NF-IL6 (C/EBP␤) induces HIV-1 replication by inhibiting APOBEC3G

Shigemi M. Kinoshita* and Shizuka Taguchi

Laboratory of Combined Research on Microbiology and Immunology, Research Institute of Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan

Communicated by Tadamitsu Kishimoto, Osaka University, Osaka, Japan, July 25, 2008 (received for review June 12, 2008) activation is crucial for the productive HIV-1 infection of cytidine deaminase APOBEC3G. This association prevents G- primary T cells; however, little is known about the host molecules to-A hypermutations in HIV-1 DNA normally caused by involved in this process. We show that the host transcription factor APOBEC3G, allowing HIV-1 reverse transcription and subse- NF-IL6 (also called C/EBP␤) renders primary CD4؉ T cells highly quent viral replication to proceed. Our findings indicate that permissive for HIV-1 replication. NF-IL6 facilitates reverse transcrip- NF-IL6 is an inhibitor of APOBEC3G and, therefore, plays a tion of the by binding to and inhibiting the antiviral cytidine role in regulation of DNA and maintenance of deaminase APOBEC3G. A mutation in NF-IL6 at Ser-288 weakened genomic stability. its binding to APOBEC3G and strongly inhibited HIV-1 replication. NF-IL6 also induced the replication of a Vif-deficient strain of HIV-1 Results in nonpermissive HUT78 cells. These data indicate that NF-IL6 is a Screening of Host Permissive Factors for HIV-1 Replication. We used natural inhibitor of APOBEC3G that facilitates HIV-1 replication. a cDNA complementation screen with a cDNA Host factors, such as NF-IL6, that are involved in early HIV-1 library derived from the Jurkat CD4ϩ T cell line to identify replication are potential targets for anti-HIV-1 therapy. Our find- host molecules permissive for HIV-1 replication in primary ings shed light on the activation of HIV-1 replication by T cell host CD4ϩ T cells. We infected Ϸ5 ϫ 107 primary CD4ϩ T cells with molecules and reveal a unique regulation of DNA deamination by a retroviral Jurkat T cell cDNA library at Ϸ30% infection rate. APOBEC3G and NF-IL6. Fourteen days later, these cells were challenged with HXB- CD5, an engineered HIV-1 construct, in which mouse CD5 is productive HIV-1 infection spontaneously occurs in many fused to the nef reading frame. Seven days after HIV-1 ACD4ϩ T cell lines but is never observed in primary quiescent challenge, we collected CD5-positive cells by using anti-CD5- CD4ϩ T cells. In primary T cells, a productive HIV-1 infection conjugated magnetic beads and prepared total DNA from occurs only after T cell activation. These observations suggest these cells. Using primers specific to constant regions flanking that, in T cell lines, host molecules important for HIV-1 repli- the cDNA insert, we amplified this DNA by using PCR, cation are constitutively active but these molecules are available subcloned the PCR fragment into the pBMN retrovirus vector, only after activation in primary CD4ϩ T cells (1–3). Dissecting and prepared plasmid DNA. We prepared 50 independent the nature of such differences represents an opportunity to retrovirus and transfected these DNAs into Phoenix- understand the biology of HIV-1 infection and may reveal Ampho to prepare recombinant retroviral supernatants for potential therapeutic targets. retesting. These retroviral supernatants were transduced into APOBEC3G (initially called CEM15) was identified as a host primary CD4ϩ T cells as in the original screen. In this retesting, restriction factor for HIV-1 replication by a subtractive hybrid- we obtained 16 clones that induced HIV-1 replication in ization screen using cell lines that differ in their abilities to primary CD4ϩ T cells; 7 carried unique cDNA inserts. Se- support the replication of an HIV-1 strain deficient in the virion quence analysis indicated that it was NF-IL6 that rendered infectivity factor (Vif) (4). APOBEC3G belongs to the APO- primary CD4ϩ T cells permissive for HIV-1 replication. BEC family of cytidine deaminases that edit RNA and mutate NF-IL6 was originally identified as a transactivator of the IL-6 DNA. The APOBEC family consists of APOBEC1, APOBEC2, and exhibits homology to the CCAAT/enhancer binding APOBEC3A-G, and activation-induced deaminase (AID) (5, 6). (C/EBP), which belongs to the basic leucine zipper APOBEC3 family members inhibit infection by various , family of transcription factors (18). NF-IL6 is involved in including (7) and also DNA viruses such as hepatitis regulation of expression of various acute-phase , cy- B virus (HBV) (8) and adeno-associated virus (9). In the case of tokines, and viruses (19) and has been called C/EBP␤,AGP/ HIV-1, APOBEC3G catalyzes cytidine deamination in the newly EBP, LAP, IL-6DBP, CRP2, and NF-M (19–21). synthesized, minus-strand viral DNA and induces guanosine (G)-to-adenosine (A) hypermutation in viral plus strand during NF-IL6 Induces HIV-1 Replication in Primary T cells. To characterize reverse transcription (7, 10–12). These mutations may result in the function of NF-IL6 in HIV-1 replication, we measured incomplete reverse transcription or lead to the production of HIV-1 replication levels in primary CD4ϩ T cells that ectopi- nonfunctional viral proteins. The HIV-1 accessory protein Vif cally express NF-IL6. We prepared NF-IL6-expressing CD4ϩ binds to APOBEC3G and blocks its antiviral function. Vif T cells and control CD4ϩ T cells by using a retroviral gene binding induces the degradation of APOBEC3G by a protea- delivery system (pBMN-NF-IL6-IRES-Lyt2␣Ј or pBMN- some-mediated pathway and inhibits virion encapsidation of control-IRES-Lyt2␣Ј). Lyt2␣Ј-expressing primary CD4ϩ T APOBEC3G (13–15). In addition to its activity against HIV-1, cells were selected after transduction by flow cytometry to APOBEC3G inhibits infection by human T cell leukemia virus result in cell populations that were Ͼ98% pure. Twelve days type-1 (HTLV-1) (16), murine leukemia virus (MLV) (10), HBV, and primate foamy virus (PFV) (17). These viruses do not have a Vif analog, and how these viruses overcome the antivirus Author contributions: S.M.K. designed research; S.M.K. and S.T. performed research; S.M.K. function of APOBEC3G is still unclear. analyzed data; and S.M.K. wrote the paper. As reported here, we have used a cDNA complementation The authors declare no conflict of interest. screen to demonstrate that the host transcription factor NF-IL6 *To whom correspondence should be addressed. E-mail: [email protected]. (also known as C/EBP␤) associates with the host antiviral © 2008 by The National Academy of Sciences of the USA

