Thesis: Targeting β-catenin in MPNSTs.
Jed Kendall
August 8th, 2016
Previous Degree: B.S. from Brigham Young University
Degree to be conferred: Doctorate of Philosophy
Department: Molecular and Developmental Biology
Committee Chair: Nancy Ratner Abstract
MPNSTs are a highly invasive soft tissue sarcoma that arises from aberrantly regulated Schwann cells/Schwann cell precursors. Fifty percent of MPNSTs originate in patients with Neurofibromatosis type 1, an autosomal dominant disease that affects 1:3500 people, and the other fifty percent are sporadic in origin.
Curative drug treatments are lacking due to MPNSTs high resistance to chemotherapy. The combination of MPNST’s invasive nature and ability to resist chemotherapy results in a dismal 5-year survival rate
Malignant peripheral nerve sheath tumors (MPNSTs) are soft tissue sarcomas that are a major cause of mortality of Neurofibromatosis type 1 (NF1) patients. MPNST patients have few therapeutic options available and only complete surgical resection can be curative. MPNST formation and survival are dependent on activated β- catenin signaling. The goal of my work is to identify novel genes important in
MPSNT progression and survival and also to screen any developed anti cancer agents against MPNST cell lines. With this approach we can identify readily available therapeutics and also identify potential therapeutics of the future.
CK2 is a known oncogenic kinase in diverse types of cancer through maintaining.
Often times CK2 maintains oncogenic phenotypes through stabilizing β-catenin, which is a critical factor for MPNST survival. We found that CK2α is over expressed in MPNSTs and is critical for maintaining cell survival, as the CK2 inhibitor, CX-4945
(Silmitasertib), and shRNA targeting CK2α in vitro each significantly reduced
MPNST cell viability. These effects were preceded by loss of critical signaling
2 pathways in MPNSTs, including destabilization of β-catenin and TCF-8. CX-4945 administration in vivo slowed tumor growth and extended survival time. We conclude that CK2 inhibition is a promising approach to blocking β-catenin in
MPNST cells, although combinatorial therapies may be required for maximal efficacy.
To find potential therapeutic targets we identified genes critical for MPNST cell survival. We used microarray analysis, stringent selection criteria, and shRNA knock down. Through these methods we identified PITX2 as a critical survival gene specific to MPNST cells. Knocking down PITX2 leads to apoptosis in MPNST cells. We discovered a novel relationship between PITX2 expression and β-Catenin protein stability. Through microarray analysis of PITX2 shRNA treated MPNST cells as compared to controls we have identified NLK, FZD6, and GAS2 as genes differentially regulated by PITX2 expression, containing bicoid response elements within the promoter, and implicate β-Catenin signaling. Furthermore, we identified
GAS2 as a mechanism used by MPNSTs to stabilize β-catenin.
3
4 Preface
The work contained in this thesis is published or is in preparation for publication.
1. Kendall JJ, Katherine CE, Patel AV, Rizvi TA, Largaespada DA, Ratner N. CK2 blockade causes MPNST cell apoptosis and promotes degradation of β- catenin. Oncotarget. 2014 July
2. Kendall JJ, Patel AV, Choi K, Ratner N. PITX2 over-expression is critical for MPNST survival and promotes β-catenin protein stability. Manuscript in preparation.
5 Acknowledgments
Through the course of my dissertation studies I have been graced with assistance and friendship of many colleagues. I would first like to thank Nancy Ratner for building a successful and well-funded lab. I have been the benefactor of her tremendous success. Nancy has imparted an abundance of wisdom and guidance to many, including me, through the years. I will always be grateful to Nancy for allowing me to pursue topics about which I am most passionate. The topics in retrospect are not so important; rather the refinement of thought from my own trial and error is by far and away the greatest skill that I will take away from my years as a PhD student. Outside of scientific accolades and above all else Nancy is a good person.
I would like to thank my thesis committee, Dr. Aaron Zorn, Dr. Brian
Gebellein, Dr. Lionel Chow, and Dr. David Largaespada. Each member of my committee has given valuable feedback for the betterment of my projects.
Additionally, my committee has challenged me as a scientist and encouraged me to think outside of the box that often traps me. Additionally, I would like to thank the
Molecular and Developmental and MSTP program for their support.
Through the good and bad times I have had the support and friendship of many Ratner lab members. Since Ami Patel had to endure the brunt of my naïve ideas during my early years she definitely deserves the most credit. Ami, Preeti, and
Tilat all have become my good friends and I will miss each of you. Kwangmin, I greatly appreciate your willingness to run a thousand different bioinformatics analyses that have been integral in forming working hypotheses. I would like to
6 thank Lindsey Aschlbacher-Smith, Katie Chaney, Jianqiang Wu and Josh Pressler for creating a fun and productive work environment. I would also like to thank Meghan
Brundage for taking me under her wing when I was a new arrival.
Finally, I would like to thank all of my family members. To my mom, dad and grandparents thank you for a wonderful life and magical childhood. Each of you have made tremendous sacrifices on my behalf. Any achievements that I happen to stumble upon are to your credit. Most of all, I would like to thank my lovely wife. She has been the source of my greatest happiness. From our move to Cincinnati where we purchased our first home, to raising our two beautiful children, thank you for all your love and support.
7 Table of Contents
ABSTRACT ...... 2 CHAPTER 1: ETIOLOGY, PATHWAYS, AND THERAPEUTICS OF MPNSTS ...... 12 1.1 THE ETIOLOGY OF MPNSTS ...... 12 1.2 FROM BENIGN TO MALIGNANT ...... 14 1.3 MPNST OUTCOMES AND TREATMENT ...... 15 1.4 THERAPEUTIC ADVANCEMENTS IN MPNSTS PAST AND PRESENT...... 16 1.5 Β-CATENIN AS A POTENTIAL THERAPEUTIC TARGET IN MPNSTS ...... 19 1.5.1. Canonical WNT signaling cascade ...... 19 1.5.2 Pathogenesis of β-catenin signaling in MPNSTS ...... 21 1.5.3 WNT signaling therapeutics ...... 23 CHAPTER 2: CK2 AS AN ONCOTARGET ...... 24 2.1 INTRODUCTION TO CK2 ...... 24 2.2 CK2 AND DNA DAMAGE REPAIR ...... 26 2.3 CK2 AND CELL CYCLE PROGRESSION ...... 28 2.4 CK2 AND CELL DEATH/APOPTOSIS ...... 29 2.5 CK2 AND CANCER ...... 30 2.6 CROSS TALK BETWEEN CK2 AND PRO-SURVIVAL/PROLIFERATIVE PATHWAYS...... 32 2.6.1 NF-κB and CK2 ...... 32 2.6.2 PI3K/AKT and CK2 ...... 32 2.6.3 CK2 and β-catenin ...... 34 2.8 RESULTS ...... 38 2.8.1 CK2 is overexpressed in MPNSTs ...... 38 2.8.2 CK2 inhibition induces cell death and cell cycle arrest in MPNSTs in vitro...... 38 2.8.3 CK2 regulates β-catenin protein stability in MPNSTs in vitro...... 39 2.8.4 CK2 regulates TCF8 and other survival pathways in MPNSTs in vitro...... 40 2.8.5 CX-4945 slows tumor growth in vivo ...... 41 2.8.6 MPNST treatment with CX-4945 in combination with PD0325901 ...... 42 2.9 DISCUSSION, IMPLICATIONS, AND LIMITATIONS ...... 43 2.9.1 Discussion ...... 43 2.9.2 Implications and limitations ...... 45 2.10 FUTURE DIRECTIONS ...... 46 2.11 METHODS ...... 49 2.12 FIGURES AND LEGENDS ...... 54 CHAPTER 3: PITX2 IS OVER-EXPRESSED AND NECESSARY FOR MPNST SURVIVAL ...... 64 3.1 INTRODUCTION TO PITX2 ...... 64 3.2 PITX2C IN LEFT RIGHT ASYMMETRY AND HEART DEVELOPMENT...... 66 3.3 PITX2 IN CANCER AND THE WNT SIGNALING PATHWAY ...... 67 3.5 RESULTS ...... 71 3.5.1 PITX2 is over-expressed in MPNSTs ...... 71 3.5.2 PITX2 is necessary for MPNST survival...... 71 3.5.3 PITX2 gene network in MPNSTs ...... 72 3.5.4 PITX2 regulates a subset of WNT related genes...... 74 3.5.5 GAS2 is necessary for MPNST survival and regulates β-catenin protein stability. .... 74 3.6 DISCUSSION ...... 75 3.7 IMPLICATIONS AND LIMITATIONS ...... 77
8 3.8 FUTURE DIRECTIONS FOR PITX2 ...... 78 3.9 MATERIALS AND METHODS: ...... 80 3.10 FIGURES AND LEGENDS ...... 83 CHAPTER 4: FUTURE DIRECTION AND DISCUSSION ...... 90 4.1 TARGETING Β-CATENIN AND OTHER SURVIVAL PATHWAYS IN MPNSTS...... 90 BIBLIOGRAPHY: ...... 97
9 Figures and Tables
Figure 1.1 NF1 and RAS signaling …………………………………………………………………………………13
Figure 1.2 Drivers of MPNST transformation………………………………………………………………..…14
Figure 1.3 canonical Wnt signaling pathway……………………………………………………………………19
Figure 2.1 Functions of CK2……………………………………………………………………………………………26
Figure 2.2 CK2 activates the AKT pathway through PTEN inhibition………………………………..33
Figure 2.3 CK2 activates β-catenin signaling through phosphorylation of β-catenin and DSH…………………………………………………………………………………………………………35
Figure 2.4.…………………………………………………………………………………………..…………………………54
Figure 2.5…………………………………………………………………………………………..…………….……………56
Figure 2.6…………………………………………………………………………………………..…………….……………57
Figure 2.7…………………………………………………………………………………………..…………….……………59
Figure 2.8…………………………………………………………………………………………..…………….……………61
Figure 2.9.…………………………………………………………………………………………..…………………………62
Figure 3.1…………………………………………………………………………………………..…………….……………83
Figure 3.2…………………………………………………………………………………………..…………….……………84
Figure 3.3…………………………………………………………………………………………..…………….……………85
Supp. Figure 3.3……………………………………………………………………………………………..………………54
Figure 3.4…………………………………………………………………………………………..………………………….88
Figure 3.5…………………………………………………………………………………………..………………………….89
Table 1.1……………………………………………………………………………...……………..…………………………17
Table 3.1……………………………………………………………………………...……………..…………………………87
10
11
Chapter 1: Etiology, Pathways, and Therapeutics of MPNSTs 1.1 The Etiology of MPNSTs Neurofibromatosis type 1 (NF1), the most common genetic disease predisposing cancer formation, is an autosomal dominant disease affecting 1:3000 people worldwide [1,2,3]. Neurofibromas are benign tumors formed within the peripheral nerve and are the most common morbidity suffered by NF1 patients 4,5. These tumors occur when cells of Schwannian lineage develop a “second hit” mutation in the NF1 tumor suppressor gene[6,7,8,9,10,11]. Mutations in the NF1 gene prohibit the expression of the functional RAS-GAP protein Neurofibromin [12–14]. The GTPase activating domain of Neurofibromin effectively turns off multiple RAS family members including HRAS, NRAS, KRAS, MRAS, RRAS and RRAS2[15]. When
Neurofibromin function is lost, it results in the hyper-reponse of the RAS-MEK-ERK signaling cascade and activation of other downstream effector cascades [16].
Classification of neurofibromas is typically determined by position. Dermal neurofibromas are located superficially within a peripheral nerve while plexifrom neurofibromas are located in larger nerves; other significant symptoms of NF1 include: optic gliomas, bone deformities, cognitive deficiencies, and café au lait spots
[17–22]. Malignant peripheral nerve sheath tumors (MPNSTs) are soft tissue sarcomas, and represent the single greatest cause of mortality for adult NF1 patients[23]. In
50% of cases, MPNSTs arise in NF1 patients, most often between the 3rd and 5th
[24,25] decades of life . Plexiform neurofibromas are benign, and the initiating lesion
12 for MPNST development in context of NF1 [26]. The other half of MPNSTs arise sporadically without a defined precursor lesion. Sporadic MPNSTs also arise later in
th th [24,25] life than NF1 derived MPNSTs, typically between the 5 and 7 decades of life .
