Transgenic Mice Granulysin-Mediated Tumor Rejection In

Granulysin-Mediated Tumor Rejection in Transgenic Mice Lisa P. Huang, Shu-Chen Lyu, Carol Clayberger and Alan M. Krensky This information is current as of October 1, 2021. J Immunol 2007; 178:77-84; ; doi: 10.4049/jimmunol.178.1.77 http://www.jimmunol.org/content/178/1/77 Downloaded from References This article cites 64 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/178/1/77.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Granulysin-Mediated Tumor Rejection in Transgenic Mice1

Lisa P. Huang, Shu-Chen Lyu, Carol Clayberger, and Alan M. Krensky2

Granulysin (GNLY) is a cytolytic molecule expressed by human CTL and NK cells with activity against a variety of tumors and microbes, including Mycobacterium tuberculosis. Although the molecular mechanism of GNLY-induced apoptosis of Jurkat T cells is well defined in vitro, no direct evidence for its in vivo effects has been demonstrated. Because there is no murine homologue of GNLY, we generated mice expressing GNLY using a bacterial artificial chromosome containing the human GNLY gene and its 5؅ :and 3؅ flanking regions. GNLY is expressed in leukocytes from transgenic mice with similar kinetics as in PBMC from humans GNLY is constitutively expressed in NK cells and, following stimulation through the TCR, appears in T lymphocytes 8–10 days after activation. Both forms of GNLY (9 and 15 kDa) are produced by activated T cells, whereas the 15-kDa form predominates in freshly isolated NK cells from transgenic animals. GNLY mRNA is highest in spleen, with detectable expression in thymus and lungs, and minimal expression in heart, kidney, liver, muscle, intestine, and brain. Allospecific cell lines generated from GNLY transgenic animals showed enhanced killing of target cells. In vivo effects of GNLY were evaluated using the syngeneic T lymphoma tumor C6VL. GNLY transgenic mice survived significantly longer than nontransgenic littermates in response to a lethal Downloaded from tumor challenge. These findings demonstrate for the first time an in vivo effect of GNLY and suggest that GNLY may prove a useful therapeutic modality for the treatment of cancer. The Journal of Immunology, 2007, 178: 77–84.

ranulysin (GNLY)3 is a cytolytic molecule expressed by findings suggest that impaired GNLY expression correlates with human CTL and NK cells with activity against a variety tumor progression. In another recent study, Pages et al. (31) found G of tumors (1–6) and microbes (7–12), including Mycobac- GNLY among other markers in infiltrating cells in colorectal can- http://www.jimmunol.org/ terium tuberculosis (13). GNLY was first identified as part of a search cer. As compared with tumors with signs of early metastatic in- for genes expressed by T lymphocytes late after T cell activation (14, vasion, tumors with GNLY-expressing infiltrating cells had no ev- 15). It belongs to the saposin-like protein family that includes idence of invasion and were independently associated with amoebapores and NK lysin and is characterized by a conserved three- improved survival (31). These two studies suggest that GNLY may dimensional structure (10, 16). GNLY is expressed in a variety of be a valid prognostic indicator and that it may be used to develop disease settings as diverse as infection (17–25), autoimmunity (17), an effective tumor therapeutic. and transplant rejection (26–28). Recent studies show that GNLY Because no murine homolog for GNLY has been identified, we also has chemoattractant and proinflammatory activities (29). generated GNLY transgenic mice to test its in vivo biological func- by guest on October 1, 2021 Both biologic and clinical studies strongly suggest that GNLY tion. We report in this study that GNLY transgenic mice have nor- may also function as a tumoricidal agent (6, 10, 30–32). The mal development and fertility and no abnormal phenotype when mechanism of GNLY-induced apoptosis of Jurkat T cells in vitro housed in a pathogen-free environment. These mice express is well defined and involves a novel pathway of cell killing (2, 10). GNLY similarly to that in human T and NK cells in vitro and in Two clinical studies suggest that GNLY may be important in pa- vivo and in resting and activated states. Transgenic mice exhibit an tients with cancer. Kishi et al. (6) correlated GNLY expression enhanced in vivo response against the T lymphoma C6VL com- with clinical outcome in cancer patients. Progression of cancer was pared with littermates, giving rise to improved tumor rejection and associated with decreased GNLY expression in peripheral NK survival. This is the first demonstration of an in vivo action of cells in comparison with controls and tumor-free patients. In con- GNLY and suggests that GNLY, or its derivative peptides (6, 30), trast, perforin expression was similar in all three groups. These may prove useful as a cancer therapeutic.

Materials and Methods Department of Pediatrics, Stanford University School of Medicine, Stanford, CA 94305 Generation of transgenic mice Received for publication August 14, 2006. Accepted for publication October The DNA fragment used for the transgene was human bacterial artificial 20, 2006. chromosome (BAC) clone RP11-439L14 (Chori Children’s Hospital Oak- The costs of publication of this article were defrayed in part by the payment of page land Research Institute). This BAC clone is constructed in the BAC vector charges. This article must therefore be hereby marked advertisement in accordance pBACe3.6 and grows in Luria-Bertani medium supplemented with 20 with 18 U.S.C. Section 1734 solely to indicate this fact. ␮g/ml chloramphenicol. The BAC is 186 kb, covering four genes (partial 1 This research was supported by National Institutes of Health Grant AI43348 (to small nuclear ribonucleoprotein (SnRNP) assembly defective 1 homologue, A.M.K.). A.M.K. is the Shelagh Galligan Professor of Pediatrics. surfactant pulmonary-associated protein B (SFTPB), GNLY, and basic helix-loop-helix transcription factor 6). It was streaked to single colonies 2 Address correspondence and reprint requests to Dr. Alan M. Krensky, Department of Pediatrics, Stanford University School of Medicine, Center for Clinical Science from a bacterial Luria-Bertani agar stab culture in host Escherichia coli Research 2105, 300 Pasteur Drive, Stanford, CA 94305-5164. E-mail address: DH10. Ten single colonies were purified and confirmed by two different [email protected] GNLY PCR sets that cover exons 1–4. BAC DNA was purified to micro- injection quality and quantity. Size, concentration, and purity were con- 3 Abbreviations used in this paper: GNLY, granulysin; BAC, bacterial artificial chromosome; Ct, cycle threshold; FloKA, flow-based killing assay; GUS, ␤-glucoroni- firmed by restriction enzyme digestions and clamped homogeneous electric dase; qRT-PCR, quantitative real-time RT-PCR; SnRNP, small nuclear ribonucleo- field gel electrophoresis. BAC DNA was microinjected into embryonic protein; SFTPB, surfactant pulmonary-associated protein B. stem cells and offspring were produced. DNA was isolated from mouse ϫ tails and analyzed by PCR using two pairs of GNLY (CBA C57BL/6)F1 Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$2.00 gene-specific probes: pair 1, GNLY 5Ј exon 1 (GGGCCCTCCTGCTC www.jimmunol.org 78 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE

CTTGCAGCCATGCTCCTGGGC)and3Јexon2(GCAGGGTGCAGGGG GCAGGAAGTCTGCCTTGAACA), generating a 469-bp product; and pair 2 GNLY 5Ј exon 3 (GGTCTTCTCTCGTCTGAGCCCTGAGTACT ACGACC) and GNLY 3Ј exon 4 (CTGTAGTCACGGCCCAGCTCCTG TGTTTTGGTCAA), generating a 668-bp product. The following condi- tions were used in a GeneAmp PCR system 9700 Thermocycler (Applied Biosystems): denaturing at 94°C for 1 min, followed by 40 cycles of 30 s at 94°C, 30 s at 65°C, and 1 min at 72°C; ﬁnal extension at 72°C for 10 min. For each PCR, primers targeting the endogenous gene Nemo-like kinase 245-bp product were included simultaneously: Nemo-like kinase 5-exon 2 (CAGTAACAGATCCAAGAGATGGAAAGAGAGTAGC) and 3-control-RC (GGCATAAACTATAGCTGAATTATTCCATGCCCCC). Five mice expressing the transgene were backcrossed for more than eight generations with wild-type C57BL/6 mice or six generations with CBA/J mice, producing independent lines of GNLY heterozygous offspring on pure C57BL/6 or CBA/J backgrounds. Mice and cell lines CBA/J (H-2k) mice were purchased from The Jackson Laboratory, and C57BL/6 (H-2b) mice were purchased from Charles River Laboratories. All mice were housed at the Laboratory Animal Facility at Stanford Uni- versity Medical Center. Studies reported in this work were performed using

protocols approved by the institutional review board. C6VL is an MHC Downloaded from class Iϩ, MHC class IIϪ T cell lymphoma cell line of C57BL/6 mouse origin (33). The RMA-S cell line, derived from a C57BL/6 mouse, is a T lymphoma devoid of internally derived antigenic peptides and that ex- presses low levels of MHC class I (34). EL4.F15, a mouse thymoma (H-2b) defective in Fas signaling, was a gift from M. Simon (Max-Planck-Institut for Immunbiology, Freiburg, Germany) (35). YAC-1, a mouse lymphoma established by inoculation of the Moloney leukemia virus into a newborn A/Sn mouse, is a target for NK cells (36). http://www.jimmunol.org/ NK cell purification and activation of splenocytes Murine NK cells were isolated from GNLYϩ/Ϫ splenocytes by negative selection using NK cell MACS isolation kits (Miltenyi Biotec); Ͼ98% stained with the NK cell-specific Ab DX5 (BD Biosciences) by FACS analysis. Human NK cells were purified from PBMC by negative selection using NK cell MACS isolation kits (Miltenyi Biotec), and purity was confirmed by FACS analysis using the human NK-specific Ab CD56 (BD Biosciences; clone B159). Splenocytes were cultured in 24-well plates precoated with 0.2 ␮g/ml anti-CD3 (BD Biosciences; clone 145-2c11) at 106 by guest on October 1, 2021 cells/ml in Medium I (RPMI 1640 supplemented with 10% heat-inactived FCS (HyClone), 2 mM L-glutamine, 100 U/ml penicillin-streptomycin, 0.05 mM 2-ME) plus 0.2 ␮g/ml anti-CD28 Ab (BD Biosciences; clone 37.51). A total of 50 U/ml IL-2 (TECIN) was added to the culture daily starting on day 5. Intracellular GNLY staining and flow cytometric analysis One million cells were first blocked with unlabeled Abs against CD16 (FcRIII) and CD32 (FcRII) (Caltag Laboratories) and then labeled with fluorochrome-conjugated Abs specific for CD4 (clone H129.19), CD8 (clone 53-6.7), or NK (clone DX5) (all from BD Pharmingen). After fix- ation and permeabilization (Cytofix/Cytoperm; BD Pharmingen), samples were stained with rabbit anti-GNLY antiserum (1) diluted 1/10,000 in staining buffer, followed by FITC-conjugated goat anti-rabbit secondary Ab diluted 1/2,000, or with PE-granzyme B Ab (Caltag Laboratories). Flu- orescence was analyzed using a FACSCalibur four-color flow cytometry system (BD Biosciences). All FACS results are representative of three or more independent experiments.

Quantitative real-time RT-PCR (qRT-PCR) FIGURE 1. GNLY expression in transgenic mice. A, Schematic repre- Total RNA was isolated from cells (stabilized in RNAlater solution when sentation of the human GNLY gene and its position in BAC RP11-439L14. necessary; Ambion) using the RNeasy Mini Kit (Qiagen). One-half micro- E ϭ Exon. B, Fluorescent in situ hybridization for transgenic line A (upper gram of total RNA from each sample was reverse transcribed into cDNA panel) and transgenic line B (lower panel). There is a single transgene using Superscript III (Invitrogen Life Technologies). The qRT-PCR was integration site for each line, at chromosome 14E2 in line A and at chro- performed using A 7900HT Fast Real-Time PCR System (Applied Bio- mosome 18E for line B. C, qRT-PCR analysis of tissue distribution of systems) using validated primer sets. GNLY and ␤-glucoronidase (GUS) GNLY mRNA in GNLYϩ/Ϫ mice. Each value represents the average Ϯ primers were designed using software Primer Express (Applied Biosys- SEM of three mice. tems) and are as follows: GNLY, forward, 5Ј-GATAAGCCCACCC AGAGAAGTG-3Ј, and reverse, 5Ј-CGTGACCTCCCCGTCCTA-3Ј; mouse GUS, forward, 5Ј-GATTCAGATATCCGAGGGAAAGG-3Ј, and reverse, 5Ј-CCAACGGAGCAGGTTGAAAT-3Ј; human GUS, forward, uct in a particular sample was determined by interpolation from a standard 5Ј-CGCACAAGAGTGGTGCTGAG-3Ј, and reverse, 5Ј-CACGATG curve of cycle threshold (Ct) values generated from dilution series with GCATAGGAATGGG-3Ј. All other primers were purchased (Applied Bio- known amounts of gene product. Each gene is expressed as a relative ratio systems). Thermal cycler parameters were as follows: 2 min at 50°C; of gene to the housekeeping gene GUS. The expression level of a gene was Ϫ⌬⌬Ct ⌬⌬ ϭ ⌬ Ϫ heated to 95°C for 10 min; 40 ampliﬁcation cycles at 95°C for 15 s (de- also represented as fold increase (2 ), where Ct [ Ct(stimulated)] ⌬ ⌬ ϭ Ϫ naturing), 60°C for 1 min (annealing and extension). The amount of prod- [ Ct(unstimulated)], and Ct [Ct(sample)] [Ct(GUS)]. All PCR assays were The Journal of Immunology 79

