

1.2 Aim The study aimed at investigating the genetic profiles of G2 rotavirus strains over a 25-year period at Dr George Mukhari Hospital in Pretoria.

1.3 Objectives Primary objective  To investigate the genetic evolution of the G2 strains over a 25 year period. Secondary objectives  To sequence the VP7 genomic segment of G2 rotavirus strains for which sequences are not available in the Genbank. The study population comprised two groups of samples; those which were previously sequenced in the VP7 genomic segment only (from 1984 to 1997) and those which were sequenced de novo in this study for the VP4, VP6 and VP7 genomic segments (from 2003 to 2009).  To compare sequences, assess and identify any changes that might have occurred on the antigenic regions and the glycosylation regions of the G2 strains over a 25 year period and to determine whether there are changes in the VP7 genes of the contemporary strains when compared with previous strains.  To investigate genetic lineages of G2 rotavirus strains over time.  To monitor the genetic variability of VP4 of some of the G2 strains.  To perform molecular characterization of the VP6 gene of some of the G2 strains.

1.4 Expected significance of the study The G2P[4] rotavirus genotype has been observed to dominate after every 3 to 4 years at Dr George Mukhari Hospital since 1984 until 2007. Surprisingly, from 2007 until 2009, it was noticed that the G2P[4] strains were detected annually. The pattern of occurrence of these strains has caught our attention and therefore there is a need to study the genetic variability of these strains over time. In this study, the genetic variation or similarities within the outer capsid protein (VP7) of these strains will be determined. This could permit us to determine whether there are accumulations of amino acid changes over time in antigenic sites. Additionally, it will also inform us if these strains evolved from the same ancestor or from different ancestors. The VP7 nucleotide sequence of the vaccine strain is homologous to the DS-1 prototype, it will be essential to determine the VP7 nucleotide sequences of the study strains in order to determine homology to the vaccine strain. It could also be hypothesized that if the vaccine strain differs substantially to the study strains, therefore vaccine coverage could also be low.

Molecular analysis of the genes encoding the VP4 and VP6 proteins will also help us to monitor the genetic variability of these proteins as well. Monitoring the genetic variability of the VP4 and the VP6 proteins will be of crucial importance, since: the VP4 gene is an important antigenic component of the virus and VP6 gene is the most abundant protein of the virus that is targeted by EIA, which is the primary serological assay that is routinely used for the diagnosis of rotavirus infection. Furthermore, molecular analysis of the VP7, VP4 and VP6 protein could also help us identify novel strains which could pose a challenge in diagnosis, or attributed to high virulence of the virus, or results in vaccine escape mutants.

CHAPTER 2: LITERATURE REVIEW

2.1 Introduction Diarrhoeal disease is one of the leading causes of mortality in children worldwide. It is reported that 4 to 6 million children die each year due to diarrhoea. There are many different organisms that cause diarrhoea, and these include bacteria, parasites and viruses. Rotavirus is one of the most significant viral agents that cause severe diarrhoea, and it is estimated that rotavirus causes about 453 000 deaths annually worldwide (Tate et al, 2012). The virus can infect people of all races and all socioeconomic groups. Furthermore, this virus can be transmitted between different species (interspecies transmission) leading to the evolution of novel rotavirus strains of epidemiological significance (Iturriza-Gómara et al, 2004). However, in humans the primary targets are infants and young children below 5 years of age, the elderly, and the immunocompromised individuals. It is also estimated that by the age of 3 years, most children will have been infected at least once by the virus. The disease is ubiquitous; mortality rate remains higher in the developing world especially in Africa and Asia (Tate et al, 2012).

2.2 History Rotavirus research started in 1943 by Jacob Light and Horace Hodes. These two scientists proved that a filterable agent in the faeces of children cause infectious diarrhoea and also cause livestock diarrhoea in cattle (Light and Hodes, 1943). In 1963, Adams and Kraft reported that the electron micrographs of the intestinal epithelium of infant mice infected with epizootic diarrhoea virus demonstrated intracellular spherical structures measuring 65 to 75 nm in diameter, and this virus was later associated with rotavirus (Adams and Kraft, 1963). In 1969, Mebus and colleagues identified similar viruses in stools of calves presenting with diarrhoea (Mebus et al, 1976). Human rotaviruses were officially reported in 1973 by Ruth Bishop and colleagues; the virus was visualized by electron microscope (EM) in intestinal biopsy specimens of children with acute gastroenteritis (Bishop et al, 1973).

The virus was then named rotavirus in 1974 by Thomas Henry Flewett; this name came after its morphological appearance observed under the EM, the virus appears like a wheel-shaped under the EM. The word rota means a “wheel” in Latin. Four years later, the name was officially recognized by the International Committee on Taxonomy of Viruses (ICTV).

2.3 Virology and classification Rotaviruses belong to the Reoviridae family, along with the genera: Orthoreovirus, Orbivirus, Rotavirus, Coltivirus, Aquareovirus, Cypovirus, Fijivirus, Phytoreovirus, Oryzavirus, Seadornavirus, Idnoreovirus and Mycoreovirus. The complete viral particle has a triple-layered capsid structure which is made up of the core, inner capsid and outer capsid. The core encases a genome that consists of 11 segments of double-stranded deoxyribonucleic acid (dsRNA) (Figure 2.1) which encode six structural viral proteins (VP1-VP4 and VP6- VP7) and six non-structural proteins (NSP1-NSP5/NSP6) (Estes and Kapikian, 2007). Classification of rotaviruses is based mainly on the VP6, VP7 and VP4 antigens. However, the rotavirus whole-genome RNA hybridisation patterns have been documented to identify different genogroups.

The inner capsid consists of trimers of the highly immunogenic protein VP6, which is used to classify the rotaviruses into groups and subgroups (SG). To date, eight groups (A to H) have been identified, although group F-H are not yet firmly confirmed. Group A is the most common cause of rotavirus epidemics and sporadic cases in humans worldwide. Groups B, C and H can also cause disease in humans and group B has been associated with adult diarrhoea (Fang et al, 1989; Patton, 2012), Group C infection is associated with sporadic outbreaks, while groups D, E and G are known as avian rotaviruses (Trojnar et al, 2010). Group A rotaviruses are classified into four subgroups (Subgroup I, Subgroup II, Subgroup I and II, and Subgroup non-I non II) (Greenberg et al, 1983a; Lopez et al, 1994; Estes and Kapikian, 2007).

The outer capsid consists of the VP7 and VP4 proteins. The VP4 proteins are spike-like and are embedded on the VP7 glycoproteins. The VP4 protein is encoded by genomic segment 4; it is a protease-sensitive protein and is often denoted as P to specify the P serotype antigen. The VP7 protein is encoded by genomic segment 7, 8 or 9 depending on the strain. The VP7 is a glycoprotein and specifies the G serotype antigen. Group A rotaviruses are classified according to the binary classification system based on VP7 (G) and VP4 (P) genome segments to specify the G and P types, respectively (Estes and Kapikian, 2007). To date, there are 27 G types and 35 P types that have been identified in humans and animals (Matthijnssens et al, 2011). Both VP7 and VP4 proteins are known to play significant roles in rotavirus genetic and antigenic diversity and can independently elicit the protective immunity against rotavirus infections (Hoshino et al, 1988).

In the early 1980s, the fluorescent-focus tube neutralization assay was developed to describe four different antigenic types (serotypes). This was achieved after developing methods to cultivate the virus in vitro. In 1982, Wyatt et al (1983) used the plaque reduction assay technique to describe various serotypes. The four distinct antigenic types were designated as serotypes G1, G2, G3 and G4 (Wyatt et al, 1983). These four serotypes were reported to be the most common strains worldwide and they constitute 90% of the strains in circulation (Gentsch et al, 2005). Depending on the serotypes, these common strains shares similar or distinct genetic and antigenic features. Almost all the G2 serotypes were associated with VP6 SGI and a VP4 serotype designated as P1B[4], while serotype G1, G3, and G4 rotaviruses were associated with VP6 SGII, and a VP4 serotype P1A[8] (Gorziglia et al, 1988; Gentsch et al, 2005; Santos and Hoshino, 2005). The genetic profile of the G2 is also different to the other three serotypes when demonstrated by hybridization radioactive probes. It was found that hybridization probes made from the genome of G1 serotype hybridized strongly to other serotypes G3 and G4, while it was not able to hybridize with all the gene segments of the G2 serotype. Conversely the radioactive probes made from the genome of G2 serotype did not hybridize with the G1, G3, and G4 as well. Therefore, it was concluded that the segments of serotypes G1, G3, and G4 were closely related to each other but highly divergent to the G2 serotype and vice versa. These distinct gene constellations were then referred to as genogroups. The G1, G3 and G4 serotypes were clustered under Wa genogroup, while serotype G2 is under DS-1 genogroup (Flores et al, 1982; Nakagomi and Nakagomi, 1993). Few years later, another minor genogroup distinct from both the Wa and the DS-1 genogroups was reported and was called the AU-1 genogroup. Rotaviruses in the AU-1 genogroup belonged to SGI but were identified as serotype G3 (Nakagomi et al, 1989; Nakagomi and Nakagomi, 1990; Ward et al, 1990).

Currently, G9 serotype has been a predominant serotype as well and is also considered as a common serotype (Kirkwood, 2010; Patton, 2012). This serotype was detected originally in the mid 1980’s and in the 1990’s it was detected in a more increased rate. To date serotype G9 have been identified in every continent including the United States, Japan, India, Bangladesh, France, Malawi, Nigeria, Australia, China, Thailand, South Africa, Paraguay, Ghana, Brazil, and United Kingdom etc (Ramachandran et al, 1998; Cunliffe et al, 1999; Iturriza-Gómara et al, 2000; Armah et al, 2003; Kirkwood et al, 2003; Steele and Ivanoff, 2003; Zhou et al, 2003). Genotype G12 was detected originally in Philippines in 1987;

6 afterwards it was not detected anymore for a period of 10 years until it was detected again in 1998 and 1999 in Thailand and USA, respectively. Since 1999 several G12 predominant seasons were documented in Asian, European and South American countries including India: (1999-2005), Bangladesh (2000-2005), Japan (2003), Korea (2002-2003), Nepal (2003- 2004), UK (2002, 2006), Belgium (2003), Hungary (2005), Slovakia (2006), Argentina (1999-2003) and Brazil (2004). Recently G12 have been detected globally with increased detection rates. Several uncommon G serotypes including: G6, G8, G10, G5 and G11 have been detected in children and most of them are believed to have originated from animals. The G6, G8 and G10 rotavirus strains are the most common bovine rotavirus genotypes while G5 and G11 are the most common porcine rotavirus genotypes (Gouvea and Santos, 1999; Cunliffe et al, 2001).

Rotavirus classification is no longer only based on binary classification system, but by full genome classification where all the eleven genes are defined. This new classification system was initiated in 2008 were the Rotavirus Classification Working Group (RCWG) developed a nucleotide-sequence-based complete genome classification system to classify rotavirus strains. The new classification system is based on assigning a specific genotype to each of the 11 rotavirus genome segments according to established nucleotide percent cut off values (Table 2.1). In this new classification system, VP7-VP4-VP6-VP1-VP2-VP3-NSP1-NSP2- NSP3-NSP4-NSP5/6 proteins of the rotavirus strains are described using the abbreviations Gx-P[x]-Ix-Rx-Cx-Mx-Ax-Nx-Tx-Ex-Hx, respectively. This nomenclature was used in order to designate the complete genetic constellation of the virus, where x represents the numbers of the corresponding genotypes (Matthijnssens et al, 2008a).

Table 2.1: Nucleotide (amino acid) percentage identity cutoff values defining genotypes for 11 rotavirus gene segments.

Gene Percentage identity Genotype (n)b Description of gene product Cutoff value product

VP7 80(89)a G(27) Glycosylated

VP4 80(89) P(35) Protease-sensitive

VP6 85 I(16) Intermediate capsid shell

VP1 83 R(9) RNA-dependent RNA polymerase

VP2 84 C(9) Core shell protein

VP3 81 M(8) Methyltransferase

NSP1 79 A(16) Interferon antagonist

NSP2 85 N(9) NTPase

NSP3 85 T(12) Translation enhancer

NSP4 85 E(14) Enterotoxin

NSP5 91 H(11) Phosphoprotein

KEY: aCutoff values based on amino acid percentage identities between rotaviruses belonging to different serotypes bn, number of genotypes

Figure 2.1: Structural organization of Rotavirus (RV): (A) Polyacrylamide gel showing RV RNAs 1-11 with gene–protein assignment on the right. (B) Surface representation of RV structure. Channels of classes I–III are indicated, the VP4 spikes are in red, and the VP7 capsid layer is in yellow. (C) Cut-away of the RV structure showing the intermediate layer (VP6, blue), the core (VP2, green) and the flower-shaped VP1/VP3 complexes at the inside of VP2 opposite of class I channels (red). (D)Structural organization of the VP2 layer (some of the 60 dimers are shown in red and purple). (E) Genomic RNA in the RV structure. The VP6 and VP2 layers are partially cut-away to expose the RNAs, which at the outside have dodecahedral appearance. (F) Structure of the actively transcribing DLPs with nascent mRNAs (grey) exiting through the class I channels. (G) A close-up cut- away view of the exit pathway in one of the channels. The bowling pin-shaped density of the exiting transcript

(pink) is seen in actively transcribing DLPs. Panels (B)–(G) are delineated from image constructions of cryo- electron micrographs (Desselberger et al, 2009).

2.4 Diversity of rotaviruses Rotaviruses genetic diversity is through three different mechanisms such as point mutations (genomic drift), reassortment (genomic shift) and rearrangement (duplications and deletions of sequence within a gene). Since rotavirus can infect a variety of avian and mammalian species including humans, the possibility of interspecies transmission is very high and therefore leading to a broader genetic variation (Taniguchi and Urasawa, 1996; Ramig and Ward, 1991). Earlier studies have highlighted that genome diversity of rotavirus may be attributable to the segmented nature of the genome as it has been already observed with influenza viruses (Webster, 1992).

2.4.1 Point mutations Evidence of sequential accumulation of point mutations has been detected by oligonucleotide mapping and by sequencing (Flores et al, 1988; Palombo et al, 1993). Point mutations can occur in each rotavirus genome segment, more especially because of different immune or host-selection pressures. Even though any genome segment can accumulate point mutations, other studies stress the fact that since the VP7 and the VP4 proteins are the main targets for the current vaccine, therefore the genome segment encoding these proteins are expected to accumulate several point mutations and suddenly evolve much more rapidly than the proteins located in the inner capsid and the inner core layer of the virus (Taniguchi and Urasawa, 1996).

The VP7 has about six hypervariable regions which are known to be associated with G serotype specificity. To date rotavirus monotypes exist and they are defined as strains that carry the same substitutions of amino acids in the hypervariable regions (Coulson, 1987), the identification of monotypes was attained using serotype specific neutralizing monoclonal antibodies. The nucleotide sequence of the hypervariable regions of genome segment (7, 8 or 9) contains cross reactive and serotype specific neutralization epitopes. When these hypervariable regions were mapped it was shown that the following amino acids regions represent the antigenic and the neutralization regions of the rotavirus A (amino acids 87-101), B (145-152), C (208-221), and F (235-242) (Coulson and Kirkwood, 1991; Taniguchi et al, 1988). Most of the point mutation occurs at antigenic regions when the virus responds to selection pressure mounted by the immune system. Virtually almost all the contemporary

10 emerging rotavirus G2 strains are characterized by amino acids substitutions (D96N) in the antigenic regions of the VP7 protein (Doan et al, 2011).

2.4.2 Reassortment Rotavirus reassortment usually occurs when one cell is infected with two different and compatible viruses resulting in progeny novel viruses containing reassorted gene segments (Ramig and Ward, 1991). Earlier studies stipulate that this form of genetic change can be between members of the same genogroup or between members of different genogroups. Furthermore other studies have shown that reassortment between members of the same genogroup is common, while between members of different genogroups is uncommon (Gentsch et al, 2005). Nevertheless, the recent data based on full genome analyses have shown that, reassortment between members of different groups is also possible (Matthijnssens et al, 2008b). The driving force of rotavirus reassortment is the frequency of co-infection with different genotypes. Recent statistics estimated that in the developing countries the rate of rotavirus co-infection can be as high as 20%, while in developed countries it is below 5% (Iturriza-Gómara and Gray, 2011; WHO, 2011). As a result of reassortment, several rotavirus novel strains have been identified, such as (subgroup I-G3- long RNA pattern and subgroup II-G2-long RNA pattern) (Matsuno et al, 1988; Ward et al, 1990).

2.4.3 Rearrangement Rearrangement can occur as a form of deletion or duplication of genome segments. The mechanism of rearrangement in rotavirus is attributable to the dysfunction of RNA polymerase during replication resulting in partial gene duplication of a dsRNA segment (Schnepf et al, 2008). Possible evidence of rearrangement can easily be noticed by polyacrylamide gel electrophoresis (PAGE) when some segments are missing from their original positions, and when additional bands are noticed with different mobilities. The first rearrangement virus was isolated from humans who are immunocompromised (Pedley et al, 1984; Hundley et al, 1987). Other studies illustrated that rearrangements in rotaviruses is mostly confirmed to genome segment 11 than to the other segments (Estes, 2001).The majority of gene duplications are found to start after the stop codon and extends through to the 3’ end, therefore leading to a long untranslated 3’ region (UTR) (Desselberger, 1996). Cases of rearrangement involving deletions are rare, one of them were identified in a study by

Tian et al (1993), who reported a deletion of 308 bp in the 5’ region of the ORF from a gene segment encoding NSP1. A typical example of rearranged gene segment is illustrated by Figure 2.2.

Figure 2.2: Structure of rearranged rotavirus genome segments containing partial ORF duplications (Ballard et al, 1992).

2.4.4 Interspecies transmission Interspecies transmission is one of the contributing factors of rotavirus diversity; the mechanism is possible either through transmission of the whole virus or through reassortment. Evidence of interspecies transmission has been detected by using hybridization probes made from HRV strains by in vitro transcription (Gentsch et al, 2005). Todd et al (2010) suggested that the rate of interspecies transmission is higher in the developing world, especially in Africa because most people are living in close proximity with animals. To date there are several G serotypes of animal origin, which are frequently detected in human hosts, some of them are: G5, G6, G8, and G3. Serotype G5 is believed to be of porcine origin and it was first reported in Brazil (Gouvea et al, 1994). G8 is believed to be of cattle origin, and the first detection of this genotype in Africa was reported in Nigeria (Adah et al, 1996). Serotype G6 have been detected for the first time in Africa in Mali and is believed to be a human bovine reassort (Rahman et al, 2003).

2.5 Prevalence of rotavirus genotypes The most common G genotypes of human rotavirus are G1, G2, G3, G4 and G9, while the most common P genotypes are P[4] and P[8]. The most common genotype combinations of human rotavirus are G1P[8], G2P[4], G3P[8], G4P[8] and G9P[8] (Kirkwood, 2010; Patton, 2012). In developed countries these common rotavirus genotypes can cause almost 100% of infections (Payne et al, 2011). Among these common strains, the G1P[8] strains are often detected in higher rates (Figure 2.3) as compared to the other strains, however few exceptions have been noticed where a non G1P[8] strain was dominant. Uncommon G and P genotypes have also been encountered, some of which are: G12P[8], G12P[6], G2P[6], G3P[6], G1P[6], G1P[4], and G2P[8] strains (WHO, 2011). Most of these uncommon strains vary widely from one region to another, majority of these strains have been reported in developing countries. In 2010, WHO reported the G12P[8] and G12P[6] in Southeast Asia, G2P[6], G3P[6],G1P[6] and G1P[4], G2P[8] strains in sub-Saharan Africa and Western Pacific, respectively (WHO, 2011).

Figure 2.3: Illustration of the proportion of G and P combination from regional and worldwide surveillance data between 1994 and 2003 (Gentsch et al, 2005).

2.6 Prevalence of G2 worldwide Since 1973 to 2003 analysis of the G2P[4] genotype has shown a continent /subcontinent variation and these variations are reported as follows: South America 23%, Africa 2%, Asia 13%, North America 11%, Europe 9% and Australia 14% (Santos and Hoshino, 2005). The G2 strain has been reported to be the most prevalent strain, from several studies that have been performed in Bangladesh aiming to evaluate the genetic diversity of rotaviruses. However G4 genotype was the most dominant strain from 1992-1997 and its detection rate decreased with time Rahman et al (2005). G2 strains also showed a robust increase starting from 2001 to 2004 with P[4] being the dominant genotype and accounting for 76% of the cases. The four common worldwide strains {G1P[8], G2P[4], G3P[8], G2P[8]} was found in 83,9% of the cases (Rahman et al, 2007).

From a recent report in Brazil, it was documented that a remarkable increase and dominance of G2P[4] was noted immediately after the implementation of Rotarix® (Gurgel et al, 2009). The predominance of serotype G2 was also observed in other regions of Latin America, including: Argentina, El Salvador, Guatemala, Honduras and Paraguay. In Argentina, the predominance of G2P[4] was observed in 2004 (44%) and 2007 (58%) (Esteban et al, 2010). The 2006 Surveillance reports from El Salvador, Guatemala, and Honduras indicated (68-81%) detection rate of G2P[4] (Patel et al, 2008). In Paraguay, G2P[4] was predominant in 2006 (64%) and 2007(46%) after it was absent for six years (Martinez et al, 2010).

Page and Steele (2004) mentioned that in South Africa the circulation of the G2 strains follows a cyclic pattern. Between 1996 and 2000 a broader study was conducted in the African continent aiming to characterize the G2 serotype both genetically and antigenically, countries included: Kenya, Nigeria, Ghana, Ivory Coast, Burkina Faso, Tunisia, Mauritius and South Africa, but the study was performed in South Africa at the University of Limpopo (Medunsa Campus). Most of these African strains exhibited subgroup I specificity, short RNA profiles, and altered P types. The P[4] genotype was displayed by strains from Tunisia, Kenya and Mauritius, and P[6] genotype was displayed in the strains from Nigeria, Ghana, Burkina Faso and Ivory Coast (Page and Steele, 2004).

In Thailand and United Kingdom (UK), studies conducted by Zao et al (1999) and Itturriza- Gómara et al (2001), respectively, reported the re-emergence of G2 strains. In Taiwan, the G2 strains re-emerged in 1992, and caused an epidemic in 1993. In the UK, the G2 strains re- emerged in 1995-1996 but it was the second most common genotype and it contributed 16- 18%. From a recent study in Nepal, several nucleotide sequences of genome segment (7, 8 or 9) encoding the VP7 protein, deposited in the GenBank database over the last 34 years from across the world was extracted. These sequences were used to perform a phylogenetic analysis, in order to assess major antigenic changes in the gene encoding VP7 protein from diverse strains collected in different areas of the world and to gain a more comprehensive knowledge of the evolution of G2 strains. In general it was concluded that most of contemporary G2 strains are characterized by D96N substitution and most of them are grouped in lineage IVa (Doan et al, 2011).

2.7 Viral proteins 2.7.1 Structural proteins

The VP1 protein The gene encoding the VP1 protein (125-kDa) is 3,302 base pairs in length and is located on gene segment 1 (Table 2.2). This protein is located in the core of the virus particle and is the viral RNA-dependent RNA polymerase. It contains sequence motifs shared by RNA- dependent RNA polymerases of other viruses (Vasquez-del Carpio et al, 2006). In an infected cell, this enzyme produces mRNA transcripts for the synthesis of viral proteins and produces copies of the rotavirus genome RNA segments for newly produced virus particles. The VP1 binds nucleotides and cross-linking of the nucleotide analog azido-ATP to inhibit viral RNA polymerase activity (Valenzuela et al, 1991). Baculovirus-expressed core-like particles (CLPs) consisting of VP1 and VP2 can catalyze the synthesis of dsRNA from template mRNA, but CLPs consisting of VP2 only, lack such polymerase activity (Zeng et al, 1996).

The VP2 protein

The gene encoding VP2 protein (102-kDa) is 2,690 base pairs in length and is located on gene segment 2 (Table 2.2). The VP2 is also located in the core of the virus and is regarded as the major protein component of the core. The protein contains nonspecific RNA-binding activity for both single-stranded and dsRNA and is able to self-assemble into CLPs (Labbe et al, 1994). Although the VP2 CLPs have been shown by assay in cell-free systems to lack replicase activity, studies with rotavirus temperature-sensitive mutants have indicated that the VP2 plays an essential role in the formation of replication intermediates with replicase activity (Mansell and Patton, 1990; Zeng et al, 1996).

The VP3 protein

The gene encoding VP3 protein (88-kDa) is 2,591 base pairs in length and is located on gene segment 3 (Table 2.2). Like the VP1, the VP3 protein is located within the inner core of the virus. Fresco and Buratowski (1994) highlighted that the VP3 is the other minor protein of the core which covalently binds GTP and functions as the viral guanyltransferase, and this is a capping enzyme that assists in the synthesis of proteins by catalysing the formation of the 5’ cap in the post-transcriptional modification of the 5’ cap that stabilizes viral mRNA by

16 protecting it from nucleases, which are nucleic acid degrading enzymes (Fresco and Buratowski, 1994).

The VP4 protein

The gene encoding VP4 protein (87-kDa) is 2,362 base pairs in length and is located on gene segment 4 (Table 2.2). This protein is located in the outer shell on the surface of the virion that protrudes as a spike (Gardet et al, 2006), 60 series of short spikes approximately 10-12 nm in length have been reported (Prasad et al, 1990). The VP4 protein is non-glycosylated, protease-sensitive and it contains the viral hemagglutinin (Kalica et al, 1983). This protein determines both the virulence and the P-type of the virus. After infection the VP4 protein binds to receptors on the surface of the cells and drives the entry of the virus into the cells (Arias et al, 2002). The VP4 protein has to be cleaved by a protease enzyme (found in the gut) into the VP5*(60-kDa) and the VP8*(28-kDa) protein before the virus can be infectious (Konno et al, 1993), hence the cleavage of the VP4 protein into the VP5* protein and the VP8* protein enhance viral infectivity because the VP5* protein fragment is the viral hemagglutinin and the VP8* protein fragment facilitates in the permeabilization of membranes (Konno et al, 1993). Both the VP4 protein and the VP7 protein are considered the most important viral proteins for rotavirus vaccine development since they elicit serotype specific neutralizing antibody response in the infected host (Hoshino et al, 1985; Offit and Blavat, 1986).

The VP6 protein

The gene encoding the VP6 protein (45-kDa) is 1,356 base pairs in length and is located on gene segment 6 (Table 2.2). The VP6 protein is a trimeric protein, found on the inner capsid and it forms the bulk of the capsid (51%). This protein interacts with both the outer capsid proteins VP4, VP7 and the core protein. It is highly antigenic and can be used to identify rotavirus species (Bishop, 1996). It can also be used in laboratory tests for diagnosis of rotavirus group A infections.

The VP6 also plays several important roles in the replication cycle of rotavirus:

1. It is a structural protein on the surface of the immature inner capsid particle (ICP) and assembles as 260 trimers with a T.13l icosahedral lattice (Roseto et al, 1979; Prasad et al, 1988).

2. It binds to a virally encoded glycoprotein receptor (NSP4, formerly NS28), which mediates the budding of the immature ICP into the endoplasmic reticulum (ER) where final maturation and assembly of the virus takes place (Meyer et al, 1989).

3. It is a necessary component for the ICP to be transcriptionally active (Bican et al, 1982; Sandino et al, 1986).

4. It is the group and subgroup-specific antigen for group A rotavirus (Kalica et al, 1981; Matsui et al, 1989).

5. IgA neutralizing antibodies directed against the VP6 proteins can protect against rotavirus infection (Burns et al, 1996).

The VP7 protein

The gene encoding the VP7 protein (34 or 38-kDa) is 1,062 base pairs in length and is located on gene segment 7, 8 or 9 depending on the strain (Table 2.2). It is located on the outer capsid forming the smooth external surface of the shell (Greenberg et al, 1983b). The VP7 protein constitutes 30% of the virion protein and thus making it to be the second most abundant rotavirus protein and also the major constituent of the outer capsid. Unlike the VP4 protein, the VP7 protein is a glycoprotein and it contains one to three potential sites for N-linked glycosylation. However, the VP7 protein is glycosylated early studies has indicated that some mutant strains (SA 11) can still be infectious even when they lack glycosylation sites (Estes et al, 1982; Liu et al, 1988). Apart from its structural functions, it determines the G-type of the strain and along with the VP4 protein, the VP7 protein is the main antigenic determinant and it induces the development of type-specific neutralization antibodies (Pesavento et al, 2006).