15022–15027 ͉ PNAS ͉ September 30, 2008 ͉ vol. 105 ͉ no. 39 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0807269105 Downloaded by guest on September 23, 2021 A 106 A APOBEC3G-HA 105 NF-IL6 104

103 kDa 102 GST ControlGST NF-IL6GST (p65) ControlGST NF-IL6GST (p65)(S220A, NF-IL6GST S221A) NF-IL6(S288A)

p24 (pg/ml) 95 ＊ 10 68 ＊ 1 Control 54 N.D. N.D. N.D. N.D. N.D. N.D. 0.1 43 3 6 9 12 15 18 36 Days post-infection

αHA : IP B αGST : Blot

ControlNF-IL6 ControlNF-IL6 ControlNF-IL6 ControlNF-IL6 1 kb ladder R/U5 U3/5NC R/5NC β-actin 106 B NF-IL6 NF-IL6(S220A, S221A) * NF-IL6(S288A) 105 * *

104 Fig. 1. NF-IL6 induces HIV-1 replication in primary T cells. (A) Primary CD4ϩ

T cells transduced with either an NF-IL6-expressing (NF-IL6) or a control p24 (pg/ml) 5 retrovirus (control) were challenged with HIV-1 (NL4-3; 400 TCID50/10 cells). P24gag levels in culture supernatants were assayed from five wells on various 103 days after infection, as indicated. P24gag levels were normalized for cell numbers measured by using the XTT assay. Data represent the average (Ϯ SE) 6 per 10 cells. Similar results were observed in three independent experiments. 102 (B) PCR amplification using the indicated primer pairs was performed by using 369121518 cellular DNA from the cells in A. ␤-actin was used to normalize DNA levels. The Days post-infection asterisks indicate the position of PCR bands of interest. N.D., not detected. Fig. 2. Ser-288 of NF-IL6 is essential for the association between NF-IL6 and APOBEC3G and for optimal HIV-1 replication enhancement. (A) 293T cells after transduction, both NF-IL6-expressing CD4ϩ T cells and were cotransfected with the indicated combinations of expression vectors: control CD4ϩ T cells were challenged with the HIV-1 T-tropic APOBEC3G-HA, GST-p65 (control), GST-NF-IL6, GST-NF-IL6(S220A, S221A), or GST-NF-IL6(S288A). Cell lysates were immunoprecipitated with anti-HA mAb strain NL4-3 and viral replication was measured by p24-based and immunoblotted with anti-GST mAb. Purified GST (p65) and GST NF-IL6 are ELISA during the subsequent 18 days. As previously reported, shown as controls and marked with asterisks. (B) Primary CD4ϩ T cells express- ϩ HIV-1 replication was undetectable in control CD4 T cells (22). ing NF-IL6 or its mutants, NF-IL6(S220A, S221A) and NF-IL6(S288A), were ϩ 5 gag HIV-1 replication was dramatically induced in CD4 T cells challenged with HIV-1 (NL4-3; 600 TCID50/10 cells). P24 levels in culture expressing NF-IL6 (Fig. 1A). supernatants were assayed from five wells on the indicated days after infec- To define the NF-IL6-dependent step necessary to establish a tion. P24gag levels were normalized for cell numbers measured by using the Ϯ 6 productive HIV-1 infection, we performed DNA-dependent XTT assay. Data are presented as the average ( SE) per 10 cells. Similar results were observed in three independent experiments. PCR with primer sets able to distinguish between salient stages