FIGURE 2. GNLY expression in activated human PBMC and mouse splenocytes. A, Kinetics of GNLY expression in activated human PBMC (initial concentration of PBMC is 1–2 ϫ 106/ml), measured Downloaded from by qRT-PCR. B–D, Kinetics of GNLY, perforin, and granzyme B expression in activated splenocytes from GNLYϩ/Ϫ mice. E, Western blot of GNLY, perforin, and granzyme B in activated splenocytes from GNLYϩ/Ϫ mice. Jab-1 protein was used as a http://www.jimmunol.org/ loading control. F, Flow cytometry analysis of GNLY and granzyme B colocalization in activated GNLYϩ/Ϫ CD8ϩ T cells on day 12 after activation of splenocytes. Bars in A–D represent the average Ϯ SD of three or more experiments using cells from different donors. by guest on October 1, 2021

performed in triplicate. Results are representative of two or more independent For FloKA, target cells (El4.F15, RMA-S, or YAC-1) were washed experiments. three times with PBS and labeled with 1 ␮M CFSE (Molecular Probes) for 15 min at 37°C. The reaction was stopped by addition of RPMI 1640 Flow-based killing assay (FloKA) supplemented with 10% FCS. Cells were washed twice with PBS supplemented with 2% FCS, resuspended in Medium I plus 50 U/ml IL-2 (for For allospeciﬁc CTL, spleens were harvested from CBA/J mice that had 5 7 CTL) or 50 ng/ml IL-15 (for NK cells). Effector cells were mixed with 10 been primed 4 wk prior by i.p. injection with 10 irradiated (10,000 rad) labeled target cells in 50 ␮l of medium into 96-well plates. A total of 1 EL4.F15 cells. Splenocytes were cultured in Medium I in 24-well plates at ␮g/ml 7-aminoactinomycin D (Calbiochem) was added to each well im- 2 ϫ 106 ϫ 5 cells/well. Irradiated (10,000 rad) EL4.F15 (2 10 /well) were mediately before FACS analysis. added on day 0 and every week thereafter. Cultures were supplemented with 50 U/ml rIL-2 beginning on day 7. Immediately before FloKA, cells Tumor challenge were puriﬁed over Ficoll, washed twice, and resuspended in Medium I and 50 U/ml IL-2. C6VL and RMA-S tumor cell lines used for challenge were expanded in For NK cells, splenocytes were cultured in 24-well plates in Medium I vitro in Medium I and injected within 1 wk of culture. Tumor cells were plus 50 ng/ml IL-15 (R&D Systems) for 8 days. NK cells were isolated by washed three times and diluted in PBS. Eight- to 10-wk-old mice negative selection using NK cell MACS isolation kits (Miltenyi Biotec). (C57BL/6 background) were injected i.p. with 5,000 C6VL cells or 70,000 Purity was Ͼ98% purity, as determined by staining with the DX5 Ab and RMA-S cells in 500 ␮l of PBS. Survival of mice was monitored daily for FACS analysis immediately before FloKA. at least 60 days after tumor injection. For the RMA-S tumor, mice were 80 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE

FIGURE 3. GNLY expression in freshly isolated, unstimulated NK cells. A and B, Fold increase in GNLY, granzyme B, and perforin mRNA. Expression in unseparated murine splenocytes (A) or human PBMC (B) was compared with expression in purified NK and non-NK cells. C and D, Western blot of GNLY in the same GNLYϩ/Ϫ (C) and human (D) cells as in A and B. Jab-1 protein was used as a loading control. Each figure is a representative example of at least two independent experiments with similar results. Each value represents the average Ϯ SD of three or more repeated experiments. Jab-1 designates mouse protein, and JAB-1 designates human protein. Downloaded from weighed daily and sacrificed when their body weight increased by 25%. GNLY expression in activated splenocytes Survival statistical analysis was performed using the LogRank method in GraphPad Prism software. GNLY is expressed late after activation of human PBMC (Fig. 2A) (1). To characterize GNLY protein expression in GNLYϩ/Ϫ ani- Immunofluorescence cell staining and microscopy mals, splenocytes were activated with anti-CD3 and anti-CD28