2.7.2 Non-structural proteins

NSP1

The gene encoding NSP1 protein (59kDa) is 1,611 base pairs in length and is located on gene segment 5 (Table 2.2). This protein contains a cysteine-histidine rich zinc-binding domain and it is the least conserved protein among the strains. According to studies by Barro and Patton (2007) it was shown that this protein function as E3 ubiquitin ligase and mediate suppression of cellular innate immune responses by targeting interferon regulatory factors IRF3, IRF5, and IRF7 to proteasome-mediated degradation (Pesavento et al, 2006; Barro and Patton, 2007). The NSP1 protein from different strains differs in their abilities to suppress the innate immune system responses, and once the virus enters the cells, the NSP1 protein influence the replication efficiency of the virus (Feng et al, 2009). Patton et al (2001) reported that viruses containing mutated NSP1 protein replicate slowly but they are still viable as well.

NSP2

The gene encoding the NSP2 protein (35-kDa) is 1,059 base pairs in length and is located on gene segment 8 (Table 2.2). The NSP2 protein is a major component of virus replicase complex, it merges with the NSP5 protein to form viroplasm structures that are sites of viral RNA replication, packaging and assembly (Estes and Kapikian, 2007). The co-expression of the NSP2 protein and the NSP5 protein in uninfected cells results in upregulation of the NSP5 protein hyperphosphorylation and formation of viroplasm-like structures. The NSP2 protein contain single-stranded RNA binding nucleic acid helix destabilizing and Mg2+- dependent nucleoside triphosphatase (NTPase), nucleoside diphosphate kinase (NDP kinase) and RNA triphosphatase (RTPase) properties (Suguna and Durga Rao, 2010).

NSP3

The gene encoding the NSP3 protein (37-kDa) is 1,104 base pairs in length and is located on gene segment 7 (Table 2.2). This protein occurs as a dimer and it consists of two separable domains with the N-terminal RNA-binding domain consisting of residues 1-170 and the elF- 4G1-interacting domain formed by the last 107 residues of the C-terminus. These two

19 domains are separated by the dimerization domain lying between amino acids 150 and 206. Rotavirus mRNAs lack a poly (A) tail but instead contain a consensus sequence at their 3’ ends. The NSP3 protein is a sequence-specific RNA binding protein and it binds the tetranucleotide sequence that is conserved at the 3’ ends of all rotaviral mRNAs (Suguna and Durga Rao, 2010). A study conducted by Montero et al (2006) has indicated that the NSP3 protein is not required for viral translation, but it could be important for inhibition of cellular mRNA (Montero et al, 2006; Pesavento et al, 2006).

NSP4

The gene encoding NSP4 protein (20-kDa) is 751 base pairs in length and is located on gene segment 10 (Table 2.2). The NSP4 protein is essential for virus morphogenesis and pathogenesis. This protein is the first virus-encoded enterotoxin to be identified and it exists in multiple forms in the infected cell. The full-length protein is anchored in the endoplasmic reticulum through the N-terminal hydrophobic domains and the C-terminal region of about 131 residues attains cytoplasmic orientation (Bergmann et al, 1989). The protein performs the following functions: intracellular receptor for single-shelled particles and mediation of virus assembly into double-shelled particles, intracellular calcium mobilization, membrane permeabilization, Ca2+ and VP4 binding, double-layered particle-binding and diarrhoea induction in host cells (Estes and Kapikian, 2007). Six NSP4 genotypes (A-F) have been identified by sequencing and phylogenetic analysis of NSP4 gene (Estes and Kapikian, 2007). Out of the six genotypes three (A-C) has been identified in human and also many mammalian species (Estes and Kapikian, 2007).

Figure 2.4: Schematic representation of the ER-anchored NSP4 and its role in the budding of DLP into the ER lumen during morphogenesis of DLP into mature triple-layered particle (Suguna and Durga Rao, 2010).

Figure 2.5: Schematic representation of the different domains of rotavirus NSP4 (Suguna and Durga Rao, NSP52010).

NSP5

The gene encoding NSP5 protein (22-kDa) is 667 base pair in length and it is the major product that is located on gene segment 11 (Table 2.2). This protein can undergo phosphorylation and glycosylation to yield isoforms that range from 22 to 37-kDa in size. The NSP5 protein is rich in serine-threonine sequences and it contains target sites for multiple cellular kinases. The NSP5 protein appears to undergo hyperphosphorylation and dephosphorylation, but the hyperphosphorylated forms are found in the insoluble viroplasm fractions. The phosphorylation of the NSP5 protein is modulated by its interaction with other nonstructural protein, NSP2. The NSP5 protein also possesses ATPase activity. In the

infected cell the NSP5 protein and the NSP2 protein merge together to form one unit that becomes a major component of the viroplasma structures. The NSP5 protein can also interact with the NSP6 protein, the viral RNA-dependent RNA polymerase (VP1) and also the inner capsid protein (VP2). The NSP5 protein is also shown to be essential for virus replication and encapsidation (Africanova et al, 1996; Poncet et al, 1997; Blackhall et al, 1998; Pesavento et al, 2006).

NSP6

The gene encoding NSP6 protein (11-kDa) is 667 base pair in length. Together with the NSP5 protein, the NSP6 protein is located on gene segment 11 (Table 2.2). They are encoded by two open reading frames. The NSP6 protein functions as a nucleic acid binding protein (Torres-Vega et al, 2000; Pesavento et al, 2006).

Table 2.2: Summary of the 11 rotavirus structural and non-structural proteins with their respective, size, molecular weight, function and their location on the virion (Claude et al, 2005).

RNA Size base Protein Molecular Location Copies per Function Segment pairs weight Particle (Gene) kDa 1 3302 VP1 125 At the vertices of <25 RNA-dependent RNA the core polymerase 2 2690 VP2 102 Forms inner shell of 120 Stimulates viral RNA the core replicase 3 2591 VP3 88 At the vertices of <25 Guanylyltransferase mRNA the core capping enzyme 4 2362 VP4 87 Surface spike 120 Cell attachment, virulence

5 1611 NSP1 59 Nonstructural 0 5’RNA binding

6 1356 VP6 45 Inner Capsid 780 Structural and species specific antigen 7 1104 NSP3 37 Nonstructural 0 Enhances viral mRNA activity and shut-offs cellular protein synthesis 8 1059 NSP2 35 Nonstructural 0 NTPase involved in RNA packaging 9 1062 VP7 34 or 38 Surface 780 Structural and neutralization antigen 10 751 NSP4 20 Nonstructural 0 Enterotoxin

11 667 NSP5/NSP6 22 Nonstructural 0 ssRNA and dsRNA binding modulator of NSP2

2.8 Transmission Rotaviruses are transmitted by the faecal-oral route through contaminated hands, surfaces, objects, foods and water. This was proved when diarrhoeal disease was induced in adult volunteers after ingesting rotavirus positive stool material (Kapikian et al, 1983). Rotaviruses can also be transmitted by the respiratory route (Dennehy, 2000), this was also proved from studies where gnotobiotic piglets that were given a virulent human rotavirus strain intranasally, and responded by developing diarrhoea and viremia (Saif et al, 1996).

Poor hygiene increases the rate of rotavirus transmission, the stools of an infected person can contain more than 10 trillion infectious particles per gram, but only 10-100 of the viruses are required to transmit the infection to the next person (Graham et al, 1987). The incidence of rotavirus infection is similar in both developed and developing countries (Figure 2.6). It has been documented that the standard sanitary measures adequate for eliminating bacteria and parasites is not effective enough to control rotavirus infection (Kapikian et al, 1996b). However, the difference is that rotavirus kills the majority of children in developing countries because the standard of care is not the same as in developed countries (Parashar et al, 2003).

Figure 2.6: Pie charts comparing prevalence of aetiological agents of diarrhoea between developed and developing countries (Bernstein, 2009).

2.9 Pathogenesis Once the virus enters the body, it infects the gastrointestinal tract. The infection initiates in the proximal end of the small intestine when the virus binds and infects enterocytes in the small intestine. This binding is mediated by sequential interaction with a series of sialic acid- containing and nonsialylated receptor molecules (Isa et al, 2006).

The virus is internalized by an unknown mechanism and loses its outer capsid thereafter. This causes sudden activation of the virion-associated transcriptase and viral macromolecular synthesis (Baker and Prasad, 2010). Viral proteins and RNAs concentrate in cytoplasmic structures that are called viroplasms, where RNA replication and packaging takes place. The infection then advances distally and is accompanied by histological changes, which include shortening, stunting, and atrophy of villi, mononuclear cell infiltration into the lamina propria; sparse, irregular microvilli; and distension of endoplasmic reticulum cisternae and mitochondrial swelling (Hernandez et al, 1997). This pathology influences the mechanisms of diarrhoea because there is a sudden reduction in the absorptive surface and impaired absorption. As a result, the function of the small intestine epithelium is altered and the diarrhoea is generally considered to be malabsorptive and the absorption of Na+, water, and mucosal disaccharides are decreased (Chrystie et al, 1978). While mucosal cyclic Amp is not altered, malabsorption results in the transit of undigested mono and disaccharides, fats, and proteins into the colon.

Based on analysis of different virus reassortants, several virus proteins have been identified as being involved in virulence (VP3, VP4, NSP1, VP6, VP7, NSP2, NSP3 and NSP4) (Estes et al, 2003). The VP3, NSP2, VP6 and NSP3 are thought to have roles in the efficiency of virus replication. The NSP3 is thought to be involved in shutting off of host protein synthesis. NSP3 and VP6 are involved in extraintestinal spread of virus. The VP4 and VP7 are involved in assisting the virus to enter cells. NSP1 is involved in regulation of the induction of interferon and NSP4 is involved in the induction of diarrhoea by triggering the release of Ca+ from the endoplasmic reticulum (Lundgren et al, 2000). The increase in intracellular Ca+ concentration triggers a number of cellular processes, including disruption of the microvillar cytoskeletal network, lowered expression of disaccharides and other enzymes at the apical

24 surface, general inhibition of the Na+ solute co-transport systems, and necrosis (Estes et al, 2003).

The pathologic changes associated with rotavirus infection are usually limited to the villi of the small intestine that suddenly lead to the development of diarrhoea with severe dehydration. It is also proposed that rotavirus can also replicate and cause disease in the hepatic and the central nervous system, but there is no consistent evidence of this proposal (Gentsch et al, 1996). Diagrammatic illustration of mechanism of rotaviral diarrhoea is depicted in Figure 2.7.

Figure2.7: Illustration of model of rotavirus-induced diarrhoea. Panel A depicts events in the infected epithelium. For clarity, not all events are shown in each cell. The following processes are shown in order from left to right across the four cells. (i) The initial cell is infected by luminal virus, with virus entry and uncoating, formation of a viroplasm (Vi), and the release of virus and viral proteins. NSP4 (red triangles) may be released via a nonclassical secretory pathway. Intracellular NSP4 also induces release of Ca2+ from the internal stores, primarily the endoplasmic reticulum (blue), increasing [Ca2+]. (ii) A cell is secondarily infected after virus release from the initial cell. NSP4 produced by the infection disrupts the tight junctions, allowing paracellular flow of water and electrolytes (green arrow). (iii) NSP4 binds to a specific receptor on a cell and triggers a signaling cascade through PLC and IP3 that results in 2+ 2+ release of Ca and an increase in [Ca ]i. Intracellular expression of NSP4 does not stimulate PLC. The increase in 2+ [Ca ]I acts to disrupt the microvillar cytoskeleton. (iv)The brown cell represents a crypt cell. It can be acted on directly by NSP4, or NSP4 can stimulate the ENS, which in turn signals an 2+ - increase in [Ca ]i that induces Cl secretion. Panel B shows the normal architecture of the small intestine, with the circulatory system removed for clarity. This panel emphasizes the ENS and its ganglia in the different submucos allevels. Panel C shows a reflex arc in the ENS that can receive signals from the villus epithelium and activate the crypt epithelium. Inset 1 shows a whole mount of an adult mouse small intestinal villus, stained with antibody to protein gene product 9.5 to reveal the rich innervation (yellow stain). Inset 2 shows that infected villus enterocytes may stimulate the ENS by the basolateral release of NSP4 or other effector molecules (Gershon,1999; Lundgren and Svensson, 2001 )

2.10 Replication The replication of rotavirus takes place in the gut (Greenberg and Estes, 2009). The virus infects the enterocytes of the villi of the small intestine by a mechanism called receptor mediated endocytosis. Once in the cell, it forms a vesicle called an endosome within the viroplasm. It then uses the two outer proteins (VP4 and VP7) to destroy the membrane of the endosome but the virus remains located in the viroplasm. Destruction of endosomes eventually causes a difference in the calcium concentration. This difference in calcium concentration causes the breakdown of VP7 trimers into single protein subunits, leaving the VP6 and the VP2 protein coats around the viral dsRNA, meaning that the virus now remains with two layers and is called double layered particles (DLPs), this process lead to sudden activation of transcriptase which is an endogenous viral RNA-dependent RNA polymerase (Mason et al, 1980). In the presence of ATP, transcriptase synthesizes eleven viral plus RNA strands from a nuclease-sensitive plus-strand RNA. The synthesized plus RNA strands are then extruded through both the VP2 and VP6 layers. The extruded plus strand-RNA strand lacks 5’ caps and 3’ poly (A) and is suddenly translated into six structural and six nonstructural proteins. The plus-strand RNAs is also a template used for the synthesis of the dsRNA genome segments. The RNA strand also remains associated with subviral particles (VP1, VP2, VP6, NSP3, NSP1 and NSP2). This subviral particles aggregate inside the cytoplasmic viroplasms and acquire VP2, NSP2 and NSP5 (Petrie, 1984). Subviral particles bud through the membrane of the endoplasmic reticulum (ER) where they acquire an envelope but once the particles moves towards the interior of the ER the envelope is lost and suddenly replaced by a thin layer of protein that will eventually encompasses the outer capsid of mature virions. The subviral particles acquires most of the structural and non-structural proteins that are synthesized on free ribosomes, VP6 and VP4 that are localized on the space between the periphery of the viroplasm and the outside of the ER. Finally VP7 and NSP4 are acquired during budding into the ER. The acquired NSP4 functions as an intracellular receptor when the particle acquires the third layer. The virus is then released from the cell by lysis (Altenburg et al, 1980). Diagrammatic overview of detailed rotavirus replication is demonstrated in Figure 2.8.

Figure 2.8: Diagrammatic representation of the rotavirus replication cycle (Desselberger et al, 2009).

2.11 Signs and symptoms Rotavirus gastroenteritis causes mild to severe disease characterized by vomiting, watery diarrhoea and accompanied by low-grade fever. The virus has an incubation period of about 24-48 hours and symptoms often start with vomiting and then followed by four to eight days of profuse diarrhoea (Kapikian et al, 1983). Dehydration is more common in rotavirus infection than in most diarrhoeal infections caused by bacterial pathogens. Mortality due to rotaviruses is attributed to untreated severe dehydration (Maldonado and Yolken, 1990).

The first rotavirus infection is usually associated with severe diarrhoea, but severity of the disease decreases after subsequent infections (Linhares et al, 1988). The first rotavirus infection elicits a homotypic neutralizing antibody response to the virus whereas subsequent infection may elicit heterotypic responses. The symptomatic infection of rotavirus is very high in children less than two years of age (Bernstein et al, 1991). Infection in newborn is often associated with mild or asymptomatic disease, and severe symptoms tend to occur in

28 children from six months to 2 years of age, the elderly, and also those who are immunocompromised (Cameron et al, 1978). Rotavirus infection in immunocompromised adults can have a variable course from symptomless to severe and sustained infection. Rotavirus infection in adults has been associated with a wide spectrum of disease from asymptomatic infection to severe. Often infection in adults is subclinical; however, outbreaks of gastroenteritis have been reported in emergency situations and in closed communities. Most adults acquire rotavirus immunity during childhood. Infected asymptomatic adults may play a major role in transmitting the virus to the community, this is another factor that contributes to the global spread of the virus (Hrdy, 1987; Anderson and Weber, 2004), often symptomatic reinfections are due to a different rotavirus serotype (Linhares et al, 1988).

2.12 Epidemiology Surveillance data from epidemiological studies in both developing and developed countries indicate clearly that rotaviruses are the major etiological agents causing severe diarrhoea illness in infants and young children (Bishop, 1996). Although rotavirus diarrhoea occurs in high frequency in the developed countries, mortality rate remains low. According to statistical reports, it is indicated that in the United States, rotavirus cause about 5% to 10% of all diarrhoeal episodes in infants and children under 5 years of age (Fischer et al, 2004; Glass et al, 2005). In 2004 WHO estimated that worldwide, 527 000 (95% CI) children under the age of five years die each year due to rotavirus infection (Parashar et al, 2009). Approximately 82% of these children are from the poorest countries in Asia and Africa. Among the top ten countries with the highest childhood mortality attributed to rotavirus includes: Democratic Republic of the Congo, Ethiopia, India, Nigeria, Uganda, Angola, Pakistan, Afghanistan, Indonesia and Bangladesh (Parashar et al, 2009). However, in 2008 rotavirus mortality estimates was decreased to 453 000 (95% CI) in children less than 5 years of age (Tate et al, 2012).

Figure 2.9: Estimated annual distribution of 527,000 deaths due to rotavirus disease among children 5 years of age, by country. Each dot represents 1000 deaths. Brown dots indicate rotavirus cases reported in poorest countries in Africa and Asia (Parashar et al, 2009).

2.13 Rotavirus Seasonality In temperate climates, rotavirus disease occurs during the cooler months while in tropical climates seasonal patterns are less pronounced but the disease is said to be common during the drier cooler months (Linhares et al, 1983, van Damme et al, 2007). In the United States, rotavirus seasonality occur from late fall to early spring and the peak of disease varies by region (Turcios et al, 2006). In Africa the seasonality of rotavirus disease tends to vary, in West Africa the peak of the disease is during the cool-dry months of January and February. In East Africa the prevalence of rotavirus disease peaks from October to December, in Southern Africa the peak season occurs during winter (May-August) (Mwenda et al, 2010) and in sub- Saharan Africa the peak season occurs during dry season months of May to October (Cunliffe et al, 2010).

2.14 Diagnosis Diagnosis of rotavirus infection cannot be made based on clinical presentation only, and therefore a specific laboratory test is required for a conclusive confirmation. Before rapid assays were implemented to detect and diagnose rotavirus infection, EM was used for diagnosis. Diagnosis by EM was conclusive because the characteristic morphology of the

30 virus on appropriately processed stool specimens could readily provide confirmation of the presence of the virus. Other studies reported that direct EM examination of stools can permit detection of rotavirus in 80-90% of the virus-positive specimens (Brandt et al, 1981). Currently, diagnosis by EM is not often used because a variety of commercially available rapid assays for virus detection are commonly used. The most common assays are enzyme immunoassay-based or latex agglutination tests (Kapikian et al, 1996b). Dot hybridization assays and polymerase chain reaction are also used except that they are very expensive and also requires skilled personnel. The use of dot hybridization assays and polymerase chain reaction (PCR) provides reliable results and they have a much higher sensitivity (Flores et al, 1983; Wilde et al, 1991). Cell culture can also be used, although it is less preferred in many laboratories. Serological tests are often considered but they are sometimes less preferred bearing in mind that during acute illness, specific IgM may not appear until after the fifth or sixth day of symptoms (Losonsky and Reymann, 1990). Other methods that are routinely used in some laboratories include counterimmunoelectroosmophoresis, polyacrylamide gel electrophoresis (PAGE), reverse passive hemagglutination assay (RPHA), and also flow cytometry.

2.15 Therapy and prognosis

Treatment of acute rotavirus infection is nonspecific and normally involves management of symptoms, and most importantly maintenance of hydration. To date, oral fluids, electrolytes and supplementary nutrition remains the mainstay of rotavirus therapy worldwide. The Centre for Disease Control and Prevention (CDC, Atlanta) and the American Academy of Pediatrics highly recommend oral rehydration as a cornerstone of treating rotavirus gastroenteritis. Treating dehydrated patients is simply managing rehydration by compensating severe fluid loss; therefore the mainstay of managing rotavirus infection is usually directed at restoring normal physiological function (Duggan et al, 1992).

Appropriate effective therapy involves not only early rehydration but also continued replacement of on-going fluid losses and frequent feeding after rehydration. The oral glucose electrolyte solution recommended by the WHO contains 30 mEq/L of sodium, 30 mEq/L of potassium, and 30 mEq/L of bicarbonate. Numerous studies have shown that this formula is very effective for rehydration. If the disease is not treated, children will die from severe dehydration (Alam and Ashraf, 2003). When the infection is serious enough, the fluids can be

31 administered intravenously (drip) or by using a nasogastric tube. Rotavirus infections rarely cause other complications, and if the child is well managed the prognosis is excellent, however there are rare inconsistent reports of complications involving the central nervous system (CNS) where the virus was detected in the fluid of the CNS in cases of encephalitis and meningitis (Kehle et al, 2003; Goto et al, 2007). Other studies have shown that besides causing complications in the gut, the virus can progress to cause viremia (Widdowson et al, 2005).

2.16 Immunity Rotavirus immunity has been researched more in animals than humans. Rotavirus is more confined to children less than 5 years possibly due to an immature immune system that cannot clear the infection. Some studies also reveal that maternal antibodies acquired during breastfeeding are not efficient enough to prevent rotavirus gastroenteritis. This observation was confirmed based on the fact that antibodies in the lumen of the small intestine are the primary determinants of resistance to rotavirus illness, whereas circulating antibodies are not. Maternal antibodies fail to prevent rotavirus gastroenteritis because they are not sufficient enough to be present in the lumen (Offit and Clark, 1985).

VP4 and VP7 are the two proteins found on the outer capsid of the rotavirus and they are the major antigenic components of the rotavirus that determine the virulence of the virus; they independently induce neutralizing antibodies and as a consequence, each outer capsid protein plays a role in resistance to disease (Hoshino et al, 1988; Offit et al, 1986a). VP7 has been proven to be more efficient than the VP4 in terms of inducing neutralizing antibodies, this was proved in a study when 72% of infants and young children who were given the live rhesus rotavirus RRV vaccine developed antibodies to the major serotype-specific neutralization epitope on VP7 whereas only 56% of the vaccinees responded to a major neutralization epitope on VP4 (Shaw et al, 1987).

Both the cell mediated and the humoral immunity are involved during rotavirus infection. Studies performed on mice showed that cytolytic T lymphocytes can mediate clearance of primary rotavirus, however the effect of cell mediated immunity in humans is not quite clear. In humoral immunity, the rotavirus antigen stimulates two compartments of the immune system which are the mucosal compartment and the systemic compartment, in the mucosal compartment the rotavirus antigen in Peyer’s Patches generates memory cells which contain

32 homing receptors such as α4β7+ and CCR9+ that permit these memory cells to circulate in blood and to return to Peyer’s Patches, and antibody secreting cells that home to the lamina propria in the intestine and secrete IgA. These antibodies then mediate viral expulsion and exclusion and fill the intestinal cavity. Similarly in the systemic compartment the viral antigen stimulates memory B cells in spleen with homing receptors such as CD62L+ that permit these cells to circulate in blood and to return to the spleen, and antigen secreting cells that home to the bone marrow and secrete IgA and IgG (Manuel et al, 2006).

2.17 Vaccines The ability to culture and grow rotavirus in vitro increased the pace of research, and as a result, in the mid-1980s, the first candidate vaccines were evaluated (Vesikari et al, 1985). The first rotavirus vaccines candidates developed were: RIT4237 (P[6]G6) and WC3 (P[7]G6) which were made from bovine strains. Production of these vaccines was similar to the approach that was used by Edward Jenner to develop smallpox vaccine (Clark et al, 1996; Kapikian et al, 1996a; Vesikari, 1996). Monovalent Jennerian’s approach was used because of the virtual observations that children infected with rotavirus develop an immune response to both human and animal rotavirus strains. Therefore, it was believed that infection of children with an attenuated non-human rotavirus vaccine strain would provide cross- protection against natural rotavirus strains. Unfortunately the two vaccine candidates demonstrated variable efficacy and were later discontinued and withdrawn from clinical trials (De Mol et al, 1986; Georges-Courbot et al, 1991). After the withdrawal of RIT4237 and WC3, the MMUI8006 (P[5]G3) vaccine was developed using the same approach. The P[5]G3 shares neutralization specificity with human rotavirus G3 strains. Similarly to RIT4237 and WC3, MMUI8006 vaccine was also withdrawn since its efficacy was not consistent (Christy et al, 1988). During the year 2000, the Lanzhou Institute produced the monovalent vaccine LLR from a Lamb strain (P[12]G10). This vaccine is the only monovalent non-human rotavirus strain that is currently licenced in some areas of China; however, it cannot be used worldwide because it did not undergo sufficient clinical trials (Parashar et al, 2006).

Since the monovalent Jennerian’s approach was not successful, the modified Jennerian approach was initiated by developing reassortant animal-human rotavirus strains vaccines. Therefore reassortant animal-human rotavirus vaccine, the human-rhesus rotavirus reassortant vaccine (RRV) and RotaShield® (RRV-TV) were developed to stimulate homotypic immunity by inducing a neutralizing antibody response against different serotypes

33 in order to produce a broad immune response. The RotaShield® provided an efficacy of about 70-100% protection against severe rotavirus disease, it also showed efficacy against multiple strains. RotaShield® was licensed for routine use in the United States of America (USA) in 1998 (CDC, 1999). According to the results of the clinical trials that were conducted in the USA, Finland and Venezuela, the vaccine was found to be 80 to 100% effective in preventing gastroenteritis caused by group A rotaviruses. Unfortunately, the vaccine was withdrawn from the market one year after it was introduced because it was linked with intussusception which is a serious adverse event. It was reported that 1 out of every 12,000 vaccinated children suffered from intussusceptions (Parashar et al, 2006).

Finally, a safe and efficacious rotavirus vaccine was produced (Rotateq®). A pentavalent WC3 live oral based bovine-human reassortant vaccine, it contains five reassortant rotaviruses developed from human and bovine parent rotavirus strains [W179-9 (G1P[5]), SC-2 (G2P[5]), WI78-8 (G3P[5]), BrB-9 (G4P[5]) and WI79-4 (G6P[8])] (Matthijnssens et al, 2010). Rotateq® efficacy and safety trial studies were conducted in the United States and Finland with more than 70,000 infants enrolled. After 42 days of post vaccination monitoring, only six cases of intussusceptions were identified. It was interesting to learn that five cases of intussusceptions were also identified in the placebo group. Out of 70,000 infants 7,000 were further monitored for vaccine efficacy and it was found that the vaccine was 74% (95% CI: 67%, 79%) efficacious against G1-G4 rotavirus gastroenteritis of any severity and 98% (95% CI: 90%, 100%) efficacious against severe G1-G4 rotavirus gastroenteritis (Parashar et al, 2006; Vesikari et al, 2006). The large clinical trials for Rotateq® were also conducted in developing countries, especially in Africa (Ghana, Mali and Kenya) and Asia (Bangladesh) (Armah et al, 2010; Zaman et al, 2010). The vaccine has shown lower efficacy rates in developing countries as compared to developed countries. In general during post marketing surveillance Rotateq® has been considered to have successfully reduced the incidence of medical visits, emergency visits and hospitalization due to rotavirus gastroenteritis. In 2007, CDC (Centre for Disease Control and Prevention) recommended routine use of Rotateq® in the United States (CDC, 2007).

Another successful rotavirus vaccine is Rotarix®, a monovalent live attenuated vaccine containing a rotavirus strain RIX4414 of G1P[8] specificity. Similarly to Rotateq®, Rotarix® vaccine safety and efficacy was monitored and evaluated using a very large number of participants, more than 63,000 infants. Half of them were selected to receive two doses of

34 vaccine and the other half to receive two doses of placebo. Only 16 cases of intussusceptions occurred in the placebo group while 9 occurred in the vaccine group and therefore, the vaccine was declared not to be associated with intussusceptions. Although Rotarix® is a G1P[8] monovalent vaccine the study conducted in Latin America and Finland has proved that the vaccine is also efficacious against strains that are related to the VP4 gene G3P[8], G4P[8], and G9P[8], it was also interesting to note that the vaccine is also efficacious to G2P[4] strains, hence, efficacy of 41.0% was reported. Several meta-analysis studies documented an efficacy of (67-70%) with (95% CI:15%,87%). Rotarix® efficacy cannot be said to be serotype dependent and it can confer protection against rotavirus disease regardless of the serotype. For some unknown reasons the efficacy of Rotarix® and Rotateq® is less in the developing countries as compared to developed countries (Armah et al, 2010; Patel et al, 2011). From June 2009, the World Health Organisation (WHO) recommended that both Rotarix® and Rotateq® should be included in all the national immunisation programmes to provide protection against rotavirus diarrhoea in children (WHO, 2009). The WHO and Global Alliance for Vaccine and Immunisation (GAVI) are also aiming to assist in introducing rotavirus vaccines into poor countries who do not have enough infrastructure and financial strength to implement rotavirus vaccination themselves (Patton, 2012).