While there are dissimilarities in the genesis of sporadic and NF1 derived MPNSTs the etiology between the two appears similar. First, the gene signatures between sporadic and NF1 derived MPNSTs are very similar [27]. Second, genetic aberrations commonly found in sporadic MPNSTs involve the RAS pathway; one study determined that NF1 mutations occurred in over half of 21 sporadic MPNST patient biopsies, however bi-allelic loss of NF1 in sporadic MPNSTs was not confirmed [28,29].
Figure 1.1. NF1 and RAS signaling. RAS signaling pathway is hyper-activated when RAS-GAP protein NF1 is mutated leading to increased cell proliferation.
13
1.2 From Benign to Malignant As with neurofibromas, MPNSTs are derived from the Schwann cell lineage, and half of MPNSTs stain positive for Schwann cell lineage marker S100 [30,31]. The progression from neurofibromas to MPNST is underlined by the emergence of a more immature state indicated by a higher expression level of neural crest markers than observed in neurofibromas [32].
Therefore, MPNST cell identity most Figure 1.2. Drivers of MPNST transformation. Transitioning from neurofibromas to MPNST involves closely resembles mutations in tumor suppressor genes and up regulation of growth factor receptors. an early time point in Schwann cell differentiation. The transformation from benign neurofibroma to MPNST is a process that results in faster proliferation and anchorage independent growth. These changes are accomplished through a combination of mutations in tumor suppressor genes and chromosomal instability. Reports suggest that the TP53 locus is mutated in 75% of MPNSTs[33–35]; however, bi-allelic loss of
TP53 is rarely demonstrated. CDKN2A is another tumor suppressor that facilitates
TP53 stabilization and is estimated to be mutated in 50% of MPNSTs [36,37]. The
14 CDKN2A1 locus encodes two different proteins. One of the proteins is P16ink4a, which is an inhibitor of cyclin dependent kinases 4 & 6. The CDKN2A1 locus also encodes P19arf, which is an inhibitor of the MDM2 ligase that targets P53 for destruction[38]. Importantly, CDKN2A is frequently lost in atypical neurofibromas, the MPNST precursor lesion within plexiform neurofibromas [37]. In addition to tumor suppressor gene mutations, chromosomal instability exhibited by MPNSTs results in low level amplification of growth promoting genes such as EGFR, erbB2, neuregulin-1, and c-Kit. Furthermore, 50% of MPNSTs exhibit haploinsufficiency for the PTEN locus[29,39].
1.3 MPNST Outcomes and Treatment The lifetime risk of an NF1 patient developing an MPNST is 8-13%[24]. The diagnosis of MPNSTs in NF1 patients is often complicated, due to MPNSTs arising from existing plexiform neurofibroma lesions. This can prevent early detection of
MPNSTs and is perhaps one reason that NF1 associated MPNSTs appear more aggressive than sporadic MPNSTs [40,41]. Surgical resection is the mainstay treatment for MPNSTs, and most sarcomas. However, the ramification of severing nerves complicates MPNST resection and leads to a 40% rate of local recurrence[42,43]. Pharmacological options for MPNST patients are severely limited as MPNSTs are resistant to chemotherapeutics [42,44]. The combination of limited treatment options and MPNSTs high propensity to metastasize leads to dismal 5 and
10-year survival rates of 34 and 23% respectively[44]. In a study of 62 NF1 patients with MPNSTs and 58 patients with sporadic MPNSTs, metastases developed in 39% and 16% of cases respectively [44]. Pulmonary metastasis represent a majority of
15 cases, but MPNSTs also have a predilection for invading soft tissue, bone, liver, the abdominal cavity, adrenal glands, diaphragm, mediastinum, brain, ovaries, kidneys, and retroperitoneum [44]. The dismal outcomes and the paucity of pharmacological interventions for MPNST patients is the impetus for our research.
1.4 Therapeutic advancements in MPNSTs past and present. Early clinical studies have not yielded a suitable treatment for MPNSTs, but have demonstrated that clinical trials can be effectively conducted despite typical challenges posed by rare diseases. Epidermal Growth Factor Receptor (EGFR) is a receptor tyrosine kinase that when activated promotes cell proliferation and malignant transformation in MPNSTs [45–48]. EGFR is amplified in MPNST patient tumors and pre-clinical mouse models demonstrated some promise for EGFR inhibition [47]. The EGFR inhibitor Erlotinib was the first drug used in histology specific trails in MPNSTs (Table 1.1). However, Erlotinib failed to demonstrate any efficacy in phase II clinical trails and patients demonstrated no significant increase in survival time[49]. A RAF inhibitor, Sorafenib, was the next inhibitor to be tried and fail in phase II clinical trials targeting a spectrum of soft tissue sarcomas including
MPNSTs[50]. Other inhibitors that have reached phase II clinical trials for MPNST treatment and fail include Imatinib (C-KIT, PDGFR, ABL) and Dasatinib (C-KIT, SRC)
[51–53]. Currently, there are two clinical trials that involve inhibition of mTOR in combination with either a VEGFA or an HSP90 inhibitor. The rationale underlying testing of the HSP90 and mTOR inhibitors is discussed below.
16 Table 1.1: Clinical trials and outcomes in MPNST patients.
Drug Target Phase n Results
Erlotinib EGFR II 24 1/24 stable disease
RAF VEGFR Sorafenib II 12 1.7 month increase in survival C-KIT PDGFR C-KIT Imatinib VEGFR II 7 1 stabilized disease PDGFR C-KIT Dasatinib II 14 Did not stabilize disease SRC Bevacizumab/ Angiogenesis II - In progress Everolimus mTOR Ganetspib Hsp90 I/II - In progress /Sirolimus mTOR
Recently the molecular mechanisms governing MPNST progression and survival have been studied. Therapeutic interventions targeting MPNSTs have emerged from pre-clinical studies. While no single agent or combination treatment has cured any
MPNST model, some treatments have shown merit in effectively slowing, stabilizing, or in one case shrinking, MPNST tumors. De Raedt et al approached MPNST treatment by exploiting the pre-existing high baseline of Endoplasmic Reticulum
(ER) stress that exists in MPNSTS [54]. The treatment of a genetic MPNST mouse model was conducted with the combination of MTORC1 inhibitor, Rapamycin, with
HSP90 inhibitor IPI-504. IPI-504 induces ER stress by inhibiting protein folding and
Rapamycin prevents glutathione regeneration permissive to increased levels of oxidative stress in the ER. In combination, these two drugs induced massive cell death and reduced MPNST tumor size on average by 48% [54]. This has been the
17 most effective pre-clinical treatment to date. Most therapies have delayed or stabilized tumor growth, and the combination of Rapamycin and IPI-504 shrunk existing tumors. While the results from this study are impressive, only short-term studies (30 days) were published leaving questions about possible tumor resistance and resurgence after short duration treatment. MPNST tumor resistance to MTOR inhibition is not unprecedented, Sirolimus (MTOR inhibitor) as a single agent initially demonstrated anti-tumor properties in MPNSTs but long-term use resulted in resistance to the treatment [55]. Phase I clinical trials are underway using
Sirolimus and HSP90 inhibitor. In the same vein, a recent study identified a new
MTOR inhibitor (AZD8055) effective against MPNSTs. AZD8055 effectively inhibits both MTORC 1 and 2 and preventing all protein synthesis in mouse MPNSTs [56].
Furthermore, this study identifies the MEK inhibitor PD0325901 and bromo- domain inhibitors as capable of working synergistically with AZD8055 [56].
There is a growing list of inhibitors that have shown some efficacy as single agents in slowing MPNST growth in either genetic or xenograft mouse models. The MEK inhibitor PD0325901 was effective at slowing MPNST xenograft tumor growth, however, only transiently [57]. MPNSTs have a high dependence on fatty acids as a source of metabolic energy. Additionally, Fatty Acid Synthase (FAS) is over- expressed in MPNSTs. Inhibition of FAS had similar effects as MEK inhibition [58].
Polo like Kinase 1 inhibitors and Bromo-domain inhibitors also have both shown some efficacy in slowing MPNST tumor growth [59]. Due to high rates of proliferation
18 and an over-expression of Aurora Kinase A in MPNSTs, the inhibitor MLN8375 stabilized MPNST in vivo tumor growth [60].
1.5 β-catenin as a potential therapeutic target in MPNSTs
1.5.1. Canonical WNT signaling cascade
The
Figure 1.3. Canonical WNT signaling pathway: WNT ligands interact with FZD/LRP receptor complexes to inhibit the β-catenin destruction complex.
The discovery of β-catenin was independently accomplished twice, due to its dual functions in gene transcription and in cytoskeletal structure. Rolf Kelmer’s lab discovered mammalian β-catenin through studies focusing on players involved in E- cadherin-containing cellular junctions. These studies defined β-catenin as a bridge between cadherin signaling and actin cytoskeletal rearrangement [61]. The gene transcriptional effects of β-catenin were discovered in the lab of Eric Wieschaus, when the Armidillo gene was identified in forward genetic screens designed to identify regulators of drosophila segmentation [62,63]. The homology between
19 mammalian β-catenin and Drosophila armadillo was soon realized, and β-catenin became one of the earliest examples of a “moonlighting” protein (dual function protein). In 1990, the Riggleman lab identified an epistatic relationship between the signaling molecule wingless and the anterior segment regulator armadillo [64]. This discovery was key in defining what would be known as the canonical WNT signaling pathway.
The canonical WNT signaling cascade is now intensely studied, and is known to orchestrate numerous biological processes. There are 19 WNT ligands; many of these can potentiate the β-catenin “canonical” signaling pathway in which cytoplasmic pools of β-catenin protein are regulated by a multi-protein destruction complex that includes glycogen synthase kinase 3β (GSK-3β), AXIN, Casein Kinase I
(CKI), Adenomatous Polyposis Coli (APC), and protein phosphatase 2A (PP2A) [65–69].
This complex docks to β-catenin through the AXIN and APC scaffolding proteins, which situates β-catenin to be phosphorylated by CKI and GSK-3β [65–69]. The phosphorylation of β-catenin by these kinases primes it for ubiquitination and degradation [65]. In order for β-catenin to exert its transcriptional functions, β- catenin must first escape the destruction complex.
When WNT ligands bind to co-receptors FZD and LRP5/6, cytoplasmic Dishvelled
(DVL) is recruited to this receptor complex, where it multimerizes [70]. DVL then recruits the GSK-3β destruction complex to the cell membrane, rendering it unable to phosphorylate β-catenin [71]. Unphosphorylated β-catenin then accumulates in the
20 cytoplasm, translocates to the nucleus, and activates gene transcription. β-catenin’s lack of a DNA binding domain renders it dependent on interacting with DNA binding co-factors to activate gene transcription. The LEF/TCF families of transcription factors are the most well known and most frequently used co-transcription factors of β-catenin [72–76]. The interaction between LEF/TCF transcription factors and β- catenin can be classified as derepression. When LEF/TCF factors are bound to a promoter they exert a negative effect on gene transcription [77]. Upon activation of the WNT signaling cascade, β-catenin translocates to the nucleus to bind LEF/TCF factors and activates WNT target gene transcription.
1.5.2 Pathogenesis of β-catenin signaling in MPNSTS Multiple studies have recently implicated β-catenin as a driver of MPNST transformation and essential factor for sustaining MPNST cell survival [78–81].
Watson et al demonstrated that β-catenin is over-expressed and nuclear in MPNSTs as compared to control immortalized human Schwann cell lines (iHSCs) [82].