Cells were immobilized on poly(L-lysine)-coated slides, and exocytosis Abs, and aliquots were removed on days 0–12 for assessment of was conducted, as previously described (1). GNLY mRNA (by qRT-PCR) and protein (by Western blot) ex- http://www.jimmunol.org/ pression (Fig. 2, B–D). On day 8, 86% of cells were CD8ϩ, and Results this increased to 95% CD8ϩ at day 12. In GNLYϩ/Ϫ cultures, GNLY transgenic mice GNLY mRNA was expressed with nearly identical kinetics to that Transgenic mice were generated to investigate the in vivo function in activated human PBMC (Fig. 2, A and B), and expression was of GNLY. Initial attempts used cDNA encoding the 9- or 15-kDa significantly delayed compared with that of perforin and granzyme forms of GNLY driven by either the mouse TCR promoter (a gift B. Similar to activated human PBMC, two forms of GNLY, 9 and from M. Davis, Stanford University, Stanford, CA) or the gran- 15 kDa, are detected (Fig. 2E) (1). Granzyme B expression is zyme B promoter (a gift from T. Ley, Washington University, St. detected early (by 2 days after activation), and expression in- by guest on October 1, 2021 Louis, MO). Although in both cases the cDNA was incorporated creases dramatically at days 10–14. Glycosylation of granzyme B into the mouse DNA, neither mRNA nor protein could be detected, results in a number of larger species detected from days 10 to 14 suggesting that tissue-specific promoter elements were lacking in after activation (37). Using intracellular staining and FACS anal- these constructs or that certain intron(s) or more distant gene re- ysis of anti-CD3/anti-CD28-activated splenocytes on day 12 of gions were required for the expression of this molecule. Therefore, culture, 22% of the cells express GNLY and essentially all of these we obtained a human BAC (RP11-439L14) that contains the com- coexpress granzyme B (Fig. 2F). plete GNLY gene and 3Ј and 5Ј flanking regions (Fig. 1A). Eight GNLY transgenic (GNLYϩ/Ϫ) mice were derived. Seven of eight GNLY expression in NK cells mice gave germline transmission, and four of these seven lines Because NK cells express perforin and granzymes (38), we rea- express GNLY protein. Lines A and B express GNLY at the high- soned that the low level of GNLY expression in freshly isolated est levels and appear indistinguishable in degree of transgene ex- splenocytes (Fig. 1C) might be attributed to NK cells. To investi- pression and phenotype. They are both from parental strain gate this, NK and non-NK cells were isolated from GNLYϩ/Ϫ ϫ B6CBAF1/J (strain details: F1 hybrid from C57BL/6J female splenocytes and from human PBMC (Fig. 3, A and B). For both CBA/J male). Both lines were used in the experiments reported human and mouse cells, essentially all of the mRNA encoding with similar results. The two selected lines were used separately in GNLY, granzyme B, and perforin was found in the NK population, individual experiments, and results obtained were identical. and the fold increase of each of these genes in NK cells relative to GNLYϩ/Ϫ mice display normal development, fertility, and no ab- splenocytes or PBMC was similar for mouse and human NK cells, normal phenotype when housed in a specifically pathogen-free en- respectively. Lysates from these cells were analyzed by Western vironment. Fluorescent in situ hybridization indicates a single blot for GNLY protein (Fig. 3, C and D). Densitometry of the transgene integration site for each line, at chromosome 14E2 in Western blots revealed that in human NK cells, expression of the line A (Fig. 1B, upper panel) and at chromosome 18E in line B 9- and 15-kDa forms is similar: 15 kDa/JAB-1 ϭ 0.8; 9 kDa/JAB- (Fig. 1B, lower panel). 1 ϭ 0.46. In contrast, in NK cells isolated from GNLYϩ/Ϫ spleens, mRNA tissue distribution of the GNLY transgene was assessed only the 15-kDa form is detectable and, by densitometry, the by qRT-PCR (Fig. 1C). The highest expression was observed in amount is less than in human NK cells (15 kDa/Jab-1 ϭ 0.26). spleen, with detectable expression in the thymus and lung, and GNLY was not detected in non-NK cells from either human minimal expression in heart, kidney, liver, muscle, intestine, and PBMC or spleens from GNLYϩ/Ϫ mice. brain. These findings demonstrate that GNLY is largely expressed In contrast to the later expression of GNLY in GNLYϩ/Ϫ spleno- in immune organs. No GNLY mRNA was detected in any of these cytes activated by anti-CD3 and anti-CD28 Abs, IL-15 induces organs in nontransgenic littermates using the same qRT-PCR expression of both forms of GNLY within 4 days (Fig. 4A). After probe (data not shown). 8 days of culture with IL-15, approximately half of the cells are The Journal of Immunology 81 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 4. GNLY expression in IL-15-stimulated cells. A, Splenocytes from GNLYϩ/Ϫ mice were cultured with IL-15, and expression of GNLY, granzyme B, and perforin was determined by Western blot. ␣-Actinin protein was used as a loading control. B and C, Expression of GNLY in CD4, CD8, and NK cells after 8 days of culture of GNLYϩ/Ϫ and GNLYϪ/Ϫ FIGURE 5. GNLY expression in CD8ϩ-allospeciﬁc cells increases ap- splenocytes with IL-15. D, GNLY is exocytosed upon the simulation of optosis. A, Allogeneic CTL from GNLYϩ/Ϫ and nontransgenic littermates TCR. Splenocytes from GNLYϩ/Ϫ mice were activated with anti-CD3 and induce apoptosis in EL4.F15 target cells, as measured by FloKA (E:T ϭ anti-CD28 (left panels) or IL-15 (right panels) for 10–12 days and then 5:1). The R1 gate includes target cells in late stages of apoptotic cell death added to plates precoated with IgG1 (top panels) or anti-CD3 Ab (lower with shrinking cell size. The R2 gate includes the early apoptotic target panels). Four hours later, cells were stained with anti-GNLY antiserum cells. Target: CFSE-labeled target cells only. 7-AAD, 7-aminoactinomycin (green) and propidium iodide (red). Cultures enriched for CD8ϩ T cells D; FSC, forward light scatter. B, Graphic representation of FloKA results (left panels), but not NK cells (right panels) exocytose GNLY when trig- at different E:T ratios over time (R1 gate only). p ϭ 0.04 (1 h); p ϭ 0.04 gered with anti-CD3 Ab. (2 h); p ϭ 0.08 (3 h); p ϭ 0.12 (4 h). Results are representative of three similar experiments.

CD8ϩ, half are NK cells, and a small minority are CD4ϩ (Fig. 4B). One-third of NK cells, but only 5% of CD8ϩ cells, express GNLY (Fig. 4B). GNLY and perforin levels decreased by day 12 because GNLY after stimulation with anti-CD3 Ab (Fig. 4D, upper and some cells were undergoing apoptosis. Thus, NK cell expression lower right panels). FACS analysis of these cells revealed that of GNLY is both constitutive and inducible, but T cells express only NKT cells (among NK cells) released GNLY in response to GNLY only after activation through the TCR. anti-CD3 (data not shown).

GNLY is exocytosed upon stimulation of the TCR Effects of GNLY expression on in vitro cytotoxicity We previously showed that stimulation of activated human CD8ϩ To assess the role of GNLY in cytotoxicity in vitro, we adapted the cells with anti-CD3 Ab results in granule exocytosis, releasing FloKA described by Ley and coworkers (39). Four weeks after intracellular GNLY stores into the extracellular environment (1). immunization with allogeneic cells, splenocytes from GNLYϩ/Ϫ Similar exocytosis of GNLY is observed after anti-CD3 mAb animals and from nontransgenic littermates were cultured with ir- treatment of activated cells from GNLYϩ/Ϫ animals (Fig. 4D, up- radiated EL4.F15 cells. On day 14 of culture, these cells were per and lower left panels). In contrast, NK cells do not release assayed for cytotoxicity against CFSE-labeled EL4.F15 target cells 82 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE Downloaded from