Other rotavirus vaccine candidates developed included bovine-human reassortant vaccine using the UK rotavirus strain P[7]G6. This vaccine contain 10 genes derived from the parent UK strain as well as one gene for the common human VP7 serotypes (G1, G2, G3 and G4), it has also been mentioned that in the future reassortants for types G8 and G9 will be incorporated as well. Currently NIH has licensed this vaccine to the manufacturers in Brazil, China and India for further development (Parashar et al, 2006).

CHAPTER 3: MATERIALS AND METHODS

3.1 Ethical Consideration Before commencing with this research project, a research protocol was submitted to School Research Ethics Committee (SREC) and Medunsa Research Ethics Committee (MREC). The two committees reviewed and approved the project. The project was eventually awarded research protocol number (MREC/P/37/2011: PG).

3.2 Study Site The study was based on samples collected at the Dr George Mukhari Hospital, which is the second largest academic hospital in South Africa, located 20km north west of Pretoria city centre on the border between Gauteng and North West Provinces, near Ga-Rankuwa township. It is a teaching hospital for the University of Limpopo (Medunsa Campus).

3.3 Study design This is an exploratory study, where archived diarrhoeal stool samples were analysed. The samples were collected from children presenting with mild to severe diarrhoea at Dr George Mukhari Hospital from 1984 to 2009 (Table 3.1). The samples were confirmed to be rotavirus positive by enzyme immunoassay (EIA), polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) assay from previously approved projects (MR58/2003 and MP46/2005). The samples were previously genotyped as G2 rotavirus strains. The samples were stored at -20oC at the MRC-Diarrhoeal Pathogens Research Unit (MRC- DPRU) in the University of Limpopo (Medunsa Campus) for research purpose. A total number of samples selected and the total number of samples typed as G2 per year are summarised in (Table 3.1).

Table 3.1: Total number of rotavirus positive samples and total number of samples typed as G2 serotype per year from 1984-2009.

GROUP I GROUP II Year No. of No. of No. of Year No. of No. of No. of samples G2P[4] G2P[4] samples G2P[4] G2P[4] genotyped recorded included genotyped recorded included in study in this study

1984 84 3 1 1998 35 6 0 1985 117 2 1 1999 18 0 0 1986 116 2 1 2000 22 0 0 1987 113 8 2 2001 21 0 0 1988 90 0 0 2002 21 0 0 1989 109 0 0 2003 151 64 18 1990 81 0 0 2004 131 3 3 1991 90 0 0 2005 211 2 0 1992 826 0 0 2006 208 8 2 1993 32 1 1 2007 171 20 6 1994 38 0 0 2008 154 24 5 1995 8 0 0 2009 122 2 2 1996 97 0 0 2010 ND 0 0 1997 83 4 1 2011 ND 0 0 SUB- 1884 20 7 SUB- 1265 129 36 TOTAL TOTAL

KEY: ND = not included in the sampling criteria; only samples from 1984 to 2009 were included.

3.4 Sampling and Study population Samples were selected based on the data sheet available from the laboratory at the (MRC- DPRU). The study population comprised two groups of samples; those which were previously sequenced for VP7 genomic segment only (Group I: 1984 to 1997) and those which were analysed de novo in this study for the VP4, VP6 and VP7 genomic segments (Group II: 2003 to 2009) (Table 3.1).

Regardless of the group, all the samples were previously typed as genotype G2P[4]. For group I, the primary inclusion criteria in the current study was based on the availability of the full or near-full length sequence of the VP7 genomic segment in the GenBank database. Unfortunately, the stool materials of most of these samples were exhausted because they were used in previous

37 studies. Thus, the VP4 and VP6 genomic segments could not be examined in the current study. For group II, the stool materials of most samples were available for analyses from 2003 to 2009. Thus, a total of 36 archived stool samples from 2003 to 2009 were selected based on RT-PCR and genotyping assays confirmation as G2P[4] strains and abundance of stool materials available for further analyses, the remaining samples were excluded. All the 36 samples from 2003-2009 were analysed in this study by PAGE, RT-PCR, genotyping, RFLP (only genome segment 6 fragment 379bp) and sequencing. From the 36 samples, at least 1 to 2 samples (n = 11) representing G2 during dominant and non-dominant seasons were sequenced in the VP7 genomic segment (full length); only 1 sample (n = 6) was sequenced in the VP4 genomic segment (VP8 fragment only); while 1 to 3 samples (n = 9) were sequenced in the VP6 genomic segment (full length) (Table 3.4).

Finally, although the study aimed to examine the evolution of the G2 strains over a 25 year period, there were some years which were not represented for reasons beyond the control of the researcher. These included (1988,1989,1991,1992,1994,1995,1996,1999,2000,2001,2002). According to Page and Steele (2004), there was not even a single G2 strain detected at Dr George Mukhari hospital during those years. This formed the major limitation of this study during data analyses.

3.5 Laboratory Methods 3.5.1 Extraction of dsRNA from stool for PAGE Before beginning with viral RNA extraction for PAGE, 10% archived stool suspensions stored in -20°C in the screw cap test tubes were vortexed (VELF Scientific, Stanziano, Italy) for 1 minute. The samples were then placed on a bench for at least 1 hour to settle. A total volume of 450µl of the 10% stool suspension and 50µl of the pre-warmed 1M sodium acetate (NaAc) (pH 5.0) (USB, Cleveland, USA) containing 1% sodium dodecyl sulphate SDS (Serva, Heidelberg, Germany) were placed in the 1.5ml eppendorf tubes and incubated at 37°C in a water bath (Memmert, Schwabach, Germany) for 15 minutes. After incubation, 500µl of (1:1) phenol /chloroform (Sigma Aldrich, Deisenhofen, Germany) was added and vortexed for 1 minute and incubated in a water bath again at 56°C for 15 minutes. The tubes were opened and resealed immediately to reduce the air pressure, vortexed and centrifuged (Eppendorf, Hamburg, Germany) for 3 minutes at 12 000rpm in order to separate the nucleic acid from the proteins (phase separation).

The upper aqueous phase containing the rotavirus dsRNA was carefully removed and placed in new clean eppendorf tubes. The dsRNA was then precipitated in 40µl of 3M NaAc and 700µl ice-cold (-20°C) absolute ethanol (Sigma Aldrich). The tubes were then mixed 4-6 times before incubated at -20°C overnight or at -70°C for 30 minutes. The tubes were then centrifuged at 4°C for 15 minutes at 12 000rpm and the supernatant was poured off and the pellets were allowed to air dry. The pellets were resuspended in 30µl of PAGE sample dye before loading on a PAGE gel. PAGE sample dye was prepared by dissolving 10mg bromophenol blue (Sigma Aldrich) in 5ml of spacer gel buffer and 1ml glycerol).

3.5.2 Polyacrylamide gel electrophoresis (PAGE)

The glass plates were cleaned with 96% ethanol (Sigma Aldrich), the equipment for gel casting (Hoefer, San Francisco, USA) was assembled. The resolving gel was prepared by mixing 15.8 ml distilled water, 10ml of 30% acrylamide stock (Sigma Aldrich), 3.75ml resolving buffer (pH 8.9), 450µl of 10% ammonium persulphate (APS) (USB) and 15µl Tetramethylethylenediamine (TEMED) (USB). The reagents were mixed in a beaker before poured into the assembled glass plates up to the marked level and the gel was allowed to solidify for 2 hours. Spacer gel was prepared by mixing 6.8ml distilled water, 1.6ml of 30% acrylamide Stock (Sigma Aldrich), 1.25ml spacer buffer (pH 6.7), 150µl of 10% APS (USB), and 5µl of TEMED. Similarly, the spacer gel was mixed in a beaker before it was added in the assembled glass plates on top of the resolving gel. The gel was also allowed to solidify for 2 hours. The samples were then loaded and electrophoresed overnight for 18 hours at 100Volts using a discontinuous buffer (1×Tris glycine) system (Steele and Alexander, 1987).

3.5.3 Silver nitrate (AgNO3) staining After 18 hours of electrophoresis the PAGE apparatus was carefully removed from the glass plates and the bottom right hand corner of the gel was cut and the spacer gel was discarded. The rotavirus dsRNA segments were fixed by incubating the gel twice on fixing solution 1 and 2 containing ethanol, distilled water and acetic acid for 30 minutes each. The gel was stained in

0.37g silver nitrate (AgNO3) (Merck, Darmstadt, Germany) with distilled water for 30 minutes on an orbital shaker (Labnet, Woodbridge, USA). After staining with silver nitrate, the gel was washed twice with distilled water for 2 minutes each time. The gel was agitated in approximately 50ml of developing solution [7.5g sodium hydroxide (Merck), 250ml distilled water

(dH2O)(Merck) and 2ml formaldehyde (Rochelle Chemicals, Johannesburg, South Africa)] for 30 seconds to remove the black precipitates before it was incubated in approximately 200ml of developing solution until all the eleven segments of the rotavirus can be observed. Thereafter, the gel was incubated for approximately 10 minutes in 200ml of stopping solution [acetic acid (Sigma Aldrich) and distilled water] to prevent further bands development. Thereafter, the gel was placed in distilled water before it was covered in cellophane sheets and dried overnight in an easy breeze gel dryer (Hoefer) (Herring et al, 1982).

3.5.4 Extraction of RNA for RT-PCR assay The viral RNA was extracted from 10% archived stool suspensions stored in -20°C using QIAamp viral RNA extraction method (Qiagen, Hilden, Germany). Briefly, 140µl of the samples was added to 560µl of lysis buffer AVL (Qiagen) containing carrier RNA in 1.5ml eppendorf tubes and incubated for 10 minutes at room temperature. After incubation 560µl of ethanol, 96- 100% (Sigma Aldrich) was added to the samples to ensure efficient binding and the tubes were mixed briefly by pulse vortexing and thereafter centrifuged briefly.

A total volume of 630µl of the solution was applied to the QIAamp mini spin columns without wetting the rim. After applying the solution, the caps were closed and the spin columns were centrifuged at 6 000 ×g (8 000rpm) for 1 minute. The spin columns were placed into clean 2ml collection tubes. The tubes containing the filtrate were discarded and the spin columns were opened to repeat the previous step. The spin columns were opened and the samples were washed with 500µl of buffer AW1 (Qiagen), in order to wash effectively, the tubes containing the spin column were centrifuged at 6 000 ×g (8 000 rpm) for 1 minute, thereafter the spin columns were placed in clean 2ml collection tubes. The tubes containing the filtrate were discarded. The samples were washed for the second time by adding 500µl of buffer AW2 to the spin columns and centrifuging (20 000 ×g; 14 000rpm) for 3 minutes. The spin columns were placed in new 2ml collection tubes and centrifuged at full speed for 1 minute, and the tubes containing the filtrate was discarded. The spin columns were lastly placed in clean 1.5ml microcentrifuge tubes and 60µl of buffer AVE was added into the spin columns, the spin columns were incubated for 5 minutes before centrifuging to elute viral RNA ready to be used for PCR reactions.

3.5.5 RT-PCR assay RT-PCR assay was used to reverse transcribe and amplify a fragment of VP4 genome segment (876bp) and full length of genome segment 9 (1062bp) and genome segment 6 (1356bp). VP4 genome segment (gene segment 4) was amplified by using primers described by Gentsch et al (1992): Con3 (nt 11-32, 5’-TGGCTTCGCTCATTTATAGACA-3’) and Con2 (nt 868-887, 3’-ATTTCGGACCATTTATAACC-5’). VP7 genome segment (gene segment 9) was amplified by using primers described by Gouvea et al (1990) which were sBeg9 (nt 1-21, 5’-GGCTTTAAAAGAGAGAATTTC-3’) and End9 (nt 1062-1036, 3’- GGTCACATCATACAATTCTAATCTAAG-5’).

The VP6 RT- PCR was performed twice, both for the amplification of full gene segment (1356 bp) and for the amplification of 379bp fragment. Full length gene was amplified by using primers described by Shen et al (1994), which were; VP6F (nt 1-20, 5’- GGCTTTTAAACGAAGTCTTC- 3’) and VP6R (nt 1356-1339, 5’-GGTCACATCCTCTCACTA-3’). The 379bp fragment was amplified by using VP6 published primers described by Iturriza-Gómara et al (2002a) which were VP6-R (nt 1126-1106,5’-GTCCAATTCATNCCTGGTGG-3’) and VP6-F (nt 747-766, 5’- GACGGVGCRACTACATGGT-3’).

3.5.6 Methodology for RT-PCR assay Two 1.5 ml eppendorf tubes were labelled, one for RT master mix and the other one for PCR amplification master mix. The RT-PCR components were briefly mixed by pulse vortexing before preparing the master mix. The RT master mix was prepared by mixing: 0.25µl of each (10mM) deoxyribonucleate triphosphates (dNTPs) [deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP)] (Bioline, London, United Kingdom), 2.0µl of 5× Avian myeloblastosis virus (AMV) buffer (MBI Fermentas, Burlington, Canada) and 0.2µl of (20U/µl) Avian myeloblastosis virus reverse transcriptase (AMV-RT) (MBI Fermentas).The PCR master mix was prepared by mixing: 1µl of each (10mM) dNTPs (Bioline), 5µl of (5U/µ) Taq buffer (Bioline), 1.2µl of (50mM) Magnessium

Chloride (MgCl2) (Bioline), 30µl of distilled water (dH2O) (Merck) and 0.3µl of (5U/µl) Taq polymerase (Bioline). The new clean 0.5ml eppendorf tubes were labelled on top of the lid with sample number, primers used and date. A volume of 1µl of each 10 pmol primer (forward and reverse) (Integrated DNA Technology, USA) and 8µl of dsRNA was added to each tube and mixed by pipetting. The tubes were incubated at 94°C for 5 minutes on heating blocks (Bibby Scientific Limited, Staffordshire ST15 0SA, United Kingdom) to denature the dsRNA and

42 immediately placed on ice (maximum of 5 minutes). A total volume of 3.2µl of RT-master mix was added to the tubes, mixed by pipetting, spun for 10 seconds and incubated at 42°C on heating blocks for 30 minutes. The total volume of 40µl of the PCR master mix was added to each tube and placed in a G-Storm thermocycler (Vacutec, California, United States of America) for denaturation of the rotavirus cDNA to take place at 94°C for one minute, annealing of primers at 42°C for one minute and extension of a new strand at 72°C for one minute. These steps were repeated for 30 cycles. The amplification products were run on 1% agarose gels (Bioline) stained in 10mg/ml ethidium bromide (Bio Basic Inc, Toronto, Canada) and visualized on Ultraviolet light (UV) (G:Box, Vacutec).

3.5.7 Genotyping 3.5.7.1 Genome segment 7 (VP7) The RT-PCR products were used as a template for typing both VP7 and VP4 genome segments. VP7 genome segment was typed by using a cocktail of primers that are specific to the human rotavirus genotypes (G1-G4, G8-G9 and G12) described by (Gouvea et al, 1990; Iturriza-Gómara et al, 2004; Aladin et al, 2010). Oligonucleotide primer lists for RT-PCR and genotyping assays as described by Gouvea et al (1990), Itturiza-Gómara et al (2004) and Aladin et al (2010) are summarised in Table 3.2. It was important to use a pool of all the common rotavirus published primers in order to detect non G2 genotypes as well as mixed infections so that they can be eliminated from the study since the study is focusing on G2 genotypes only.

Figure 3.1: Schematic illustration of the Human rotavirus VP7 genotyping products showing expected sizes of each product (G1,G2,G3,G4,G8 and G9) and the primer binding sites for each genotype using a set of primers described by (Gouvea et al, 1990 and Iturriza-Gómara et al, 2004). 43

Table 3.2: List of the VP7 oligonucleotide primers for RT-PCR and genotyping assays as described by Gouvea et al (1990), Iturriza-Gómara et al (2004) and Aladin et al (2010).

Primer Sequence (5’-3’) Position Reference sBeg9 GGCTTTAAAAGAGAGAATTTC 1-21 Gouvea et al,1990

Beg9 (Forward) GGCTTTAAAAGAGAGAATTTCCGTCTGG 1-28 Gouvea et al, 1990

End9 (Reverse) GGTCACATCATACAATTCTAATCTAAG 1062-1036 Gouvea et al, 1990

RVG9 (Reverse) GGTCACATCATACAATTCT 1062-1044 Gouvea et al, 1990 aAT8 (G8) GTCACACCATTTGTAAATTCG 178-198 Gouvea et al, 1990 aBT1 (G1) CAAGTACTCAAATCAATGATGG 314-335 Gouvea et al, 1990 aCT2 ( G2) CAATGATATTAACACATTTTCTGTG 411-435 Gouvea et al, 1990 aDT4 (G4) CGTTTCTGGTGAGGAGTTG 480-498 Gouvea et al, 1990

(mG3) CGTTTGAAGAAGTTGCAACAG 250-269 Iturriza- Gómara et al, 2004

(mG9) CTTGATGTGACTAYAAATAC 757-776 Iturriza- Gómara et al, 2004

(newG12) GGTTATGTAATCCGATGGCG 504-524 Aladin et al, 2010

3.5.7.2 Genomic segment 4 (VP4) VP4 genomic segment was typed using a cocktail of primers that are specific to the human rotavirus genotypes (P[4], P[6], P[8], P[9], P[10], mP[11] and P[14]) described by (Gentsch et al, 1992; Iturriza- Gómara et al, 2004; Mphahlele et al, 1999). Oligonucleotide primers list for RT-PCR and genotyping assays as described by Gentsch et al (1992), Mphahlele et al, 1999 and Iturriza- Gómara et al, 2004 are summarised in Table 3.3. Similarly genotyping of genome segment 4 was performed using a pool of all the common rotavirus published primers in order to detect non P[4] or P[6] genotypes as well as mixed infections so that they can be eliminated from the study since the study is focusing on P[4] or P[6] genotypes only. The primer binding sides of genome segment 4 are depicted by Figure 3.2.

1 11 278 356 402 494 605 887 2359 nt 5’ 3’ con3 3T-1 1T-1 4T-1 2T-1 5T-1 con2 876bp Con2

267bp P[6] 3T-1

345bp P[8] 1T-1

391bp P[9] 4T-1

483bp P[4] 2T-1

594bp P[10] 5T-1

Figure 3.2: Schematic illustration of the Human rotavirus VP4 (VP8* fragment) genotyping products showing expected sizes of each product ( P[4], P[6], P[8], P[9] and P[10] ) and the primer binding sites for each common genotype using a set of primers described by (Gentsch et al, 1992).

Table 3.3: VP4 oligonucleotide primer list for RT-PCR and genotyping assays as described by (Gentsch et al, 1992; Mphahlele et al, 1999; Itturriza-Gómara et al, 2004). Primer Sequence (5’-3’) Position Reference

Con2 (Reverse) ATTTCGGACCATTTATAACC 868-887 Gentsch et al, 1992 Con3 (Forward) TGGCTTCGCTCATTTATAGACA 11-32 Gentsch et al, 1992 (1T-1) P[8] ACTTGGATAACGTGC 339-356 Gentsch et al, 1992 (2T-1) P[4] CTATTGTTAGAGGTTAGAGTC 474-494 Gentsch et al, 1992 (3T-1) P[6] TGTTGATTAGTTGGATTCAA 259-278 Gentsch et al, 1992 (4T-1) P[9] TGAGACATGCAATTGGAC 385-402 Gentsch et al, 1992 (5T-1) P[10] ATCATAGTTAGTAGTCGG 575-594 Gentsch et al, 1992 (mP11) P[11] GTAAACATCCAGAATGTG 305-323 Itturriza-Gómara et al, 2004 P[14] GGTGTAGTTCCTGCGTA 538-544 Mphahlele et al, 1999

3.5.7.3 Methodology for genotyping The 1.5ml eppendorf tube was labelled for genotyping master mix. Genotyping master mix was prepared as follows; 1µl of each 10mM (dNTPs) (Bioline), 1µl of 10 pmol (anchor primer) (Integrated DNA Technology), 1µl of each 10 pmol (type specific primer) (Integrated DNA

Technology), 5µl of 10xTaq buffer (Bioline), 1.2µl of 50MgCl2 (Bioline), 26µl sterile dH2O (Merck) and 0.3µl of Taq Polymerase (Bioline) per each reaction. The 0.5ml eppendorf tubes were labelled on top of the lid for sample number; primers used and date before dispensing 40µl of the master mix to each tube. Thereafter, the amplified cDNA was added to its respective tube containing the master mix based on the corresponding sample number, only 0.5-6µl of cDNA was added with reference to the concentration of the product. After adding each cDNA to the master mix, the samples were mixed by pipetting before incubating in a thermocycler (Vacutec) for denaturation to take place at 94°C for one minute, annealing of primers at 42°C for one minute and extension of a new strand at 72°C for one minute, these steps were repeated until 30 cycles are completed. After 30 cycles, the products were run on 2% agarose (Bioline) gels stained in 10mg/ml ethidium bromide (Bio Basic Inc) and visualized on Ultraviolet light (UV) (G:Box, Vacutec).

3.5. 8 Restriction Fragment Length Polymorphism (RFLP) The rotavirus VP6 genomic segment (379bp) was characterized by RFLP. This technique was performed after amplifying the 379bp fragment by RT-PCR. The VP6 cDNA amplicons were analysed by direct digestion with 10,000 U/ml AciI (New England Biolabs Inc, Ipswich, United States of America) restriction enzyme. RFLP was performed by incubating the VP6 cDNA

46 amplicons on the heating blocks (Bibby Scientific Limited) with the AciI restriction enzyme for 16 hours at 37°C, followed by deactivation for 20 minutes at 65°C. The reaction was carried out in a 0.5ml eppendorf tube with 1.5µl of AciI enzyme, 2.5µl buffer (NE buffer 3) (New England Biolabs Inc), 10 x NE buffer 3 [100 mM Sodium Chloride (NaCl), 50 mM Tris- Hydrochloric acid (HCI)(pH 7.9), 10mM MgCl2 (magnesium chloride), 1 mM Dithiothreitol (DTT), 1 mM Ethylenediaminetetraacetic acid (EDTA), 200µg/ml Bovine serum albumin (BSA), 50% glycerol] (New England Biolabs Inc) supplied with the enzyme, 22.5µl of PCR water (H2O) (Merck) and 8-15µl of amplified cDNA depending on the concentration of the cDNA products. RFLPs were analysed by using 3% normal and low melting agarose (Bioline) gel stained with 10mg/ml ethidium bromide (Bio Basic Inc) and visualized on Ultraviolet light (UV) (G:Box, Vacutec).

3.5.9 Sequencing After genotyping, a total of 11 samples (cDNA) were selected for the analysis of genome segment 9 by sequencing using sBeg and End9 primers, for genome segment 6 only 9 samples were selected and sequencing was carried using VP6-R and VP6-F primers, lastly only 6 samples were selected for the analysis of genome segment 4 by sequencing using Con2 and Con3 primers (Table 3.4). Sequencing was performed at Inqaba Biotech using ABI 3130XL sequencer and the samples were selected randomly and based on the PCR results, samples with high intensity had a better chance of been selected.

3.6 Data Analysis After receiving the sequence data from Inqaba Biotech, editing was performed by using ChromasPro (www.technelysium.com.au) software package which displays chromatograms which are then interpreted into nucleotide sequences. After editing, the data was converted into FASTA format. The nucleotide sequence data from the (1984-1997) strains together with the DS-1 strain was retrieved from the GenBank database and combined with the data that was obtained in this study. The edited FASTA format sequences were compared with the reference strains by using the BLAST (Basic Local Alignment Search Tool) server algorithm. Highly similar nucleotide sequences were searched using megablast from the database by submitting the edited FASTA sequences on nucleotide blast program from National Center for Biotechnology Information (NCBI) and downloading from the GenBank database.

The sequences were grouped together with reference strains compiled from the GenBank

47 database for multiple alignment using the CLUSTALW (www.ebi.ac.uk/clustalw) program within Bioedit (www.mbio.ncsu.edu/bioEdit/bioedit.html) software package (Hall, 1999). Gaps within the sequences were removed using the Bioedit software, conserved regions and sequence identities were also calculated using Bioedit programme as well. The DS-1 was used as a consensus sequence for the analysis of the sequences. For the analysis of antigenic regions and glycosylation regions the sequences were toggle translated using the bioedit program in order to identify amino acids sequences specifying these regions. The VP7, VP4 and VP6 phylogenetic trees were constructed by using the neighbor-joining Molecular Evolutionary Genetics Analysis (MEGA 4.1) package method (Saitou and Nei, 1987). Statistical significance at the branching point was calculated with 1,000 pseudo-replicate datasets. A lineage was defined as a cluster of sequences having a bootstrap probability of 70% or higher at the branching point and a sub- lineage was defined as a cluster of sequences that have a bootstrap probability of 70%.

Table 3.4: Representation of all the study samples (Group I and II) and the underlying assays performed on each sample. No Lab no Year PAGE Genotyping VP6 Subgrouping Sequencing VP7 VP4 RT-PCR RFLP GROUP I 1 1296 1984 X X X X X GenBank 2 410 1985 X X X X X GenBank 3 659 1986 X X X X X GenBank 4 504 1987 X X X X X GenBank 5 514 1987 X X X X X GenBank 6 1831 1993 X X X X X GenBank 7 3958 1997 X X X X X GenBank GROUP II 8 2114 2003 Y Y Y X X X 9 666 2003 Y Y Y X X X 10 421 2003 Y Y Y X X X 11 629 2003 Y Y Y X X X 12 2143 2003 Y Y Y X X X 13 667 2003 Y Y Y X X X 14 644 2003 Y Y Y X X Y(de novo) 15 404 2003 Y Y Y X X X 16 391 2003 Y Y Y Y Y Y(de novo_ 17 613 2003 Y Y Y X X X 18 603 2003 Y Y Y X X X 19 589 2003 Y Y Y X X X 20 433 2003 Y Y Y Y Y Y(de novo) 21 594 2003 Y Y Y X X Y(de novo) 22 1293 2004 Y Y Y X X X 23 431 2004 Y Y Y Y Y Y(de novo) 24 29 2004 Y Y Y Y Y Y(de novo) 25 2199 2006 Y Y Y Y Y Y(de novo) 26 800 2006 Y Y Y X X Y(de novo) 27 2123 2006 Y Y Y X X X 28 457 2006 Y Y Y X X X 29 853 2006 Y Y Y X X X 30 460 2006 Y Y Y X X X 31 1428 2007 Y Y Y Y Y Y(de novo) 32 1776 2007 Y Y Y X X Y(de novo) 33 1363 2007 Y Y Y X X X 34 1389 2007 Y Y Y Y Y Y(de novo) 35 4059 2007 Y Y Y X X X 36 1793 2007 Y Y Y X X Y(de novo) 37 1057 2008 Y Y Y X X Y(de novo) 38 1036 2008 Y Y Y X X Y(de novo) 39 1941 2008 Y Y Y X X X 40 1040 2008 Y Y Y Y Y Y(de novo) 41 1029 2008 Y Y Y X X X 42 140 2009 Y Y Y Y Y Y(de novo) 43 1392 2009 Y Y Y X X Y(de novo) Key: X denotes that the sample was not selected for that particular assay in this project, it might have been selected from previous projects or not. Y denotes that the sample was selected for a particular assay. Genbank- denotes that the sample was not sequenced in the current study but its sequence were retrieved from the Genbank. de novo- denote that the sample was sequenced in the current study.