Additionally, Watson et al demonstrated that β-catenin over-expression transformed this otherwise benign iHSC line as indicated by increased anchorage independent growth [82]. In support of β-catenin being a driver of MPNST formation, neurofibromas, precursors of MPNSTs, demonstrate increased expression and nuclear localization of β-catenin as compared to normal Schwann cells [83]. Not only is β-catenin a potential driver of MPNST formation, β-catenin expression and nuclear localization might be a predictor of tumor aggressiveness. MPNSTs with higher β-catenin expression and nuclear localization of β-catenin corresponded with higher-grade MPNST tumors [80].
21 As mentioned above, several studies have identified increased nuclear localization of β-catenin in MPNSTs. The escape mechanism(s) employed by β-catenin to avoid the GSK-3β destruction complex in MPNSTs are unknown. There is a possibility that a WNT signaling autocrine loop exists, because WNT ligands WNT5A, WNT5B, and
WNT2 ligands are up-regulated in MPNSTs [48]. A R-spondin 2, EIF3E fusion protein is also over-expressed in MPNSTs [79,82]. R-spondins amplify the WNT signaling cascade through inhibiting the degradation of the FZD/LRP co-receptor complex at the plasma membrane [84–87]. R-spondins complex with WNT receptor LGR4/5 and inhibit the transmembrane E3 ubiquitin ligases RNF43 and ZNRF3, freeing LRP and
FZD receptors from ubiquitination and degradation [87–89]. Watson et al also found that key components of the β-catenin destruction complex, GSK-3β and APC, were down regulated in MPNST, suggesting that the GSK-3β destruction complex functions at a lower baseline in these cells [82]. A milieu of up-regulated WNT ligands and R-spondin2 coupled with down regulation of the GSK-3β destruction complex likely contributes to β-catenin over-expression and hyper-activation. MPNSTs deploy additional mechanisms to suppress GSK-3β activity. Mo et al demonstrated that the receptor ligand complex CXCL12/CXCR4 are overexpressed in MPNSTs [78].
This ligand receptor combination regulates GSK-3β through inhibitory phosphorylation of S9. Inhibitors of CXCR4 destabilized β-catenin signaling in
MPNSTs in vitro and were effective in slowing tumor growth in MPNST mouse models [78].
22 How loss of NF1 initiates escape of β-catenin from the GSK-3β complex is unknown. During the process of transformation, up-regulation of β-catenin can be the result of downstream genetic instability, further mutations, and/or hyper- activated RAS. Luscan et al demonstrated that knockdown of NF1 in MSC80
Schwann cells (but not HEK293 or MCF-7 cell lines) increased expression of β- catenin target genes and induced expression of a β-catenin responsive luciferase reporter [81]. Interestingly, this study supports the idea that the Schwann cell lineage somehow enables the interaction between loss of NF1 and β-catenin activation. Multiple other studies have demonstrated that cross talk between RAS and β-catenin signaling occurs. MEK and ERK can both target GSK-3 β through inhibitory phosphorylation on S9 [90,91]. Furthermore, MEK/ERK can potentiate
WNT signaling through phosphorylating LRP6 [92,93].
1.5.3 WNT signaling therapeutics The dysregulation of canonical WNT signaling is involved in numerous disease processes and the oncogenesis of many cancers. For decades WNT signaling has been known to be a key driver of colorectal cancer formation [94]. WNT signaling’s prominent role in disease has drawn major attention to the pathway. However, targeting WNT signaling is complicated by its role in maintaining homeostasis of many adult organ systems most notably gut epithelium, bone metabolism, and hair follicles [90,95–97]. Development of therapeutics targeting general WNT signaling components, and especially the GSK-3 β destruction complex, such as Tankerase inhibitors, have been hindered by their toxicity. There is hope that second generation drugs directly inhibiting WNT signaling will show more promise. Drugs
23 directly targeting aspects of WNT signaling such as Frizzled receptors, porcupine, or
β-catenin’s interaction with specific transcription factors are currently in phase I or dose escalation studies [98–101]. Of particular interest is a direct inhibitor of β-catenin,
PRI-724 that had an acceptable toxicity profile during a phase I clinical trial [98].
Targeting WNT signaling machinery directly may be the simplest solution therapeutically and could be applied to the many diseases caused by aberrant WNT activation. However the hurdles of this approach may be too high to clear. An alternative approach, which is more laborious, time consuming, and less generalizable, is to target disease-specific components of WNT signaling that do not belong to the core WNT signaling cascade. This is a challenging endeavor requiring a thorough study of up and down stream WNT relevant changes in a particular disease. As already discussed, Mo et al demonstrated that β-catenin could be effectively targeted in pre-clinical models via CXCR4 inhibition [78]. This approach sidesteps inhibition of general β-catenin promoting machinery and therefore, may not cause the general toxicities associated with WNT/β-catenin inhibitors of the past.
Chapter 2: CK2 as an Oncotarget
2.1 Introduction to CK2 CK2 is a holoenzyme that exists in tetramers of α2β2, α’2β2, or α’αβ2. The CK2α and
α’ subunits are catalytically active, and can use ATP or GTP to facilitate phosphorylation of target proteins [102]. The α and α’ subunits are 90% homologous;
α has a 20 amino acid extension of its C-terminal tail [103]. Mechanistic differences
24 between the α and α’ subunits have not yet been identified, but knockout of CK2α, not CK2α‘, is embryonic lethal in mice [104]. CK2α seems capable of compensating for loss of CK2α‘, except in the process of spermatogenesis, as male CK2α‘-/- mice show oligospermia [104,105]. Of the two subunits, α is the more commonly expressed and the lack of redundant activity between CK2α and CK2α‘ in mouse phenotypes might be due to non-overlapping expression patterns. CK2α‘ and CK2α are inversely related in spermatogenesis expression. CK2α is expressed in the developing spermatocyte while CK2α’ is expressed in the mature spermatid. CK2β is a regulatory subunit that specifies phosphorylation targets of the holoenzyme. CK2β directs the docking of the holoenzyme to proteins such as FGF2, TP53, p21, p27,
FAF1, and many others [106–111]. How CK2β selects a substrate is not completely understood but is contextual and likely dependent on CK2β’s phosphorylation status [112]. CK2 is generally studied as a serine/threonine kinase, despite its documented ability to also phosphorylate tyrosine residues [113]. CK2 activity can be subtly modulated through changes in subcellular localization, phosphorylation, or association with specific protein complexes [114–116]. For the most part, however, CK2 is constitutively active, in that its activity is not known to be significantly regulated by posttranslational modification [117]. Most RD kinases become fully activated when a conserved threonine residue in their activation loop is phosphorylated. While CK2 is a member of the RD kinase family based on overall sequence, this critical threonine in the activation loop is absent [118]. CK2α’s active site therefore exists in a
25 conformation that closely resembles fully activated cyclin dependent kinases (CDKs) and MAP Kinases [118].
CK2 phosphorylates its substrates at the minimal recognition site S/T-X-X-D/E [119].
These sites comprise 20% of the potential phosphoproteome— 18,404 out of
83,808 identified phosphosites [120–122]. This disproportionate representation of CK2 phosphosites suggests that CK2 is a highly pleiotropic enzyme. Indeed, CK2 has been implicated in regulating a wide variety of processes that include cell cycle, apoptosis, metabolism, DNA repair and others discussed in the following section
[122].
Figure 2.1: Functions of CK2: Since CK2’s discovery in the 1950’s, CK2 has become known as one of the most pleiotropic enzymes.
2.2 CK2 and DNA Damage repair DNA damage repair mechanisms are highly coordinated processes that balance the decision between life and death of a cell. All mechanisms of DNA repair are highly dependent on DNA repair enzyme accessibility to a site of DNA damage, which may
26 be obscured by heterochromatin. CK2 facilitates rapid dissociation of heterochromatin through phosphorylation of Histone Protein 1 (HP1) [123].
Phosphorylation of HP1 causes HP1 mobilization and disassembly of heterochromatin. DNA by repair enzymes are then able to access the site of DNA damage [123–126]. In addition to general accessibility of DNA repair enzymes to sites of DNA damage, CK2 also plays a role in the specific mechanism of multiple DNA repair processes. When DNA double strand breaks (DSB) occur, H2AX replaces H2A in the histone tetramer, increasing the tightness of DNA winding around histones
[125–129]. This prevents DNA mutation dissemination through limiting accessibility of
DNA to transcriptional machinery, effectively inducing cell cycle arrest [127]. The swapping of H2A for H2AX in the histone makeup is facilitated by CK2 phosphorylation of H2AX. Multiple studies have shown that CK2 inhibitors prevent the association of CK2 with H2AX and that the lack of phosphorylation of H2AX by
CK2 results in inhibition of DNA DSB repair [126,130–132]. Additionally, CK2 phosphorylation of MDC1 facilitates the formation of the Nijmegen breakage syndrome 1 complex around the site of the DNA DSB [133,134,135,136]. MDC1 recognizes histone subunits H2AX at the site of the DSB [130]. Upon phosphorylation of MDC1 by
CK2, MDC1 then recruits multiple enzymes to the site of the break including E3 ubiquitin ligase RNF8 that creates DSB foci by ubiquitinating histones in proximity of the DSB [137]. Single stranded DNA repair is another mechanism in which CK2 plays a pivotal role. Single stranded DNA repair is sensed and rapidly coordinated by the XCC1 scaffolding protein [138]. The assembly of the XCC1 scaffolding complex
27 at the site of DNA damage is only enabled after the phosphorylation of the XCC1 protein by CK2 [139–142].
2.3 CK2 and cell cycle progression During the G1/S phase of the cell cycle DNA synthesis, which faithfully replicates all
23 pairs of chromosomes, is the dominant activity. To replicate millions of nucleotide sequences in perfect order, extensive DNA integrity monitoring mechanisms must be employed. UV radiation often compromises cells undergoing cell cycle progression by causing numerous thymidine-thymidine dimers within the genome. UV DNA damage correction occurs in the G1/S phase through P53 dependent cell cycle arrest [143,144]. When cells are irradiated, CK2 expression increases, which prevents the degradation of P53 in two ways [145]. First, CK2 phosphorylates MDM2 at Ser 267, preventing this E3 ubiquitin ligase from ubiquitinating P53 [146–148]. Second, CK2 phosphorylates P53 on Ser 392, which further prevents P53 from interacting with MDM2 [145,149,150]. Additionally, this phosphorylation results in increased P53 transcriptional capacity [145].
In the G2/M phase of the cell cycle, cells prepare for cytokinesis. Cytokinesis involves coordination of separating chromosomes, so that each daughter cell receives identical chromosomes. Inhibition of CK2 leads to G2/M cell cycle arrest in many cell types [151–153]. CK2 has been shown to localize to the mitotic spindles and centrosomes during G2/M, and inhibition of CK2 results in malformation of both mitotic spindles and centrosomes [151]. While SIX1, WEE1, and PIN1 have been identified as substrates of CK2 during G2/M, the effects of phosphorylation by CK2 on these substrates is still unknown [154–158]. Thus, while the exact role that CK2
28 plays in G2/M progression is important, how this occurs remains under investigation.
2.4 CK2 and Cell Death/Apoptosis In healthy normal cells CK2 controls a balance between promoting cell proliferation though cell cycle regulation and inducing cell death. CK2’s dichotomy in regulating apoptosis is context dependent. As discussed earlier, CK2 can potentiate P53 signaling which leads to G1/M arrest, but if DNA damage is severe enough, the P53 activation eventually induces apoptosis. On the other hand, in a perfectly healthy, undamaged cell CK2 suppresses multiple pro-apoptotic signals. Release of cytochrome C from the mitochondria robustly activates the caspase apoptotic- signaling cascade when cells have become irreparably damaged [159–163]. BCL-2 family proteins tightly regulate release of cytochrome C [164,165]. BID is a pro- apoptotic BCL-2 family member that is activated under situations that overly stress the cells [166–169]. BID can be cleaved by caspase 8 rendering a protein structure called T-BID [166]. This protein fragment then interacts with BAX, which enables the release of cytochrome C from the mitochondria [168]. When cells are unstressed the cleavage of BID by caspase 8 is inhibited through CK2 phosphorylation of BID on Ser
61 [170,171].