FIGURE 7. GNLY protects mice from C6VL tumor, but not RMA-S tumor challenge. A, Nontransgenic littermates (n ϭ 12) and GNLYϩ/Ϫ (n ϭ FIGURE 6. GNLY expression in activated NK cells does not increase 11) mice were challenged with i.p. injection of 5,000 C6VL tumor cells ϩ/Ϫ Ϫ/Ϫ apoptosis. Purified NK cells from GNLY and GNLY splenocytes (median survival: nontransgenic littermates ϭ 27.7 days, GNLYϩ/Ϫ ϭ 32 ϩ Ϫ incubated with IL-15 for 8 days lyse YAC-1 target cells at various E:T days, p ϭ 0.03). B, Nontransgenic littermates (n ϭ 9) and GNLY / (n ϭ http://www.jimmunol.org/ ratios (2-h incubation), as measured by FloKA. 7-AAD, 7-aminoactino- 8) mice were challenged with i.p. injection of 70,000 RMA-S tumor cells. mycin D; FSC, forward light scatter. The mean survival: nontransgenic littermates ϭ 29.5 days, GNLYϩ/Ϫ ϭ 31.2 days, p ϭ 0.4. Each figure is a representative example of at least three for incorporation of 7-aminoactinomycin D, which measures apo- independent experiments with similar results. ptosis/late cell death (Fig. 5). EL4.F15 cells are unable to signal through Fas, so lysis is mediated mainly by the granule exocytosis 28, 49–51). rGNLY is cytotoxic against a variety of microbes (13, ϩ/Ϫ pathway (35, 39). At early time points (1 and 2 h), GNLY 42, 52) and tumor cells (5, 52); GNLY is coexpressed with per- effector cells show significantly enhanced killing of the targets forin and granzymes in cytotoxic granules in CTL and NK cells by guest on October 1, 2021 over a wide range of E:T ratios. However, by 3–4 h, the difference (13, 53); and increased GNLY expression is associated with im- between the cells expressing GNLY and the nontransgenic litter- proved prognosis in cancer patients (6, 31, 32). This study is the mates controls is much less, especially at higher E:T ratios. Thus, first direct demonstration that GNLY functions in vivo to enhance GNLY plays a role in CTL-mediated lysis. tumor-specific immunity. Similar experiments were conducted to assess the role of GNLY GNLY homologues have been identified for pig (NK-lysin) ϩ/Ϫ in NK cell-mediated cytotoxicity. Splenocytes from GNLY and (54), cow (Bo-lysin) (55), and horse (56), but not for rodents (10). nontransgenic littermates were cultured for 8 days with IL-15, at Although gene disruption in mice has proven highly informative in which time NK cells were isolated using magnetic beads. There defining the function of perforin (57) and granzymes (58), such was no difference in cytotoxicity using YAC-1 (Fig. 6) or RMA-S experiments are not possible for GNLY. Therefore, we engineered cells (data not shown) as targets in the FloKA assay. a transgenic mouse to assess the in vivo effects of GNLY. Initial efforts used a TCR promoter and the human granzyme B promoter, GNLY and tumors in vivo both of which have been used previously to produce transgenic The effects of GNLY expression on tumor rejection in vivo were animals expressing proteins of interest (59, 60). However, no ϩ evaluated in two lymphoma models. CD8 T cells are necessary mRNA or protein was detected in mice using these promoters for and sufficient for protection against the C6VL T cell lymphoma either the 9- or 15-kDa forms of GNLY, suggesting that flanking (40), whereas NK cells are central to rejection of the MHC-defi- and/or intronic sequences are required for expression. ϩ Ϫ cient RMA-S tumor (34). GNLY / mice showed significant pro- GNLY is constitutively expressed in NK cells isolated from hu- tection against the C6VL tumor compared with nontransgenic lit- man PBMC or from GNLYϩ/Ϫ spleens. Although the relative ϩ Ϫ termates ( p ϭ 0.03) (Fig. 7A). Both GNLY / and nontransgenic amounts of GNLY mRNA in human and GNLYϩ/Ϫ NK cells are littermates began to die by day 24 after injection, but the rate of similar, there is substantially more GNLY protein in human than ϩ Ϫ death was slower in the GNLY / group, with 20% of the animals GNLYϩ/Ϫ NK cells, suggesting that GNLY protein expression is surviving Ͼ80 days. However, nontransgenic littermates died rap- controlled in part at the level of translation. Moreover, only the ϩ Ϫ idly, with 100% mortality by 40 days. In contrast, GNLY / and 15-kDa form of GNLY is detectable in GNLYϩ/Ϫ mouse NK cells, nontransgenic littermates injected with the RMA-S tumor showed whereas both the 9- and 15-kDa forms are present in nearly equal similar survival, suggesting that GNLY plays little or no role in amounts in human NK cells. Nevertheless, NK cells from rejection of this tumor (Fig. 6). GNLYϩ/Ϫ mice are capable of expressing high levels of both forms of GNLY when activated by IL-15 (Fig. 4A). This suggests that Discussion mice maintained in a relatively clean facility are not exposed to To date, the in vivo function of GNLY has been inferred from in environmental Ags that induce NK cell activation, altering the pat- vitro assays (5, 9, 13, 30, 41–48) and clinical correlates (6, 17, 26, tern of expression of GNLY. The Journal of Immunology 83