CHAPTER 4: RESULTS

4.1 Overview of the results The current study aimed at investigating the genetic profiles of genome segment 9 (encoding VP7 protein) of G2 rotavirus strains over a 25-year (1984-2009) period at Dr George Mukhari Hospital in Pretoria. Stool materials from 1984-1997 (Group I) were already depleted from the previous research projects. However, their genome segment 9 sequences were available in the GenBank database for comparative analysis. Only samples from 2003- 2009 (Group II) previously genotyped as G2 strains had sufficient stool materials. The group II samples were then characterised by PAGE in order to investigate the RNA profiles. The investigation of RNA profiles revealed that all the 2003-2009 strains were associated with short RNA profiles. This correlates well with the RNA profiles of almost all the published G2 strains. Literally, the G2 strains are in the DS-1 genogroup and almost all the G2 strains are associated with short RNA profiles, unless if the strain has undergone reassortment with the strains in the Wa genogroup. Apparently, the RNA segments were arranged in a profile of 4,2,3,2 which is a documented RNA profile that exists among group A rotaviruses. Further analysis of PAGE results revealed that the G2 strains from 2003-2009 displayed three different arrangements of RNA profiles which were subsequently designated as S1, S2 and S3 based on migration of segments 7, 8 and 9. All the 2004 and 2008 strains displayed only one RNA profiles (S2) and (S1), respectively.

All the samples were positive by RT-PCR and subsequent characterization by genotyping revealed G2 genotype and P[4] genotype except one sample from 2009 was associated with P[6] genotype. Only three samples revealed mixed infections of P[4] and P[6] genotypes. Sequencing results correlated well with genotyping results. Based on nucleotide sequences and phylogenetic analysis of genome segment 9 of all the study strains (n=18,Table 4.1), it was revealed that over the past 25 years, three lineages (lineage 1, 2 and 5c) of G2 strains have been circulating at the Dr George Mukhari Hospital. The Group I strains, excluding the 1993 and the 1997 strains, were clustered in lineage 1. The 1993 strain clustered within lineage 2 and the 1997 strain clustered within lineage 5c together with the Group II strains. Most of the Group I strains, excluding the 1993 and the 1997 strain were highly homologous to the G2 ancestor (DS-1 prototype) than to the Group II strains and vice versa; the 1997 strain was highly homologous to the Group II strains while the 1993 was neither homologous

50 to the Group I nor the Group II strains. Group I (excluding the 1993 and the 1997) strains also shared a bootstrap value of 100% with the DS-1 prototype. Nucleotide sequence identity between Group I (excluding the 1993 and the 1997 strain) and Group II strains ranged from 85.3-86.2%. Nucleotide sequence identities between the 1993 strain and both Group I and Group II strains ranged from 90.6-91.2% and 83.4-83.8%, respectively. While nucleotide identities between the 1997 and Group II strains ranged from 90.3-90.8%. The 1993 and the 1997 strain shared 91.9% nucleotide identities. The 1997 strain was similar to the Group II strains; together they were characterized by A87T and D96N substitutions mutations at antigenic region A, N213D and N242S mutations at antigenic regions C and F, respectively. In contrast, antigenic region B was conserved in all the strains. The Group I strains (excluding the 1993 and the 1997 strains) were conserved at antigenic region A, B and C, but displayed I239V substitution at antigenic region F. The 1993 strain was conserved at antigenic region A, but it displayed T147A, N213S and N242S substitutions at antigenic regions B, C and F, respectively.

Glycosylation regions (aa 69-71,146-148 and 238-240) were also analysed. It was interesting to discover that the 1997 strain together with all the Group II strains were conserved at all the glycosylation regions. Group I strains were not conserved and they displayed N69D substitution. The 1993 strain displayed N69D substitution and T147A substitution, but it was conserved at region 238-240. All the samples selected for the analysis of genome segment 4 (n=6) were found to be highly homologous at both nucleotide and amino acid level; they shared nucleotide identities of 98.9-99.8%. Therefore, they all belonged to lineage V on the phylogenetic tree. Only 9 samples were selected for the analysis of genome segment 6 by sequencing. During analysis, the strains were highly conserved, hence only four conserved amino acids regions were identified (region 1-45, 47-130, 132-275, and 277-299). The strains shared 98.7-100% nucleotide sequence identities. The regions containing epitopes for subgroup I specificity were conserved as well. Phylogenetic analysis has allowed all the study strains to be grouped into one genotype (I2).

Table 4.1: Representation of all the study samples (Groups I and II), summary of samples selected for sequencing per specific gene. No Strain Genome Segment Sequencing 9 4 6 Group I 1 RVA/Human-wt/ZAF/GR1296/1984/G2P[4] Y X X GenBank 2 RVA/Human-wt/ZAF/GR410/1985/G2P[4] Y X X GenBank 3 RVA/Human-wt/ZAF/GR659/1986/G2P[4] Y X X GenBank 4 RVA/Human-wt/ZAF/GR405/1987/G2P[4] Y X X GenBank 5 RVA/Human-wt/ZAF/GR514/1987/G2P[4] Y X X GenBank 6 RVA/Human-wt/ZAF/GR1831/1993/G2P[4] Y X X GenBank 7 RVA/Human-wt/ZAF/GR3958/1997/G2P[4] Y X X GenBank Group II 8 RVA/Human-wt/ZAF/MRC-DPRU2114/2003/G2P[4] X X X X 9 RVA/Human-wt/ZAF/MRC-DPRU666/2003/G2P[4] X X X X 10 RVA/Human-wt/ZAF/MRC-DPRU421/2003/G2P[4] X X X X 11 RVA/Human-wt/ZAF/MRC-DPRU629/2003/G2P[4] X X X X 12 RVA/Human-wt/ZAF/MRC-DPRU2143/2003/G2P[4] X X X X 13 RVA/Human-wt/ZAF/MRC-DPRU667/2003/G2P[4] X X X X 14 RVA/Human-wt/ZAF/MRC-DPRU644/2003/G2P[4] Y X X Y (de novo) 15 RVA/Human-wt/ZAF/MRC-DPRU404/2003/G2P[4] X X X X 16 RVA/Human-wt/ZAF/MRC-DPRU391/2003/G2P[4] X X Y Y (de novo) 17 RVA/Human-wt/ZAF/MRC-DPRU613/2003/G2P[4] X X X X 18 RVA/Human-wt/ZAF/MRC-DPRU603/2003/G2P[4] X X X X 19 RVA/Human-wt/ZAF/MRC-DPRU589/2003/G2P[4] X X X X 20 RVA/Human-wt/ZAF/MRC-DPRU433/2003/G2P[4] X X Y Y (de novo) 21 RVA/Human-wt/ZAF/MRC-DPRU594/2003/G2P[4] Y Y X Y (de novo) 22 RVA/Human-wt/ZAF/MRC-DPRU1293/2004/G2P[4] X X X X 23 RVA/Human-wt/ZAF/MRC-DPRU431/2004/G2P[4] Y Y Y Y (de novo) 24 RVA/Human-wt/ZAF/MRC-DPRU29/2004/G2P[4] Y X Y Y (de novo) 25 RVA/Human-wt/ZAF/MRC-DPRU2199/2006/G2P[4] X X Y Y (de novo) 26 RVA/Human-wt/ZAF/MRC-DPRU800/2006/G2P[4] Y Y X Y (de novo) 27 RVA/Human-wt/ZAF/MRC-DPRU2123/2006/G2P[4] X X X X 28 RVA/Human-wt/ZAF/MRC-DPRU457/2006/G2P[4] X X X X 29 RVA/Human-wt/ZAF/MRC-DPRU853/2006/G2P[4] X X X X 30 RVA/Human-wt/ZAF/MRC-DPRU460/2006/G2P[4] X X X X 31 RVA/Human-wt/ZAF/MRC-DPRU1428/2007/G2P[4] X X Y Y (de novo) 32 RVA/Human-wt/ZAF/MRC-DPRU1776/2007/G2P[4] Y X X Y (de novo) 33 RVA/Human-wt/ZAF/MRC-DPRU1363/2007/G2P[4] X X X X 34 RVA/Human-wt/ZAF/MRC-DPRU1389/2007/G2P[4] X X Y Y (de novo) 35 RVA/Human-wt/ZAF/MRC-DPRU4059/2007/G2P[4] X X X X 36 RVA/Human-wt/ZAF/MRC-DPRU1793/2007/G2P[4] Y Y X Y (de novo) 37 RVA/Human-wt/ZAF/MRC-DPRU1057/2008/G2P[4] Y X X Y (de novo) 38 RVA/Human-wt/ZAF/MRC-DPRU1036/2008/G2P[4] Y Y X Y (de novo) 39 RVA/Human-wt/ZAF/MRC-DPRU1941/2008/G2P[4] X X X X 40 RVA/Human-wt/ZAF/MRC-DPRU1040/2008/G2P[4] X X Y Y (de novo) 41 RVA/Human-wt/ZAF/MRC-DPRU1029/2008/G2P[4] X X X X 42 RVA/Human-wt/ZAF/MRC-DPRU140/2009/G2P[4] Y Y Y Y (de novo) 43 RVA/Human-wt/ZAF/MRC-DPRU1392/2009/G2P[6] Y X X Y (de novo)

Key: Y denotes samples were selected while X denotes samples that were not selected. All the samples are named using a new nomenclature of naming rotavirus strains proposed in 2011 by rotavirus classification working group (RCWG) (Matthijnssens et al, 2011). Therefore strains are named as follows; RV group/species of origin/country of identification/common name/year of identification/G-and P-type. If the country of isolation is not known xxx is used, if the year of isolation is not known xxxx is used, and if the genotype is not known x is used.

4.2 PAGE Analysis All the 36 samples exhibited a standard short RNA profile of group A rotavirus 4, 2, 3 and 2. This profile was reported before by Kalica et al, 1978. Only three different types of rotavirus RNA migration profiles were noted (S1, S2 and S3) which was based on the migration of gene segments 7, 8 and 9. The overall summary of the RNA profile of the rotavirus segments among the study samples is presented in Table 4.2. If segments 8 and 9 were co-migrating, the RNA profile was designated S1, co-migration of segments 7 and 8 was S3, and an equal separation of segments 7, 8 and 9 was designated S2 (Table 4.3). All the three RNA profiles noted were almost equally distributed among the study strains regardless of the year of isolation, except that the 2008 strains exhibited S1 profiles. Similarly, all the 2004 strains exhibited S2 profiles only (Table 4.2). PAGE gel is represented in (Figure 4.1).

Table 4.2: Overall summary of PAGE profiles among the study strains (Group II, 2003-2009).

Year S1 S2 S3 Total

2003 4 5 4 13

2004 0 3 0 3

2005 0 0 0 0

2006 1 4 2 7

2007 4 0 2 6

2008 5 0 0 5

2009 1 0 1 2

Total 15 12 9 36

Table 4.3: Characterization of study samples from (2003-2009) in terms of PAGE patterns.

Lab Strain Year RNA Lab Strain Year RNA number Pattern number Pattern 2114 RVA/Human-wt/ZAF/MRC-DPRU2114/2003/G2P[4] 2003 S1 800 RVA/Human-wt/ZAF/MRC-DPRU800/2006/G2P[4] 2006 S1 666 RVA/Human-wt/ZAF/MRC-DPRU666/2003/G2P[4] 2003 S1 2123 RVA/Human-wt/ZAF/MRC-DPRU2123/2006/G2P[4] 2006 S2 421 RVA/Human-wt/ZAF/MRC-DPRU421/2003/G2P[4] 2003 S1 457 RVA/Human-wt/ZAF/MRC-DPRU457/2006/G2P[4] 2006 S2 629 RVA/Human-wt/ZAF/MRC-DPRU629/2003/G2P[4] 2003 S1 853 RVA/Human-wt/ZAF/MRC-DPRU853/2006/G2P[4] 2006 S2 2143 RVA/Human-wt/ZAF/MRC-DPRU2143/2003/G2P[4] 2003 S2 460 RVA/Human-wt/ZAF/MRC-DPRU460/2006/G2P[4] 2006 S3 667 RVA/Human-wt/ZAF/MRC-DPRU667/2003/G2P[4] 2003 S2 1428 RVA/Human-wt/ZAF/MRC-DPRU1428/2007/G2P[4] 2007 S1 644 RVA/Human-wt/ZAF/MRC-DPRU644/2003/G2P[4] 2003 S2 1776 RVA/Human-wt/ZAF/MRC-DPRU1776/2007/G2P[4] 2007 S1 404 RVA/Human-wt/ZAF/MRC-DPRU404/2003/G2P[4] 2003 S2 1363 RVA/Human-wt/ZAF/MRC-DPRU1363/2007/G2P[4] 2007 S1 391 RVA/Human-wt/ZAF/MRC-DPRU391/2003/G2P[4] 2003 S2 1389 RVA/Human-wt/ZAF/MRC-DPRU1389/2007/G2P[4] 2007 S1 613 RVA/Human-wt/ZAF/MRC-DPRU613/2003/G2P[4] 2003 S3 4059 RVA/Human-wt/ZAF/MRC-DPRU4059/2007/G2P[4] 2007 S3 603 RVA/Human-wt/ZAF/MRC-DPRU603/2003/G2P[4] 2003 S3 1793 RVA/Human-wt/ZAF/MRC-DPRU1793/2007/G2P[4] 2007 S3 589 RVA/Human-wt/ZAF/MRC-DPRU589/2003/G2P[4] 2003 S3 1057 RVA/Human-wt/ZAF/MRC-DPRU1057/2008/G2P[4] 2008 S1 433 RVA/Human-wt/ZAF/MRC-DPRU433/2003/G2P[4] 2003 S3 1036 RVA/Human-wt/ZAF/MRC-DPRU1036/2008/G2P[4] 2008 S1 594 RVA/Human-wt/ZAF/MRC-DPRU594/2003/G2P[4] 2003 S3 1941 RVA/Human-wt/ZAF/MRC-DPRU1941/2008/G2P[4] 2008 S1 1293 RVA/Human-wt/ZAF/MRC-DPRU1293/2004/G2P[4] 2004 S2 1040 RVA/Human-wt/ZAF/MRC-DPRU1040/2008/G2P[4] 2008 S1 431 RVA/Human-wt/ZAF/MRC-DPRU431/2004/G2P[4] 2004 S2 1029 RVA/Human-wt/ZAF/MRC-DPRU1029/2008/G2P[4] 2008 S1 29 RVA/Human-wt/ZAF/MRC-DPRU29/2004/G2P[4] 2004 S2 140 RVA/Human-wt/ZAF/MRC-DPRU140/2009/G2P[4] 2009 S1 2199 RVA/Human-wt/ZAF/MRC-DPRU2199/2006/G2P[4] 2006 S2 1392 RVA/Human-wt/ZAF/MRC-DPRU1392/2009/G2P[6] 2009 S3

S2 S3 S4

S5 S6

S7, 8 S9

S11 (a) S10

S11 (b)

Figure 4.1: PAGE gel representing different RNA profiles. Lanes 1-4 are study samples representing genotype G2P[4] with short RNA profiles. Lanes 5 is a short profile positive control while lane 7 is a long profile positive control. Lane 6 is a negative control. Genome segment 1-11 are labelled with black arrows, (a) indicate short RNA profile and (b) indicate long RNA profile.

4.3 RT-PCR and genotyping The genome segments 9, 4 and 6 were succesfully reverse transcribed to code the VP7 (1,062bp), VP6 (1,356bp; 379bp) and VP4 (876bp) genes, respectively. All the samples were selected for both VP7 and VP4 genomic segments amplification, while only nine samples were amplified for genome segment 6 which was perfomed twice, for amplification of full- length gene and amplification of 379bp fragment. During the analysis of RT-PCR results, different intensities of the amplification products were obtained; from strong positive (+4) to low positive (+1). For amplification of genome segment 9, most samples 31/36 (86%) were strong positive, while 5/36 (14%) of the samples were displaying low positive results. An example of genome segment 9 and 4 RT-PCR gel is presented in Figure 4.2A and 4.2B. The RT-PCR amplification of genome segment 4, showed that 15/36 (42%) of samples were strong positive, 12/36 (33%) moderatly positive and only 9/36 (25%) were low positive. For the amplification of genome segment 6 (both full length and 379 bp fragment), all the samples 9/9 (100%) were strong positive. During genotyping, 36/36 (100%) of the samples were G2. For P typing 32/36 (89%) were P[4] and only 1/36 (3%) was P[6]. Only three samples 3/36 (8.3%) revealed mixed infections of P[4] and P[6] genotypes. A typical example of genome segment 9 and 4 genotyping analysis are presented by the agarose gel in Figure 4.3 and 4.4, respectively.

Figure 4.2: RT-PCR products run on a 1% agarose gel stained in ethidium bromide. Section A shows amplification of genome segment 9 (VP7), MW=11bp molecular weight marker, PC is the positive and NC is the negative control. Study samples are labelled. Section B shows amplification of genome segment 4 (VP4), MW=11bp molecular weight marker, PC is the positive and NC is the negative control. Study samples are labelled.

1000bp

500bp

MW PC 1036 1392 1793 1057 140 800 1776 431 NC

Figure 4.3: Genotyping products of genome segment 9 (VP7) analysed by using 2% agarose gel electrophoresis and visualized by staining with 10mg/ml ethidium bromide. Lane1and 12 =100bp molecular size marker, lanes 3-10=G2 serotype, lane 2= G2 positive control, lane 11=negative control.

1000bp

300bp

MW PC 594 431 1793 PC 1036 MW PC 800 NS 140 PC NS NC

Figure 4.4: Genotyping products of genome segment 4 (VP4) analysed by using 2% agarose gel electrophoresis and visualized by staining with 10mg/ml ethidium bromide. Lane 1 and 16 =100bp molecular size marker, lanes 3-5, 7, 10 and 12=P[4] genotype, lane 2=[P4] positive control, lane 6 and 9=P[8] positive controls, lane 13=P[6] positive control, lane 11=no sample added, lane 14 =non specific bands, lane 15= negative control.

4.4 Genetic profiles of genome segment 9 (VP7 protein) 4.4.1 Nucleotide sequence analysis of genome segment 9 The full length genome segment 9 contains 1,062 nucleotide base pairs, with an open reading frame of 981 nucleotides capable of coding a protein of 326 amino acids (Li et al, 1994). Nearly full-length (1-1050bp) nucleotide sequences from group I samples were obtained from the GenBank database while partial length gene segment 9 sequences of 50-1023 nucleotide sequence was obtained from the 11 samples (Group II). Both the partial and nearly full length nucleotide sequences of the study strains are presented in Appendix A1.

All the study strains were compared with the G2 prototype in order to identify any genetic changes on genome segment 9 of the G2 strains. Interestingly, Group I (1984-1987) strains: (RVA/Human-wt/ZAF/GR1296/1984/G2P[4], GR410/1985, GR659/1986, GR405/1987 and GR514/1987) displayed an eleven 11bp deletion from nucleotide 1,032 to 1,042. The 1993 strain (GR1893) and the 1997 strain (GR3958) did not display any deletion in this position. Unfortunately, only partial sequences (50-1,023) of the Group II (2003-2009) strains were generated which did not cover this region. Therefore, it cannot be deduced whether they also possess this deletion or not. Additionally, analysis of the 1,032-1,042 region between 1993 and 1997 strains which did not display the 11bp deletion revealed that, the 1993 strain displayed 1032 (A-G) substitution while the 1997 strain did not reveal this substitution (it was conserved with the DS-1 prototype at this region). Group I (1997) and Group II strains displayed several substitutions including: 44 (C-T), 92 (C-T), 171 (T-C), 180 (A-G), 191 (A- G), 198 (A-G), 229 (G-C), 237 (G-A), 259 (G-A), 286 (G-A), 309 (A-G), and 336 (A-G).

Furthermore, analysis of conserved regions among Group I (1984-1987) study strains revealed 12 conserved regions which were nucleotides position: 1-62, 164-193, 206-245, 247-358, 373-389, 391-469, 471-493, 509-571, 573-625, 627-701, 703-871 and 873-926. Group I (1997) and Group II strains revealed 16 conserved regions which were: 61-83, 85- 117, 145-164, 172-203, 225-337, 339-417, 430-479, 493-566, 568-590, 592-620, 622-698, 700-724, 766-803, 819-890 and 895-918. Group I (1984-1987) and all Group II strains shared 16 conserved regions. The 1993 strain shared 14 conserved regions with the Group I strains and 15 conserved regions with Group II strains.

Analysis of the genome 9 sequence distance matrix data revealed that the Group I (1984- 1987) strains shared nucleotides identities of 98.9-99.6%. The lowest identity was revealed between the 1987 (GR405) and the 1986 strain (GR659), while the highest identity was shared between the 1985 strain (GR410) and the 1984 strain (GR1296). The 1997 and Group II strains revealed 90.3-100% nucleotide identities. The lowest identity was 90.3% which was shared by the 2007 strain (MRC-DPRU1793) and the 1997 strain (GR3958) while the highest identity was 100% which was between the 2009 (MRC-DPRU140) and the 2008 strain (MRC-DPRU1057). When comparing all the study strains: Group I (1984-1997) and Group II (2003-2009) shared the nucleotide distance identities of 83.4-100%, the lowest identity was shared between the 2004 (MRC-DPRU 29) and the 1993 strain (GR1831). The highest identity was 100% which was between the 2009 strain (MRC-DPRU140) and the 2008 strain (MRC-DPRU1057). The summary of nucleotide sequence identities is depicted by the sequence identity matrix in Table 4.4.

4.4.2 Sequencing and nucleotide blast search results. Genotyping and sequencing results correlated with each other. All the samples were submitted to the NCBI database to search for highly similar sequences. Group I strains (1984-1987) revealed 100% query coverage and 98% maximum identity among each other. They also revealed 95% query coverage and 98% maximum identity to two Taiwanise G2 strains: TA3, accession number (AF106280) and TW3, accession (AF044338) isolated in 1981. The 1993 strain revealed a 100% query coverage and 98% maximum identity to two G2P[4] strains: 64SB, accession number (AY261341) and 906SB, accession number (AY261347) detected in South Africa in Stellenbosch in 1996 and 1998, respectively . It also revealed a 100% query coverage and 98% maximum identity to a Kenyan G2P[4] strain D205, and accession number (JF304920) detected in 1989. The 1997 strain revealed 100% query coverage and 99% maximum identity to two Chinese G2 strains: CH-128, accession number (FJ598027) and CH-95, accession number (FJ598026) the years of detection were not documented. Furthermore, the 1997 strain also revealed a 100% query coverage and 99% maximum identity to a Uruguayan strain mvd9707, accession number (AF480268) detected between 1996 and 1998.

From group II strains, nucleotide blast search for highly similar sequences revealed that all the study strains showed 100% query coverage and 99% maximum identity to the following

61 published strains: Korean G2P[4] strains KMR024, accession number (HQ425267) detected in 2002, KMR750, accession number (HQ425276) detected in 2001, KMR757,accession number (HQ425277), detected in 2001, two Chinese G2 strains: CH-128, accession number (FJ598027) and CH-95, accession number (FJ598026) the years of detection were not documented. Two Thailand strains: CU-497, accession number (GQ996895) detected in 2009 and CU-456, accession number (GQ996892) detected in 2009. Vietnam strain, VN-25, accession number (DQ904515) year of detection is not documented, and Taiwanese strain: TW9259, accession number (AF044349) detected in 1992. USA strain: LB2772, accession number (HM467956) detected between 2005 and 2006.

Table 4.4: Nucleotide sequence identity matrix of the strains analysed for genome segment 9. Years of collection of the strains are: 1296 (1984), 410 (1985), 659 (1986), 405 (1987), 514 (1987), 1831 (1993), 3958 (1997) ,1057 (2008), 1036 (2008), 29 (2004), 431 (2004), 140 (2009), 1392 (2009), 594 (2003), 644 (2003), 800 (2006), 1776 (2007), and 1793(2007).

Strain DS-1 1296 410 659 405 514 1831 3958 1057 1036 29 431 140 1392 594 644 800 1776 1793 DS-1 ID 1296 96.2 ID 410 96.4 99.6 ID 659 96.0 99.4 99.4 ID 405 95.9 99.1 99.1 98.9 ID 514 96.4 99.4 99.4 99.2 99.5 ID 1831 92.1 91.0 91.2 91.0 90.6 91 ID 3958 94.0 92.3 92.5 92.1 92.0 92.5 91.9 ID 1057 86.0 86.0 86.2 85.8 85.7 86.2 83.8 90.6 ID 1036 85.7 85.7 85.9 85.5 85.4 85.9 83.8 90.5 99.2 ID 29 85.4 85.6 85.8 85.4 85.3 85.8 83.4 90.3 98.7 98.6 ID 431 85.7 85.7 85.9 85.5 85.4 85.9 83.7 90.3 98.8 98.7 98.8 ID 140 86.0 86.0 86.2 85.8 85.7 86.2 83.8 90.6 100 99.2 98.7 98.8 ID 1392 85.7 85.7 85.9 85.5 85.4 85.9 83.8 90.5 99.0 99.1 98.4 98.5 99.0 ID 594 85.9 86.1 86.2 85.9 85.8 86.2 83.8 90.7 99.2 99.1 99.4 99.3 99.2 98.9 ID 644 85.8 85.8 86.0 85.6 85.5 86.0 83.8 90.6 99.1 99.0 99.3 99.2 99.1 98.8 99.6 ID 800 86.0 86.0 86.2 85.8 85.7 86.2 84.0 90.8 99.5 99.4 98.9 99.0 99.5 99.2 99.4 99.3 ID 1776 85.6 85.6 85.8 85.4 85.3 85.8 83.8 90.4 99.1 99.2 98.5 98.6 99.1 98.8 99.0 98.9 99.3 ID 1793 86.1 86.0 86.2 85.8 85.7 86.2 83.7 90.3 99.1 99.0 98.3 98.4 99.1 98.8 98.8 98.7 99.1 98.7 ID

Key: Values represent percentage identities between nucleotide sequences.

4.4.3 Analysis of the antigenic regions and glycosylation sites of VP7 protein The VP7 is a glycoprotein with nine regions that differ across serotypes and four regions A, B, C and F have shown to be antigenically important. These regions are represented by amino acid (87-96; 145-150; 211- 223 and 235-242) respectively (Dyall-Smith et al, 1986; Kirkwood et al, 1993). The analysis of the study strains was based on the antigenic regions on these four antigenic regions A, B, C and F.

From the Group I (1984-1993) strains, all the strains: 1984 (GR1296), 1985 (GR410), 1986 (GR659), 1987 (GR514), 1987 (GR504) and the 1993 strain (GR1831) were conserved with the DS-1 prototype at antigenic region A (87-96). The strains were also conserved at antigenic region B (145-150) and C (211-223) as well, except that the 1993 strain (GR1831) revealed T147A and N213S substitutions at antigenic region B and C respectively. Similarly, all the strains apart from the 1993 (GR1831) strain revealed I239V substitution at antigenic region F while the 1993 strain revealed N242S substitution (Table 4.5). Group I (1997) and all the Group II (2003-2009) strains showed less homology to the DS-l prototype. This group of strains revealed two mutations at antigenic region A (A87T and D96N), a single mutation at antigenic region C (N213D) and antigenic region F (N242S), antigenic region B was conserved with the DS-1 prototype, however, two strains (MRC-DPRU1057) and (MRC- DPRU1392) detected, respectively in 2008 and 2009 were conserved with the DS-1 prototype at antigenic region F (Table 4.5).

Four strains: (GR1296), (GR410), (GR659), and (GR1831) from Group I (1984-1993) revealed amino acid substitution N69D at glycosylation site (69-71), but the two 1987 strains did not display this mutation. Group I (1997) strain together with Group II (2003-2009) strains did not possess this mutation and were conserved with the DS-1 prototype at this location. All the strains were conserved at region (146-148) except the 1993 strain which revealed T147A mutation. All Group I (1984-1987) strains displayed I239V mutation, whereas none of the Group II strains displayed a mutation at region (238-240). Furthermore, the VP7 protein of these G2 strains also displayed several other substitutions that where neither associated with the antigenic sites nor the glycosylation regions, which can be considered minor substitutions. When analysing these substitutions, it was interesting to learn that all the Group I (1984- 1993) strains shared same patterns of substitutions as the Group I

(1997) and Group II (2003-2009) strains shared similar pattern of substitutions as well. Some of the minor substitutions noted from Group I (1997) and Group II (2003-2009) strains are: S15F, I44M, P75S, I113T, N125T, V129M, S178N, I287V and V306I. These substitutions were not consistent among the strains. The first exception noted was P75S which was noted from a 2004 strain (MRC-DPRU29) which instead displayed P75L substitution. The second exception was noted from a 2007 (MRC-DPRU1793) strain which was conserved with the DS-1 prototype at amino acid residue 113. An overall summary of mutations at glycosylation sites is shown in (Table 4.5).