Activation of apoptosis can also be caused by external signals resulting in activation of the caspase-signaling cascade [172–174]. Caspases are proteolytic enzymes that carry out the degradation of critical enzymes to induce apoptosis. Caspases are initially translated as inactive pro-enzymes that are catalytically inactive. Caspase activity is organized into hierarchal order signaling cascade. Initiator caspases 2, 8,
29 9, and10 are activated from an external death signal, which results in conversion of the initiator caspases from a pro-enzyme to a catalytically active enzyme. Upon activation of the initiator caspases executioner caspases 3, 6, and 7 are proteolyticly cleaved to carry out programmed cell death [175,176]. The activation of apoptotic machinery is averted if cleavage of any of the caspases in the signaling cascade can be inhibited. Multiple studies have shown that CK2 prevents the cleavage of caspases at multiple points along the caspase-signaling cascade. Caspase 9 cleavage by caspase 8 is prevented when CK2 phophorylates the cleavage site of pro-caspase
9 [177]. This phosphorylation prevents caspase 8’s proteolytic active site from aligning properly with pro-caspase9’s cleavage site [177,178]. CK2’s most important role maybe through inhibiting caspase activation of pro-caspase 3 [179,180]. CK2 phosphorylates the flank of the pro-caspase 3-cleavage site on Ser 174 and 176 [179].
In the same way as caspase 9, these phosphorylations prohibit the cleavage of pro- caspase 3. The inhibition of caspase 3 activity is a significant mechanism to escape programmed apoptosis because caspase 3 is the key executioner enzyme that both intrinsic and extrinsic caspase pathways converge on to activate programmed apoptosis, where as phosphorylation of caspase 9 only prohibits activation of the intrinsic caspase pathway.
2.5 CK2 and Cancer Since the discovery of CK2 in 1954 by Burnett and Kennedy [181], CK2 has been extensively studied. In the late 80s and 90s, after over-expression of CK2 was identified in multiple cancer types (colorectal, lung, and prostate) [182–184], CK2 has been assessed as a possible drug target, and first the list of CK2 dependent cancers
30 has been steadily growing [185–187]. CK2 over-expression is now known to be a marker of poor prognosis in multiple cancer types. For example, CK2 expression is negatively correlated with the 10-year survival rate of patients with ovarian and/or breast cancer, and metastasis rates in breast cancer are highly correlated with higher levels of CK2 [188–190]. Additionally, ovarian cancers that over-express CK2 have much higher relapse rates after treatment than those that do not over-express
CK2 [190].
The number of cancers dependent on CK2 activity may not be surprising, considering CK2’s pleiotropic role in normal cellular biology. CK2 is involved in protein synthesis and metabolism as well as in the cell cycle, DNA repair, and cell death processes described above [191–194]. Generally, CK2 is considered a supporting player in cancer that integrates dysregulated survival pathways in cancer, as opposed to activating a hierarchically organized pathway that drives oncogenesis.
Given CK2’s roles in survival and cell death and its ubiquitous expression and constitutive activity, it is likely that CK2 is poised for high-jack by cells undergoing transformation, and that CK2 further activates other pro-proliferative pathways or anti-apoptotic pathways [120,185].
Over time, cancers may become addicted to CK2 for survival. As transforming cells suppress death signals caused by genetic instability and meet the metabolic demands of hyper-proliferation, CK2 expression increases. Therefore, it is argued that although healthy normal cells are dependent on CK2 activity, cancer cells have a higher dependence on CK2 activity and therefore are more susceptible to CK2 inhibition, potentially providing a therapeutic window. Efforts are ongoing to
31 develop effective drugs targeting CK2 activity [195,196]. Some promising therapeutics are emerging, one of which is CX-4945, which will be discussed in a later section
[196].
2.6 Cross talk between CK2 and pro-survival/proliferative pathways.
2.6.1 NF-κB and CK2 NF-κB was first identified as an oncogenic factor when a truncated form (v-rel) was the oncogenic factor in avian reticuloendotheliosis virus [197,198]. Other viruses that induce NF-κB activation include Epstein-Bar virus and HTLV-1 [199,200]. NF-κB is a transcription factor that activates transcription of a host of genes including chemokines, C-MYC, CyclinD1, BCL, cytokines, and anti-inflammatory factors [201–205].
NF-κB has recently been implicated in the process of EMT, by regulating expression of ZEB and TWIST family members [206–208]. Additionally, NF-κB regulates metalloproteinases (MMPs), which facilitate metastasis by clearing extracellular proteins surrounding cancer cells [209–211]. The negative regulatory protein IκB inhibits NF-κB transcriptional activity by holding NF-κB captive in the cytoplasm
[212,213]. The inhibitory grasp of IκB on NF-κB is relieved through phosphorylation of
IκB by CK2 [214]. In this way CK2 can activate the processes of epithelial to mesenchymal transformation and metastasis.
2.6.2 PI3K/AKT and CK2 The PI3K/AKT pathway is a well-studied pathway in oncogenesis. This pathway controls important functions including metabolism, proliferation, motility, and cell death [215–224]. PI3K becomes active when it docks to and is phosphorylated by active receptor tyrosine kinases (RTKs) [225,226]. It can also be activated directly by Ras-
32 GTP [227,228]. Upon activation PI3K phosphorylates a lipid component of the cell membrane called phosphatidylinositol bisphosphate
(PIP2), resulting in formation of phosphatidylinositol trisphosphate
(PIP3) [229]. PIP3 serves as a Figure 2.2 CK2 activates the AKT pathway signaling node, binding to proteins through PTEN inhibition. containing Plekstrin homology (PH) domains bringing them into close proximity to each other [230]. PDK1 is a major signaling partner recruited to the PIP3 signaling node [231]. Upon binding of PDK1 to PIP3, PDK1 stimulates the activity of AKT through directly phosphorylation [232,233]. AKT, in coordination with the MTORC complexes, then regulates glucose homeostasis and β-catenin protein stability, providing pro-proliferative signaling and an input of energy for rapid cell division
[234,235].
PTEN is a commonly mutated phosphatase that has been implicated in numerous cancers [236]. The PTEN phosphatase converts PIP3 to PIP2, effectively nullifying actions of PI3K and any down-stream effectors such as AKT [237,238]. Loss of PTEN leads to unabated activation of the PI3K/AKT signaling cascade, facilitating the conversion of a normal cell to a hyper-proliferative one [238]. While the PTEN locus often undergoes loss of function mutations in cancers (as in MPNST), PTEN activity can also be silenced through CK2 phosphorylation [239–241]. Two validated consensus sequences for CK2 phosphorylation exist in PTEN’s C-terminal domain at Ser 370
33 and 385 [241,242]. When CK2 phosphorylates these sites, PTEN undergoes a conformational change that inactivates the enzyme. In this way, cells undergoing oncogenic transformation can down regulate PTEN activity without loss of function mutations in the PTEN locus.
2.6.3 CK2 and β-catenin As mentioned in chapter 1, β-catenin is the downstream effector of canonical WNT signaling. When WNT ligands bind to LRP/FZD complexes a signal is transduced that inhibits the degradation of β-catenin by the GSK-3β directed destruction complex. In the absence of WNT signaling β-catenin docks to the GSK-3β complex and is phosphorylated targeting β-catenin for ubiquitination and degradation. As β- catenin is a regulator of cell fate and is pro-proliferative, cancer cells often try to short circuit the regulation of β-catenin protein stability. [243] β-catenin can avoid regulation by the GSK-3β destruction complex through being phosphorylated in the armadillo repeat region on residue TH393 by CK2. This phosphorylation of β- catenin by CK2 renders β-catenin unable to dock to the GSK-3β destruction complex
[244]. Furthermore, CK2 can to physically interact with and phosphorylate
Dishevelled (DVL), activating the protein [245]. DVL is a downstream effector of WNT signaling that inactivates the GSK-3β destruction complex by sequestering it near the cell membrane [71].
34
Figure 2.3 CK2 activates β-catenin signaling through phosphorylation of β-catenin and DSH.
As discussed, β-catenin does not directly bind DNA and is therefore dependent on co-factors to regulate gene transcription (such as LEF/TCF family members).
LEF/TCF transcription factors bind to the consensus sequences TTCAAAG [246], and once β-catenin binds to LEF/TCF factors, transcriptional repression of these genes is relieved [77]. How CK2 regulates β-catenin and LEF-1 cooperative transcription is not understood [247,248]. However, reports have confirmed that CK2 directly phosphorylates LEF-1 on Ser 42 and Ser 61. This does not change the binding
35 affinity between β-catenin and LEF-1. Current thought is that CK2 phosphorylation of β-catenin and of LEF-1 may direct the specificity of LEF-1 and β-catenin gene transcription.
36 CK2 blockade causes MPNST cell apoptosis and promotes degradation of β-catenin.
Jed J. Kendall1, Katherine E. Chaney1, Ami V. Patel1, Tilat A. Rizvi1, David A.
Largaespada2, and Nancy Ratner1*
1Division of Experimental Hematology and Cancer Biology, Cincinnati Children’s
Hospital, Department of Pediatrics, University of Cincinnati, Cincinnati, OH 45229-
0713; 2Department of Pediatrics, Masonic Cancer Center, University of Minnesota,
Minneapolis, MN 55455.
Published in Oncotarget:
Kendall JJ, Katherine CE, Patel AV, Rizvi TA, Largaespada DA, Ratner N. CK2 blockade causes MPNST cell apoptosis and promotes degradation of β- catenin. Oncotarget. 2014 July
37 2.8 Results
2.8.1 CK2 is overexpressed in MPNSTs We measured CK2α protein and CK2α mRNA expression in MPNST cell lines. QPCR revealed higher CK2α mRNA expression in MPNST cell lines (2 to 5) fold as compared to control normal human Schwann cells (NHSCs) (Fig. 2.4a). The CK2α protein was also overexpressed in each MPNST cell line (Fig. 2.4b). If CK2α is important for MPNST survival, then overexpression of CK2α should lead to abnormal phosphorylation patterns of CK2 substrates. Western blot analysis of
MPNST cell lines versus NHSCs using an anti-CK2 substrate antibody, which recognizes CK2 consensus target motif pS/pTDXE only when phosphorylated, shows that CK2α overexpression correlates with increased phosphorylation of CK2 target proteins in MPNSTs vs NHSCs. We identified CK2 substrate phosphorylation bands unique to MPNSTs based on size observed on the western blot. The identity of these bands is unknown to date (Fig. 2.4c). CK2α expression was analyzed in multiple human MPNST tissue (n=6 different patients) and nerve (n=2) biopsies using immunohistochemistry (IHC). CK2α immunoreactivity appeared increased in
MPNSTs as compared to the normal nerve, but showed variability among the
MPNST samples (Fig. 2.4d-i).
2.8.2 CK2 inhibition induces cell death and cell cycle arrest in MPNSTs in vitro. To test if MPNST cells depend on CK2α for survival, MPNST cell lines were treated with two different CK2α shRNAs, each of which decreased expression of the CK2α protein (Fig. 2.5a). MPNST cell viability, as measured by MTS assay, was significantly reduced by the knockdown of CK2α by 72h post infection (Fig. 2.5b,c). We
38 confirmed the sh-CK2α knockdown results by the pharmacological inhibition of
CK2. CX-4945 is an anti-tumor agent in phase II clinical trials that inhibits CK2 activity by competitively binding to the CK2 enzyme active site [249]. To determine the effective concentrations of CX-4945, MPNST and iHSC cell lines were treated with CX-4945 for 72h and cell viability was measured through MTS absorbance. At approximately 6 µm CX-4945 decreased NF1 derived MPNST cell line viability by
50%. CX-4945 at 10 µm had maximal effect on NF1 derived MPNST cell line survival, causing significant reduction of viability at 72h. The 26T sporadic MPNST cell line was more resistant to CX-4945 than the NF1 derived MPNST cell lines. An immortalized human Schwann cell (iHSC) control cell line was significantly more resistant to CX-4945 treatments as compared to MPNST cell lines (Fig. 2.5d,e).