of reverse transcription. The primer pair R/U5 was designed to IMMUNOLOGY amplify the earliest reverse-transcription product (minus-strand reverse transcription (7, 10–12). These mutations might inter- strong stop DNA); primer pairs U3/5NC and R/5NC detect only fere with the completion of reverse transcription or may lead to full-length, double-stranded viral DNA (22, 23). Total cellular the production of nonfunctional viral proteins that block repli- DNA was prepared 7 days after HIV-1 challenge from control cation. Because our results indicate that NF-IL6 facilitates the ϩ ϩ CD4 T cells and from CD4 T cells expressing NF-IL6. production of the full-length reverse-transcription product and Although we observed a specific band for the earliest reverse- induces HIV-1 replication in primary CD4ϩ T cells, we hypoth- ϩ transcription product in both the control CD4 T cells and in esized that NF-IL6 associates with and inactivates APOBEC3G. ϩ NF-IL6-expressing CD4 T cells, the U3/5NC and R/5NC We cotransfected 293T cells with GST-NF-IL6 and primer sets generated specific bands only in the NF-IL6- APOBEC3G-HA and immunoprecipitated the cell lysates with ϩ expressing CD4 T cells (Fig. 1B). This result indicates that anti-HA antibody. Western blotting of the lysates with anti-GST NF-IL6 is critical for the production of full-length, double- antibody indicated that NF-IL6 specifically associated with ϩ stranded viral DNA in primary CD4 T cells. Although several APOBEC3G (Fig. 2A). We confirmed that APOBEC3G does laboratories have reported that NF-IL6 can activate HIV-1 gene not bind to GST by using the GST-p65 fusion protein as a transcription (24–26), this is an indication that it is also involved negative control. Because phosphorylation of NF-IL6 is impor- in HIV-1 reverse transcription. Thus NF-IL6 regulates HIV-1 tant for its activity, we repeated the immunoprecipitations with replication during two discrete points in the viral life cycle: APOBEC3G-HA and either NF-IL6(S220A, S221A) or NF- during reverse transcription upon infection and during gene IL6(S288A), proteins with mutations at NF-IL6 phosphorylation transcription after integration. It is possible that NF-IL6 expres- sites. NF-IL6(S220A, S221A) contains alanines in place of sion triggers a degree of T cell activation sufficient to facilitate serines in a serine-rich domain (20). In NF-IL6(S288A), a serine HIV-1 replication. located in a basic domain is replaced with alanine; this mutation disrupts the protein’s ability to exit the nucleus (27). We found NF-IL6 Binds to APOBEC3G and Facilitates HIV-1 Replication. It is likely that although APOBEC3G and NF-IL6(S220A, S221A) were that the cytidine deaminase activity of APOBEC3G inhibits specifically associated, the association between APOBEC3G HIV-1 replication by introducing G-to-A mutations during and NF-IL6(S288A) was very weak (Fig. 2A). These data

Kinoshita and Taguchi PNAS ͉ September 30, 2008 ͉ vol. 105 ͉ no. 39 ͉ 15023 Downloaded by guest on September 23, 2021 indicate that NF-IL6 physically associates with APOBEC3G and 104 that the Ser-288 residue in NF-IL6 is crucial for this association. A To determine whether the association we observed between 103 NF-IL6 and APOBEC3G affects HIV-1 replication, we used a retroviral gene delivery system [pBMN-NF-IL6-IRES-Lyt2␣Ј, 102 pBMN-NF-IL6(S220A, S221A)-IRES-Lyt2␣Ј, and pBMN-NF- 10 IL6(S288A)-IRES-Lyt2␣Ј] to stably overexpress NF-IL6 and its p24 (ng/ml) mutants in primary CD4ϩ T cells. Lyt2␣Ј-positive cells were selected by flow cytometry to create cell populations that were 1 Ͼ98% pure. The HIV-1 T-tropic strain NL4-3 was then used to challenge the transduced and sorted cells, and HIV-1 replication 0.1 levels were determined as described above. We found that HUT78

HIV-1 replication levels were similar in the NF-IL6-expressing HUT78 ControlHUT78 NF-IL6HUT78 NF-IL6HUT78 NF-IL6 and the NF-IL6(S220A, S221A)-expressing primary CD4ϩ T (S220A, S221A)(S288A)