4.4.4 Analysis of proline and cysteine residues Zao et al (1999) performed sequence analysis of genome segment 9 of the human rotavirus G2 strains and found that 11 prolines and 8 cysteines are conserved. They also mentioned that conserved proline and cysteine residues indicate that the basic structural features of the proteins are similar. Therefore, in the current study the proline and cysteine residue were analysed as well. The amino acids alignment of all the study strains revealed that 11 prolines are conserved among all the strains at residues (46, 58, 86, 112, 131, 167, 197, 254, 266, 275 and 279). Analysis of the cysteine residues reveals that 8 cysteine residues are conserved among all the study strains at this residues: (82, 135, 165, 191, 196, 207, 244, 249), however, the Group I (1984) strain displayed C82V and Group I (1985) displayed C165F substitutions (Figure 4.5).

Table 4.5: A summary of all substitution mutations from the antigenic regions (A, B, C and F) and the glycosylation regions (aa 69-71,146-148 and 238-240) on VP7 protein of study G2 strains.

Region A Region B Region C Region F Amino acid Amino acid Amino acid Study samples (1984-2009) (87-96) (145-150) (211-223) (235-242) 69-71 146-148 238-240

RVA/Human-wt/ZAF/GR1296/1984/G2P[4] Conserved Conserved Conserved I239V N69D Conserved I239V RVA/Human-wt/ZAF/GR410/1985/G2P[4] Conserved Conserved Conserved I239V N69D Conserved I239V RVA/Human-wt/ZAF/GR659/1986/G2P[4] Conserved Conserved Conserved I239V N69D Conserved I239V RVA/Human-wt/ZAF/GR504/1987/G2P[4] Conserved Conserved Conserved I239V Conserved Conserved I239V RVA/Human-wt/ZAF/GR514/1987/G2P[4] Conserved Conserved Conserved I239V Conserved Conserved I239V RVA/Human-wt/ZAF/GR1831/1993/G2P[4] Conserved T147A N213S N242S N69D T147A Conserved RVA/Human-wt/ZAF/GR3958/1997/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU594/2003/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU644/2003/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU431/2004/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU29/2004/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU800/2006/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU1793/2007/G2P[4] A87T,D96N Conserved N213D Conserved Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU1776/2007/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU1036/2008/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU1057/2008/G2P[4] A87T,D96N Conserved N213D Conserved Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU140/2009/G2P[4] A87T,D96N Conserved N213D N242S Conserved Conserved Conserved RVA/Human-wt/ZAF/MRC-DPRU1392/2009/G2P[6] A87T,D96N Conserved N213D Conserved Conserved Conserved Conserved

VP7 protein (aa 1-308)

Figure 4.5: Deduced amino acids sequence alignments of representative study samples from Dr George Mukhari Hospital (South Africa) collected between 1984-2009 compared to strains in the GenBank database from other regions in South Africa, as well as from different geographical areas worldwide. The DS-1 is included as the G2 prototype). The sequences are grouped according to their respective lineages; the solid black regions denote the antigenic regions (AR’S) A, B, C and F. The orange dashed outline denote regions of proline residues, the black dashed outline denote cysteine residues, whereas the dashed navy purple outline denote glycosylation sites. Dots mean identity to the standard sequence (Consensus sequence). DS-1 prototype has been used as a consensus sequence.

4.4.5 Phylogenetic analysis of genome segment 9 (VP7) Phylogenetic analysis of the nucleotide sequence alignment of the genome segment 9 of the G2 strains, have revealed that over the past 25 years in South Africa, there has been three populations of strains circulating at Dr George Mukhari Hospital. The first population is represented by Group I (1984-1987) strains, forming lineage 1 (Figure 4.6). The second population is represented by Group I (1993) strain at lineage 2. The third population is represented by Group I (1997) strain and all Group II strains, lineage 5c. The Group I (1984- 1987) strains seem to have evolved from the common ancestor with the DS-1 prototype, however only full genome analysis can show conclusive results. This is based on the fact that both Group I (1984-1987) and the DS-1 prototype are clustered together within lineage 1, and amino acids sequence alignment revealed that the Group I (1984-1987) strains contains long regions of amino acids residues that are conserved with the DS-1 prototype (Figure 4.5). The Group I (1984-1987) and the DS-1 strain also shared a bootstrap value of 100%. When comparing the Group I (1984-1987) strains with the DS-1 strain in terms of nucleotide and amino acids percentages identity, it was found that the Group I (1984-1987) strains shared a homology of 98% and 99% with the DS-1 strain both at the nucleotide and the amino acids level, respectively. This kind of information indicates that the Group I (1984-1987) strains are highly homologous to the DS-1 prototype. The Group I (1993) strain was distinct from other study strains, it clustered with published strains from Australia, as well as two strains from South Africa, strain from Port Elizabeth and Stellenbosch. The Group I (1993) strain also shared a bootstrap value of 97% to the Stellenbosch and Port Elizabeth strains. This strain shared less homology to the Group I (1984-1987) strains (91%-92% at nucleotide level, 90%-92% at amino acids level) and (91%-92% at nucleotide level, 91%-92% at amino acids level) to the Group I (1997) and Group II strains. Group I (1997) and Group II strains differed from the Group I (1984-1987) strains by 64-69 nucleotides (92.5-83.4% identity, Table 4.4). Group I (1993) strain differed from Group I (1984-1987) and Group II strains by 77-83 nucleotides (92.1-90.6% identity) and 77-84 nucleotides (91.9-83.4% identity), respectively.

The difference between the lineages was based on the amino acid substitutions in the antigenic regions (A, C and F) with respect to the DS-1 prototype. The Group I (1984-1987) strains are clustered in lineage 1 because they are conserved with the DS-1 prototype at the antigenic regions. The Group I (1993) strain is clustered in lineage 2 because it revealed N213S and N242S at antigenic regions C and F, respectively. The Group I (1997) and Group

II strains are clustered in lineage 5c because they display A87T and D96N substitutions at antigenic region A, furthermore, they display N213D and N242S substitutions at antigenic region C and F, respectively. Strains in lineage 3 display A87T and D96T substitutions at antigenic region A. Antigenic region C is conserved but they display N242S substitution at antigenic region F. Strains in Lineage 4 are conserved at antigenic region A, but they display N213D and N242S at antigenic region C and F, respectively. Strains in lineage 5a display same substitutions as lineage 5c strains, however, they also display V66A and G73E. Strains in Lineage 5b display A87T and D96N substitutions at antigenic region A, N213D at antigenic region C while antigenic region F is conserved (Figure 4.6).

Figure 4.6: Phylogenetic tree of the deduced amino acids sequence alignment of VP7 protein of G2 strains constructed based on the neighbor-joining methods using MEGA 4.1 program. Human G5P[6] was used as an outgroup. Study strains are denoted with black triangles while the outgroup is denoted with red dot. The number adjacent to the node represents the bootstrap value and the scale bar shows genetic distance expressed as amino acid substitution per site. The tree was contructed with the following G2 published sequences downloaded from the GenBank database: J-4787 (DQ904511), KO-2 (AF401754), KY3103 (AY261349), GR3958 (AY261344), PT96 (AY261342), JHB4372 (AY261346), TE65 (AF106295), TD69 (AF106293), NG4585 (AY26135) ,NG5113 (AY261352), MR4717 (AY261358), MMC6 (EU839923), MMC88 (EU839925), PT4476 (AY261343), SB4419 (AY261345), TN1529 (AY261357), BF3767 (AY261355), BF3704 (AY261356), CI1735 (AY261354),94A(U73950), KY3303 (AY261350), JAPAN 0022 (D50117), JAPAN 137 (D50121), TB-CHEN (AY787646), DS-1 (AF044360), GR405 (AY261337), GR514 (AY261337), GR410 (AY261335), GR1296 (AY261334), GR659 (AY261336), Rotateq-SC2-9 (GU565068), 95A (U73955), GR1831 (AY261340), PE7 (AY261339), SB906 (AY261347), 34461-4 (AY766085), CMP034 (DQ534015).

4.5 Genetic profiles of Genome segment 4 (VP4 protein) 4.5.1 Nucleotide sequence analysis of genome segment 4 Only genome segment 4 nucleotides sequences of samples from 2003-2009 (Group II) were analyzed in the present study (n=6). The complete nucleotide sequence of genome segment 4 of the rotavirus strains is 2,359 base pairs in length, with 5'-and 3'-noncoding regions of 9 and 25 nucleotides (Gorziglia et al, 1986). The rotavirus genome segment 4 can be cleaved into two fragments which are: VP8* fragment (741) coding for 247 amino acids and VP5* fragment (1589) coding for 529 amino acids (Lopez et al, 1987). In the current study, only the VP8* fragment was analysed. The primers used (Con 2-reverse and Con 3-forward) as described by Gentsch et al (1992) were specific for amplification of an 876bp fragment. The nearly full length nucleotides sequences of the VP8* fragment of genome segment 4 obtained in the current study are displayed in Appendix A2.

Analysis of the VP8* fragment of genome segment 4 of the selected study strains revealed that all the strains were highly conserved. The observed conserved regions are nucleotides: 10-32, 184-212, 399-416, 574-593, 613-647 and 762-776. Not even a single strain revealed an insertion or deletion of nucleotides. However, several point mutations were identified, which were mainly substitutions. Some of the notable substitutions that were identified are: 276 (C-T), 552 (T-C), and 756 (T-C) displayed among almost all the strains, excluding only two strains: MRC-DPRU1793 and MRC-DPRU431 which were isolated in 2003 and 2004, respectively. The T-C substitution was also identified at position 505 but it was revealed by only one strain, MRC-DPRU431 which was isolated in 2004. Other noticeable substitutions were 276 (C-T) and 739 (C-T). Only two strains MRC-DPRU431 and MRC-DPRU594 did not display 276 (C-T) substitution, and only one strain MRC-DPRU140 did not display 739 (C-T) substitution. The other identified substitution was 395 (A-G) which was also shared among all the strains, excluding MRC-DPRU594 which instead displayed 395 (A-T) substitution. The highest nucleotide sequence identity among the study strains was 99.8% which was shared between a 2006 strain MRC-DPRU800 and a 2009 strain MRC-DPRU140. The lowest nucleotide sequence identity was 98.9% which was shared between a 2009 strain MRC-DPRU140 and two strains MRC-DPRU594 and MRC-DPRU431, which were isolated in 2003 and 2004, respectively. A summary of nucleotide sequence identities among genome segment 4 is depicted by the sequence identity matrix in (Table 4.6).

Table 4.6: Distance matrix of the strains analysed for genome segment 4.Years of isolation of the strains are: 1793 (2007), 431 (2004), 594 (2003), 800 (2006), 140 (2009) and 1036 (2008).

Strain DS-1 1793 431 594 800 140 1036 DS-1 ID

1793 91.8 ID 431 92.1 99.1 ID

594 92.3 99.1 99.7 ID 800 92.1 99.4 99.1 99.1 ID 140 92.0 99.3 98.9 98.9 99.8 ID 1036 91.9 99.7 99.3 99.3 99.7 99.6 ID

Key: Values represent percentages identities between nucleotides.

4.5.2 Sequencing and nucleotide blast search results Sequencing results correlated well with genotyping results, and the sequences were submitted to the NCBI database in order to search for highly similar sequences. Nucleotide blast search results revealed that all the study strains shows 100% query coverage and 99% maximum identity to the following strains: Two Belgian strains, BE1147, accession number (JN849155) and BE1248, accession number (JN849129) detected in 2009 , two Russian G2P[4] strains, Nov10-N539, accession number (HQ537499) and Nov10-N397, accession number (HQ537494) detected in 2010 and one German G8P[4] strain, GER1H-09, accession number (GQ414543) detected in 2009.

4.5.3 Analysis of the VP4 protein The amino acids sequence alignment of VP4 proteins are presented in (Figure 4.7). The trypsin cleavage site is at amino acid position 241 and 247 that divide VP4 protein into VP8* (247 amino acids) and VP5* (529 amino acids) (Lopez et al, 1985). Only the VP8* fragment was analysed in this study. Interestingly, the trypsin cleavage site at amino acid position 241 is conserved in all the study strains except the 2009 strain (MRC-DPRU140) which is not conserved at trypsin cleavage position 247 (Figure 4.7), this strain revealed A247V substitution. Other substitutions were noted but were not associated with trypsin cleavage sites: these include N133I and Y169H from the 2003 (MRC-DPRU594) and the 2004 (MRC- DPRU431) strains, respectively. All the strains revealed conservation of cysteine residue at amino acid 215. The regions 224-236 and 257-264 flanking trypsin cleavage sites were also conserved in all the strains. None of the strains displayed a cysteine residue at position 203, this conforms to deductions by Gorziglia et al, 1986. Also the regions (100,114-135, and 173- 188) that are involved in viral neutralization were almost completely or highly conserved (Mackow et al, 1988); however, one strain (MRC-DPRU594) showed a N133I substitution at aa residue 133. Furthermore, all the study strains shared long regions of identical amino acid residues: 1-132, 134-168, 170-246, and 248-264.

Table 4.7: Summary of the identified amino acids substitution on VP4 proteins of G2 strains (Group II) Strain Position Wild type Novel

RVA/Human-wt/ZAF/MRC-DPRU431/2004/G2P[4] 169 Tyrosine Histidine

RVA/Human-wt/ZAF/MRC-DPRU800/2006/G2P[4] - - -

RVA/Human-wt/ZAF/MRC-DPRU1793/2007/G2P[4] - - -

RVA/Human-wt/ZAF/MRC-DPRU1036/2008/G2P[4] - - -

RVA/Human-wt/ZAF/MRC-DPRU140/2009/G2P[4] 247 Arginine Valine

4.5.4 Phylogenetic analysis of genome segment 4 The phylogenetic analysis of the VP8* fragment demonstrated five lineages (designated I-V) (Figure 4.8). All the study strains belong to lineage V and were clustered with the following strains. Two Indian strains: mani-30/06, accession number (GQ240586) detected in 2008. mani-174/06, accession number (GQ240587) detected between 2005 and 2008. Two Russian strains: Omsk08-464, accession number (HQ738608) detected in 2008 and RUS-Omsk-257, accession number (FJ440334) detected in 2008. Two Bangladesh strains MMC88, accession number (HQ641373) detected in 2005 and SK13888, accession number (EU839945) detected in 2004. German strain GER1H-09, accession number (GQ996732) detected in 2009. Italian strain Ita3, accession number (DQ172842) detected in 2004. Chinese strain TB-Chen, accession number (AY787644) year of detection is not documented. Furthermore, the study strains were also clustered with two strains from Paraguay Py04ASR42, accession number (EU045249) and Py05ASR60, accession number (EU045253) detected in 2004 and 2005, respectively. The study strains differed by 1-8 nucleotides (99.8-98.9% identity, Table 4.6) to each other and were supported by a bootstrap value of 98%.

Figure 4.8: Phylogenetic dendrogram of the deduced amino acids sequence alignment of VP4 protein of G2 strains. The tree was constructed based on the neighbor-joining method using MEGA 4.1 program. Porcine G4P[6] was used as an outgroup. Study strains are denoted with black dots while the outgroup is denoted with a red dot.The number adjacent to the node represents the bootstrap value and the scale bar shows genetic distance expressed as amino acid substitution per site. The tree was contructed with the following P[4] published sequences downloaded from GenBank database: M33516 (HQ650120.1), MW333 (AY855067.1), R29 (DQ172847.1), H93 (DQ172840.1) I200 (DQ857926.1), RJ5326 (DQ857927.1), RJ5619 (115605959), L26 (M58292.1), RV5 (M32559), H41 (DQ172838.1), Py04ASR42 (EU045249), Py05ASR60 (EU045253), Ita3 (DQ172842), KO-2(AF401755.1), R291(AY855067), mani-30/06 (GQ240586), mani-174/06 (GQ240587), Omsk08-464(HQ738608),Rus-Omsk-257(FJ440334),MMC88(HQ641378), SC185(AJ299459), SK138(EU839945), MMC84(EU83995), MMC6(EU839950), LB2764 (HM467943), CU209-KK/08 (GQ996732),GER1H-09 (GQ414543),KO-2 (AF401753),LB2772 (HM467945), TB-Chen (AY787644).

4.6 Genome segment 6 (VP6) 4.6.1 Nucleotide sequence analysis of genome segment 6 Similar to the genome segment 4, only the nucleotides sequences of Group II samples (2003- 2009) were analyzed in the current study (n= 9). Genome segment 6 contains 1356bp and therefore, coding for a protein of 397 amino acids (Both et al, 1984; Gorziglia et al, 1988). The partial nucleotides sequences of genome segment 6 are represented in Appendix A3. All the study strains were highly conserved as they revealed nucleotide sequence identity of 98.5- 100%. The lowest identity was between the 2007 strain (MRC-DPRU1389) and the 2004 strain (MRC-DPRU431). The highest identity was between 2007 strain (MRC-DPRU1428) and the 2008 strain (MRC-DPRU1040). Distance matrix among the genome segment 6 (VP6) nucleotides are shown in Table 4.8. None of the study strains revealed deletion or even addition of nucleotides. Only few substitutions of nucleotides were noted, Appendix A3.

Table 4.8: Distance matrix of the strains analysed for genome segment 6. The strains were isolated from these years: 433 (2003), 2199 (2003) 391 (2003), 29 (2004), 431 (2004), 1389 (2007), 1428 (2007), 1040 (2008), 140 (2009).

Strain 433 2199 391 29 431 1389 1428 1040 140 433 ID 2199 99.6 ID 391 99.6 99.3 ID 29 99.4 99.3 99.3 ID 431 99.2 99.1 99.5 99.1 ID 1389 99.0 98.8 98.7 99.1 98.5 ID 1428 99.3 99.2 99.0 99.0 98.7 99.6 ID 1040 99.3 99.2 99.0 99.0 98.7 99.6 100 ID 140 98.8 98.7 99.2 98.7 99.0 99.1 99.3 99.3 ID

Key: Values represent percentage identities between the nucleotides.

4.6.2 Sequencing and nucleotide blast search results Nucleotide blast search of highly similar sequences revealed that all the study strains shows a 99% query coverage and 99% maximum identity to the following strains: CMH190/01, accession number (EU372726), genotype G2P[4] and subgroup I detected in Thailand but year of detection is undocumented. GER1H-09, accession number (GQ414544), genotype G8P[4] detected in Germany in 2009. LB2772, accession number (HM467951), genotype G2P[4] detected in the United States of America in 2006. Furthermore, the study strains

79 revealed 99% query coverage and 99% maximum identity to the following Brazilian strains: 14322-07MG, accession number (HM123834), Genotype I2 detected in 2007. 12585-06ES, accession number (H123823), genotype I2 detected in 2006. 11581-05AC, accession number (HM123816), genotype I2 detected in 2005. 15771-08PE, accession number (HM066142), genotype I2 detected in 2008.

4.6.3 Amino acids and phylogenetic analysis of genome segment 6 (VP6) The amino acids sequence alignments of the VP6 protein are presented in Figure 4.9. This represents the open reading frame of the VP6 proteins of serotype G2 strains of selected study samples collected during 2003-2009. The amino acid sequence alignments showed that VP6 proteins of these strains are highly conserved. Only four conserved regions were noted, these were amino acid residues: 1-45, 47-130, 132-275 and 277-299. Three substitutions were also noted, N46T, N131S and I276F. The N46T substitution was revealed by the 2007-2009 strains which were: two strains from 2007 (MRC-DPRU1389 and MRC-DPRU1428), one from 2008 (MRC-DPRU1040) and one from 2009 (MRC-DPRU140). All the study strains shared amino acids identities of 90-100% and were all clustered together within genotype I2 on the phylogenetic tree (Figure 4.10). The VP6 phylogenetic tree was constructed with the rotavirus published strains obtained from the GenBank database to represent the already known rotavirus VP6 diversity that contains sixteen distinct clusters (genotypes) ( I1-I16), as already documented by Matthijnssens et al (2011) who initiated classification of rotavirus based on full genome.

Figure 4.10: Constructed phylogenetic tree of the deduced amino acids sequence alignment of VP6 protein of study samples together with VP6 protein of publish strains from different genogroups : Wa-like, DS-1 like and AU-1-like . The tree was constructed by the neighbor-joining method using the MEGA 4.1 program. The tree is rooted with pigeon rotavirus G18P[17] strain. The percent bootstrap values are indicated at each node. Study strains are denoted with black dots while the outgroup is denoted with red dot. The tree was constructed using the following published strains obtained from the GenBank database: LB2744(HM467947.1), B1711(AF532203), MMC6(HQ641358.1), DRC86(6677342), PAI58(GU296429.1), RRV(HQ846848.1), 30/96 (AY740737.1), BA222(GU827410.1), PAH136(GU296428.1), SA11-H96(NC011509.2), Azuk- 1(AB573082.1), Dai-10(AB573073.1), CMH222(DQ288659.1), KE4852(GU983675.1), B10(HM627557.1), TUCH(EF583013.1), ETD822(JN887819.1), CE-M-06-0003(GU183245.1), RMC321(AF531913.1), mani97(HM348744.1), RV172(DQ204741.1), R479(DQ873675.1), CMP034(DQ534018.1), A131(AF317124.1), OSU(AF317123.1), A253(AF317122.1), E30(JF712570.1), L338(JF712559.1), DC5544(FJ947510.1), mani-253(HM348745.1), NIV929893(FJ685614.1), LB2719(HM467946.1), 0613158(HM467946.1), wa(EF583024.1), RV3(FJ99827.1), 116E(FJ99827.5), 02V0002G3(DQ096805.1), 06V0661(EQ486969.1), 03V0002E10 (EU486965.1), Ty-3(D82981.1), Ecu534 (EU805774.2), Cat97(EU708949.1), Cu-1(EU708916), Lamb-NT(FJ031028), Om46(HQ127440).

4.6.4 Analysis of VP6 RFLP A region of 379bp (nt 747-1126) coding for amino acids 241-367 of genome segment 6 is said to contain amino acid residues that specify the rotavirus subgroups. Iturriza-Gómara et al (2002b) deduced that by using vector NTI suite version 5.5 software, restriction enzyme AciI would not cut the 379 nucleotide sequence from strains of subgroup I, however, it would cut in one place from nucleotide sequence of strains in the subgroup I +II (therefore yielding two fragments of 285 and 94bp), in two places from nucleotide sequence of strains in the subgroup non I, non II (yielding three fragments of 167, 119 and 94bp). Finally, the enzyme would cut in three places from nucleotide sequence of strains in the subgroup II (yielding four fragments of 202, 83, 62 and 32bp).

In the current study, 9 samples from Group II (2003-2009) were selected for analysis by RFLP, the fragment of the VP6 gene was reverse transcribed to yield a 379bp amplicon (nt 747-1126). The VP6 amplicons were analysed by restriction fragment length polymorphism (RFLP) using AciI restriction enzyme. This was to investigate the VP6 subgroup specificity. The RFLP results showed that all the selected study strains (n=9) belonged to subgroup I specificity, hence all the selected study strains did not display any restriction pattern after exposure to AciI restriction enzyme and the 379bp was not cut (Figure 4.11). The RFLP results correlate well with sequencing results as the sequences are highly conserved, showing that genome segment 6 is highly conserved and free of single point mutations that might introduce restriction sites.

1000bp

300bp

MW PC 433 2199 29 431 391 140 1040 PC PC NC Figure 4.11: Shows RFLP products of genome segment 6 (VP6) analysed by using 3% agarose gel electrophoresis and visualized by staining with 10mg/ml ethidium bromide. Lane 1 and 12 =50bp molecular size marker, lanes 3-8=study samples showing no restriction digestion fragments (full length amplicon of 379bp), lane 9=subgroup I positive control, lane 2 and 10= subgroup II positive controls showing digestion of 379bp to 202, 83, 62 and 32). The resolution power of the gel electrophoresis used did not allow the visualisation of bands that are below 50bp in length, lane 11=negative control.

CHAPTER 5: DISCUSSION

5.1 Overview of the study The G2 rotavirus strains were reported as one of the most prevalent strains detected in South Africa. At the Dr George Mukhari Hospital, the incidence of rotavirus G2 strains has been documented to occur after almost every 3 to 4 years from 1984-2007. Previous studies indicated that G2P[4] strains were detected in 1984, 1987, 1990, 1993, 1997, 2003 and 2007. Thus, the current study aimed at investigating the genetic profiles of the G2 rotavirus strains over a 25-year period at Dr George Mukhari Hospital. To better understand how rotavirus strains may vary over time, the genetic and antigenic regions of the G2 rotavirus strains were analyzed. Our analysis was based on two groups; those samples which were previously sequenced for genomic segment 9 (VP7) only and sequences are available in the GenBank database (Group I: 1984 to 1997) and those which were analyzed de novo for VP4, VP6 and VP7 genomic segments (Group II: 2003 to 2009).

All the Group II (2003-2009) samples were characterized by PAGE for the investigation of RNA profiles and few of them were characterized by sequencing for the investigation of the genetic profiles of the VP4, VP7 and VP6. The PAGE results revealed that all the 36 samples were associated with short RNA profiles. All the 36 samples displayed short RNA profiles with three different profiles which were subsequently named (S1, S2 and S3) which were based on migration profiles of RNA segment 7, 8 and 9. Interestingly, all the samples collected in 2008 displayed same short profile (S1) and all the samples collected in 2004 displayed S2 only.

In summary, from the 36 Group II samples a total of eleven samples were selected for sequencing analysis for genome segment 9 (encoding the VP7), nine samples for genome segment 6 (VP6) and six samples for genome segment 4 (encoding the VP4). The nucleotide and the deduced nucleotide sequences of these 26 samples were analyzed and compared with the reference strains. Sequence analysis of genome segment 9 revealed that the G2 strains circulating at Dr George Mukhari Hospital over a 25 year period can be grouped into two major populations of strains. The first population is formed by Group I strains (exception of 1993 and1997 strain); the samples were detected during 1984 and 1987. These strains were highly homologous to the DS-1 prototype with a homology of 98% and 99% at the nucleotide

87 and amino acids level, respectively, suggesting that the genetic and molecular properties of these strains were similar to the ancestral strains. The second population is formed by Group II strains detected from 2003 and 2009 (including the 1997 strain from Group I). These strains were less homologous to the DS-1 prototype. This observations correlate well to most of the currently circulating rotavirus G2 strains reported worldwide. Analysis of antigenic regions of the VP7 proteins revealed that the 1984 -1987 (Group I) strains were conserved at antigenic regions A, B and C, but I239V mutation was noted at antigenic region F. The Group II strains (including 1997 strain) displayed A87T and D96N substitution mutations at antigenic region A, antigenic region C and F displayed N213D, and N242S substitution mutations respectively, while antigenic region B was conserved. Interestingly, one strain from 1993 (GR1831) was neither grouped with the Group I nor with Group II strains, hence it was conserved at antigenic region A, antigenic region B, C and F displayed T147A, N213S and N242S respectively.

Sequence analysis of the G2 strains detected at the Dr George Mukhari Hospital between 1984 and 2009 has demonstrated the existence of three distinct lineages. Phylogenetic analysis showed that 1984-1987 strains were grouped together in lineage 1, the 1993 strain belongs to lineage 2 and the 1997-2009 strains were clustered in lineage 5c. Analysis of the deduced amino acid sequence alignments of genome segment 4 showed that all the strains were conserved at trypsin cleavage site (aa position 241), but only one isolate from 2009 was not conserved at trypsin cleavage site (aa position 247), it revealed A247V substitution mutation. Phylogenetic analysis of the P[4] study strains revealed that the strains belong to lineage V.

Genetic analysis of the nine genomic segment 6 samples showed highly conserved regions (only four conserved regions). Sequencing results have revealed that all the strains belong to subgroup I, hence the regions containing epitopes for subgroup I specificity (aa 296-299, 305). Sequencing results did not permit us to analyse amino acid residue 305 because it was not obtained. Phylogenetic analysis has showed that these strains were grouped together in VP6 genotype I2. The VP6 protein was also characterized by RFLP digestion using AciI restriction enzyme, which revealed no restriction digestion. These results also confirmed the subgroup I strains.