MPNST cell lines were treated with CX-4945 for 24h and harvested for western blot analysis. The antibody against CK2 phosphorylated target motif pS/pTDXE showed that increasing concentrations of CX-4945 progressively decreased CK2 substrate phosphorylation (Fig. 2.5f). CX-4945 treatment induced apoptosis as indicated by increased cleaved PARP (Fig. 2.5f) and increased the percent of cells in the G2/M phase of the cell cycle, an indicator of cell cycle of arrest (Fig. 2.5g).
2.8.3 CK2 regulates β-catenin protein stability in MPNSTs in vitro. CK2 activity can induce canonical WNT signaling pathway activation by phosphorylating β-catenin in its armadillo repeat region [244]. This phosphorylation prevents interaction with the GSK-3β destruction complex, allowing β-catenin to translocate to the nucleus and induce target gene transcription [244,250]. As β-catenin expression is important for MPNST growth and survival [80,78], and CK2 is elevated
39 in MPNSTs, we hypothesized that CK2 might regulate β-catenin protein stability. CX-
4945 treatment reduced β-catenin protein levels by 10min. and caused profound reduction by 12h (Fig. 2.6a.). MPNST treatment with CX-4945 did not affect CTNNB1 mRNA levels (data not shown). This data suggests that CK2 likely regulates β-
Catenin protein stability in MPNST cells through a protective phosphorylation of the armadillo repeat region of β-Catenin. Loss of β-catenin decreased MPNST cell viability in previous studies [80,78]. To begin to test if stabilization of β-catenin protein would rescue the cytotoxic effects of CK2 inhibition, we treated MPNST cells with CX-4945 and GSK-3β inhibitors LiCl or CHIR92201. Treatment with GSK-3β inhibitors partially rescued the cytotoxicity of CK2 inhibition (Fig. 2.6b), as β- catenin protein levels (Fig. 2.6c) and downstream target gene expression AXIN2,
LEF1, and C-MYC were restored (Fig. 2.6d). To determine if β-catenin knock down phenocopies the G2/M arrest or apoptosis caused by CK2 inhibition, cells were treated with sh-CTNNB1 for 72h and subjected to propidium iodide flow or western blot analysis. β-catenin knockdown phenocopied apoptosis as indicated by cleaved
PARP (Fig. 2.6e). However, shCTNNB1 did not phenocopy CK2 mediated changes in the cell cycle profile (Fig. 2.6f) suggesting that CK2 regulates additional mechanisms of cell survival.
2.8.4 CK2 regulates TCF8 and other survival pathways in MPNSTs in vitro. To investigate mechanisms of survival regulated by CK2 that are independent of β- catenin we overlapped lists of known and predicted CK2 targets to genes overexpressed in MPNSTs, resulting in three potential targets: SIX1, TWIST1, and
TCF8 [251,252]. Of the potential three targets only TCF8 decreased in response to CK2
40 inhibition (Fig. 2.7a). Over-expression of the CK2α subunit has been shown to drive over-expression of TCF8 in breast cancer and TCF8 contains potential CK2 phosphorylation sites [252,253,254]. To test if TCF8 is involved in MPNST survival we treated MPNSTs with TCF8 specific shRNA. Treatment of MPNSTs with TCF8 shRNA significantly decreased cell viability but had little effect on iHSCs as measured by a
MTS assay 3 days post infection (Fig. 2.7b). We demonstrate that the TCF8 shRNA knocks down TCF8 mRNA and protein by day 3 (Fig. 2.7c,d). MPNSTs treated with shTCF8 undergo apoptosis as demonstrated by cleaved PARP western blot analysis
(Fig. 2.7d.). However, cell cycle progression was not perturbed in MPNSTs through shRNA knockdown of TCF8 (Fig. 2.7e).
2.8.5 CX-4945 slows tumor growth in vivo To test the effectiveness of CX-4945 in vivo, athymic nude mice were injected with
1.5 million MPNST (S462-TY) cells. When xenografts grew to an average of 250 mm3 treatment began. The study continued for 24 days, or until tumor burden reached
2500 mm3. At a dose of 75 mg/kg twice daily, CX-4945 slowed MPNST tumor growth by approximately 50% through 15 days of treatment (Fig. 2.8a). CX-4945 also significantly increased the survival of engrafted mice, with 66% of CX-4945 treated mice surviving through day 24, while only 20% of the vehicle control treated mice survived 24 days (Fig. 2.8b). Tumors were harvested 30min and 3h post CX-
4945 treatment, and substrates were analyzed. CX-4945 treatment resulted in decreased phosphorylation of CK2 targets at 30min and 3h. β-catenin and TCF8 protein levels were, however, only decreased at the 3h time point (Fig. 2.8c,f). CX-
4945 also decreased Ki67 expression indicating reduced proliferation (Fig. 2.8d) but
41 did not induce apoptotic cell death as measured by cleavage of Caspase 3 in MPNST xenografts (Fig. 2.8e).
2.8.6 MPNST treatment with CX-4945 in combination with PD0325901 Hyper-activated RAS signaling is a hallmark of the NF1 syndrome. RAS activates downstream targets including MEK. Previous reports showed that CX-4945 can sensitize head and neck cancer to MEK inhibitors and MEK inhibition has been shown to slow MPNST tumor growth [255,57]. Therefore, we hypothesized that combination treatment with a MEK and CK2 inhibitor might be a more effective
MPNST treatment than either single agent alone. To test this idea MPNSTs were treated with CX-4945, PD0325901, or PD0325901 and CX-4945 in vitro and cells were counted after 72h. Combination treatment decreased the MPNST cell population by 50-70% as compared to cells treated with either CX-4945 or
PD0325901 alone and the combination index (C.I.=0.85) suggests that CX4945 with
PD0325901 is moderately synergistic as defined by Compusyn
(www.combosyn.com) (Fig. 2.9a). The death marker cleaved PARP indicated that the combination of PD0325901 and CX-4945 caused a larger percentage of cells to enter apoptosis at 24h as compared to equivalent doses of single agents (Fig. 2.9b)
A xenograft study was performed to test the effectiveness of CX-4945 and
PD0325901 as combination treatment in vivo. However, the effect on tumor growth by the combination of CX-4945 with PD0325901 did not differ from mice treated with PD0325901 alone (Fig. 2.9c). All mice treated with PD0325901 or PD0325901 with CX-4945 survived until day 24 (Fig. 2.9d). Thus, while the in vitro results of combining CX-4945 and PD0325901 seemed promising, the in vivo combination
42 treatment was not more effective than PD0325901 alone.
2.9 Discussion, Implications, and Limitations
2.9.1 Discussion In this study we demonstrate that CK2α is overexpressed in MPNST cells and that inhibition of CK2 through shRNA or with CX-4945 causes MPNST cells to arrest in the G2/M phase of the cell cycle and undergo apoptotic cell death. β-catenin plays a significant role in MPNST cell survival in vitro, and we find that CK2 controls β- catenin protein stability in MPNST. Additionally, CK2 may regulate survival of
MPNSTs through TCF8. CX-4945 inhibited tumor growth and increased survival in a
MPNST xenograft model. It has been reported that there is minimal toxicity of CK2 inhibition in phase I clinical trials [256], making CX-4945, or other CK2 inhibitors, an appealing therapeutic approach for treating MPNSTs.
At least part of the effect of CX-4945 on MPNST cell survival is due to its reduction of β-catenin; partial rescue of CX-4945 cytotoxicity was achieved by re- expression of β-catenin using GSK-3β inhibitors, and knockdown of β-catenin phenocopies the apoptosis caused by CK2 inhibition. However, shCTNNB1 did not phenocopy the modest G2/M arrest demonstrated by CK2 inhibition with CX-4945.
These results compelled us to explore other pathways. We identified TCF8 as another potential MPNST survival factor. TCF8 is consistently overexpressed in human MPNST cells and tumors (Miller et al., 2009), and CK2 inhibition caused a decrease in TCF8 protein. Knockdown of TCF8 using shRNA induced apoptosis in
MPNSTs. Thus, CK2 regulates β-catenin and TCF8 stability to promote MPNST survival. This may be a general phenomenon, as CK2α overexpression also resulted
43 in TCF8 overexpression in breast cancer [257]. Precisely how CK2 facilitates cell cycle progression is unknown. Correlative data suggests that one CK2 substrate relevant to cell cycle regulation is SIX1 [258]. It is therefore of interest that several SIX transcripts (SIX1- 4) show elevated expression in MPNST (Miller et al., 2010).
Although SIX1 expression was not reduced by CK2 inhibition, the potential phosphorylation of SIX1 by CK2 may be important for MPNST cell viability.
Bian et al (2015) reported that MEK inhibition sensitizes head and neck cancer cells to the cytotoxic effects of CK2 inhibition with CX-4945 [255]. We reproduced these results in MPNST cells in vitro, finding that MPNST cell survival was decreased by the combination of CX-4945 and PD0325901. Our xenograft studies confirmed that PD0325901 is effective at slowing MPNST growth, as previously shown using a dose of 10mg/kg in another xenograft model [57]. The lower dose of 1.5 mg/kg used in this study is the mouse counterpart of the current recommended clinical dose. We found that 1.5 mg/kg PD0325901 dose significantly slowed tumor growth in a xenograft model and significantly down regulated MEK signaling. However, we failed to find any added benefit of the combination in the
S462TY xenograft model at the doses tested.
In conclusion, inhibiting CK2 activity decreased MPNST cell survival, which correlated with a reduction in β-catenin and TCF8 protein expression. Based on these findings, CK2 inhibition enables targeting of survival pathways in MPNST and supports further investigation of CX-4945 as a potential therapeutic.
44 2.9.2 Implications and limitations Developing a CK2 inhibitor that is effective in vivo and yet not completely toxic to the organism has been in the works for decades. CX-4945 has cleared phase 2 clinical with no dose limiting toxicities and demonstrated some efficacy as an anti- tumor agent. CX-4945 successfully stabilized 26% of enrolled patients advanced stage solid tumors. Currently, intriguing clinical trials are on going testing CX-4945 in earlier onset tumors and in combination with other drugs. Due to CK2’s role in
DNA damage repair and the nature of chemotherapeutics, the Mayo medical clinic is conducting a phase II clinical trial combining CX-4945 with gemcitabine and cisplatin in cholangocarinomas.
While the data from this study is promising in regards to targeting CK2 in MPNST patients, the results are not enticing enough to begin a phase II clinical trial. While
CX-4945 induced significant cell death in vitro, at best CX-4945 was cytostatic in- vivo. While CX-4945 slowed tumor growth and extended survival time, treated mice eventually succumbed to tumor burden. CX-4945 effects on MPNSTs in vivo is likely linked to CX-4945’s pharmacodynamics. Of the animals tested CX-4945 had the shortest half-life and lowest bioavailability in mice. In the mouse, CX-4945 has a 5h half-life and only 20% bioavailability (259), and reduced β-catenin protein partially and transiently in the Xenograft. Most studies using CX-4945 in xenografts have dosed mice at 75 mg/kg b.i.d., as we did [255,260,141,249,261,259]. Under these conditions, CX-4945 is under its IC50 for prolonged periods, even when dosing twice daily. In humans, however, CX-4945 has a half-life of 25h and can maintain higher concentrations in the blood for longer periods of time, and thus should be
45 more effective than in mice. In addition to the poor pharmacodynamics of CX-4945 in the mouse, it is likely that the current standard treatment of twice daily is an insufficient dosing schedule. Reports from an adult phase I clinical trial concluded that CX-4945 4 times daily was more effective in maintaining CK2 inhibition in blood cells than a split dose of CX-4945 twice daily and did not report additional side effects [262]. Further optimization of dose or schedule could also enhance the combinatorial effect with CX-4945. In addition, new generations of CK2 inhibitors in mice might be used to test single agent activity and identify more effective combinations.