cells during the 18 days after challenge. In contrast, HIV-1 450 509 ϩ B TACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAA replication levels were substantially lower in CD4 T cells .... AA ...... A. G...... C.. G ...... AA...... A...... A...... A...... A...... A.... overexpressing NF-IL6(S288A), which did not bind tightly to HUT78 ..... A...... A...... A...... A...... A...... A .... APOBEC3G (Fig. 2B). Our results indicate that NF-IL6 facil- ..... A...... A...... HUT78 . T...... A ...... AA ...... A...... A...... A.... itates HIV-1 replication by binding to APOBEC3G and inter- Control ..... A...... A...... fering with its natural antiviral function. Moreover, Ser-288 in ...... HUT78 NF-IL6 ...... NF-IL6 plays an important role in this association and, by ...... T...... extension, in the activation of HIV-1 replication. NF-IL-6 does ...... HUT78 NF-IL6 ...... not inhibit APOBEC3G expression, as shown by a comparison (S220A, S221A) ...... ϩ ...... of the levels of APOBEC3G expression in primary CD4 T cells HUT78 NF-IL6 ...... G T ϩ (S288A) ...... and in primary CD4 T cells engineered to ectopically express 510 569 NF-IL6 (data not shown). CCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTCAAAGTAGTGTGTGCCCGTCT ...... GAA ... HUT78 ...... NF-IL6 Is a Natural Inhibitor of APOBEC3G. The natural antiviral ...... HUT78 ...... A defense mechanism of APOBEC3G is neutralized upon binding Control ...... by the HIV-1 accessory protein Vif; the interaction with Vif ...... HUT78 NF-IL6 ...... directs APOBEC3G degradation and elimination via a protea- ...... C ...... ⌬ ...... some-dependent pathway (13, 14). Vif-deficient HIV-1( vif ...... HUT78 NF-IL6 ...... HIV-1) cannot replicate in nonpermissive cells such as primary (S220A, S221A) ...... ϩ ...... T cells, , and certain CD4 T cell lines that express ...... HUT78 NF-IL6 ...... APOBEC3G (23, 28, 29). (S288A) ...... 570 629 We then sought to determine whether host factors like NF-IL6 GTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTC ...... A...... AA ...... can substitute for Vif and induce the replication of ⌬vif HIV-1 ...... A...... A ...... HUT78 ...... in nonpermissive cells. We therefore transduced nonpermissive ...... A A ...... A ...... A ...... HUT78 cells with NF-IL6 or mutants NF-IL6(S220A, S221A) or HUT78 ...... A ...... Control ...... A NF-IL6(S288A). Nontransduced HUT78 cells (HUT78) and ...... HUT78 cells transduced with the control retrovirus (control HUT78 NF-IL6 ...... HUT78) were used as controls. These cells were then challenged ...... ⌬ HUT78 NF-IL6 ...... with vif HIV-1, and HIV-1 replication levels were determined (S220A, S221A) ...... by p24 ELISA after 8 days. ⌬vif HIV-1 replication levels were ...... ϳ HUT78 NF-IL6 ...... C 1000-fold higher in HUT78 cells overexpressing NF-IL6 and (S288A) ...... 630 670 NF-IL6(S220A, S221A) than in nontransduced HUT78 cells or TAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGTAAA ...... T ...... HUT78 cells transduced with the control retrovirus. Further- ...... HUT78 ...... more, ⌬vif HIV-1 replication levels were ϳ100-fold higher than ...... controls, even in HUT78 cells overexpressing NF-IL6(S288A), HUT78 ...... A Control ...... the mutant that binds only weakly to APOBEC3G (Fig. 3A)...... These data indicate that NF-IL6 dramatically enhances HIV-1 HUT78 NF-IL6 ...... A...... replication in nonpermissive HUT78 cells in the absence of Vif...... T HUT78 NF-IL6 ...... It was reported that expression of APOBEC3G is correlated (S220A, S221A) ...... with an increase in the prevalence of G-to-A hypermutations in ...... ⌬ HUT78 NF-IL6 ...... newly synthesized vif HIV-1 cDNA (15). We therefore exam- (S288A) ...... ined whether NF-IL6 interferes with the cytidine deaminase activity of APOBEC3G by examining the extent of G-to-A Fig. 3. NF-IL6 inhibits APOBEC3G activity and induces HIV-1 replication. hypermutation in various HUT78 cells infected with ⌬vif HIV-1 (A) Nontransduced HUT78 cells; HUT78 transduced with a control retrovi- (Fig. 3B). We prepared cellular DNA from HUT78 and control- rus; and HUT78 cells expressing NF-IL6, NF-IL6(S220A, S221A), or NF- ⌬ ϫ 4 transduced HUT78 cells and from HUT78 cells overexpressing IL6(S288A) were challenged with vif HIV-1 (NL 4–3; 600 TCID50/5 10 either NF-IL6 or its mutants 8 days after challenge with ⌬vif cells). P24gag levels in culture supernatants were assayed from five wells 8 HIV-1. HIV-1 cDNA was amplified by PCR using the U3 and days after infection. P24gag levels were normalized for cell numbers by Ϯ 6 5NC primer pair. We detected an increased prevalence of using the XTT assay. Data are presented as the average ( SE) per 10 cells. Similar results were observed in three independent experiments. (B) Cel- G-to-A mutations in the R and U5 regions, including the primer lular DNA was prepared from the cells in A and amplified with the U3 and (PBS), in both HUT78 and control HUT78 cells 5NC primer pair, and the sequences of the R, U5, and PBS regions (450–670) infected with ⌬vif HIV-1. Five of six mutation hotspots con- were analyzed. The NL4-3 sequence is shown at the top. Four sequences are tained the sequence TGG, which is known to be targeted by shown from each sample and only the mutated nucleotides are shown. Dots APOBEC3G. In contrast, we detected almost no G-to-A muta- indicate sequence identity.