For humans and GNLYϩ/Ϫ mice, GNLY is constitutively ex- without early invasion (31). Sekiya et al. (30) used a murine lung pressed by NK cells and inducible in T cells. We observed that cancer model to show that gene transfer of 9-kDa GNLY is ther- splenocytes from GNLYϩ/Ϫ mice activated with anti-CD3/CD28 apeutic in vivo. In this study, we now show that GNLY expressed show enhanced lysis of targets at early times and at low E:T ratios as a transgene in mice improves outcome for experimental lym- when assayed by FloKA. Additionally, GNLYϩ/Ϫ mice survived phoma compared with wild-type controls. These studies suggest longer than wild-type mice after challenge with the C6VL tumor. that GNLY or its derivatives may prove useful as new therapeutics In contrast, splenocytes from GNLYϩ/Ϫ mice activated with IL-15 with novel mechanisms of action and low toxicity. did not show enhanced lysis of RMA-S tumor cells, and there was ϩ Ϫ no difference in survival of GNLY / mice challenged with this Disclosures tumor in vivo. Thus, transgenic human GNLY plays a role in elim- The authors have no financial conflict of interest. ination of tumors by CD8ϩ T cells, but not by NK cells. This is especially interesting in light of previous in vitro data indicating References that, although both human CD8ϩ T cells and NK cells express ϩ 1. Pena, S. V., D. A. Hanson, B. A. Carr, T. J. Goralski, and A. M. Krensky. 1997. GNLY and kill Cryptococcus neoformans, only the CD8 T cells, Processing, subcellular localization, and function of 519 (granulysin), a human and not the NK cells, use GNLY to kill this fungus (11). late T cell activation molecule with homology to small, lytic, granule proteins. J. Immunol. 158: 2680–2688. The BAC clone contains one partial gene (SnRNP assembly 2. Okada, S., Q. Li, J. C. Whitin, C. Clayberger, and A. M. Krensky. 2003. Intra- defective 1 homologue) and three complete genes SFTPB, GNLY, cellular mediators of granulysin-induced cell death. J. Immunol. 171: 2556–2562. and basic helix-loop-helix transcription factor 6 (also known as 3. Pardo, J., P. Perez-Galan, S. Gamen, I. Marzo, I. Monleon, A. A. Kaspar, S. A. Susin, G. Kroemer, A. M. Krensky, J. Naval, and A. Anel. 2001. A role of HATH6 or ATOH8). The SnRNP assembly defective 1 homologue the mitochondrial apoptosis-inducing factor in granulysin-induced apoptosis. Downloaded from gene is truncated at the 5Ј terminus, and therefore is not expressed J. Immunol. 167: 1222–1229. in the transgenic mice. Using RT-PCR, we detected human SFTPB 4. Kaspar, A. A., S. Okada, J. Kumar, F. R. Poulain, K. A. Drouvalakis, A. Kelekar, D. A. Hanson, R. M. Kluck, Y. Hitoshi, D. E. Johnson, et al. 2001. A distinct mRNA expression in the transgenic mice at a level similar to that pathway of cell-mediated apoptosis initiated by granulysin. J. Immunol. 167: of murine SFTPB. The main function of SFTPB is to lower the 350–356. 5. Gamen, S., D. A. Hanson, A. Kaspar, J. Naval, A. M. Krensky, and A. Anel. surface tension at the air-liquid interface in the alveoli of lung, 1998. Granulysin-induced apoptosis. I. Involvement of at least two distinct path- suggesting that expression of human SFTPB in mice would not ways. J. Immunol. 161: 1758–1764. affect any of the parameters measured in our studies. In humans, 6. Kishi, A., Y. Takamori, K. Ogawa, S. Takano, S. Tomita, M. Tanigawa, http://www.jimmunol.org/ Ͻ M. Niman, T. Kishida, and S. Fujita. 2002. Differential expression of granulysin expression of ATOH8 is restricted to infants 3 years of age (Na- and perforin by NK cells in cancer patients and correlation of impaired granulysin tional Center for Biotechnology Information UniGene Hs.135569). expression with progression of cancer. Cancer Immunol. Immunother. 50: Because all of our studies were conducted in adult mice, we do not 604–614. 7. Krensky, A. M. 2000. Granulysin: a novel antimicrobial peptide of cytolytic T expect expression of this gene to affect any of the parameters lymphocytes and natural killer cells. Biochem. Pharmacol. 59: 317–320. investigated. 8. Wang, Z., E. Choice, A. Kaspar, D. Hanson, S. Okada, S. C. Lyu, A. M. Krensky, The FloKA is more sensitive than the 51Cr release assay and and C. Clayberger. 2000. Bactericidal and tumoricidal activities of synthetic peptides derived from granulysin. J. Immunol. 165: 1486–1490. allows analysis of early steps in apoptosis (39, 61). EL4.F15 tar- 9. Kumar, J., S. Okada, C. Clayberger, and A. M. Krensky. 2001. Granulysin: a gets are defective in signaling through Fas, and thus, lysis is me- novel antimicrobial. Expert Opin. Investig. Drugs 10: 321–329. 10. Clayberger, C., and A. M. Krensky. 2003. Granulysin. Curr. Opin. Immunol. 15: by guest on October 1, 2021 diated chiefly by the granule exocytosis pathway (35). Allospecific 560–564. ϩ/Ϫ cultures from GNLY mice showed significantly enhanced 11. Ma, L. L., C. L. Wang, G. G. Neely, S. Epelman, A. M. Krensky, and C. H. cytolysis at early time points and low E:T ratios compared with Mody. 2004. NK cells use perforin rather than granulysin for anticryptococcal activity. J. Immunol. 173: 3357–3365. nontransgenic littermates. In contrast, purified NK cells from 12. Ramamoorthy, A., S. Thennarasu, A. Tan, D. K. Lee, C. Clayberger, and ϩ/Ϫ GNLY and nontransgenic littermates show equivalent lysis of A. M. Krensky. 2006. Cell selectivity correlates with membrane-specific inter- YAC-1 or RMA-S targets in the FloKA. These studies indicate that actions: a case study on the antimicrobial peptide G15 derived from granulysin. Biochim. Biophys. Acta 1758: 154–163. GNLY can play a role in allospecific cytotoxicity in vitro. The 13. Stenger, S., D. A. Hanson, R. Teitelbaum, P. Dewan, K. R. Niazi, C. J. Froelich, relatively minor effect of GNLY is most likely due to high expres- T. Ganz, S. Thoma-Uszynski, A. Melian, C. Bogdan, et al. 1998. An antimicro- sion of other cytolytic molecules such as perforin and granzymes. bial activity of cytolytic T cells mediated by granulysin. Science 282: 121–125. 14. Donlon, T. A., A. M. Krensky, and C. Clayberger. 1990. Localization of the These molecules most likely overwhelm the measurements at human T lymphocyte activation gene 519 (D2S69E) to chromosome 2p12—q11. higher E:T ratios and longer times in culture. Cytogenet. Cell Genet. 53: 230–231. The identification and characterization of GNLY as an antimi- 15. Manning, W. C., S. O’Farrell, T. J. Goralski, and A. M. Krensky. 1992. Genomic structure and alternative splicing of 519, a gene expressed late after T cell acti- crobial and tumoricidal product of T lymphocytes and NK cells vation. J. Immunol. 148: 4036–4042. suggest a broader, and perhaps more important, role for these cell 16. Anderson, D. H., M. R. Sawaya, D. Cascio, W. Ernst, R. Modlin, A. Krensky, and D. Eisenberg. 2003. Granulysin crystal structure and a structure-derived lytic types in the ongoing war against microbes and provide an addi- mechanism. J. Mol. Biol. 325: 355–365. tional effector mechanism against tumors (3, 26, 43, 45, 62). 17. Raychaudhuri, S. P., W. Y. Jiang, S. K. Raychaudhuri, and A. M. Krensky. 2004. Phagocytes, not lymphocytes, have generally been implicated as Lesional T cells and dermal dendrocytes in psoriasis plaque express increased levels of granulysin. J. Am. Acad. Dermatol. 51: 1006–1008. the important lines of defense against bacteria (21). The roles of 18. Toossi, Z., H. Mayanja-Kizza, A. Kanost, K. Edmonds, M. McHugh, and CTL and NK cells have been more narrowly confined to tumor and C. Hirsch. 2004. Protective responses in tuberculosis: induction of genes for antiviral immunity and certain specific bacterial and parasitic in- interferon-␥ and cytotoxicity by Mycobacterium tuberculosis and during human tuberculosis. Scand. J. Immunol. 60: 299–306. fections (46, 63). GNLY has broad-based clinical relevance as a 19. Oono, T., S. Morizane, O. Yamasaki, Y. Shirafuji, W. K. Huh, H. Akiyama, and diagnostic (biomarker) and potential therapeutic in entities as di- K. Iwatsuki. 2004. Involvement of granulysin-producing T cells in the develop- verse as transplant rejection, cancer, and infectious diseases (6, ment of superficial microbial folliculitis. Br. J. Dermatol. 150: 904–909. 20. Gansert, J. L., V. Kiessler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, 17–25, 30–32). GNLY may also be involved in the normal phys- S. A. Porcelli, R. L. Modlin, and S. Stenger. 2003. Human NKT cells express iologic response that kills dysregulated cells (64). Two clinical granulysin and exhibit antimycobacterial activity. J. Immunol. 170: 3154–3161. 21. Dieli, F., G. Sireci, N. Caccamo, C. Di Sano, L. Titone, A. Romano, P. Di Carlo, studies suggest that GNLY may be important in fighting cancer in A. Barera, A. Accardo-Palumbo, A. M. Krensky, and A. Salerno. 2002. Selective patients. As noted above, Kishi et al. (6) correlated GNLY expres- depression of interferon-␥ and granulysin production with increase of prolifera- sion with clinical outcome in cancer patients. More recently, colo- tive response by V␥9/V␦2 T cells in children with tuberculosis. J. Infect. Dis. 186: 1835–1839. rectal cancer patients have prolonged survival associated with in- 22. Modlin, R. L. 2002. Learning from leprosy: insights into contemporary immu- creased level of GNLY mRNA in effector T cells in tumors nology from an ancient disease. Skin Pharmacol. Appl. Skin Physiol. 15: 1–6. 84 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE

23. Morizane, S., D. Suzuki, K. Tsuji, T. Oono, and K. Iwatsuki. 2005. The role of Granulysin-dependent killing of intracellular and extracellular Mycobacterium CD4 and CD8 cytotoxic T lymphocytes in the formation of viral vesicles. tuberculosis by V␥9/V␦2 T lymphocytes. J. Infect. Dis. 184: 1082–1085. Br. J. Dermatol. 153: 981–986. 44. Hata, A., L. Zerboni, M. Sommer, A. A. Kaspar, C. Clayberger, A. M. Krensky, 24. Takemoto, M., R. Kira, K. Kusuhara, H. Torisu, Y. Sakai, and T. Hara. 2005. and A. M. Arvin. 2001. Granulysin blocks replication of varicella-zoster virus Gene expression profiles in peripheral blood mononuclear cells from patients and triggers apoptosis of infected cells. Viral Immunol. 14: 125–133. with subacute sclerosing panencephalitis using oligonucleotide microarrays. 45. Ma, L. L., J. C. Spurrell, J. F. Wang, G. G. Neely, S. Epelman, A. M. Krensky, J. Neurovirol. 11: 299–305. and C. H. Mody. 2002. CD8 T cell-mediated killing of Cryptococcus neoformans 25. Sun, Q., R. L. Burton, and K. G. Lucas. 2002. Cytokine production and cytolytic requires granulysin and is dependent on CD4 T cells and IL-15. J. Immunol. 169: mechanism of CD4ϩ cytotoxic T lymphocytes in ex vivo expanded therapeutic 5787–5795. Epstein-Barr virus-specific T-cell cultures. Blood 99: 3302–3309. 46. Gansert, J. L., V. Kiessler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, 26. Sarwal, M. M., A. Jani, S. Chang, P. Huie, Z. Wang, O. Salvatierra, Jr., S. A. Porcelli, R. L. Modlin, and S. Stenger. 2003. Human NKT cells express C. Clayberger, R. Sibley, A. M. Krensky, and M. Pavlakis. 2001. Granulysin granulysin and exhibit antimycobacterial activity. J. Immunol. 170: 3154–3161. expression is a marker for acute rejection and steroid resistance in human renal 47. Farouk, S. E., L. Mincheva-Nilsson, A. M. Krensky, F. Dieli, and M. Troye- transplantation. Hum. Immunol. 62: 21–31. Blomberg. 2004. ␥␦ T cells inhibit in vitro growth of the asexual blood stages of 27. Soccal, P. M., R. L. Doyle, A. Jani, S. Chang, O. A. Akindipe, C. Poirier, and Plasmodium falciparum by a granule exocytosis-dependent cytotoxic pathway M. Pavlakis. 2000. Quantification of cytotoxic T-cell gene transcripts in human that requires granulysin. Eur. J. Immunol. 34: 2248–2256. lung transplantation. Transplantation 69: 1923–1927. 48. Walch, M., E. Eppler, C. Dumrese, H. Barman, P. Groscurth, and U. Ziegler. 28. Kotsch, K., M. F. Mashreghi, G. Bold, P. Tretow, J. Beyer, M. Matz, 2005. Uptake of granulysin via lipid rafts leads to lysis of intracellular Listeria J. Hoerstrup, J. Pratschke, R. Ding, M. Suthanthiran, et al. 2004. Enhanced granu- innocua. J. Immunol. 174: 4220–4227. lysin mRNA expression in urinary sediment in early and delayed acute renal 49. Ochoa, M. T., S. Thoma-Uszynski, P. A. Sieling, S. Sabet, S. Cho, A. M. allograft rejection. Transplantation 77: 1866–1875. Krensky, A. Burdick, T. H. Rea, and R. L. Modlin. 2000. Role of granulysin in 29. Deng, A., S. Chen, Q. Li, S. C. Lyu, C. Clayberger, and A. M. Krensky. 2005. immunity to leprosy. Lepr. Rev. 71(Suppl.): S115–S116. Granulysin, a cytolytic molecule, is also a chemoattractant and proinflammatory 50. Ochoa, M. T., S. Stenger, P. A. Sieling, S. Thoma-Uszynski, S. Sabet, S. Cho, activator. J. Immunol. 174: 5243–5248. A. M. Krensky, M. Rollinghoff, E. Nunes Sarno, A. E. Burdick, et al. 2001. T-cell 30. Sekiya, M., A. Ohwada, M. Katae, T. Dambara, I. Nagaoka, and Y. Fukuchi. release of granulysin contributes to host defense in leprosy. Nat. Med. 7: 174–179.