5.2 Worldwide epidemiological trends of G2 strains Worldwide, the G2 rotavirus strains have been detected in many countries including South Africa, Burkina Faso, Malawi, Jordan, Oman, Bangladesh, Yemen, Egypt, Brazil, Paraguay, Taiwan, Thailand, Italy, United Kingdom and Australia (Fun et al, 1991; Zao et al, 1999; Iturriza-Gómara et al, 2001; Steele et al, 2003a; Page and Steele, 2004; Arista et al, 2005; Khamrin et al, 2007; Teleb, 2008; Kamel et al, 2009; Kirkwood et al, 2009; Cunliffe et al, 2010; Mascarenhas et al, 2010). The G2P[4] genotype has shown a continent /subcontinent variation representing; South America 23%, Africa 2%, Asia 13%, North America 11%, Europe 9% and Australia 14% (Santos and Hoshino, 2005). Currently the G2 strain is one of the most common strains circulating throughout the world. Based on epidemiological surveillance studies of serotype G2, it is well known that this serotype varies with its occurrence and is sometimes absent in the population during specific rotavirus season. These have been highlighted by several studies conducted from different geographical locations. In South Africa, Page and Steele (2004) outlined that the serotype G2 strains has been observed to occur after almost every three to four years at Dr George Mukhari Hospital. The 2010 rotavirus surveillance data from Blantyre (Malawi) has documented a 10 year absence of G2 strains (Cunliffe et al, 2010). In Burkina Faso, between 1996 and 1999 the G2 strains were dominant as compared to other African countries (Steele et al, 2003b). Surveillance studies from the middle eastern countries (Jordan, Oman and Yemen) and north African countries (Egypt) has reported the prevalence of rotavirus G2P[4] genotype to be ranging from 26 to 48% (Kamel et al, 2009; Teleb, 2008).

Studies conducted in Bangladesh have reported that the G2 rotavirus strain was dominant during the 1987-1989 rotavirus season (Fun et al, 1991). Rahman et al (2007) also reported another epidemic peak of the G2 serotype (43.2%) in Bangladesh which was from 2005- 2006. Gusmao et al (1999) has reported that in Belem out of 55 samples that were reported to be group A rotavirus positive, 46 of them were found to be serotype G2 strains, the year 1999 was regarded as the G2 epidemic season in Belem. A recent study conducted in Brazil, Parauapebas, South Para’ State reported that from 30 rotavirus positive samples collected during 2006 and 2008, 27/30 were serotype G2 strain (Mascarenhas et al, 2010). Also from a study conducted by Gurgel et al (2009) in Aracaju, Brazil, between October 2006 to April 2008, it was reported that 56/59 of the detected rotavirus positive samples were G2P[4] genotype. This finding means that the 2006-2008 period was the G2 epidemic season in these two regions.

In Taiwan, it was documented that the rotavirus serotype G2 strains were highly prevalent in 1993 after low detection rates between 1981 and 1987 and almost completely undetected from 1987 to 1992 (Zao et al, 1999). In the UK serotype G2 strains were observed as a re- emerging strain from 1995 to 1996 and it was the second-most common genotype (Iturriza- Gómara et al, 2001). Rotavirus studies have reported that in Thailand, there was a sharp increase of serotype G2 strains in 2003, statistically it was observed that from 2001-2002 the G2 strains contributed to very low rates but in 2003 the detection rate increased to 83% (Khamrin et al, 2007). Surveillance studies from Australia reported two major epidemic peaks attributable to G2P[4] strains. The first peak was in 1997 and the successive peak in 2004, in 2005 and 2006 the peak declined to only 5% of the infection rate, in 2008/2009 the G2P[4] strain became dominant again and accounted for more than 50% of the infection rate (Kirkwood et al, 2009).

In Napal the off-peak season of the G2P[4] rotavirus strain was reported from 2003 to 2004 at 1% detection rate, and the peak season can be considered to be from 2003-2004 where the detection rate increased from 1% to 33% from 2004-2005 (Doan et al, 2011). Therefore in this regard the findings from Nepal support that the G2 serotype can sometimes be absent from the circulation, and 2000-2004 interval were considered the off-pick season of the serotype G2 strain in this region. Even though several predominance years of serotype G2 were reported in a certain population, it is worth mentioning that sometimes the same strain can be circulating in a population for an extended period, this has been observed in Paraguay where a single rotavirus G2P[4] strain (Py99406) has been circulating in Paraguayan children from 1998-2004 with increased cycles of circulation (Martinez et al, 2010). To investigate if the same strain was circulating requires intensive efforts such as full genome analysis in order to investigate the whole genome constellation. The peak season of the serotype G2 strain was also observed in Paraguay in 2006 where this serotype was detected in 69 cases from 143 cases of rotavirus associated diarrhea (Martinez et al, 2010).

5.3 Analysis of the RNA profiles A total of 36 archival stool samples from 2003 to 2009 (Group II), were characterized for the RNA migration profiles. Polyacrylamide gel electrophoresis analysis showed that all the 36 short RNA profiles displayed eleven rotavirus segments. The arrangements and mobilities of the RNA patterns were different and only three different patterns of segments mobilities were noticed (S1, S2 and S3). All these different patterns were formed by four large segments, two medium-sized segments, three smaller segments and two smallest segments, therefore forming an order of 4,2,3,2. This order of RNA migration pattern was consistent with the human group A rotavirus segments arrangements as reported by Kalica et al (1978) and is the common RNA migration pattern that is reported in many epidemiological studies. However, it seems not to be the only RNA migration pattern that exist among group A rotaviruses. Other reported patterns exist, including 4,3,3,1 or 4,2,4,1 which are known to exist in lapine rotavirus (Thouless et al, 1986). All the identified different types of RNA patterns were characteristic of human rotavirus RNA pattern and none were associated with murine, avian or bovine rotavirus. Murine rotavirus segment 10 is known to migrate closer to segment 11 (Smith and Tzipori, 1979). None of the samples were associated with this feature. Avian rotavirus segment 4 migrates close to segment 5, while segments 10 and 11 are difficult to resolve whereas bovine rotavirus does not have segment 11 (Todd et al, 1980). Short RNA profiles is a characteristic feature of the DS-1 genogroup, therefore in this study it was significant to observe that all the samples that displayed short RNA profiles typed as G2 strains by genotyping. Even though the G2 strains are associated with short RNA profiles, limited cases exist were some G2P[4] strains has been observed to exhibit long RNA profiles (Ahmed et al, 2010).

5.4 Association of G2 serotype with either P[4] or P[6] or mixed P types Almost all of the study G2 strains were associated with P[4] genotype and only three samples (MRC-DPRU421, MRC-DPRU2123 and MRC-DPRU1029) were associated with mixed infection of the P[4] and P[6] genotypes. The phenomenon is highly possible in rotaviruses because the viral genome is segmented. The rotavirus genome may facilitate re-assortment between different strains during mixed infection leading to a variety of mixed genotypes (Kapikian, 2001). [In addition, previous studies have reported that even though the packaging of rotavirus is strictly equimolar for all RNA segments of the genome, this does not rule out the possibility of packaging extra genetic material (Whitton et al, 1983; Allan and Desselberger, 1985)]. The mixed infections were also identified before by Page and Steele, (2004). Only strain MRC-DPRU1392, detected in 2009, possessed the P[6] genotype and was also found to be associated with S3 short RNA profile. Other studies that reported the combination of G2 serotype with P[6] genotype (Flores et al, 1986; Griffin et al, 2002; Adah et al, 2006; Lin et al, 2006; Mascarenhas et al, 2006; Clark et al, 2010; Mascarenhas et al, 2010).

The G2P[4] combination detected in this study was consistent with epidemiological studies conducted globally where it was reported that most of the common rotavirus G and P combinations are: G1P[8], G3P[8], G4P[8], G2P[4], G9P[8] and G9P[6] (Gentsch et al, 1996; Koshimura et al, 2000; Santos and Hoshino, 2005). Worldwide unusual combinations exist were P[4] genotype is found to be associated with non G2 serotype, including G8, G9 and G12 associated with short RNA electropherotype (Mwenda et al, 2010; Volatao et al , 2006). From a study conducted by Lin et al (2006), another unique P[4] genotype was noted, the G9P[4] displayed subgroup II specificity, and short RNA electropherotype. In Australia, several rotavirus uncommon strains bearing P[4] and P[6] genotypes have been reported from the 2008\2009 rotavirus surveillance program including six cases of G1P[4], two cases of G4P[4] and a single case of G1P[6] (Kirkwood et al, 2009). Also from an epidemiological study that aimed to assess the burden of rotavirus gastroenteritis in the Middle Eastern and North African paediatric populations, several uncommon genotypes bearing P[4] genotypes have been observed, this included strains bearing (G9P[4], G3P[4], G4P[4] and G8P[4]) combinations (Khoury et al, 2011).

5.5 VP7 (Genomic segment 9) 5.5.1 Identification of three populations of G2 strains over 25 year period During the study period, the nucleotide sequence alignments of VP7 gene reported only three populations of the G2 strains circulating. Therefore, it can be assumed that these three populations of the G2 rotavirus strains were the main etiological agents of these epidemics. The first population of the G2 strains could have been introduced during early 1980s. The strains that were circulating during the 1980s persisted up to 1987, and could have evolved from the same ancestor with the DS-1 prototype which was isolated from the United States in 1976. This is based on the fact that from the nucleotide and amino acid alignments, the strains introduced in 1980s showed similar conserved regions with the DS-1 prototype. The observed conserved regions were at amino acid residues: 1-54, 83-119, 121-156, 171-209, 210-238, 241-290, and 292-309. The second population of the G2 strains can be postulated to have been introduced somewhere in 1996 or 1997 through 2009. This cluster of strains contained regions that were divergent from the cluster introduced by the 1984 strains. The third population is represented by the 1993 strain and it was divergent to both the 1984 and the 1997 strains.

5.5.2 Analysis of mutations on VP7 antigenic regions The four known antigenic regions; A (aa 87-96), B (aa 145-150), C (aa 211-223) and F (aa 235-242) have been previously described as the major rotavirus neutralization sites (Dyall Smith et al, 1986; Kirkwood et al, 1993). Based on this phenomenon, the deduced amino acids sequence alignment of the VP7 protein of the G2 strains detected at Dr George Mukhari Hospital revealed that there is a noticeable variability of the amino acid sequences between the contemporary circulating strains and the strains that were circulating two decades ago. These antigenic regions are also described as immunodominant epitopes mapping neutralizing monoclonal antibodies against the G2 rotavirus strains (Dyall Smith et al, 1986). VP7 protein of the selected G2 strains indicate that all the G2 strains isolated after the 1997 until 2009 shares the same substitution mutations A87T and D96N at antigenic region A. The A87T is a mutation caused by the substitution of alanine by threonine, whereas the D96N mutation is caused by the substitution of aspartic acid by asparagine, both the A87T and D96N mutations occurred at the first base of the codon and were caused by the substitution of guanine by adenine. The A87T and D96N substitution mutations were also reported in a study conducted in the United Kingdom (UK) by Iturriza-Gómara et al (2001) who also

93 reported that the D96N substitution mutation was linked to serotype G2 failure by serological assays (Iturriza-Gómara et al, 2001). Scientifically it has been proved that strains possessing D96N mutation evade the recognition of neutralization monoclonal antibodies by inducing a change in electric charge of the protein and thus result in a conformational change of the epitopes recognized by neutralizing antibodies, therefore meaning that the paratopes on the antibodies cannot bind to the epitopes on the antigens and the virus cannot be neutralized.

From a study conducted by Lazdins et al (1995), the D96N mutation was associated with neutralization-escape mutants. In Napal all the emerging G2 strains from 2004-2005 were characterized by the D96N mutation thus causing the G2 epidemic peak that increased the detection rate from 1% to 33% (Doan et al, 2011). It was also reported in Palermo, Italy during 2002-2004, were the monoclonal antibody specific for G2 strains was not reactive and sequence analysis of this strains also revealed that all possessed D96N mutation (Arista et al, 2005). According to the study conducted in Thailand, it was observed that a group of the G2 strains causing the epidemic peak in 2003 were also characterized to be associated with the D96N substitution (Khamrin et al, 2007; Trinh et al, 2010). In general, the D96N mutation has been considered to be the hallmark of emergence of all the new populations of G2 strains emerging into the rotavirus circulation, in fact, all the rotavirus G2 strains possessing this mutation are believed to re-emerge in peaks into the circulation because they are mutated at antigenic regions that allows them to escape recognition and neutralization by monoclonal antibodies. It is worth mentioning that from a recent study by Doan et al (2011), it was speculated that the rotavirus G2 strains possessing the D96N mutation was first detected in India in 1987 and subsequently increased in the following years and there after it rapidly dominated globally in the 2000s, therefore, it remains tempting to conclude that all the globally circulating G2 strains possess the D96N mutations (Doan et al, 2011).

Previous studies conducted in Australia and United Kingdom have concluded that unlike the D96N mutation, the A87T mutation is not the hallmark of mutation associated with failure to serotype using monoclonal antibodies (Iturriza-Gómara et al, 2001). This has been proved when strains containing both the A87T and D96N mutations were untypeable using monoclonal antibodies while strains possessing only the A87T mutation were typeable. But however even if the A87T mutation does not have an effect in terms of binding to serotype G2 specific monoclonal antibodies, it can be hypothesized to play a role in the re-emergence

94 of the new population of the G2 strains that are also less homologous to the DS-1 prototype. In the present study, all the samples collected from 1997 to 2009 and selected for sequencing displayed A87T mutation. They were typed by genotyping primers specific to the known rotavirus serotypes rather than using monoclonal antibodies. The amino acids sequence alignment have revealed that the 1997-2009 group of study strains possessed A87T and D96N mutations at the antigenic region A. This mutation has also been reported by Iturriza- Gómara et al (2001) and Arista et al (2005) in the UK and Italy respectively. The study strains also revealed N213D substitution which the UK strains did not reveal. From former studies, the N213D mutation was known to be correlated to the reaction with neutralizing monoclonal antibodies (Coulson et al, 1996). In Australia, the N213D mutation has also been linked with cross reactivity of G2 strains isolated with monoclonal antibodies (Iturriza- Gómara et al, 2001). But the study conducted by Arista et al (2005) has proved otherwise.

The Group I strains (1984-1987) did not display A87T and D96N mutations and they appeared to be more similar to the DS-1 strain at antigenic region A, except at antigenic region F which revealed I239V substitution mutation which was caused by the substitution of adenine by guanine on the first base of the codon. The I239V mutation was also reported by (Coulson et al, 1996) from the Hoso virus of G4 strains. Both the first and second G2 population of strains did not display any form of substitutions mutation at antigenic region B, the third G2 population including the 1993 strain GR1831 revealed T147A substitution at region B. The T147A substitution was also present on the 1076 G2 published strain isolated by (Coulson et al, 1996). The T147A substitution was caused by the substitution of adenine by guanine at the first base of the codon which therefore coded for alanine in place of threonine. The A152P substitution was caused by the substitution of guanine by cytosine at the first base of the codon and also substitution of adenine by guanine at the third base which caused the codon to code for proline at the place of alanine. The substitution at the third base did not influence the outcome of the amino acid and it was consistent with the concept of wobble hypothesis.

Analysis of antigenic region C revealed that the 1997 strain and all the 2003-2009 strains contains N213D that was absent when compared to the antigenic region C from all the 1984- 1987 and the 1993 strain. However, the 1993 strain displayed N213S substitution which was also identified previously by (Coulson et al, 1996). This mutation was caused by the substitution of adenine by guanine at the first nucleotide of the codon, which caused the

95 codon to code for aspartic acid at the place of asparagine, the third base of the codon also revealed substitution of cytosine by thymine but it was not the determinant of this mutation (Crick, 1966). The 1993 isolate also displayed both I217T (which was caused by the substitution of thymine by cytosine) and A219S (which was caused by the substitution of guanine by thymine) substitution at antigenic region C. The I217T substitution which was caused by the substitution of guanine by thymine occurred at the second base of the codon which resulted in the translation of threonine at the place of isoleucine, while the A219S substitution occurred at the first base of the codon which resulted in the translation of serine in the place of alanine. The analysis of antigenic region F revealed that all the strains isolated before 1997 displayed I239V, while the strains that were isolated after 1997, excluding the 1993 strain revealed N242S at antigenic region F, however, this substitution was absent in one strain from 2008 (MRC-DPRU1057) one strain from 2007 (MRC-DPRU1793) and also one strain from 2009 (MRC-DPRU140). The I239V substitution was caused by the substitution of alanine by guanine at the first base of the codon which led to the translation of valine at the place of isoleucine. The N242S substitution was caused by the substitution of alanine by guanine at the second base of the codon leading to the translation of serine at the place of asparagine. Although the N242S mutation was prevalent in the 1997 and all the 2003-2009 strains, it was also observed on the 1993 (MRC-DPRU1831) strain.

5.5.3 Analysis of glycosylation sites on VP7 protein The analysis of the glycosylation site has revealed that four of Group I strains (GR1296, GR410, GR659 and GR1831) isolated in 1984, 1985, 1986 and 1993 respectively had N69D mutation that resulted in the abolition of this site, but within the Group I strains, the two strains isolated in 1987 did not display this mutation and they were conserved with the Group I (1997) and the Group II (1997-2009) strains at this site. Glycosylation at this site was speculated to be involved in preventing the binding of certain rotavirus-specific antibodies in the human immune system thereby enabling these G2 strains to infect susceptible infants (Page and Steele, 2004). Further analysis of the glycosylation sites have revealed that almost all the strains were conserved at residue 147, except the 1993 strain GR1831 which displayed T147A mutation. All the strains were conserved at region 238-240.

5.5.4 Analysis of proline and cysteine residues on the VP7 protein The amino acids alignment of these G2 strains was also compared to those reported by Zao et al (1999) for the conservation of the proline residues at amino acid positions (46, 58, 86, 112, 131, 167, 197, 254, 266, 275 and 279) and it was interesting to note that all the proline residues were found to be conserved in all the study strains. Also, when comparing the cysteine residues of this G2 strains it was found that the strains were conserved in most of the locations. These conserved proline and cysteine residues indicate that the basic structural features of all the study strains are similar. However, few exceptions were noted from three strains that all belonged to the Group I, this included one strain (GR405) isolated in 1987, which displayed a C81W substitution and two strains (GR410) and (GR1296) which were isolated in 1985 and 1984, respectively. The 1985 strain displayed C165F substitution and the 1984 strain displayed a C191F substitution. None of the Group II strains were found to display a substitution on a cysteine residue.

5.5.5 Assessment of variability of G2 strains over time and phylogenetic analysis Currently, there are five different phylogenetic lineages of G2 rotavirus strains that have been identified worldwide (Paul et al, 2008). The phylogenetic analysis of the G2 strains have revealed that over the past 25 years in South Africa at the Dr George Mukhari Hospital three distinctive lineages were infecting the population. The nucleotide and deduced amino acids sequence alignment and subsequent phylogenetic analysis allowed the 1984-1987 strains to be grouped together with the DS-1 prototype, accession number (AF044360) under G2 strains lineage 1. The 1993 strain belonged to lineage 2, and all the 1997-2009 strains belonged to lineage 5c, and they were grouped with the following strains: J-4787 (DQ904511) and KO-2 (AF401754) from Japan, KY3103 (AY261349) from Kenya, TE65 (AF106295) from Thailand and PT96 (AY261342), JHB4372 (AY261346) from South Africa. None of the study strains belonged to lineage 3 or lineage 4. Regarding lineage 2, it was interesting to note that the 1993 strain was also grouped on the same cluster with other G2 strains from South Africa [Port Elizabeth, PE7 (AY261339) and Stellenbosch, SB906 (AY261347)]. This confirms the third population of the G2 rotavirus strains that were circulating at the Dr George Mukhari Hospital. There is high possibility that the strains were probably the predominant genotypes circulating during that period, unfortunately only one sample was selected for sequencing.

In the current study, it was noticed that the difference in G2 lineages is based on amino acid residue 87 and 96 from antigenic region A (87-101), residue 213 from antigenic region C (208-221) and residue 242 from antigenic region F (233-242) which are regarded as potential epitopes for the G2 strains (Dyall-Smith et al, 1986; Doan et al, 2011). The Group I (1984- 1987) strains are grouped in lineage 1 because they are conserved with the DS-1 prototype at the antigenic regions. The 1993 strain is clustered in lineage 2 because it displayed N213S and N242S at antigenic regions C and F, respectively. The Group I (1997) and Group II (2003-2009) strains are clustered in lineage 5c because they display A87T and D96N substitutions at antigenic regions A, furthermore they display N213D and N242S substitutions at antigenic region C and F, respectively. Strains in lineage 3 display A87T and D96T substitutions at antigenic region A, antigenic C is conserved but they display N242S substitution at antigenic region F. Strains in Lineage 4 are conserved at antigenic region A, but they display N213D and N242S at antigenic region C and F, respectively. Strains in lineage 5a display A87T and D96N at antigenic region A, N213D and N242S at antigenic region F, respectively. Strains in Lineage 5b display A87T and D96N substitutions at

98 antigenic region A, N213D at antigenic region C while antigenic region F is conserved. The 1984-1987 strains which belonged to lineage 1 seem to be no longer circulating at the Dr George Mukhari Hospital and also in many geographical locations worldwide. Although the (1997-2009) G2 strains were not detected annually each time they reappeared their sequences were highly homologous. Therefore, it can be postulated that the serotype G2 strains has shown less variability over time. It can also be hypothesized that serotype G2 appeared after every 3- 4 years because of its natural pattern of occurrence in the rotavirus circulation. But in some instants the rotavirus G2 strains emerge in the circulation because of the introduction of new mutations that aid the virus to escape the effect of the immune system.

In a study conducted by Zao et al (1999) from Taiwan, it was indicated that the strains that caused the 1993 peak were characterized by the D96N substitution. This was after the G2 strains were detected in very low rates from 1981 to 1987 and also almost completely undetected from 1987 to 1992. Therefore, it can be hypothesized that the D96N mutation evolved as a response of the rotavirus to combat the pressure mounted by the immune system and subsequently leading to emergent rotavirus G2P[4] strains. Also to support this hypothesis, the recent study by Doan et al (2011) has also indicated that in Nepal all the emerging rotavirus G2 strains had the same type of mutation, which was the substitution from aspartic acid to asparagine at residue 96 (D96N) (Doan et al, 2011).

5.6 VP4 (genomic segment 4) 5.6.1 Investigation of genetic profiles The rotavirus outer capsid protein is composed of two significant proteins (VP7 and VP4) that induce neutralizing monoclonal antibodies. Before the initiation of the recent new nomenclature of classification, rotavirus classification was based on VP7 and VP4 (binary classification). Based on this relationship, it is always imperative to study both the VP7 and the VP4 concurrently when conducting studies aiming to analyse the sequence of either one of these genes. Therefore, in the current study one representative VP4 gene from 2003-2009 have been sequenced in order to investigate the genetic profiles of this gene as well as to identify sequential mutations associated with this gene. VP4 gene is known as a hemagglutinin and its cleavage is associated with enhanced infectivity and the ability of the virus to replicate in tissue culture (Lopez and Arias, 1987).

VP4 gene is coded by genome segment 4 which is a nonglycosylated outer capsid structural protein that need to be cleaved by trypsin into VP5* and VP8* to become infectious. Therefore, the virulence of a rotavirus particle can be attributed to the VP4 gene (Offit et al, 1986b). The rotavirus infectivity is dependent on the trypsin cleavage sites of the VP4 gene which are amino acids residue 241 and 247, resulting in products of 247 amino acid (VP8*) and 529 amino acids (VP5*). In the current study, only the VP8 gene was analysed because the primers [Con 2 and Con 3 (Gentsch et al, 1992)] used were specific for amplification of an 873 nucleotide coding for the VP8 gene only. Sequence analysis has revealed that all the VP4 genes analysed in this study were conserved at both the trypsin cleavage sites, except the 2009 strain (MRC-DPRU140) which was not conserved at trypsin cleavage position 247; this strain revealed A247V substitution. These results might mean that the strains were isolated from symptomatic infections hence inability to cleave the VP4 gene is associated with loss of virulency of the virus. None of the proteins was composed of a cysteine residue at position 203 as reported by Gorziglia et al (1986) that RRV and SA11 strains contain cysteine at this position whereas all human strains lack this residue (Gorziglia et al, 1986). The S133I substitution displayed by a 2003 strain (MRC-DPRU594) and the T169H displayed by a 2004 strain (MRC-DPRU431) may confirm that even though these strains shared long conserved regions from their VP7 and VP4 genes, they are different. In an epidemic infection where one strain is reported it is always imperative to analyse both the VP7 and the VP4 genes in order to investigate whether the epidemic was caused by only a single strain or many different strains. However, only full genome analysis can give us enough information whether only one strain was circulating or not.

5.7 VP6 Protein 5.7.1 Phylogenetic analysis and investigation of genetic profiles The VP6 gene of the samples from 2003-2009 was also analysed in this study in order to characterize the VP6 gene. VP6 is a major determinant of group and subgroup specificity (Estes, 2001). The VP6 gene was characterised by sequencing and by RFLP. The analysis of the amino acids sequence alignment has revealed that the VP6 proteins of the study strains are highly conserved. Amino acid residue 305 and the region between residue 296 and 299 are known to contain specific epitopes determining subgroup I specificity while residue 315 contains epitopes determining subgroup II specificity (Lopez et al, 1994; Tang et al, 1997). None of the study strains possessed a mutation at the region 296 to 299, however residue 305

100 was not obtained, and these results might also indicate that all these strains belongs to subgroup I. From the phylogenetic tree, all the study samples were classified under VP6 genotype I2. This was very interesting because it is known from the new classification of rotavirus that most of the G2P[4] strains are classified under I2, unless if the strain has undergone reassortment with another strain that is not in the DS-1 genogroup (Matthijnssens et al, 2011).

5.7.2 RFLP analysis

From the nine samples that were selected for characterisation of the VP6 gene by RFLP with AciI enzyme, the resulting restriction patterns were indistinguishable and consistent with one another, revealing that the VP6 gene of the selected study samples is conserved and also share a great homology at the nucleotide level. None of the samples displayed restriction digest fragments. This is in line with other studies that also reported that the VP6 of the DS-1 genogroup has got no restriction site to the AciI enzyme (Iturriza-Gómara et al, 2002b). These results also indicate that none of these samples had a mutation that introduced a restriction site to the AciI enzyme. These results are imperative because on a short scale it can be presumed that the VP6 gene of the G2 strains is free of mutations at the AciI enzyme binding sites. However, a larger sample size is required in order to justify this idea. Analysis of VP6 by RFLP is important because it provide a more reliable method for the characterization of VP6 than subgrouping ELISAs, and therefore aid in avoiding the misclassification of subgroup II rotaviruses as subgroup I +II or subgroup non I/non II.

5.8 Implication of study finding to rotavirus vaccine efficacy With time the RotaTeq™ vaccine can be less efficacious against the currently circulating rotavirus strains because of several possible reasons; 1) The vaccine was derived from parental strains that were isolated 20 years ago which are no longer circulating today. 2) Based on the analyses of antigenic regions it is highly tempting to stipulate that the antigenic epitopes of RVA strains contained in the vaccines differ substantially from those of the emerging strains. 3) The fact that the vaccine strains belongs to lineage 2 while almost all the currently circulating strains belongs to lineage 4 and 5 means that gradually homology is lost between the vaccine strain and the contemporary strains. Similar findings has been reported

101 in Belgium by Zeller et al (2012) that the currently circulating Belgian G3 RVA strains possessed an extra N-linked 45 glycosylation site which was completely absent in the vaccine strain of G3 serotype of RotaTeq™ (Zeller et al, 2012). Therefore, Zeller et al (2012) concluded that these results clearly indicate that since the antigenic epitopes of strains contained in the vaccines differ significantly from those of the currently circulating strains in Belgium, it is highly possible that with time these differences might result in selection for strains that escape the neutralizing-antibody pressure induced by vaccines.

102

CHAPTER 6: CONCLUSIONS

6.1 Conclusions The most common rotavirus genotype combination are G1P[8],G2P[4],G3P[8] and G9P[8]. Among them, genotype G2P[4] displays a unique pattern of circulation and it can sometimes be absent in a population during rotavirus seasons. It has been properly documented that the distribution of the rotavirus genotypes is unpredictable and any strain can circulate at any given time. The G2 strains has shown remarkable occurrence in many geographical locations at given time periods; these strains occur in peaks are sometimes absent from the population during the rotavirus season. When the G2 strains re-emerge in a particular population, they re-emerge because of their natural pattern of circulation or because they acquired a particular point mutation on the antigenic regions that enables them to escape the immune system (adaptation and escape from selection pressure).

In the current study, the G2 strains were observed to have undergone natural variation overtime. The strains that were circulating during the 1980s and the 1990s are highly homologous to the DS-1 prototype at the antigenic sides, suggesting that these strains might be sharing common ancestry. It can also be deduced that the strains similar to the 1980s and the 1990s are no longer circulating, hence the current G2 strains seems to have drifted and displays a significant variation to the former strains. These deductions should always be considered with caution and only a broader sample size would helped us to achieve extensive insights. The contemporary strains have undergone substitution mutations at the antigenic regions, where they revealed A87T and D96N substitutions. Also from global point of view most of the current G2 strains are also characterized by these amino acid substitutions, the G2 strains displaying the A87T and D96N substitutions were previously documented to be untypeable by monoclonal antibodies. The current study strains revealed less genetic variability on the genome segment 4, hence phylogenetic analysis of the study strains allowed all the study strains to be clustered under lineage 5. However, genome segment 4 analysis should be interpreted with caution since the samples analysed were only collected from 2003- 2009.