15024 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0807269105 Kinoshita and Taguchi Downloaded by guest on September 23, 2021 Discussion The cytidine deaminase function of APOBEC3G reportedly results in its broad antiviral activity against HTLV-1, MLV, HBV, PFV, and others (7, 8, 10, 16, 17). To establish a productive infection, APOBEC3G must be inhibited. HIV-1 Vif binds to APOBEC3G and leads to its proteosome-dependent degrada- tion (13, 14). This degradation eliminates APOBEC3G from the cytoplasm, facilitating accurate HIV-1 reverse transcription and enhancing HIV-1 replication. Vif is produced after the HIV-1 is established in the host cell, during the translation of viral protein. Newly infected cells have negligible amounts of Vif before integration (30). Therefore, early steps of HIV replica- tion and viruses that do not express Vif likely require host factors to overcome inhibition by APOBEC3G. We show here that NF-IL6 inhibits the antiviral function of APOBEC3G. APOBEC3G is expressed in primary T cells and macrophages (4). Productive HIV-1 infection of primary T cells occurs only in activated T cells; HIV-1 reverse transcription terminates prematurely after synthesis of the strong stop minus- strand DNA in quiescent CD4ϩ T cell (2, 22). In contrast, macrophages host a productive HIV-1 infection regardless of their activation state (31). This variation in the relative ability of HIV-1 to infect different types of nondividing cells might be explained by the mechanism of inhibition of APOBEC3G by NF-IL6. It is likely that NF-IL6, which is constitutively expressed in macrophages (32), inhibits APOBEC3G function in these cells but not in quiescent primary T cells. We demonstrate that phosphorylation of S288 on NF-IL6 is crucial for binding to APOBEC3G. The ectopic expression of NF-IL6(S288A), which cannot be phosphorylated Ser-288 of NF-IL6, decreased HIV-1 replication by Ͼ95% in comparison with wild-type NF-IL6 expression (Fig. 2 A and B). The mutation at position 288 in NF-IL6 disrupted transport of the protein to the nucleus (27). The mutation also inhibited its binding to DNA, Fig. 4. Single-cell analysis of ⌬vif HIV-1 replication in nonpermissive cells and thus gene transcription usually activated by NF-IL6 did not expressing NF-IL6. Flow cytometry analysis of cells ectopically expressing occur (21). In comparison with wild-type NF-IL6, NF- NF-IL6 (as indicated by Lty2␣Ј expression) and cells infected by ⌬vif IL6(S288A) did not significantly enhance HIV-1 reverse tran- HIV-1-GFP (as indicated by GFP expression). (A) nontransduced HUT78 cells. (B) scription. The mutant was unable to bind tightly to APOBEC3G. HUT78 cells transduced with a control retrovirus. (C) HUT78 cells expressing Our results indicate that the phosphorylation of Ser-288 in NF-IL6. (D) NF-IL6(S220A, S221A)-expressing HUT78 cells. (E) NF-IL6(S288A)- NF-IL6 is required for binding with APOBEC3G. This mutant expressing HUT78 cells were challenged with ⌬vif HIV-1-GFP (NL4-3; 105 6 only weakly induced HIV-1 replication; in the presence of the TCID50/10 cells). GFP expression was measured 5 days after infection and plotted against Lyt2␣Ј expression. Numbers in quadrants indicate cell mutant NF-IL6, HIV-1 replication was inhibited at two different IMMUNOLOGY percentages. steps, both before and after integration: during reverse tran- scription and transcription. Our data suggest that NF-IL6 should be a potent anti-HIV-1 drug target. A further analysis of the interactions between APOBEC3G and either NF-IL6 or its tions in ⌬vif HIV-1-infected HUT78 cells overexpressing NF-IL6 mutants will provide important information, which may lead to or its mutants (Fig. 3B). Our results indicate that NF-IL6 blocks the design and development of new anti-HIV-1 drugs that are cytidine deaminase activity of APOBEC3G by binding to based on the association of these host proteins used by HIV for APOBEC3G and facilitates complete reverse transcription of its replication. HIV-1. It was reported that NFAT is involved in HIV-1 activation at pre- and postintegrative steps of the HIV-1 life cycle, as is Direct Effects of NF-IL6 on Single-Cell Infectivity by ⌬vif HIV-1. To ⌬ NF-IL6 (3, 22, 33). We verified that NFAT can bind to examine whether the induction of replication of vif HIV-1 is a APOBEC3G, but we did not observe a specific association direct or indirect effect of ectopically expressed NF-IL6 in between them (S.M.K., unpublished data). Our result suggests HUT78 cells, we analyzed the expression of NF-IL6 (via the that both NF-IL6 and NFAT are involved in the regulation of ␣Ј ⌬ Lyt2 surrogate marker) and vif HIV-1-GFP [via the expres- HIV-1 reverse transcription; however, the mechanisms by which sion of green fluorescent protein (GFP)] by dual-color, mul- these two host factors activate viral reverse transcription differ. ⌬ tiparameter FACS. As expected, there were no vif HIV-1- Interestingly, phosphorylation is important for NF-IL6 activa- GFP-infected (GFP-positive) cells in HUT78 cells or in control tion (20, 27), but NFAT is activated by dephosphorylation (34). HUT78 cells not expressing NF-IL6. In contrast, ⌬vif HIV-1- These phosphorylation and dephosphorylation events occur GFP-infected (GFP-positive) cells were observed in cultures of during T cell activation. HUT78 cells that overexpressed NF-IL6, NF-IL6(S220A, Single-cell analysis of ⌬vif HIV-1 replication indicated that S221A), or NF-IL6(S288A) (Fig. 4). These findings confirm that NF-IL6-induced replication is a direct effect of NF-IL6 expres- HIV-1 infection correlates strongly with the expression of NF- sion in nonpermissive cells (Fig. 4). For example, in HUT78 IL6 at the single-cell level. NF-IL6 cells (Fig. 4C), the NF-IL6-expressing cell population is