2.10 Future Directions Our goal has been to discover key factors regulating MPNST survival and then to therapeutically target these factors. The report of β-catenin being a necessary
MPNST survival factor led us to investigate CK2’s potential role in MPNSTs. The results of CX-4945 on MPNSTs in vitro and in vivo suggest we have found a viable way of targeting β-catenin. However, as discussed, the results must be more persuasive to take these discoveries to the clinic. To be more conclusive about CX-
4945’s potential in pre-clinical trials there are two avenues of exploration that might be pursued. First, a clinically relevant dosing regimen for CX-4945 could be optimized in mouse models. The twice-daily treatment of mice, which have lower bioavailability and higher clearance rates, is likely not reflecting CX-4945 in patients being dosed 4 times daily [259,262]. Much lower mg/kg doses of CX-4945 in dogs and rats resulted in higher plasma concentrations for longer periods time [259]. Humans demonstrate a 25 hr half-life for CX-4945 (dogs 8.3, rats 11.6) and likely
46 demonstrate even greater stability of CX-4945 in the blood [259,262]. With that being said, I recommend an increase in drug per dose, and increased dose frequency for mouse models to test CX-4945’s potential efficacy in treating human disease.
Evasion of cell death/immortality and unregulated cell growth are hallmarks of cancer. Along with escaping normal cellular checks and balances many cancers have the extraordinary ability to rapidly adapt to detrimental conditions. Freireich and
Frei’s infamous experience developing a 4-drug poly therapy for AML is a perfect depiction of cancer’s ability to resist monotherapies [263–265]. CK2 may be an excellent candidate for combination therapy in MPNSTs, or other cancers with CK2 dependency. The pleiotropic nature of CK2 in maintaining and promoting cancer survival and proliferation opens up a large pool of candidate drugs to be tested in conjunction with CK2. The clinical trial using Cisplatin, Gemcitabine and CX-4945 in cholangocarcinomas is exploiting CK2’s essential role in DNA repair and could be tested in MPNSTs. We demonstrated that CK2 regulates β-catenin protein stability in MPNSTs and that this relationship is at least partially responsible for the effects of
CX-4945 on MPNSTs. Therefore, combining CX-4945 with inhibitors of the β-catenin pathway is also worth exploring. As mentioned earlier, most direct inhibitors of β- catenin have been prohibitively toxic. However, an advantage of combination therapy is potential synergism between drugs, so that potentially less toxic doses of
β-catenin inhibitors could be used in conjunction with CX-4945, reducing toxicity.
Additionally, CX-4945 in combination with MEK inhibitors such as PD0325901 is still an avenue worth exploring. While the results of my studies show no greater effect in vivo than the MEK inhibitor alone, I believe this result could easily be
47 attributed to the poor pharmacodynamics of CX-4945 in the mouse. As recommended above, further optimization of CX4945 dosing in mice is necessary to draw strong conclusions concerning CX-4945’s potential as a therapeutic in
MPNSTs.
48 2.11 Methods
Viral Infection
MPNST cells were seeded at 1.5 x 105 in 6 well plates and then transduced with lentivirus when wells became 10-20% confluent. Target MOI for all infections was
10. Incubation of the virus was carried out a at minimal volume of 1 ml with polybrene (8 µg/mL) (Sigma) overnight. Cells were then incubated in DMEM containing 10% FBS and 1% penicillin/streptomycin with Puromycin (2 ug/ml).
Lentiviruses encoding shRNA targeting CK2 (TRCN0000000607,
TRCN0000320858), β-catenin (TRCN0000314921, TRCN0000314991), and TCF8
(TRCN0000017567, TRCN0000017564) were acquired from Sigma. Sigma non- targeting lentivirus (SHC016H) was used as a control.
RNA preparation and Real Time Quantitative RT-PCR (qPCR)
The RNeasy kit (Qiagen) was used to isolate RNA. RNA was converted to cDNA using the ABI High capacity archive kit. Real time quantitative reverse transcriptase PCR
(qPCR) QPCR was performed using Thermo scientific SYBR-green master mix. QPCR results were replicated with 3 different experimental samples and each qPCR was performed in triplicate. Expression of each gene was normalized to β-Actin. Human primers included: CSNK2A1 F-GCTGGGGGTAAGACCTTGTT and R -
TTGTCTGTGTGAGCAGAGGG , β-ACTIN F-GTTGTCGACGACGAGCG and R-
GCACAGAGCCTCGCCTT, AXIN2 F-CTGGTGCAAAGACATAGCCA and R-
AGTGTGAGGTCCACGGAAAC, LEF1 F- CACTGTAAGTGATGAGGGG and R-
49 TGGATCTCTTTCTCCACCCA, C-MYC R-GACAAATGAACACAGCCCAA and L-
GAGTCCATGGCCAGAAAACT, CTNNB1 F- ATTGTCCACGCTGGATTTTC and R-
TCGAGGACGGTCGGACT.
Immunohistochemistry.
Paraffin sections were deparaffinized, hydrated and transferred to 0.1M citrate buffer (pH 6.0) for antigen retrieval. Slides were boiled for 10 minutes in citrate buffer, cooled at room temperature for 30 minutes, rinsed in water twice and in PBS
3 times. Sections were quenched with 3% hydrogen peroxide for 10 minutes, rinsed in PBS, and blocked in 10% normal goat serum with 0.3% Triton-X-100. Sections were incubated overnight in primary antibody diluted in block; rabbit anti CK2α on human MPNST and normal peripheral nerve (Abcam, ab76040 at a dilution of
1:200) and rabbit β-catenin (Cell Signaling, 8480 at a dilution of 1:200). Sections were then washed and incubated in goat anti rabbit biotinylated secondary antibodies (Vector, BA-1000) for 1 hour at room temperature, incubated in ABC
(Vector, PK-6100) followed DAB (Vector, SK-4100) staining. Some sections were counterstained with Harris hemotoxylin. All microscopic images were acquired with
Openlab software suites on a Zeiss Axiovert 200.
Immunoblot
Cell lysates were made with radioimmunoprecipitation assay buffer (RIPA) and western blotting was performed. Membranes were probed with antibodies for CK2α
1:5000 (Cell Signaling, 2656), phosphorylated CK2 substrate 1:10,000 (Cell
Signaling, 8738), PARP 1:5000 (Cell Signaling, 9542), β-catenin 1:10,000 (Cell
Signaling, 9562), HRP conjugated β-Actin 1:50,000 (Cell Signaling, 5125), or TCF8
50 (Cell Signaling, 3396). Horseradish peroxidase-conjugated secondary antibodies
(Jackson Labs) were incubated for 1h at room temperature. Blot development was performed with ECL Plus developing system (Amersham Biosciences).
Cell viability assays
MPNST and iHSC cell lines (500 cells/well) were seeded in triplicate in 96-well plates. Cells were selected in Puro for 48h and absorbance was read day 3 post- infection of CK2, TCF8, or β-catenin shRNA or day 3-post treatment with CX-4945.
Absorbance reagent CellTiter 96® Aqueous One Solution Cell Proliferation Assay
(Promega) was used. Combination drug studies using CX-4945 and PD0325901 were completed after a 72h treatment time and cells were quantified with Biorad
TC20 automated cell counter. Combination index was calculated using ComboSyn developed by Tin-Chao Chou.
Cell cycle analysis
Approximately 200,000 MPNST cells were seeded in a six well plate and then treated with CX-4945, DMSO, or shRNAs for 24h. Cells were harvested and fixed in methanol at -20° C for 30 minutes to overnight and then washed in PBS before being stained with propidium iodide at 50 ug/ml (Sigma). A FACSCantos was used for
Flow and data was analyzed using FlowJo software.
51 Mouse xenograft
1.5×106 MPNST S462-TY cells suspended in Matrigel (BD) were injected subcutaneously into 6 to 8-week-old female athymic nude (nu/nu) mice (Harlan).
3 Treatment of tumors began when the average tumor size was 250 mm . CX-4945 sodium salt (Medchem Express, HY-50855B) was dissolved in 25mM sodium phosphate buffer (pH=4.3) (Sigma, 79629) and mice were treated twice daily at a dose of 75 mg/kg (255). PD0325901 was dissolved in 0.5% methylcellulose/0.2% tween 80 in water and administered once a day at a dose of 1.5 mg/kg by oral gavage. Tumor volumes were measured every 3 days.
Cell Lines
The ST88-14, S462TY, and 88-3 MPNST cell lines derived from patients with NF1 mutations. The STS26T MPNST cell line is derived from a sporadic MPNST with two
WT NF1 alleles. The immortalized human Schwann cell line (iHSC) is derived from normal human sciatic nerve. The iHSC’s contains no mutations in the NF1 alleles and was immortalized through expression of hTERT and CDK4R24C (Dr. Margaret Wallace, manuscript in preparation). All MPNST cell lines and iHSCs were cultured in
Dulbecco's Modified Eagle Medium (DMEM) containing 10% FBS and 1% penicillin/streptomycin (Fisher). Normal human Schwann cells (NHSCs) were obtained from autopsy specimens and maintained as described [266].
52 Acknowledgements
We thank Shyra J. Miller for editing this paper and Margart Wallace (U. Florida) for the iHSC cell line.
Disclosures
The authors have no conflicts of interest to disclose
Funding
This work was supported by grants from the National Institutes of Health
1R21NS084885-01A1 (NR and TPC), R01NS086219 (NR and DAL), and NS28840
(NR). The Cincinnati Children’s Hospital Research Foundation, Flow Cytometry,
Pathology, and Viral Vector Cores provided partial support for these studies (NIH P30
DK,090971055)
53 2.12 Figures and Legends
Fig 2.4 A. Three designated MPNST cell lines show over-expression of CSNK2A1 mRNA vs NHSCs. B. Western blot analysis shows that CK2α protein is overexpressed in MPNST cell lines vs NHSCs. C. Western blot analysis using an antibody that detects CK2 substrate phosphorylation reveals increased CK2 activity in MPNST cell lines. Some CK2 targets phosphorylated in MPNSTs but not NHSCs are highlighted by the black box. D-I. Expression of CK2α shown by IHC in human nerve (D) and
MPNST patient biopsy samples (E-I). Asterisks in A indicate statistically significant differences (* p < 0.05, ** p < 0.01, *** p < 0.001). QPCR results are shown as the mean ± standard deviation (S.D.) of three independent biological replicates, each in triplicate. Western blots are representative of at least 3 independent experiments.
54
Figure 2.5 A. MPNST (S462-TY) cells were treated with 2 unique shRNAs targeting
CSNK2A1 for 72h, and western blot analysis confirmed a reduction of CK2α protein.
NT= cells treated with a non-targeting shRNA control. B. Three day CK2α shRNA treatment had a cytotoxic effect on MPNST cell lines as measured by MTS; y-axis is
O.D. reading at 490nm. C. Phase contrast photomicrographs show S-462TY cells 3 days after NT or shCK2α #1. D. Increasing concentrations of CX-4945 (72h) decrease MPNST cell line growth. CX-4945 has less effect on control iHSC cells as measured by MTS; y-axis is O.D. reading at 490nm. E. CK2α is overexpressed in
MPNST cell lines as compared to the iHSC control cell line. F. Phase contrast shows that CX-4945 treatment depletes cell population at 24h as compared to the DMSO control. G. MPNST cell lines show a decrease in CK2 activity in response to
55 escalating CX-4945 concentrations (24h) as measured by a western blot analysis using anti-CK2 substrate, and to undergo apoptosis as indicated by increased cleaved PARP. H. CX-4945 causes MPNST cells (S462-TY) to increase the percent of cells in the G2/M phase of the cell cycle as indicated by flow analysis of propidium iodide stained cells (S.D. of DMSO = 1.8% and CX4945 =3.8%). Asterisks in B indicate differences after Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001). CX-
4945 cell viability assay, MTS, and qPCR results are the mean of three independent biological replicates each in triplicate, ± S.D.