103

The current G2 strains are characterized by subgroup 1 specificity and VP6 genotype I2, subsequently they revealed no genetic variability/polymorphism on genome segment 6 and hence nucleotide sequence analysis has revealed that all the selected study strains are highly conserved. It has been already documented that VP6 is the most abundant and conserved protein of the virus. It is not a surprise to learn that no intratypic variation was observed among the study strains. The VP6 remains the best candidate for rotavirus diagnostics and serological assays. Genetic stability of the gene encoding the VP6 protein is mediated by the fact that the protein is located on the inner capsid and therefore is not directly challenged by antibodies. The outer proteins, VP4 and VP7 are directly exposed to the neutralization antibodies and are most likely to undergo substantial genetic variation to adapt and succumb the immune pressure. Several studies have already suggested that the rotavirus genome is associated with a drastic genetic modification enhancing continuous evolution of novel strains with enhanced antigenic variability. Over and above that, since the virus has an RNA genome, it has no proof reading activity during replication. This facilitates production of distinct antigenic variants during replication. Also because of the segmented nature of the genome the virus can also undergo antigenic drift, shift and recombination.

6.2 Limitations  In the current study, the samples from 1984-1997 were not fully characterized since they were depleted. Therefore, only their genome segment 9 sequences were used for comparative analysis. Their PAGE RNA profiles are not known, their genome segment 4 and genome segment 6 were not studied as well.  Sequencing was done using the traditional Sanger sequencing. The sequences were difficult to interpret at the 5’ and the 3’ terminus because they formed junks. Better results would have been yielded if pyrosequencing was used, pyrosequencing can generate more genome data.  Because of cost, not all the 36 samples from 2003-2009 were selected for sequencing. RFLP was also done on few of the samples.  Demographic data of the patients from which the samples were collected is missing

104

6.3 Recommendations  Pyrosequencing should always be used in studies aiming to perform molecular characterization of rotavirus genome segments.  A broader sample size should always be used when conducting this kind of study, were we are aiming at investigating the genetic evolution of the strains.  The study area (site) should be expanded to include at least half a country in order to monitor all the different clusters of the G2 strains in the country and investigate their variability at the antigenic regions (this will help us to detect if there are any strains that acquired genetic variability at the antigenic sites that aid them to escape immunity conferred by the vaccine induced antibodies).  Since methods for detecting natural selection are available, they should be used in studies like this in order to determine the kind of natural selection forces that causes the evolution of the G2 strains.  The noted substitutions at the antigenic sites might also be accompanied by reassortment; therefore, it is imperative to perform full genome analysis in order to study genetic variability of the other genes.  Since inception of the two rotavirus vaccines, a continuous surveillance of the G2 strains should be maintained in order to identify any amino acids substitutions that are correlated with vaccine escape mutants.

105

CHAPTER 7: REFERENCES

1. Afrikanova I, Miozzo MC, Giambiagi S, Burrone O (1996). Phosphorylation generates different forms of rotavirus NSP5. Journal of General Virology, 77, 2059- 2065. 2. Adah MI, Rohwedder A, Olaleye OD, Werchau H (1996). Sequence analysis of VP7 gene of two Nigerian rotavirus strains. Acta Virologica, 40,187-193. 3. Adah MI, Wade A, Taniguchi K (2006). Molecular epidemiology of rotaviruses in Nigeria: detection of unusual strains with G2P[6] and G8P[1] specificities. Journal of Clinical Microbiology, 39, 3969- 3975. 4. Adams WR and Kraft LM (1963). Epizootic diarrhea of infant mice: Identification of the etiologic agent. Science, 141, 359-360. 5. Ahmed K, Ahmed S, Mitui MT, Rahman A, Kabir L, Hannan A, Nishizono A, Nakagomi O (2010). Molecular characterization of VP7 gene of human rotaviruses from Bangladesh. Virus Genes, 40, 347-356. 6. Aladin F, Nawaz S, Iturriza-Gómara M, Gray J (2010). Identification of G8 rotavirus strains determined as G12 by rotavirus genotyping PCR: updating the current genotyping methods. Journal of Clinical Virology, 47, 340-344. 7. Alam NH and Ashraf H (2003). Treatment of infectious diarrhea in children. Paediatrics Drugs, 5, 151-165. 8. Allan AM and Desselberger U (1985). Reassortment of human rotaviruses carrying rearranged genomes with bovine rotavirus. Journal of General Virology, 66, 2703- 2714. 9. Altenburg BC, Graham DY, Estes M (1980). Ultrastractural study of rotavirus replication in cultured cells. Journal of General Virology, 46, 75-85. 10. Anderson EJ and Weber SG (2004). Rotavirus infection in adults. Lancet Infectious Diseases, 4, 91-99. 11. Arias CF, Isa P, Guerrero CA, Mendez E, Zarate S, Lopez T, Espinosa R, Romero P, Lopez S (2002). Molecular biology of rotavirus cell entry. Archives of Medical Research, 33, 356-361.

106

12. Arista S, Giammanco GM, De Grazia S, Colomba C, Martella V, Cascio A, Iturriza- Go`mara M (2005). G2 rotavirus infections in an infantile population of the South of Italy: variability of viral strains over time. Journal of Medical Virology, 77, 587-594. 13. Armah GE, Steele AD, Binka FN, Esona MD, Asmah RH, Anto F, Brown D, Green J, Cutts F, Hall A (2003). Changing patterns of rotavirus genotypes in Ghana: emergence of human rotavirus G9 as a major cause of diarrhea in children. Journal of Clinical Microbiology, 41, 2317-2322. 14. Armah GE, Sow SO, Breiman RF, Dallas MJ, Tapia MD, Feikin DR, Binka FN, Steele AD, Laserson KF, Ansah NA, Levine MM, Lewis K, Coia ML, Attah-Poku M, Ojwando J, Rivers SB, Victor JC, Nyambane G, Hodgson A, Schödel F, Ciarlet M, Neuzil KM (2010). Efficacy of pentavalent rotavirus vaccine against severe rotavirus gastroenteritis in infants in developing countries in sub-Saharan Africa: a randomised, double-blind, placebo-controlled trial. Lancet, 376, 606-614. 15. Baker M and Prasad BV (2010). Rotavirus cell entry. Current Topics in Microbiology and Immunology, 343, 121-148. 16. Ballard A, McCrae MA, Desselberger U (1992). Nucleotide sequences of normal and rearranged RNA segments 10 of human rotaviruses. Journal of General Virology, 73, 633-638. 17. Barro M and Patton JT (2007). Rotavirus NSP1 inhibits expression of type I interferon by antagonizing the function of interferon regulatory factors IRF3, IRF5, and IRF7. Journal of Virology, 81, 4473-4481. 18. Bergmann CC, Maass D, Poruchynsky M, Atkinson PH, Bellamy AR (1989). Topology of the non-structural rotavirus receptor glycoprotein NS28 in the rough endoplasmic reticulum. EMBO Journal, 8, 1695-1703. 19. Bernstein DI, Sander DS, Smith VE, Schiff GM, Ward RL (1991). Protection from rotavirus reinfection: 2-year prospective study. Journal of Infectious Diseases, 164, 277-283. 20. Bican P, Cohen J, Charpilienne A, Scherrer R (1982). Purification and characterization of bovine rotavirus cores. Journal of Virology, 43, 1113-1117. 21. Bishop RF (1996). Natural history of human rotavirus infection. Archives of Virology Supplement, 12, 119-128. 22. Bishop RF, Davidson GP, Holmes IH, Ruck RJ, Goller I, Townley RRW (1973). Virus particles in epithelial cells of duodenal mucosa from children with acute non- bacterial gastroenteritis. Lancet, 2, 1281-1283.

107

23. Blackhall J, Munoz M, Fuentes A, Magnusson G (1998). Analysis of rotavirus nonstructural protein NSP5 phosphorylation. Journal of Virology, 72, 6398-6405. 24. Both GW, Siegman LJ, Bellamy AR, Ikegami N, Shatkin AJ, Furuichi Y (1984). Comparative sequence analysis of rotavirus genomic segment 6-the gene specifying viral subgroups 1 and 2. Journal of Virology, 51, 97-101. 25. Brandt CD, Kim HW, Rodriguez WJ, Thomas L, Yolken RH, Arrobio JO, Kapikian AZ, Parrott RH, Chanock RM (1981). Comparison of direct electron microscopy, immune electron microscopy, and rotavirus enzyme-linked immunosorbent assay for detection of gastroenteritis viruses in children. Journal of Clinical Microbiology, 13, 976-981. 26. Burns JW, Siadat-Pajouh M, Krishnaney AA, Greenberg HB (1996). Protective effect of rotavirus VP6-specific IgA monoclonal antibodies that lack neutralizing activity. Science, 272, 104-107. 27. Cameron DJ, Bishop RF, Veenstra AA, Barnes GL (1978). Noncultivable viruses and neonatal diarrhea: fifteen-month survey in a newborn special care nursery. Journal of Clinical Microbiology, 8, 93-98. 28. CDC (2007). Postmarketing monitoring of intussusception after RotaTeq vaccination- United States, February 1, 2006-February 15, 2007. Morbidity and Mortality Weekly Report, 56, 218-222. 29. CDC (1999). Rotavirus vaccine for the prevention of rotavirus gastroenteritis among children. Morbidity and Mortality Weekly Report, 48, 1-20. 30. Crick F (1966). Codon–anticodon pairing: the wobble hypothesis. Journal of Molecular biology, 19, 548-555. 31. Christy C, Madore HP, Pichichero ME, Gala C, Pincus P, Vosefski D, Hoshino Y, Kapikian A, Dolin R (1988). Field trial of rhesus rotavirus vaccine in infants. Pediatrics Infectious Diseases Journal, 7, 645-650. 32. Chrystie IL, Totterdell BM, Banatvala JE (1978). Asymptomatic endemic rotavirus infections of the newborn. Lancet, 311, 1176-1178. 33. Clark HF, Lawley D, Di Stefano D, Maliga M, Kilby B, Kulnis G, Mallette L, Di Nubile MJ (2010). An unusual outbreak of rotavirus genotype G2P[6] during the 2005-2006 epidemic season in Philadelphia. Diagnostic Microbiology and Infectious Diseases, 70, 218-222. 34. Clark HF, Offit PA, Ellis RW, Eiden JJ, Krah D, Shaw AR, Pichichero M, Treanor JJ, Borian FE, Bell LM, Plotkin SA (1996). The development of multivalent bovine

108

rotavirus (strain WC3) reassortant vaccine for infants. Journal of Infectious Diseases, 174, 73-80. 35. Claude MF, Maniloff J, Desselberger U (2005).Virus taxonomy: classification and nomenclature of viruses: 8th report of the International Committee on Taxonomy of Viruses. 36. Coulson BS (1987).Variation in neutralization epitopes of human rotaviruses in relation to genomic RNA polymorphism. Virology, 159, 209-216. 37. Coulson BS and Kirkwood C (1991). Relation of VP7 amino acid sequence to monoclonal antibody neutralization of rotavirus and rotavirus monotype. Journal of Virology, 65, 5968-5974. 38. Coulson BS, Kirkwood CD, Masendycz PJ, Bishop RF, Gerna G (1996). Amino acids involved in distinguishing between monotypes of rotavirus G serotypes 2 and 4. General Virology, 77, 239-245. 39. Cunliffe NA, Gondwe JS, Broadhead RL, Molyneux ME, Woods PA, Bresee JS, Glass RI, Gentsch JR, Hart CA (1999). Rotavirus G and P types in children with acute diarrhea in Blantyre, Malawi, from 1997 to 1998: predominance of novel P[6]G8 strains. Journal of Medical Virology, 57, 308-312. 40. Cunliffe NA, Gondwe JS, Kirkwood CD, Graham SM, Nhlane NM, Thindwa BD, Dove W, Broadhead RL, Molyneux ME, Hart CA (2001). Effect of concomitant HIV infection on presentation and outcome of rotavirus gastroenteritis in Malawian children. Lancet, 358, 550-555. 41. Cunliffe NA, Ngwira BM, Dove W, Thindwa BD, Turner AM, Broadhead RL, Molyneux ME, Hart CA (2010). Epidemiology of rotavirus infection in children in Blantyre, Malawi, 1997-2007. Journal of Infectious Diseases, 202, 168-174. 42. Bernstein DI (2009). Rotavirus Overview. Pediatrics Infectious Diseases Journal, 28, 50-53. 43. De Mol P, Zissis G, Butzler JP, Mutwewingabo A, André FE (1986). Failure of live, attenuated oral rotavirus vaccine. Lancet, 12, 108. 44. Dennehy PH (2000). Transmission of rotavirus and other enteric pathogens in the home. Pediatrics Infectious Diseases Journal, 19, 103-105. 45. Desselberger U (1996). Genome rearrangements of rotaviruses. Advances in Virus Research, 46, 69-95. 46. Desselberger U, Manktelow E, Li W, Cheung W, Iturriza-Gómara M, Gray J (2009). Rotaviruses and rotavirus vaccines. British Medical Bulletin, 90, 37-51.

109

47. Doan Y H, Nakagomi T, Cunliffe N A, Pandey B D, Sherchand J B, Nakagomi O (2011). The occurrence of amino acid substitutions D96N and S242N in VP7 of emergent G2P[4] rotaviruses in Nepal in 2004-2005: a global and evolutionary perspective. Archieves of Virology, 156, 1969-1978. 48. Duggan C, Santosham M, Glass RI (1992). The management of acute diarrhea in children: oral rehydration, maintenance, and nutritional therapy. Morbility and Mortality Weekly Report, 41, 1-20. 49. Dyall-Smith M L, Lazdins I, Tregear G W, Holmes I H (1986). Location of the major antigenic sites involved in rotavirus serotype specifc neutralization. Proceedings of the National Academy of Sciences of the United States of America, 83, 3465-3468. 50. Esteban LE, Rota RP, Gentsch JR, Jiang B, Esona M, Glass RI, Glikmann G, Castello AA (2010). Molecular epidemiology of group A rotavirus in Buenos Aires, Argentina 2004–2007: reemergence of G2P[4] and emergence of G9P[8] strains. Journal of Medical Virology, 82, 1083-1093. 51. Estes M K (2001). Rotaviruses and their replication. In: Fields Virology, 2, pp, 1747- 1785. 52. Estes M, Desselberger U, Ray J (2003). The rotavirus NSP4 enterotoxin current status and challenges. Perspectives in Medical Virology, 9, 207-224. 53. Estes MK, Graham DY, Ramig RF, Ericson BL (1982). Heterogenicity in the structural glycoprotein (VP7) of simian rotavirus SA11 .Virology, 122, 8-14. 54. Estes MK and Kapikian AZ (2007). Rotaviruses In: Fields Virology 5thedition, 2, pp, 1917-1974. 55. Fang ZY, Ye Q, Ho MS, Dong H, Qing S, Penaranda ME, Hung T, Wen L, Glass RI (1989). Investigation of an outbreak of adult diarrhea rotavirus in China. Journal of Infectious Diseases, 160, 948-953. 56. Feng N, Sen A, Nguyen H, Vo P, Hoshino Y, Deal E M, Greenberg H B (2009). Variation in antagonism of the interferon response to rotavirus NSP1 results in differential infectivity in mouse embryonic fibroblasts. Journal of Virology, 83, 6987- 6994. 57. Fischer TK, Bresee JS, Glass RI (2004). Rotavirus vaccines and the prevention of hospital-acquired diarrhea in children. Vaccine, 22, 49-54. 58. Flores J, Boeggeman E, Purcell RH, Sereno M, Perez I, White L, Wyatt RG, Chanock RM, Kapikian AZ (1983). A dot hybridisation assay for detection of rotavirus. Lancet, 12, 555-558.

110

59. Flores J, Midthun K, Hoshino Y, Green K, Gorziglia M, Kapikian AZ, Chanock RM (1986). Conservation of the fourth gene among rotaviruses recovered from asymptomatic newborn infants and its possible role in attenuation. Journal of Virology, 60, 972-979. 60. Flores J, Perez I, White L, Perez M, Kalica AR, Marquina R, Wyatt RG, Kapikian AZ, Chanock RM (1982). Genetic relatedness among human rotaviruses as determined by RNA hybridization. Infectious Immunology, 37, 648-655. 61. Flores J, Taniguchi K, Green K, Perez-Schael I, Garcia D, Sears J, Urasawa S, Kapikian AZ (1988). Relative frequencies of rotavirus serotypes 1, 2, 3, and 4 in Venezuelan infants with gastroenteritis. Journal of Clinical Microbiology, 26, 2092- 2095. 62. Fresco LD and Buratowski S (1994). Active site of the mRNA-capping enzyme guanyltransferase from saccharomyces cerevisiae: similarity to the nucleotidyl attachment motif of DNA and RNA ligases. Proceedings of the National Academy of Sciences of the United States of America, 91, 6624-6628. 63. Fun BN, Unicomb L, Rahim Z, Banu N N, Podder G, Clemens J, Van Loon F P, Rao M R, Malek A,Tzipori S (1991). Rotavirus-associated diarrhea in rural Bangladesh: two-year study of incidence and serotype distribution. Journal of Clinical Microbiology, 29, 1359-1363. 64. Gardet A, Breton M, Fontanges P, Trugnan G, Chwetzoff S (2006). Rotavirus spike protein VP4 binds to and remodels actin bundles of the epithelial brush border into actin bodies. Journal of Virology, 80, 3947-3956. 65. Gentsch J R, Glass R I, Woods P, Gouvea V, Gorziglia M, Flores J, Das B K, Bhan M K (1992). Identification of group A rotavirus gene 4 types by polymerase chain reaction. Journal of Clinical Microbiology, 30, 1365-1373. 66. Gentsch JR, Laird AR, Bielfelt B, Griffin DD, Banyai K, Ramachandran M, Jain V, Cunliffe NA, Nakagomi O, Kirkwood CD, Fischer TK, Parashar UD, Bresee JS, Jiang B, Glass RI (2005). Serotype diversity and reassortment between human and animal rotavirus strains: implications for rotavirus vaccine programs. Journal of Infectious Diseases, 192, 146-159. 67. Gentsch JR, Woods PA, Ramachandran M, Das BK, Leite JP, Alfieri A, Kumar R (1996). Review of G and P typing results from a global collection of rotavirus strains: implications for vaccine development. Journal of Infectious Diseases, 174, 30-36. 68. Georges-Courbot MC, Monges J, Siopathis MR, Roungou JB, Gresenguet G, Bellec

111

L, Bouquety JC, Lanckriet C, Cadoz M, Hessel L (1991). Evaluation of the efficacy of a low-passage bovine rotavirus (strain WC3) vaccine in children in Central Africa. Research in Virology, 142, 405-411. 69. Gershon MD (1999). Endothelin and the development of the enteric nervous system. Clinical and Experimental Pharmacology and Physiology, 26, 985-988. 70. Glass RI, Breese JS, Parashar UD (2005). Rotavirus vaccines: past, present, and future. Archives de Pediatrie, 12, 844-847. 71. Goto T, Kimura H, Numazaki K, Akiyama M, Kato M, Noda M, Nozaki Y, Tanaka- Taya K, Taniguchi K, Yamagata T, Nishio O, Oogane T, Momoi MY, Okabe N (2007). A case of meningoencephalitis associated with G1P[8] rotavirus infection in a Japanese child. Journal of Infectious Diseases, 39, 1067-1070. 72. Gorziglia M, Green K, Nishikawa K, Taniguchi K, Jones R, Kapikian AZ, Chanock RM (1988). Sequence of the fourth gene of human rotaviruses recovered from asymptomatic or symptomatic infections. Journal of Virology, 62, 2978-2984. 73. Gorziglia M, Hoshino Y, Buckler-White A, Blumentals I, Glass R, Flores G, Kapikian A Z, Chanock M R (1986). Conservation of amino acid sequence of VP8 and cleavage region of 84-kDa outer capsid protein among rotaviruses recovered from asymptomatic neonatal infection. Proceedings of the National Academy of Sciences, 83, 7039-7043. 74. Gouvea V, de Castro L, Timenetsky MC, Greenburg H, Santos N (1994). Rotavirus serotype G5 associated with diarrhea in Brazilian children. Journal of Clinical Microbiology, 32, 1408-1409. 75. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B, Fang ZY (1990). Polymerase chain reaction amplification and typing of rotavirus nucleic acids from stool specimens. Journal of Clinical Microbiology, 28, 276-282. 76. Gouvea V and Santos N (1999). Detection and characterization of novel rotavirus strains in the United States. Journal of Clinical Microbiology, 37, 2385-2386. 77. Graham DY, Dufour GR, Estes MK (1987). Minimal infective dose of rotavirus. Archives of Virology, 92, 261-271. 78. Greenberg HB and Estes MK (2009). Rotavirus: from pathogenesis to vaccination. Gastroenterology, 136, 1939-1951. 79. Greenberg HB, Flores J, Kalica AR, Wyatt RG, Jones R (1983a). Gene coding assignments for growth restriction, neutralization and subgroup specificities of the Wa and DS-1 strains of human rotavirus. Journal of General Virology, 64, 313-320.

112

80. Greenberg HB, Valdesuso J, van Wyk K, Midthum K, Walsh M, McAuliffe V, Wyatt RG, Kalica AR, Flores J, Hoshino Y (1983b). Production and preliminary characterization of monoclonal antibodies directed at two surface proteins of rhesus rotavirus. Journal of Virology, 2, 267-275. 81. Griffin DD, Nakagomi T, Hoshino Y, Nakagomi O, Kirkwood CD, Parashar UD, Glass RI, Gentsch JR (2002). Characterization of nontypeable rotavirus strains from the United States: identification of a new rotavirus reassortant (P2A[6]G12) and rare P3[9] strains related to bovine rotaviruses. Virology, 294, 256-269. 82. Gurgel RG, Bohland AK, Vieira SC, Oliveira DM, Fontes PB, Barros VF, Ramos MF, Dove W, Nakagomi T, Nakagomi O, Correia JB, Cunliffe N, Cuevas LE (2009). Incidence of rotavirus and all-cause diarrhea in northeast Brazil following the introduction of a national vaccination program. Gastroenterology, 137, 1970-1975. 83. Gusmão RH, Mascarenhas JD, Gabbay YB, Lins-Lainson Z, Ramos FL, Monteiro TA, Valente SA, Fagundes-Neto U, Linhares AC (1999). Rotavirus subgroups, G serotypes, and electrophoretypes in cases of nosocomial infantile diarrhoea in Belém, Brazil. Journal of Tropical Pediatrics, 45, 81-86. 84. Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98. 85. Hernandez F, Monge R, Jimenez C, Taylor L (1997). Rotavirus and hepatitis A virus in market lettuce (Latuca sativa) in Costa Rica. International Journal of Food Microbiology, 37, 221-223. 86. Herring AJ, Inglis NF, Ojeh CK, Snodgrass DR, Menzies JD (1982). Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. Journal of Clinical Microbiology, 16, 473-477. 87. Hoshino Y and Kapikian AZ (2000). Classification and importance in rotavirus epidemiology, immunity and vaccine development. Journal of Health Population and Nutrition, 18, 5-14. 88. Hoshino Y, Saif LJ, Sereno MM, Chanock RM , Kapikian AZ (1988). Infection immunity of piglets to either VP3 or VP7 outer capsid protein confers resistance to challenge with a virulent rotavirus bearing the corresponding antigen. Journal of Virology, 3, 744-748. 89. Hoshino Y, Sereno MM, Midthun K, Flores J, Kapikian AZ, Chanock RM (1985). Independent segregation of two antigenic specificities (VP3 and VP7) involved in neutralization of rotavirus infectivity. Proceedings of the National Academy of

113

Sciences, 82, 8701-8704. 90. Hrdy DB (1987). Epidemiology of rotaviral infection in adults. Reviews of Infectious Diseases, 9, 461-469. 91. Hundley F, McIntyre M, Clark B, Beards G, Wood D, Chrystie I, Desselberger U (1987). Heterogeneity of genome rearrangements in rotaviruses isolated from a chronically infected immunodeficient child. Journal of Virology, 61, 3365-3372. 92. Isa P, Arias CF, López S (2006). Role of sialic acids in rotavirus infection. Glycoconjugate Journal, 23, 27-37. 93. Iturriza Gomara M, Cubitt D, Desselberger U, Gray J (2001). Amino acid substitution within the VP7 protein of G2 rotavirus strains associated with failure to serotype. Journal of Clinical Microbiology, 39, 3796-3798. 94. Iturriza-Gómara M, Green J, Brown DW, Ramsay M, Desselberger U, Gray JJ (2000). Molecular epidemiologies of human group A rotavirus infections in the United Kingdom between 1995 and 1998. Journal of Clinical Microbiology, 38, 4394-4401. 95. Iturriza-Gómara M, Kang G, Gray J (2004). Rotavirus genotyping: keeping up with an evolving population of human rotaviruses. Journal of Clinical Virology, 31, 259- 265. 96. Iturriza-Gómara M and Gray J (2011). Euro Rota Net, 4th Year Report. 97. Iturriza-Gómara M, Wong C, Blome S, Desselberger U, Gray J (2002a). Molecular characterization of VP6 genes of human rotavirus isolates: correlation of genogroups with subgroups and evidence of independent segregation. Journal of Virology, 76, 6596-6601. 98. Iturriza-Gómara M, Wong C, Blome S, Desselberger U, Gray J (2002b). Rotavirus subgroup characterization by restriction endonuclease digestion of a cDNA fragment of the VP6 gene. Journal of Virological Methods, 105, 99-103. 99. Kalica AR, Flores J, Greenberg HB (1983). Identification of the rotaviral gene that codes for hemagglutination and protease-enhanced plaque formation. Virology, 125, 194-205. 100. Kalica AR, Greenberg HB, Wyatt RG, Flores J, Sereno MM, Kapikian AZ, Chanock RM (1981). Genes of human (strain Wa) and bovine (strain UK) rotaviruses that code for neutralization and subgroup antigens. Virology, 112, 385-390. 101. Kalica AR, Sereno MM, Wyatt RG, Mebus CA, Chanock RM, Kapikian AZ (1978). Comparism of human and animal rotavirus strains by gel electrophoresis of RNA. Virology, 87, 247-255.

114

102. Kamel AH, Ali MA, El Nady HG, de Rougemont A, Pothier P, Belliot G (2009). Predominance and circulation of enteric viruses in the region of Greater Cairo, Egypt. Journal of Clinical Microbiology, 47, 1037-1045. 103. Kapikian AZ (2001). A rotavirus vaccine for prevention of severe diarrhoea of infants and young children: development, utilization and withdrawal. Novartis Foundation Symposium, 238, 153-171. 104. Kapikian AZ, Hoshino Y, Chanock RM, Perez-Schael I (1996b). Efficacy of a quadrivalent rhesus rotavirus-based human rotavirus vaccine aimed at preventing severe rotavirus diarrhea in infants and young children. Journal of Infectious Diseases, 174, 65-72. 105. Kapikian AZ, Hoshino Y, Chanock RM, Perez-Schael I (1996a). Jennerian and modified Jennerian approach to vaccination against rotavirus diarrhea using a quadrivalent rhesus rotavirus (RRV) and human-RRV reassortant vaccine. Archives of Virology, 12, 163-175. 106. Kapikian AZ, Wyatt RG, Levine MM, Yolken RH, Van Kirk DH, Dolin R, Greenberg HB, Chanock RM (1983). Oral administration of human rotavirus to volunteers: Induction of illness and correlates of resistance. Journal of Infectious Diseases, 147, 95-106. 107. Kehle J, Metzger-Boddien C, Tewald F, Wald M, Schuurmann J, Enders G (2003). First case of confirmed rotavirus meningoencephalitis in Germany. Pediatrics Journal of Infectious Diseases, 22, 468-470. 108. Khamrin P, Peerakome S, Tonusin S, Malasao R, Okitsu S, Mizuguchi M, Ushijima H, Maneekarn N (2007). Changing pattern of rotavirus G genotype distribution in Chiang Mai, Thailand from 2002 to 2004: decline of G9 and reemergence of G1 and G2. Journal of Medical Virology, 79, 1775-1782. 109. Khoury H, Ogilvie I, El Khoury CA, Duan Y, Goetghebeur MM (2011). Burden of rotavirus gastroenteritis in the Middle Eastern and North African pediatric population. BMC Infectious Diseases, 11, 1471-2334. 110. Kirkwood CD (2010). Genetic and antigenic diversity of human rotaviruses: potential impact on vaccination programs. Journal of Infectious Diseases, 202, 43- 48. 111. Kirkwood DC, Boniface K, Bishop RF, Barnes LG, and the Australian Rotavirus Surveillance Group (2009). Australian rotavirus surveillance program, annual report, 2008/2009. Communicable Diseases Intellegence, 33, 382-388.