Kinoshita and Taguchi PNAS ͉ September 30, 2008 ͉ vol. 105 ͉ no. 39 ͉ 15025 Downloaded by guest on September 23, 2021 38.56% (38.3 ϩ 0.26) of the population and the NF-IL6- containing 10% FCS with 10 U/ml human recombinant IL-2 (Roche). HUT78 unexpressing cell population is 61.43% (61.4 ϩ 0.029). Thus, cells were cultured in RPMI 1640 containing 10% FCS. there are 1.59-fold (61.43/38.56) more cells that do not express 6 NF-IL6 than cells that do. However, NF-IL6-expressing cells Screening. A cDNA library (5 ϫ 10 primary transformants) was prepared from showed an approximately ninefold (0.26/0.029) higher infection Jurkat T cells with the pBMN vector (41). Production of and infection by ⌬ retroviruses was performed as described (22). The retrovirus-transduced pri- rate with -vif HIV-1-GFP than NF-IL6-unexpressing cells. mary CD4ϩ T cells were cultured in RPMI 1640 containing 10% FCS with 10 U/ml These data clearly show that NF-IL6 is a host factor that allows human recombinant IL-2 (Roche). After 14 days, cells were challenged with ⌬ 5 vif HIV-1 replication in nonpermissive cells. HXB-CD5 (1000 TCID50/10 cells) in 0.5 ml of culture medium at 37°C for 16 h. APOBEC family members function as cytidine deaminases Seven days after HIV-1 challenge, CD5-positive cells were collected by using that affect a wide range of physiological functions by editing both CD5 Microbeads (Miltenyi Biotec) and total cellular DNA was prepared by RNA and DNA. For example, one member of the APOBEC using the QIAamp Blood Kit (Qiagen). PCR was performed by using primers family, AID, acts on Ig genes to bring about the gene diversifi- designed to hybridize to constant regions flanking the cDNA insert (5Ј- Ј Ј Ј cation, somatic hypermutation, and class-switch recombination ACGTGAAGGCTGCCGA-3 and 5 -TAGCTTGCCAAACCTACAGGT-3 ). The PCR fragment was subcloned into the pBMN-IRES-Lyt2␣Ј retrovirus vector, plasmid steps that are important in adaptive immunity (35, 36). Although DNA was transfected into Phoenix-Ampho, and the recombinant retroviral the mutations in RNA and DNA caused by cytidine deaminases supernatant was purified for retesting in primary CD4ϩ T cells. are an important way to maximize the diversity of information available from a limited number of genes, overexpression of AID Preparation of Cells Stably Expressing NF-IL6 and Its Mutants. Two days before or APOBEC3G can cause malignancy (37, 38). retrovirus infection, CD4ϩ T cells were stimulated with 2 ␮g/ml phytohaem- The mutation of deoxycytidine to deoxyuridine by cytidine agglutinin (PHA). Recombinant retroviruses were prepared as previously de- deaminases is repaired by the base excision repair or the scribed (3, 22). These viruses were transduced 2–3 days after PHA stimulation mismatch repair system (39, 40). These comprehensive and by spin infection with 5 ␮g/ml polybrene. Lyt2␣Ј positive cells were isolated by flow cytometry 7 days after infection. Cells were challenged with HIV-1 14 days nonspecific DNA repair systems are found in the cells of almost ϩ every living organism, both prokaryotic and eukaryotic. It has after PHA stimulation. During this time, primary CD4 T cells grew slowly and HIV-1 could not replicate in these cells without stimulation or ectopically been reported that hypermutation is caused by AID and further expressed NF-IL6. We also prepared HUT78 cells expressing NF-IL6 and its mutations caused during DNA repair are involved in the gen- mutants as described previously (3). eration of antibody diversity (39). Interestingly, somatic hyper- 6 mutation happens at a rate 10 -times higher than the rate of HIV-1 Infection and Detection. Cells were infected with HIV-1 by incubating 5 5 mutation in housekeeping genes even though DNA repair cells with NL4-3 (400 TCID50/10 cells or 600 TCID50/10 cells) in 0.5 ml of culture systems are active in these cells (40). How these radically medium at 37°C for 4 h. After HIV-1 challenge, cells were washed with culture different mutation rates are maintained is still unknown. The medium and plated in five wells in a 48-well plate (1 ϫ 105 cells per well). Virus replication was measured every 3 days after HIV-1 challenge by p24 ELISA specific regulation mechanisms for the activity of cytidine deami- gag nases are also not understood, despite the importance of these according to the manufacturer’s protocol (ZeptoMetrix Corporation). P24 levels were normalized for the cell number measured by using the XTT assay for genome stability. We have observed that NF-IL6 (3). HUT78 cells expressing the gene indicated were infected with ⌬vif HIV-1 binds to AID (S.M.K., unpublished data). If NF-IL6 inhibits the 4 (600 TCID50/5 ϫ 10 cells) in 0.5 ml of culture medium at 37°C for overnight. cytidine deaminase activity of AID and other members of the P24gag levels in culture supernatants from five wells were measured 8 days APOBEC family, as it does that of APOBEC3G, NF-IL6 may be after HIV-1 challenge. For HIV-1 infection and single-cell FACS analysis, un- involved in the regulation of mutation frequency. sorted cells expressing the genes indicated were infected overnight with ⌬vif 5 6 NF-IL6 may have evolved to negatively regulate APOBEC3G, HIV-1-GFP (10 TCID50/10 cells) in 2 ml of culture medium at 37°C. to limit DNA mutations, and to ensure the genomic stability necessary for proper physiological function. However, this pro- Viral DNA PCR. Total cellular DNA from the cells indicated was prepared by using tective mechanism appears to backfire during HIV-1 infection. QIAamp Blood Kit (Qiagen) 7 days after HIV-1 challenge. DNA was amplified by 35 cycles of denaturation (94°C, 30 s), annealing (55°C, 30 s), and extension (72°C, In this situation, inhibition of APOBEC3G by NF-IL6 actually 60 s) under standard conditions. Primer pairs for amplification were previously facilitates viral reverse transcription and the ensuing replication described (22, 23). PCR products were analyzed by electrophoresis in a 1.5% of HIV-1. It appears that HIV-1 exploits the interaction between agarose gel with a 1-kb DNA ladder (Invitrogen) as a marker. APOBEC3G and NF-IL6, which is critical for genomic stability, for viral activation. Immunoprecipitation and Immunoblotting. 293T cells were seeded at 1.5 ϫ 106 cells per 60-mm dish. Twenty-four hours later, cells were transfected with 3 ␮g Materials and Methods of various plasmids by using the calcium phosphate coprecipitation technique. Plasmids and Viruses. The coding sequences of NF-IL6, NF-IL6(S220A, S221A), Two days later, the cells were lysed for 20 min in ice in buffer containing 10 mM and NF-IL6(S288A) were inserted into the retroviral expression vector pBMN- CHAPS, 50 mM NaCl, 20 mM Tris (pH 7.5) and cleared by centrifugation. The IRES-Lyt2␣Ј by using BamHI and SalI restriction sites. pBMN-control-IRES- lysates were immunoprecipitated with anti-HA mAb (clone HA-7, Sigma) and Lyt2␣Ј was used as control (22). The human APOBEC3G-HA vector was a kind immunoblotted with anti-GST mAb (G1160, Sigma) and anti-mouse-HRP con- gift from N.R. Landau (New York University, New York) (15). HXB-CD5 was jugate (A9044, Sigma). Blots were visualized with ECL Plus Western Blotting derived from HXB2 by fusion of the mouse CD5 to the nef reading frame. ⌬vif Detection System (GE Healthcare). GST fusion proteins were purified accord- HIV-1 (NL4-3) was created by the deletion of amino acids 83–170 in Vif by PCR. ing to the manufacturer’s protocol (Amersham Pharmacia). The deletion fragment was amplified with the following primers: 5Ј- ATCGCCATAGAATGGCCTAGTGTTAGGAAACTGACA-3Ј and 5Ј-TTCTGAAATG- HIV-1 DNA Sequencing. A 220-bp fragment (nucleotides 450–670 of pNL4-3, GATAAACAGCAGTT-3Ј. This fragment of vif was inserted into the PflMI M19921) was amplified with Pfu Ultra DNA polymerase (Stratagene) by using the (nucleotide 5297) and EcoRI (nucleotide 5743) sites of pNL4-3. ⌬vif HIV-1-GFP R and 5NC primer pair (23). The amplicon was cloned into pCR-Blunt II-TOPO was created by the insertion of GFP into the BlpI (nucleotide 8853) and XhoI (Invitrogen) and sequenced by using the flanking M13 reverse and forward (nucleotide 8887) sites of the pNL4-3 containing the vif deletion. ⌬vif HIV-1 primers. and ⌬vif HIV-1-GFP transfected into 293T cells and levels were quantified by p24 ELISA using SupT1 cells. ACKNOWLEDGMENTS. We thank S.C. Peiper and H. Kikutani for critical review of the manuscript, N.R. Landau for the gift of the APOBEC3G-HA vector, C. Benike and M. Fujishita for technical assistance, and T. Merigan and D. Cell Culture and Primary CD4؉ T Cell Isolation. Human peripheral blood Katzenstein for generously sharing the Stanford University Shared HIV-1 mononuclear cells were isolated by Ficoll gradient centrifugation. Depletions facility. S.M.K. was supported by The Osaka Foundation for the Promotion of of B cells (Dynabeads CD19, DYNAL), monocytes (Dynabeads CD14, DYNAL), Clinical Immunology and a grant-in-aid from the 21st Century Center of and CD8ϩ T cells (Dynabeads CD8, DYNAL) were accomplished with biomag- Excellence Program of the Ministry of Education, Culture, Sports, Science and netic beads as described by the manufacturer. Cells were cultured in RPMI 1640 Technology, Japan.