2002. Adenovirus vector-mediated transfer of 9 kDa granulysin induces DNA Downloaded from fragmentation in HuD antigen-expressing small cell lung cancer murine model 51. Sakai, M., K. Ogawa, A. Shiozaki, S. Yoneda, Y. Sasaki, K. Nagata, and S. Saito. cells. Respirology 7: 29–35. 2004. Serum granulysin is a marker for Th1 type immunity in pre-eclampsia. 31. Pages, F., A. Berger, M. Camus, F. Sanchez-Cabo, A. Costes, R. Molidor, Clin. Exp. Immunol. 136: 114–119. B. Mlecnik, A. Kirilovsky, M. Nilsson, D. Damotte, et al. 2005. Effector memory 52. Hanson, D. A., A. A. Kaspar, F. R. Poulain, and A. M. Krensky. 1999. Biosyn- T cells, early metastasis, and survival in colorectal cancer. N. Engl. J. Med. 353: thesis of granulysin, a novel cytolytic molecule. Mol. Immunol. 36: 413–422. 2654–2666. 53. Obata-Onai, A., S. Hashimoto, N. Onai, M. Kurachi, S. Nagai, K. Shizuno, T. Nagahata, and K. Matsushima. 2002. Comprehensive gene expression analysis 32. Banerjea, A., S. Ahmed, R. E. Hands, F. Huang, X. Han, P. M. Shaw, R. Feakins, of human NK cells and CD8ϩ T lymphocytes. Int. Immunol. 14: 1085–1098. S. A. Bustin, and S. Dorudi. 2004. Colorectal cancers with microsatellite insta- 54. Andersson, M., H. Gunne, B. Agerberth, A. Boman, T. Bergman, R. Sillard, http://www.jimmunol.org/ bility display mRNA expression signatures characteristic of increased immuno- H. Jornvall, V. Mutt, B. Olsson, and H. Wigzell. 1995. NK-lysin, a novel effector genicity. Mol. Cancer 3: 21. peptide of cytotoxic T and NK cells: structure and cDNA cloning of the porcine 33. Allison, J. P., B. W. McIntyre, and D. Bloch. 1982. Tumor-speciﬁc antigen of form, induction by interleukin 2, antibacterial and antitumor activity. EMBO J. murine T-lymphoma deﬁned with monoclonal antibody. J. Immunol. 129: 14: 1615–1625. 2293–2300. 55. Endsley, J. J., J. L. Furrer, M. A. Endsley, M. A. McIntosh, A. C. Maue, 34. Franksson, L., E. George, S. Powis, G. Butcher, J. Howard, and K. Karre. 1993. W. R. Waters, D. R. Lee, and D. M. Estes. 2004. Characterization of bovine Tumorigenicity conferred to lymphoma mutant by major histocompatibility com- homologues of granulysin and NK-lysin. J. Immunol. 173: 2607–2614. plex-encoded transporter gene. J. Exp. Med. 177: 201–205. 56. Davis, E. G., Y. Sang, B. Rush, G. Zhang, and F. Blecha. 2005. Molecular 35. Pardo, J., S. Balkow, A. Anel, and M. M. Simon. 2002. The differential contri- cloning and characterization of equine NK-lysin. Vet. Immunol. Immunopathol. bution of granzyme A and granzyme B in cytotoxic T lymphocyte-mediated 105: 163–169. apoptosis is determined by the quality of target cells. Eur. J. Immunol. 32: 57. Kagi, D., B. Ledermann, K. Burki, P. Seiler, B. Odermatt, K. J. Olsen,

1980–1985. E. R. Podack, R. M. Zinkernagel, and H. Hengartner. 1994. Cytotoxicity medi- by guest on October 1, 2021 36. Kiessling, R., E. Klein, and H. Wigzell. 1975. “Natural” killer cells in the mouse. ated by T cells and natural killer cells is greatly impaired in perforin-deficient I. Cytotoxic cells with specificity for mouse Moloney leukemia cells: specificity mice. Nature 369: 31–37. and distribution according to genotype. Eur. J. Immunol. 5: 112–117. 58. Heusel, J. W., R. L. Wesselschmidt, S. Shresta, J. H. Russell, and T. J. Ley. 1994. 37. Trapani, J. A., K. A. Browne, M. J. Smyth, and D. A. Jans. 1996. Localization of Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA frag- granzyme B in the nucleus: a putative role in the mechanism of cytotoxic lym- mentation and apoptosis in allogeneic target cells. Cell 76: 977–987. phocyte-mediated apoptosis. J. Biol. Chem. 271: 4127–4133. 59. Bluthmann, H., P. Kisielow, Y. Uematsu, M. Malissen, P. Krimpenfort, A. Berns, 38. Clement, M. V., P. Haddad, A. Soulie, S. Legros-Maida, J. Guillet, E. Cesar, and H. von Boehmer, and M. Steinmetz. 1988. T-cell-specific deletion of T-cell re- M. Sasportes. 1990. Involvement of granzyme B and perforin gene expression in ceptor transgenes allows functional rearrangement of endogenous ␣- and the lytic potential of human natural killer cells. Res. Immunol. 141: 477–489. ␤-genes. Nature 334: 156–159. 39. Revell, P. A., W. J. Grossman, D. A. Thomas, X. Cao, R. Behl, J. A. Ratner, 60. Grossman, W. J., J. T. Kimata, F. H. Wong, M. Zutter, T. J. Ley, and L. Ratner. Z. H. Lu, and T. J. Ley. 2005. Granzyme B and the downstream granzymes C 1995. Development of leukemia in mice transgenic for the tax gene of human and/or F are important for cytotoxic lymphocyte functions. J. Immunol. 174: T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 92: 1057–1061. 2124–2131. 61. Lecoeur, H., M. Fevrier, S. Garcia, Y. Riviere, and M. L. Gougeon. 2001. A novel 40. Wong, C. P., C. Y. Okada, and R. Levy. 1999. TCR vaccines against T cell flow cytometric assay for quantitation and multiparametric characterization of ϩ lymphoma: QS-21 and IL-12 adjuvants induce a protective CD8 T cell re- cell-mediated cytotoxicity. J. Immunol. Methods 253: 177–187. sponse. J. Immunol. 162: 2251–2258. 62. Caccamo, N., S. Milano, C. Di Sano, D. Cigna, J. Ivanyi, A. M. Krensky, F. Dieli, 41. Andreu, D., C. Carreno, C. Linde, H. G. Boman, and M. Andersson. 1999. Iden- and A. Salerno. 2002. Identification of epitopes of Mycobacterium tuberculosis tification of an anti-mycobacterial domain in NK-lysin and granulysin. Biochem. 16-kDa protein recognized by human leukocyte antigen-A*0201 CD8ϩ T lym- J. 344: 845–849. phocytes. J. Infect. Dis. 186: 991–998. 42. Ernst, W. A., S. Thoma-Uszynski, R. Teitelbaum, C. Ko, D. A. Hanson, 63. Samten, B., B. Wizel, H. Shams, S. E. Weis, P. Klucar, S. Wu, R. Vankayalapati, C. Clayberger, A. M. Krensky, M. Leippe, B. R. Bloom, T. Ganz, and E. K. Thomas, S. Okada, A. M. Krensky, and P. F. Barnes. 2003. CD40 ligand R. L. Modlin. 2000. Granulysin, a T cell product, kills bacteria by altering mem- trimer enhances the response of CD8ϩ T cells to Mycobacterium tuberculosis. brane permeability. J. Immunol. 165: 7102–7108. J. Immunol. 170: 3180–3186. 43. Dieli, F., M. Troye-Blomberg, J. Ivanyi, J. J. Fournie, A. M. Krensky, 64. Krensky, A. M., and C. Clayberger. 2005. Granulysin: a novel host defense mol- M. Bonneville, M. A. Peyrat, N. Caccamo, G. Sireci, and A. Salerno. 2001. ecule. Am. J. Transplant 5: 1789–1792.