56
Figure 2.6. A. Time course treatment of CX-4945 at 10 μm decreases β Catenin protein as early as 10min in western blot analysis in MPNST (S462-TY) cells. B
Partial rescue of CX-4945 MPNST cytotoxicity is achieved by inhibiting GSk3-β through CHIR99021 or LiCl as measured through MTS assay 72h. post treatment; y- axis is O.D. reading at 490nm. C. Treatment with GSK3-β inhibitors restored β
Catenin protein in CX-4945 treated MPNST cells (24h) as measured by western blot analysis. D. Treatment with GSK3-β inhibitors restored β-Catenin target gene mRNA expression in CX-4945 treated MPNST cells (24h) as measured by qPCR. E. Western blot shows that shCTNNB1 induces apoptosis (cleaved PARP) in MPNST cells (S462-
TY). F. MPNST (S462-TY) cells treated with shRNA containing a non-targeting sequence or against β-Catenin and then stained with propidium iodide. Flow analysis of these samples reveals no significant difference in the cell cycle profile.
(S.D. of NT = 1.6% and shCTNNB1 = 5.3%). Western blot above the cell cycle
57 analysis shows that the shRNA effectively targeted β-Catenin. Asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01, *** p < 0.001); Student’s t- test. MTS and qPCR results are the mean of three independent biological replicates each in triplicate ±S.D.
58
Figure 2.7. A. CX-4945 treatment for 3h decreases TCF8 protein expression in
MPNST cell lines (S462-TY (TY) and 26T). B. A 72h. treatment with TCF8 shRNA caused a significant decrease in MPNST cell viability in multiple MPNST cell lines, but not iHSC, in an MTS assay. NT = cells treated with non-targeting shRNA control.
C. TCF8 shRNA decreased TCF8 RNA expression in MPNSTs (S462-TY) 72h post treatment. D. TCF8 shRNA decreased TCF8 protein levels and induced apoptosis in
MPNST cells (S462-TY) as indicated by increased levels of cleaved PARP. E. TCF8 knockdown did not cause alter cell cycle progression (S.D. of G2/M phase: NT =
1.7% and shTCF8 = 1.3%). Asterisks in B indicate statistically significant differences
59 as for other figures. MTS, Flow, and qPCR results are the mean of three independent biological replicates in triplicate, ± S.D.
60
Figure 2.8. A. MPNST xenograft growth was significantly reduced by CX-4945
(p<0.05=*). B. Survival of mice was significantly increased by CX-4945 treatment (p
< .0001 using a log-rank Mandel-Cox test). C. Tumors were harvested from mice treated with CX-4945 at 30min or 3h post last dose. Western blot analysis indicates that CX-4945 inhibited CK2 substrate phosphorylation. β-catenin and TCF8 protein levels were also reduced at the 3h time point. Top, PD0325901 did not affect these targets. D. Tissue sections from MPNST xenografts harvested 3h. after the last dose of CX-4945 show significantly decreased cell proliferation (Ki67+ cells). E. Cell death
(Cleaved Caspase 3) did not change in treatment groups (Cells per high-powered field; HPF). F. β-catenin immunohistochemistry confirms that CX-4945 decreases β- catenin protein in MPNST xenografts. In E,F, effects of the MEK inhibitor are shown for comparison. Asterisks in D indicate statistically significant differences analyzed by ANOVA (* p < 0.05, ** p < 0.01, *** p < 0.001).
61
Figure 2.9. A. 72h combination treatment of CX-4945 and PD0325901 at concentrations 5 and 2 μm respectively had an additive to synergistic effect on
MPNST cell lines S462TY and ST88-14, but little effect on the sporadic 26T cell line.
B. MPNST cells treated for 24h with CX-4945, PD0325901, or the combination revealed increasing PARP cleavage in combination treatments. C. S462TY cells were grafted into nu/nu mice and segregated into vehicle, CX-4945, PD0325901, or CX-
4945 + PD0325901 groups and were treated for 24 days. CX-4945 and PD0325901 both delayed tumor growth, however the CX-4945 + PD0325901 treatment did not slow tumor growth more than the PD0325901 treatment alone. CX-4945 tumor growth results represented by the dashed redline (data shown in Figure 5a). D.
Mice were removed from the survival curve at time of death or when the tumor
62 volume reached 2500 mm3. All mice treated with PD0325901 or CX-4945 +
PD0325901 survived until the end of the study at Day 30 (p < .0001 using log-rank
Mandel-Cox test). Asterisks in A ndicate statistically significant differences (* p <
0.05, ** p < 0.01, *** p < 0.001). In vitro MTS results are the mean of three biological replicates ± S.D.
63 Chapter 3: PITX2 is over-expressed and necessary for MPNST survival
3.1 Introduction to PITX2 The PITX2 gene encodes a set of bi-coid homeo-domain DNA binding transcription factors [267]. Through alternative splicing and an internal promoter within the PITX2 locus, 3 main PITX2 variants are expressed [267–270]. PITX2 variants 1 and 2, which encode proteins PITX2 A and B, are transcribed from the proximal promoter. PITX2
A and B variants are then created via alternative splicing of the original mRNA [269].
PITX2 C (mRNA variant 3) is transcribed from an internal promoter located within intron 3 [271]. These mechanisms of RNA processing and transcription create PITX2 proteins that are homologous from the DNA binding domain to the C-terminus, with different N-termini. PITX2D is another variant that is created from a cryptic splice site, and has only been identified in humans, within the variant 3 transcript [272].
There is only one paper describing PITX2D in the literature [272]. Through a series of
GST pulldowns and over-expression assays PITX2D was shown to bind other PITX2 variants and inhibit their transcriptional activity in a dominant negative fashion [272].
PITX2 variants are known to hetero and homo-dimerize with each other to regulate gene expression [272,273]. In fact, the autosomal dominant Axenfeld Reiger syndrome is often caused by a heterozygous point mutation in the PITX2 DNA binding domain
[274]. At least in developing neural crest cells, the defective PITX2 protein acts as a dominant negative protein inhibiting PITX2 function causing craniofacial defects
[275–278]. However, developmental processes dependent on PITX2, such as pituitary, testis, and heart looping are rarely affected by the heterozygous mutation found in
64 Axenfeld Reiger syndrome [278–281]. This may suggest that all functions of PITX2 are not completely dependent on PITX2 dimerization. PITX2D is unique in that its DNA binding domain is partially deleted, which may contribute to the dominant negative effects observed.
The homeodomain of PITX2 is 60 amino acids long and contains a lysine residue at position 50 indicative of Bicoid family transcription factors [267,269,282]. The consensus DNA binding sequence for PITX2 variants is TAATCC, the 3’ CC being recognized by the Bicoid like lysine residue [282–285]. As mentioned above, PITX2 variants have regions of high homology, including in the DNA binding domain, leading to some redundancy in function among the variants [273,286,287]. Prolactin expression during development is highly dependent on PITX2 expression in the pituitary [288–291]. The Prolactin promoter can be activated through regulation of any
PITX2 variant, and in vitro assays suggests that combinations of PITX2 variants act synergistically on the prolactin promoter [289,292]. Hindbrain development also demonstrates the redundant functions among PITX2 variants as all three PITX2 variants are expressed and can contribute to this process [287]. As discussed above,
PITX2 variants contain unique N-termini, which gives them uncompensatable functions. PLOD1 and DLX2 are two promoters whose activation is dependent on
PITX2 [289]. Both PITX2 A and C can activate transcription directed from the PLOD1 and DLX2 promoters. PITX2 B individually is unable to activate PLOD1 and DLX2 transcription, but can act synergistically with PITX2 A or C on these promoters [289].
How the 20 amino acid difference between PITX2 A and B causes dramatically different effects on the PLOD1 and DLX2 promoters is still unknown. Future sections
65 of this thesis elaborate on the different functions of PITX2 isoforms.
3.2 PITX2C in left right asymmetry and heart development. Left right asymmetry is dependent on expression of PITX2 in the lateral plate mesoderm [293–295]. PITX2 expression is up regulated by Nodal at the 2 somite stage of development, and persists through later stages of development despite Nodal’s disappearance [271]. PITX2 controls the left right patterning of all structures to which the splanchnic mesoderm contributes [294,296]. In chick and Xenopus, knockdown of
PITX2 results in random assignment of sidedness, including heart looping [297]. In mice PITX2 knockdown, although embryo turning and cardiac looping occur without defect, right-sided lung and atrial isomerization occurs [297]. The differences between chick and mouse may be due to more robust factors directing mouse asymmetry patterning. Experiments designed to rescue left-right patterning defects of PITX2 knockdown determined that PITX2C, but not A or B, restores proper visceral orientation [298]. PITX2 variant expression was explored via in situ hybridization, and only PITX2C was identified in the left lateral plate mesoderm and its derivatives.
The reasons PITX2C but not variants A and/or B can govern left-right asymmetry are not completely known. Some insight into differential mechanisms employed by
PITX2 variants was gained by studying heart patterning. PITX2C and NKX2.5 are early markers of cardiogenesis and act together to regulate gene expression in the developing heart [271,295,299,300]. Mutation in either PITX2 or NKX2.5 leads to congenital heart defects [301,302]. Furthermore, NKX2.5 and PITX2C expression
66 continues to be important for adult cardiomyoctye function [301,302]. Atrial
Natriuretic Factor (ANF) is a gene commonly regulated by PITX2 and NKX2.5.
During heart development PITX2C in combination with NKX2.5 acted cooperatively in activating ANF expression, while the interaction between PITX2A and NKX2.5 inhibited ANF transcription [303].
3.3 PITX2 in cancer and the WNT signaling Pathway There is a small but growing collection of literature describing expression and mechanism of PITX2 in various cancers. PITX2 overexpression has been identified breast, colorectal, ovarian, metastatic prostate, thyroid, and squamous cell carcinoma [304–310]. There is an established negative correlation between patient survival and PITX2 over-expression in colorectal, non-small cell lung, and ovarian cancers [305,308,310]. In esophageal squamous cell carcinoma the presence of PITX2 expression was a predictive biomarker of resistance to definitive chemoradiotherapy [306]. Furthermore, renal carcinoma cells increased resistance to doxorubicin treatment when PITX2 was over-expressed [311]. In renal carcinoma cells PITX2 drove the expression of ABCB1 which is a membrane protein able to transport doxorubicin out of the cell [311].
While there is no unifying theme to describe the mechanisms of PITX2 in cancer, there are some common threads. PITX2 is highly involved in cell cycle regulation. In most reports, over-expression of PITX2 leads to increased proliferation of cancer cells through hyper-activation of cell cycle regulators such as Cyclin A1, D1 and D2
[312–314]. Similarly, PITX2C promoted stem like features including de-differentiation
67 and hyper-proliferation of cardiac progenitors through up regulation of Cyclins and c-MYC [315,316]. PITX2’s role in cell cycle regulation is muddled, however, as in some contexts PITX2 is a negative instead of a positive regulator of cell proliferation. In multiple developmental contexts and in MEFs PITX2 up-regulates the expression of cyclin dependent kinase inhibitor p21 to prevent cell proliferation [317]. It is possible that the combination of PITX2 variants expressed control active cell cycle progression or inhibition. However, no studies have been conducted to test the effects of individual PITX2 variants in cell proliferation.