15026 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0807269105 Kinoshita and Taguchi Downloaded by guest on September 23, 2021 1. Folks T, et al. (1986) Susceptibility of normal human lymphocytes to infection with 22. Kinoshita S, Chen BK, Kaneshima H, Nolan GP (1998) Host control of HIV-1 parasitism HTLV-III/LAV. J Immunol 136:4049–4053. in T cells by the nuclear factor of activated T cells. Cell 95:595–604. 2. Zack JA, et al. (1990) HIV-1 entry into quiescent primary lymphocytes: Molecular 23. von Schwedler U, Song J, Aiken C, Trono D (1993) Vif is crucial for human immunode- analysis reveals a labile, latent viral structure. Cell 61:213–222. ficiency virus type 1 proviral DNA synthesis in infected cells. J Virol 67:4945–4955. 3. Kinoshita S, et al. (1997) The T cell activation factor NF-ATc positively regulates HIV-1 24. Henderson AJ, Zou X, Calame KL (1995) C/EBP proteins activate transcription from the replication and gene expression in T cells. Immunity 6:235–244. human immunodeficiency virus type 1 in macrophages/ 4. Sheehy AM, Gaddis NC, Choi JD, Malim MH (2002) Isolation of a human gene that monocytes. J Virol 69:5337–5344. inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646–650. 25. Tesmer VM, Rajadhyaksha A, Babin J, Bina M (1993) NF-IL6-mediated transcriptional 5. Jarmuz A, et al. (2002) An anthropoid-specific locus of orphan C to U RNA-editing activation of the long terminal repeat of the human immunodeficiency virus type 1. enzymes on chromosome 22. Genomics 79:285–296. Proc Natl Acad Sci USA 90:7298–7302. 6. Muto T, Muramatsu M, Taniwaki M, Kinoshita K, Honjo T (2000) Isolation, tissue 26. Buckner AE, Tesmer VM, Bina M (2002) Regulation of HIV-1 transcription by NF-IL6 in distribution, and chromosomal localization of the human activation-induced cytidine activated Jurkat T cells. Virus Res 89:53–63. deaminase (AID) gene. Genomics 68:85–88. 27. Buck M, Zhang L, Halasz NA, Hunter T, Chojkier M (2001) Nuclear export of phosphor- 7. Mangeat B, et al. (2003) Broad antiretroviral defence by human APOBEC3G through ylated C/EBP␤ mediates the inhibition of albumin expression by TNF-␣. EMBO J lethal editing of nascent reverse transcripts. Nature 424:99–103. 20:6712–6723. 8. Rosler C, Kock J, Malim MH, Blum HE, von Weizsacker F (2004) Comment on ‘‘Inhibition 28. Strebel K, et al. (1987) The HIV ‘A’ (sor) gene product is essential for virus infectivity. of hepatitis B virus replication by APOBEC3G.’’ Science 305:1403. Nature 328:728–730. 9. Chen H, et al. (2006) APOBEC3A is a potent inhibitor of adeno-associated virus and 29. Gabuzda DH, et al. (1992) Role of vif in replication of human immunodeficiency virus retrotransposons. Curr Biol 16:480–485. type 1 in CD4ϩ T lymphocytes. J Virol 66:6489–6495. 10. Harris RS, et al. (2003) DNA deamination mediates innate immunity to retroviral 30. Camaur D, Trono D (1996) Characterization of human immunodeficiency virus type 1 infection. Cell 113:803–809. Vif particle incorporation. J Virol 70:6106–6111. 11. Zhang H, et al. (2003) The cytidine deaminase CEM15 induces hypermutation in newly 31. Heinzinger NK, et al. (1994) The Vpr protein of human immunodeficiency virus type 1 synthesized HIV-1 DNA. Nature 424:94–98. influences nuclear localization of viral nucleic acids in nondividing host cells. Proc Natl 12. Lecossier D, Bouchonnet F, Clavel F, Hance AJ (2003) Hypermutation of HIV-1 DNA in Acad Sci USA 91:7311–7315. the absence of the Vif protein. Science 300:1112. 32. Natsuka S, et al. (1992) differentiation-specific expression of NF-IL6, a 13. Marin M, Rose KM, Kozak SL, Kabat D (2003) HIV-1 Vif protein binds the editing transcription factor for interleukin-6. Blood 79:460–466. APOBEC3G and induces its degradation. Nat Med 9:1398–1403. 33. Cron RQ, et al. (2000) NFAT1 enhances HIV-1 gene expression in primary human CD4 14. Sheehy AM, Gaddis NC, Malim MH (2003) The antiretroviral enzyme APOBEC3G is T cells. Clin Immunol 94:179–191. degraded by the proteasome in response to HIV-1 Vif. Nat Med 9:1404–1407. 34. Macian F, Lopez-Rodriguez C, Rao A (2001) Partners in transcription: NFAT and AP-1. 15. Mariani R, et al. (2003) Species-specific exclusion of APOBEC3G from HIV-1 virions by Oncogene 20:2476–2489. Vif. Cell 114:21–31. 35. Martin A, et al. (2002) Activation-induced cytidine deaminase turns on somatic hyper- 16. Sasada A, et al. (2005) APOBEC3G targets human T-cell leukemia virus type 1. Retro- mutation in hybridomas. Nature 415:802–806. virology 2:32. 36. Muramatsu M, et al. (2000) Class switch recombination and hypermutation require 17. Russell RA, et al. (2005) Foamy virus Bet proteins function as novel inhibitors of the activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell APOBEC3 family of innate antiretroviral defense factors. J Virol 79:8724–8731. 102:553–563. 18. Akira S, et al. (1990) A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP 37. Okazaki IM, et al. (2003) Constitutive expression of AID leads to tumorigenesis. J Exp family. EMBO J 9:1897–1906. Med 197:1173–1181. 19. Akira S, Kishimoto T (1997) NF-IL6 and NF-kappa B in cytokine gene regulation. Adv 38. Komohara Y, et al. (2007) Expression of APOBEC3G in kidney cells. Tissue Antigens Immunol 65:1–46. 69:95–98. 20. Nakajima T, et al. (1993) Phosphorylation at threonine-235 by a ras-dependent mito- 39. Di Noia J, Neuberger MS (2002) Altering the pathway of immunoglobulin hypermu- gen-activated protein kinase cascade is essential for transcription factor NF-IL6. Proc tation by inhibiting uracil-DNA glycosylase. Nature 419:43–48. Natl Acad Sci USA 90:2207–2211. 40. Martin A, Scharff MD (2002) AID and mismatch repair in antibody diversification. Nat 21. Matsusaka T, et al. (1993) Transcription factors NF-IL6 and NF-kappa B synergistically Rev Immunol 2:605–614. activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. 41. Hitoshi Y, et al. (1998) Toso, a cell surface, specific regulator of Fas-induced apoptosis Proc Natl Acad Sci USA 90:10193–10197. in T cells. Immunity 8:461–471. IMMUNOLOGY

Kinoshita and Taguchi PNAS ͉ September 30, 2008 ͉ vol. 105 ͉ no. 39 ͉ 15027 Downloaded by guest on September 23, 2021