115

112. Kirkwood C, Bogdanovic-Sakran N, Palombo E, Masendycz P, Bugg H, Barnes G, Bishop R (2003). Genetic and antigenic characterization of rotavirus serotype G9 strains isolated in Australia between 1997 and 2001. Journal of Clinical Microbiology, 41, 3649-3654. 113. Kirkwood C, Masendycz PJ, Coulson BS (1993). Characteristics and location of cross-reactive and serotype-specific neutralization sites on VP7 of human G type 9 rotaviruses. Virology, 196, 79-88. 114. Konno T, Suzuki H, Kitaoka S, Sato T, Fukuhara N, Yoshie O, Fukudome K, Numazaki Y (1993). Proteolytic enhancement of human rotavirus infectivity. Clinical Infectious Diseases, 16, 92-97. 115. Koshimura Y, Nakagomi T, Nakagomi O (2000). The relative frequencies of G serotypes of rotavirus recovered from hospitalized children with diarrhea: A 10-year survey (1987–1996) in Japan with a review of globally collected data. Microbiology and Immunology, 44, 499-510. 116. Labbé M, Baudoux P, Charpilienne A, Poncet D, Cohen J (1994). Identification of the nucleic acid binding domain of the rotavirus VP2 protein. Journal of General Virology, 75, 3423-3430. 117. Lazdins I, Coulson B S, Kirkwood C, Dyall-Smith M, Masendycz P J, Sonza S, Holmes I H (1995). Rotavirus antigenicity is affected by the genetic context and glycosylation of VP7. Virology, 209, 80-89. 118. Li B, Clark H F, Gouvea V (1994). Amino acid sequence similarity of the VP7 protein of human rotavirus HCR3 to that of canine and feline rotaviruses. Journal of General Virology, 75, 215-219. 119. Light JS and Hodes HL (1943). Studies on epidemic diarrhea of the new-born: isolation of a filtrable agent causing diarrhea in calves. American Journal of Public Health and Nations Health, 33, 1451-1454. 120. Lin YP, Chang SY, Kao CL, Huang LM, Chung MY, Yang JY, Chen HY, Taniguchi K, Tsai KS, Lee CN (2006). Molecular epidemiology of G9 rotaviruses in Taiwan between 2000 and 2002. Journal of Clinical Microbiology, 44, 3686-3694. 121. Linhares AC, Gabbay YB, de Freitas RB, Mascarenhas JD (1988). Reinfections and rotavirus serotypes in Belem, Brazil (Preliminary report). Revista do Instituto de Medicina Tropical de São Paulo, 30, 101-106. 122. Linhares AC, Monção HC, Gabbay YB, de Araújo VL, Serruya AC, Loureiro EC (1983). Acute diarrhoea associated with rotavirus among children living in Belém,

116

Brazil. Transactions of the royal society of tropical medicine and hygiene, 77, 384- 390. 123. Liu M, Offit PA, Estes MK (1988). Identification of the simian rotavirus SA11 genome segment 3 product. Virology, 163, 26-32. 124. Lopez S and Arias C F (1987). The nucleotide sequence of the 5' and 3' ends of rotavirus SA11 gene 4. Nucleic Acids Research, 15, 11. 125. Lopez S, Arias C F, Bell JR, Strauss J H, Espejo RT (1985). Primary structure of the cleavage site associated with trypsin enhancement of rotavirus SA11 infectivity, Virology, 144, 11-19. 126. López S, Espinosa R, Greenberg HB, Arias CF (1994). Mapping the subgroup epitopes of rotavirus protein VP6. Virology, 204, 153-162. 127. Losonsky GA and Reymann M (1990). The immune response in primary asymptomatic rotavirus infection in newborn infants. Journal of Infectious Diseases, 161, 330-332. 128. Lundgren O, Peregrin AT, Persson K, Kordasti S, Uhnoo I, Svensson L (2000). Role of the enteric nervous system in the fluid and electrolyte secretion of rotavirus diarrhea. Science, 287, 491-495. 129. Lundgren O and Svensson L (2001). Pathogenesis of rotavirus diarrhea. Microbes and Infection, 3, 1145-1156. 130. Mackow ER, Shaw RD, Matsui SM, Vo PT, Benfield DA, Greenberg HB (1988). Characterization of homotypic and heterotypic VP7 neutralization sites of rhesus rotavirus. Virology, 165, 511-517. 131. Maldonado YA and Yolken RH (1990). Rotavirus. Baillieres Clinical Gastroenterology, 4, 609-625. 132. Mansell EA and Patton JT (1990). Rotavirus RNA replication: VP2, but not VP6, is necessary for viral replicase activity. Journal of Virology, 64, 4988-4996. 133. Manuel A, Franco A, Angel J, Harry B, Greenberg BC (2006). Immunity and correlates of protection for rotavirus vaccines. Vaccine, 24, 2718-2731. 134. Martinez M, Amarilla AA, Galeano ME, Aquino VH, Farin˜a N, Russomando G, Parra GI (2010). Predominance of rotavirus G2P[4] and emergence of G12P[9] strains in Asuncio´n, Paraguay, 2006–2007. Archives of Virology, 155, 525-533. 135. Mascarenhas JD, Lima CS, de Oliveira DS, Guerra Sde F, Maestri RP, Gabbay YB, de Lima IC, de Menezes EM, Linhares Ada C, Bensabath G (2010). Identification of

117

two sublineages of genotype G2 rotavirus among diarrheic children in Parauapebas, Southern Para´ State, Brazil. Journal of Medical Virology, 82, 712-719. 136. Mascarenhas J D P, Linhares A C, Bayma A P G, Lima J C, Sousa M S, Arau´ jo I T, Heinemann M B, Gusma˜ o R H P, Gabbay Y B , Leite J P G (2006). Molecular analysis of VP4, VP7 and NSP4 genes of P[6]G2 rotavirus genotype strains recovered from neonates admitted to hospital in Bele´m, Brazil. Journal of Medical Virology, 78, 281-289. 137. Matthijnssens J, Ciarlet M, Heiman E, Arijs I, Delbeke T, McDonald SM, Palombo EA, Iturriza-Go´mara M, Maes P, Patton JT, Rahman M, Van Ranst M (2008a). Full genome-based classification of rotaviruses reveals a common origin between human Wa-like and porcine rotavirus strains and human DS-1-like and bovine rotavirus strains. Journal of Virology, 82, 3204-3219. 138. Matthijnssens J, Ciarlet M, McDonald SM, Attoui H, Bányai K, Brister JR, Buesa J, Esona MD, Estes MK, Gentsch JR, Iturriza-Gómara M, Johne R, Kirkwood CD, Martella V, Mertens PP, Nakagomi O, Parreño V, Rahman M, Ruggeri FM, Saif LJ, Santos N, Steyer A, Taniguchi K, Patton JT, Desselberger U, Van Ranst M (2011). Uniformity of rotavirus strain nomenclature proposed by the Rotavirus Classification Working Group (RCWG). Archives of Virology, 156, 1397-1413. 139. Matthijnssens J, Joelsson DB, Warakomski DJ, Zhou T, Mathis PK, Van Maanen MH, Ranheim TS, Ciarlet M (2010). Molecular and biological characterization of the 5 human-bovine rotavirus (WC3)-based reassortant strains of the pentavalent rotavirus vaccine, RotaTeq. Virology, 403, 111-127. 140. Matthijnssens J, Rahman M, Van Ranst M (2008b). Two out of the 11 genes of an unusual human G6P[6] rotavirus isolate are of bovine origin. Journal of General Virology, 89, 2630-2635. 141. Mason BB, Graham DY, Estes MK (1980). In vitro transcription and translation of simian rotavirus SA11 gene products. Journal of Virology, 33, 1111-1121. 142. Matsui SM, Mackow ER, Greenberg HB (1989). Molecular determinant of rotavirus neutralization and protection. Advanced Viral Research, 36,181-214. 143. Matsuno S, Mukoyama A, Hasegawa A, Taniguchi K, Inouye S (1988). Characterization of a human rotavirus strain which is possibly a naturally-occurring reassortant virus. Virus Research, 10, 167-175.

118

144. Mebus CA, Wyatt RG, Sharpee RL, Sereno MM, Kalica AR, Kapikian AZ, Twiehaus MJ (1976). Diarrhea in gnotobiotic calves caused by the reovirus-like agent of human infantile gastroenteritis. Infectious Immunology, 14, 471-474. 145. Meyer JC, Bergmann CC, Bellamy AR (1989). Interaction of rotavirus cores with the non-structural glycoprotein NS28. Virology, 171, 98-107. 146. Montero H, Arias CF, Lopez S (2006). Rotavirus non-structural protein NSP3 is not required for viral protein synthesis. Journal of Virology, 80, 9031-9038. 147. Mphahlele MJ, Peenze I, Steele AD (1999). Rotavirus strains bearing the VP4P[14] genotype recovered from South African children with diarrhoea. Archives of Virology, 144, 1027-1034. 148. Mwenda JM, Ntoto KM, Abebe A, Enweronu-Laryea C, Amina I, Mchomvu J, Kisakye A, Mpabalwani EM, Pazvakavambwa I, Armah GE, Seheri LM, Kiulia NM, Page N, Widdowson MA, Steele AD (2010). Burden and epidemiology of rotavirus diarrhea in selected African countries: preliminary results from the African Rotavirus Surveillance Network. Journal of Infectious Diseases, 202, 5-11. 149. Nakagomi O and Nakagomi T (1993). Interspecies transmission of rotaviruses studied from the perspective of genogroup. Microbiology and Immunology, 37, 337- 348. 150. Nakagomi O, Nakagomi T, Akatani K, Ikegami N (1989). Identification of rotavirus genogroups by RNA-RNA hybridization. Journal of Clinical Microbiology, 3, 251- 261. 151. Nakagomi O and Nakagomi T (1990). Molecular evidence for naturally occurring single VP7 gene substitution reassortant between human rotaviruses belonging to two different genogroups. Archives of Virology, 119, 67-81. 152. Offit PA and Blavat G (1986b). Identification of two rotavirus genes determining neutralization specificities. Journal of Virology, 57, 376-378. 153. Offit PA and Clark HF (1985). Protection against rotavirus –induced gastroenteritis in a murine model by passively acquired gastrointestinal but not circulating antibodies. Journal of Virology, 54, 58-64. 154. Offit PA, Clark HF, Blavat G, Greenberg HB (1986a). Reassortant rotaviruses containing structural proteins VP3 and VP7 from different parents induce antibodies protective against each parental serotype. Journal of Virology, 60, 491-496.

119

155. Page NA and Steele AD (2004). Antigenic and genetic characterization of serotype G2 human rotavirus strains from the African continent. Journal of Clinical Microbiology, 42, 595-600. 156. Page NA, de Beer MC, Seheri LM, Dewar JB, Steele AD (2009). The detection and molecular characterization of human G12 genotypes in South Africa. Journal of Medical Virology, 81, 106-113. 157. Palombo EA, Bishop RF, Cotton RG (1993). Sequence conservation within neutralization epitope regions of VP7 and VP4 proteins of human serotype G4 rotavirus isolates. Archieves of Virology, 133, 323-334. 158. Parashar UD, Bresee JS, Widdowson M, Gentsch JR (2006). New breath for rotavirus vaccines. Journal of Infectious Diseases, 3, 160-165. 159. Parashar UD, Burton A, Lanata C, Boschi-Pinto C, Shibuya K, Steele D, Birmingham M, Glass RI (2009). Global mortality associated with rotavirus disease among children in 2004. Journal of Infectious Diseases, 200, 9-15. 160. Parashar UD, Hummelman EG, Bresee JS, Miller MA, Glass RI (2003). Global illness and deaths caused by rotavirus disease in children. Emerging Infectious Diseases, 9, 565-572. 161. Patel MM, Oliveira LH, Bispo AM, Gentsch J, Parashar UD (2008). Rotavirus P[4]G2 in a vaccinated population, Brazil. Emerging Infectious Diseases, 14, 863- 865. 162. Patel MM, Steele D, Gentsch JR, Wecker J, Glass RI, Parashar UD (2011). Real- world impact of rotavirus vaccination. Pediatrics Infectious Diseases Journal, 30, 1- 5. 163. Patton JT (2012). Rotavirus diversity and evolution in the post-vaccine world. Discovery Medicine, 13, 85-97. 164. Patton JT, Vasquez-del Carpio R, Morales JL, Barro M, Ricardo A, Spencer E (2001). Rotavirus RNA replication and gene expression. Novartis Foundation Symposium, 238, 64-77. 165. Paul SK, Kobayashi N, Nagashima S, Ishino M, Watanabe S, Alam MM, Ahmed MU, Hossain MA, Naik TN (2008). Phylogenetic analysis of rotaviruses with genotypes G1, G2, G9 and G12 in Bangladesh: evidence for a close relationship between rotaviruses from children and adults. Archives of Virology, 153, 1999-2012. 166. Payne DC, Staat MA, Edwards KM, Szilagyi PG, Weinberg GA, Hall CB, Chappell J, Curns AT, Wikswo M, Tate JE, Lopman BA, Parashar UD (2011). Direct and

120

indirect effects of rotavirus vaccination upon childhood hospitalizations in 3 US Counties, 2006-2009. Clinical Infectious Diseases, 53, 245-253. 167. Pedley S, Hundley F, Chrystie I, McCrae MA, Desselberger U (1984). The genomes of rotaviruses isolated from chronically infected immunodeficient children. Journal of General Virology, 65, 1141-1150. 168. Pesavento JB, Crawford SE, Estes MK, Prasad BV (2006). Rotavirus proteins: structure and assembly. Current Topics in Microbiology and Immunology, 309, 189- 219. 169. Petrie BL, Greenberg HB, Graham DY, Estes MK (1984). Ultrastructural localization of rotavirus antigens using colloidal gold. Virus Research, 1,133-152. 170. Poncet D, Lindenbaum PL, Haridon R, Cohen J (1997). In vivo and in vitro phosphorylation of rotavirus NSP5 correlates with its localization in viroplasms. Journal of Virology, 71, 34-41. 171. Prasad BV, Burns JW, Marietta E, Estes MK, Chiu W (1990). Localization of VP4 neutralization sites in rotavirus by three dimensional cryo-electron microscopy. Nature, 343, 476-479. 172. Prasad B VV, Wang GJ, Clerx JPM , Chiu W (1988). Three-dimensional structure of rotavirus. Journal of Molecular Biology, 199, 269-275. 173. Rahman M, De Leener K, Goegebuer T, Wollants E, Van Der Donck, Hoovels LE, Van Ranst M (2003). Genetic characterization of a novel, naturally occurring recombinant human G6P[6] rotavirus. Journal of Clinical Microbiology, 41, 2088- 2095. 174. Rahman M, Matthijnssens J, Nahar S, Podder G, Sack AD, Azim T, Van Ranst M (2005). Characterization of a novel P[25],G11 human group a rotavirus . Journal of Clinical Microbiology, 43, 3208-3212. 175. Rahman M, Sultana R, Ahmed G, Nahar S, Hassan ZM, Saiada F (2007). Prevalence of G2P[4] and G12P[6] rotavirus, Bangladesh. Emerging Infectious Diseases, 13, 18- 24. 176. Ramachandran M, Gentsch JR, Parashar UD, Jin S, Woods PA, Holmes JL, Kirkwood CD, Bishop RF, Greenberg HB, Urasawa S, Gerna G, Coulson BS, Taniguchi K, Bresee JS, Glass RI (1998). Detection and characterization of novel rotavirus strains in the United States. Journal of Clinical Microbiology, 36, 3223- 3229.

121

177. Ramig RF and Ward RL (1991). Genomic segment reassortment in rotaviruses and other Reoviridae. Advances in Virus Research, 39, 163-207. 178. Roseto A, Lema F, Sitbon M, Cavalieri F, Dianoux L, Peries J (1979). Detection of rotavirus in dogs. Society of Occupational Medicine, 7, 478. 179. Saif LJ, Ward LA, Yuan L, Rosen BI, To TL (1996). The gnotobiotic piglet as a model for studies of disease pathogenesis and immunity to human rotaviruses. Archives of Virology, Supplement, 12, 153-161. 180. Saitou N and Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406-425. 181. Sandino AM, Jashes M, Faúndez G, Spencer E (1986). Role of the inner protein capsid on in vitro human rotavirus transcription. Journal of Virology, 60, 797-802. 182. Santos N and Hoshino Y (2005). Global distribution of rotavirus serotypes/genotypes and its implication for the development and its implementation of an effective rotavirus vaccine. Reviews in Medical Virology, 15, 29-56. 183. Schnepf N, Deback C, Dehee A, Gault E, Parez N, Garbarg-Chenon A (2008). Rearrangements of rotavirus genomic segment 11 are generated during acute infection of immunocompetent children and do not occur at random. Journal of Virology, 82, 3689-3696. 184. Shaw RD, Fong KJ, Losonsky GA, Levine MM, Maldonado Y, Yolken R, Flores J, Kapikian AZ, Vo PT, Greenberg HB (1987). Epitope-specific immune responses to rotavirus vaccination. Gastroenterology, 93, 941-950. 185. Seheri LM, Page N, Dewar JB, Geyer A, Nemarude AL, Bos P, Esona M, Steele AD (2010). Characterization and molecular epidemiology of rotavirus strains recovered in the Madibeng District, South Africa between 2003 and 2006 during a rotavirus vaccine trial. Journal of Infectious Diseases, 202, 139-147. 186. Shen S, Burke B, Desselberger U (1994). Rearrangement of the VP6 gene of a group A rotavirus in combination with a point mutation affecting trimer stability. Journal of Virology, 68, 1682-1688. 187. Smith M and Tzipori S. Gel electrophoresis of rotavirus RNA derived from six different animal species (1979). Australian Journal of Experimental Biology and Medical Science, 57, 583-585. 188. Steele AD and Alexander JJ (1987). Molecular epidemiology of rotavirus in black infants in South Africa. Journal of Clinical Microbiology, 25, 2384-2387.

122

189. Steele AD and Ivanoff B (2003b). Rotavirus strains circulating in Africa during 1996–1999: emergence of G9 strains and P[6] strains. Vaccine, 21, 361-367. 190. Steele AD, Peenze I, de Beer M, Pager CT, Yeats J, Potgieter N, Ramsaroop U, Page NA, Mitchell JO, Geyer A, Bos P, Alexander JJ (2003a). Anticipating rotavirus vaccines: epidemiology and surveillance of rotavirus in South Africa. Vaccines, 21, 354-360. 191. Suguna K and Durga Rao C (2010). The rotavirus nonstructural proteins: a structural perspective. Current Science, 98, 352-359. 192. Tang B, Gilbert JM, Matsui SM, Greenberg HB (1997). Comparison of the rotavirus gene 6 from different species by sequence analysis and localization of subgroup- specific epitopes using site-directed mutagenesis. Virology, 237, 89-96. 193. Taniguchi K, Hoshino Y, Nishikawa K, Green KY, Maloy W L, Morita Y, Urasawa S, Kapikian A Z,Chanock R M, Gorziglia M (1988). Cross-reactive and serotype- specific neutralization epitopes on VP7 of human rotavirus: nucleotide sequence analysis of antigenic mutants selected with monoclonal antibodies. Journal of Virology, 62, 1870-1874. 194. Taniguchi K and Urasawa S (1996). Diversity in rotavirus genomes. Seminars in Virology, 6, 123-131. 195. Tate JE, Burton AH, Boschi-Pinto C, Steele AD, Duque J, Parashar UD (2012). 2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infectious Diseases, 12, 136-141. 196. Teleb N (2008). Rotavirus Surveillance Network in the Eastern Mediterranean regional. Presented at the 8th International Rotavirus Symposium; 2008 June 3-4 Istanbul; 2008. 197. Thouless ME, Di Giacomo RF, Neuman DS (1986). Isolation of two lapine rotaviruses: characterization of their subgroup, serotype and RNA electropherotypes. Archives of Virology, 89, 161-170. 198. Tian Y, Tarlow O, Ballard A, Desselberger U, McCrae MA (1993). Genomic concatemerization/deletion in rotaviruses: a new mechanism for generating rapid genetic change of potential epidemiological importance. Journal of Virology, 67, 6625-6632. 199. Todd D, McNulty MS, Allan GM (1980). Polyacrylamide gel electrophoresis of avian rotavirus RNA. Archives of Virology, 63, 87-97.

123

200. Todd S, Page NA, Steele AD, Peenze I, Cunliffe NA (2010). Rotavirus strain types Circulating in Africa: Review of studies published during 1997–2006. Journal of Infectious Diseases, 202, 34-42. 201. Torres-Vega M A, Gonzalez R A, Duarte M, Poncet D, Lopez S, Arias C F (2000). The C-terminal domain of rotavirus NSP5 is essential for its multimerization, hyperphosphorylation and interaction with NSP6. Journal of General Virology, 81, 821-830. 202. Trinh QD, Pham NT, Nguyen TA, Phan TG, Yan H, Hoang le P, Khamrin P, Maneekarn N, Li Y, Okitsu S, Mizuguchi M, Ushijima H (2010). Sequence analysis of the VP7 gene of human rotaviruses G2 and G4 isolated in Japan, China, Thailand, and Vietnam during 2001–2003. Journal of Medical Virology, 82, 878-885. 203. Trojnar E, Otto P, Roth B, Reetz J, Johne R (2010). The genome segments of a group D rotavirus possess group A-like conserved termini but encode group-specific proteins. Journal of Virology, 84, 10254-10265. 204. Turcios RM, Curns AT, Holman RC, Pandya-Smith I, LaMonte A, Bresee JS, Glass RI (2006). Temporal and geographic trends of rotavirus activity in the United States, 1997-2004. Journal of Pediatrics Infectious Diseases, 25, 451-454. 205. Valenzuela S J, Pizarro A M, Sandino M, Vasquez J, Fernandez O,Hernandez J, Patton M, Spencer E (1991). Photoaffinity labeling of rotavirus VP1 with 8-azido- ATP: identification of the viral RNA polymerase. Journal of Virology, 65, 3964- 3967. 206. van Damme P, Giaquinto C, Maxwell M, Todd P, Van der Wielen M (2007). Distribution of rotavirus genotypes in Europe, 2004–2005. Journal of Infectious Diseases, 195, 7-25. 207. Vásquez-del Carpió R, Morales JL, Barro M, Ricardo A, Spencer E (2006). Bioinformatic prediction of polymerase elements in the rotavirus VP1 protein. Biological Research, 39, 649-659. 208. Vesikari T (1996). Trials of oral bovine and rhesus rotavirus vaccines in Finland: a historical account and present status. Archieves of Virology, 12, 177-186. 209. Vesikari T, Isolauri E, Delem A, d'Hondt E, André FE, Beards GM, Flewett TH (1985). Clinical efficacy of the RIT 4237 live attenuated bovine rotavirus vaccine in infants vaccinated before a rotavirus epidemic. Journal of Pediatrics, 107, 189-194. 210. Vesikari T, Matson DO, Dennehy P, Van Damme P, Santosham M, Rodriguez Z, Dallas MJ, Heyse JF, Goveia MG, Black SB,Shinefield HR, Christie CD, Ylitalo

124

S, Itzler RF, Coia ML, Onorato MT, Adeyi BA, Marshall GS, Gothefors L, Campens D, Karvonen A,Watt JP, O'Brien KL, Di Nubile MJ, Clark HF, Boslego JW, Offit PA, Heaton PM; Rotavirus Efficacy and Safety Trial (REST) Study Team (2006). Safety and efficacy of a pentavalent human-bovine (WC3) reassortant rotavirus vaccine. New England Journal of Medicine, 354, 23-33. 211. Volatão EM, Soares CC, Maranhão AG, Rocha LN, Hoshino Y, Santos N (2006). Rotavirus surveillance in the city of Rio de Janeiro-Brazil during 2000-2004: detection of unusual strains with G8P[4] or G10P[9] specificities. Journal of Medical Virology, 78, 263-272. 212. Ward RL, Nakagomi O, Knowlton DR, McNeal MM, Nakagomi T, Clemens JD, Sack DA, Schiff GM (1990). Evidence for natural reassortants of human rotaviruses belonging to different genogroups. Journal of Virology, 64, 3219-3225. 213. Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaola Y (1992). Evolution and ecology of influenza A viruses. Microbiology Reviews, 56, 152-179. 214. Whitton JL, Hundley F, O’Donell B, Desselberger U (1983). Silver staining of nucleic acids. Applications in virus research and in diagnostic virology. Journal of Virological Methods, 7, 185-198. 215. WHO (2009). Rotavirus vaccines: an update. World Health Organization,Weekly Epidemiological Record, 84, 533-540. 216. WHO (2011). Global rotavirus information and surveillance bulletin. Reporting period: January through December 2010. World Health Organization,Volume 4,1-10. 217. Widdowson MA, Bresee JS, Gentsch JR, Glass RI (2005). Rotavirus disease and its prevention. Current Opinion in Gastroenterology, 21, 26-31. 218. Widdowson MA, Steele D, Vojdani J, Wecker J, Parashar UD (2009). Global rotavirus surveillance: preparing for the introduction of rotavirus vaccines. Journal of Infectious Diseases, 200, 1-8. 219. Wilde J, Yolken R, Willoughby R, Eiden J (1991). Improved detection of rotavirus shedding by polymerase chain reaction. Lancet, 337, 323-326. 220. Wyatt RG, Greenberg HB, James WD, Pittman AL, Kalica AR, Flores J, Chanock RM, Kapikian AZ (1982). Definition of human rotavirus serotypes by plaque reduction assay. Infectious Immunology, 37, 110-115. 221. Wyatt RG, James HD, Pittman AL, Hoshino Y, Greenberg HB, Kalica AR, Flores J, Kapikian AZ (1983). Direct isolation in cell culture of human rotaviruses and their characterization into four serotypes. Journal of Clinical Microbiology, 18, 310-317.

125

222. Yolken R, Arango-Jaramillo S, Eiden J, Vonderfecht S (1988). Lack of genomic reassortment following infection of infant rats with group A and group B rotaviruses. Journal of Infectious Disease, 158, 1120-1123. 223. Yolken RH, Maldonado YA, Kinney J, Vonderfecht S (1990). Epidemiology and potential methods for prevention of neonatal intestinal viral infections. Review of Infectious Diseases, 4, 421-427. 224. Zaman K, Dang DA, Victor JC, Shin S, Yunus M, Dallas MJ, Podder G, Vu DT, Le TP, Luby SP, Le HT, Coia ML, Lewis K, Rivers SB,Sack DA, Schödel F, Steele AD, NeuzilKM, CiarletM(2010).Efficacyof pentavalent rotavirus vaccine against sev ere rotavirus gastroenteritisin infants in developing countries in Asia:a randomised, d ouble-blind, placebo-controlled trial. Lancet, 376, 615-623. 225. Zao C L, Yu W N, Kao C L, Taniguchi K, Lee C Y (1999). Sequence analysis of VP1 and VP7 genes suggests occurrence of a reassortant of G2 rotavirus responsible for an epidemic of gastroenteritis. Journal of General Virology, 80, 1407-1415. 226. Zeller M, Patton JT, Heylen E, De Coster S, Ciarlet M,Van Ranst M, Matthijnssens J (2012). Genetic analyses reveal differences in the VP7 and VP4 antigenic epitopes between human rotaviruses circulating in Belgium and rotaviruses in Rotarix™ and RotaTeq™. Journal of Clinical Microbiology, 50, 966-976. 227. Zeng CQY, Wentz MJ, Cohen J, Estes MK, Ramig RF (1996). Characterization and replicase activity of double-layered and single-layered rotavirus-like particles expressed from baculovirus recombinants. Journal of Virology, 70, 2736-2742. 228. Zhou Y, Li L, Okitsu S, Maneekarn N, Ushijima H (2003). Distribution of human rotaviruses, especially G9 strains, in Japan from 1996 to 2000. Microbiology and Immunology, 47, 591-599.

126

APPENDICES

127

128

129

130

131

132

133

134

135

136

137

138

139

140