β-catenin is a key regulator of cell survival in cancer. As discussed earlier, cells undergoing malignant transformation employ numerous mechanisms to upregulate
β-catenin signaling. PITX2 affects WNT/β-catenin signaling pathway through several ways. The discovery of overlapping cardiac outflow track phenotypes (due to cardiac neural crest dysfunction) in CTNNB1 -/- and PITX2 -/- mice was the first evidence that PITX2 might be a down stream effector of WNT/β-catenin [318]. In this study, regulatory LEF/TCF binding sites were identified on the PITX2 promoter and the presence of β-catenin could drive PITX2 transcription [318]. PITX2 was also found to physically interact with β-catenin in a protein-to-protein complex [318,319]. β- catenin/PITX2 interaction coordinates HDAC1 activity leading to activation of β- catenin target gene transcription [318,320]. In later studies these mechanisms were confirmed and additional layers of complexity were unraveled. PITX2 not only binds to β-catenin, it also interacts with LEF-1 in a complex with β-catenin to synergistically up-regulate a subset of pro-proliferative genes [321,322]. In developing cranial neural crest designated to become the anterior segments of the eye PITX2 is
68 a downstream target of β-catenin and physically interacts with β-catenin to up- regulate gene transcription [323,324]. These interactions of PITX2 and β-catenin have also been identified in the context of cancer. In addition, in ovarian cancer a unique positive feedback mechanism between β-catenin and PITX2 was identified. WNT ligands were identified as being up-regulated by PITX2 expression. Further analysis, through chromatin immuno-precipitation, revealed that PITX2 physically bound to the WNT2 and WNT5a promoters, suggesting that PITX2 directly regulates these genes [312]. Thus, PITX2 can promote β-catenin signaling, and stabilize β-catenin in different cancer types.
69 PITX2 over-expression is critical for MPNST survival and promotes β-catenin protein stability.
Jed J. Kendall1, Ami V. Patel1, Kwangmin Choi1, and Nancy Ratner1*
1Division of Experimental Hematology and Cancer Biology, Cincinnati Children’s
Hospital, Department of Pediatrics, University of Cincinnati, Cincinnati, OH 45229-
0713;
Manuscript in preparation for publication:
Kendall JJ, Patel AV, Choi K, Ratner N. PITX2 over-expression is critical for MPNST survival and promotes β-catenin protein stability. Manuscript in preparation.
70 3.5 Results
3.5.1 PITX2 is over-expressed in MPNSTs In efforts to identify drivers of MPNST survival, a MPNST gene expression signature, generated through analyzing 13 MPNST cell lines and 6 unique NF1 MPNST patient biopsies, was compared to a normal human Schwann cell gene expression signature
[251]. PITX2 mRNA was over-expressed 31 fold in MPNSTs as compared to NHSCs
[251]. To confirm the results from the microarray analysis western blot analysis of
MPNST cell lines samples as compared to NHSCs was blotted with a PITX2 antibody revealing that the PITX2C (variant 3) but not PITX2 A or B is consistently over- expressed in MPNST cell lines (Fig. 3.1a.). QPCR validated the over-expression of
PITX2 variant 3 mRNA in multiple MPNST cell lines (Fig. 3.1b). PITX2D is a rare variant created as an alternative splice product from a cryptic slice site within the human PITX2 variant 3 mRNA. To measure PITX2D qPCR was performed with primers designed to straddle the PITX2D splice site [289]. PITX2D was over- expressed in multiple MPNST cell lines as compared to NHSCs, by at least 3 fold (Fig.
3.1c).
3.5.2 PITX2 is necessary for MPNST survival. Gene signature comparisons between neurofibromas and MPNSTs vs NHSCs were used in an shRNA screen to identify genes that had a detrimental effect on MPNST cells, with lesser effects on A549 cells (Patel et al. 2016). One of the 7 genes identified from the screen was PITX2. MPNST cell lines were treated with 2 different shRNAs targeting all PITX2 isoforms. Each of 2 shRNA hairpins effectively decreased
PITX2 mRNA expression by 7 to 11 fold as determined by qPCR (Fig. 3.2a).
Knockdown of PITX2 in MPNST cell lines also significantly decreased MPNST cell
71 viability as measured by MTS (Fig. 3.2b). Bright-field micrographs show significantly decreased MPSNT cells after shPITX2 treatment (Fig. 3.2c). To determine how
PITX2 deprivation causes decreased MPNST viability, proliferation, and apoptosis markers were analyzed. Knockdown of PITX2 did not impact the proliferation of
MPNSTs as determined by BRDU incorporation (Fig. 3.2d). However, higher levels of cleaved caspase 3 were detected in MPNST cells treated with shPITX2 as compared to MPNSTs treated with the non-targeting (NT) shRNA vector, suggesting that knockdown of PITX2 induces apoptosis in MSPNT cells (Fig. 3.2e).
3.5.3 PITX2 gene network in MPNSTs To define potential causes of PITX2 induced apoptosis, the MPNST S462-TY cell line was treated with shPITX2 or non-targeting (NT) shRNA for 3 days and then subjected to microarray analysis (Fig. 3.3a). As compared to MPNST cells treated with NT shRNA, 203 genes were dysreguated by at least 3 fold (Fig. 3.3a). The top 5 pathway clusters identified from KEGG Ingenuity pathway analysis were: cell adhesion molecule signaling, melanogenesis, P-450 drug metabolism, MAPK signaling pathway, and calcium signaling (Table 3.1). Several, a subset of genes
WNT/β−catenin related genes, PRKCAB, NLK, and FZD6, were also identified (Table
3.1). NLK phosphorylates LEF/TCF family members preventing β−catenin interactions, and FZD6 activates the non-canonical WNT pathway, which can inhibit
β−catenin signaling [325]. PRKCAB is a subunit of PKA, which has been shown to phosphorylate β−catenin, preventing β−catenin from interacting with the GSK-
3β destruction complex [326,327]. Independent from bioinformatic analysis, we noticed that loss of PITX2 resulted in a 3-fold decrease in GAS2 expression. GAS2
72 functions as an inhibitor of the Calpain proteases, which can degrade β−catenin
[328,329].
The dysregulated WNT related genes altered after PITX2 knockdown microarray and PITX2’s known role in WNT related signaling, we hypothesized that PITX2 regulates WNT/β−catenin signaling in MPNSTs. To test this hypothesis, β−catenin target genes, LEF1, AXIN2, and C-MYC were analyzed in a MPNST cell line treated with PITX2 shRNA. LEF1, AXIN2, and C-MYC were all down regulated by at least 2 fold in MPNST cells treated with shPITX2, coinsistant with PITX2’s role in β−catenin signaling in MPNSTs (Fig. 3.3b). To determine if CTNNB1 transcription was regulated by PITX2, qPCR was performed on MPNST cells treated with shPITX2, there was no change in CTNNB1 mRNA expression (Fig. 3.3b). Western blot analysis of shPITX2 treated MPNST cells revealed a decrease of β−catenin protein suggesting that PITX2 regulates β−catenin levels through protein stability (Fig. 3.3c). One-way
β−catenin is commonly stabilized is through inhibition of GSK-3β. This protects
β−catenin from being marked for ubiquitination and degradation through phosphorylation by GSK-3β. If PITX2 regulates β−catenin protein through GSK-3β inhibitory phosphorylation on Ser9 should decrease when PITX2 is knocked down.
However, the opposite occurs, the inhibitory phosphorylation of GSK-3β on Ser9 increased when PITX2 was knocked down in MPNST cells (Fig. 3.3d). These results strongly suggest that PITX2 regulates β−catenin protein stability through mechanisms independent of GSK-3β.
73 3.5.4 PITX2 regulates a subset of WNT related genes. To verify if the subset of known WNT related genes identified in the shPITX2 microarray is dysregulated in MPNST cells, qPCR of NLK, FZD6, and GAS2 was performed. FZD6 and NLK were expressed lower in MPNST cell lines as compared to
NHSCs (Fig. 3.4a), which is consistent with NLK and FZD6 being up-regulated ≥ 3 fold when PITX2 is knocked down. QPCR verified GAS2 overexpression in MPNST cell lines (Fig. 3.4a), consistent with GAS2 decreasing ≥ 3 fold on PITX2 is knock down. Coinciding with GAS2 transcription, western blot analysis showed that GAS2 protein levels are higher in MPNST cell lines as compared to NHSCs (Fig. 3.4b).
MPNST cells treated with shPITX2, multiple MPNST cell lines were treated with shPITX2, and mRNA expression of NLK, FZD6 and GAS2 were also analyzed via qPCR. NLK and FZD6 both increased in expression while GAS2 decreased in expression after PITX2 knock down, further validating the microarray results (Fig.
3.4c). Finally, western blot analysis confirmed the loss of GAS2 protein expression when MPNST cells were treatment with shPITX2 (Fig. 3.4d).
3.5.5 GAS2 is necessary for MPNST survival and regulates β-catenin protein stability. Given that GAS2 is overexpressed and its expression is regulated by PITX2 in
MPNST cells. Therefore we hypothesized that GAS2 is critical for MPNST survival.
Knockdown of GAS2 by shRNA decreased MPNST cell viability (Fig 3.5a). In contrast when NHSCs were treated with GAS2 shRNA and MTS assays were performed 5 days post infection, no significant decrease in cell viability was observed between the treatment groups (Fig. 3.5b). GAS2 has been reported to protect β−catenin from degradation by calpain proteases in other systems [328,329]. Therefore, we
74 hypothesized that loss of GAS2 expression decreases β−catenin protein expression.
Treatment of MPNST cell lines with shGAS2 resulted in decreased GAS2 expression
5 days earlier (Fig. 3.5c). Furthermore, the loss of GAS2 correlated with decreased
β−catenin protein in the MPNST cell lines (Fig. 3.5c).
3.6 Discussion Events leading to transformation of MPNSTs cause PITX2 mRNA to be expressed 27 fold higher than in normal human Schwann cells. We found that PITX2 C and D, but not A or B, are over expressed in MPNST cell lines. PITX2 C and D are transcribed from an internal promoter within the 3rd intron of the PITX2 locus. What causes the transcriptional elements within the 3rd intron to become active in MPNSTs remains unknown. In the lateral plate mesoderm, the TGF-β family member Nodal drives differential PITX2C expression [271]. While Nodal over-expression has not been reported in MPNSTs to date, TGF-β ligand expression enhances MPNST cell survival which may explain the over-expression of PITX2 C and D [330].
Decreased cell viability without altered cell proliferation, and an increase in cleaved
Caspase 3 signal in MPNSTs treated with shPITX2, suggests that PITX2 expression increases MPNST cell viability through suppression of apoptotic signals. In an effort to identify downstream factors of PITX2, we performed microarray analysis of
MPNST cells treated with shPITX2. The microarray revealed that PITX2 could directly or indirectly regulate a sub-set of WNT/β−catenin related genes. PITX2’s regulation of WNT/β−catenin in MPNSTs was confirmed; knockdown of PITX2 decreased β−catenin target genes AXIN2, LEF1, and C-MYC. Knockdown of PITX2 did not change the transcript levels of CTNNB1. Rather, PITX2 is regulates β−catenin at
75 the level of protein stability. The GSK-3β destruction complex is a major regulator of
β−catenin protein levels; however, upon knockdown of PITX2, phosphorylation of
S9 of GSK-3β and S473 on AKT increased [331–333]. This inhibition of GSK-3β is likely a compensatory mechanism for the loss of β−catenin.
The ingenuity pathway analysis of genes dysregulated by PITX2 knockdown in
MPNSTs revealed two candidates that could stabilize β−catenin protein expression,
PRKACB and GAS2. PRKACB, a subunit of PKA, phosphorylates β−catenin on S675
[327], which prevents β−catenin from being phosphorylated by GSK-3β and we have yet to study this kinase. GAS2, as mentioned, is a Calpain protease inhibitor, which prevents Calpain from actively degrading β−catenin [328,329]. Thus far, we have only investigated the effects of GAS2 in MPNSTs and β−catenin protein stability. We confirmed FZD6, NLK, and GAS2 dysregulation in MPNSTs as compared to NHSCs, suggesting that the over-expression of PITX2 is causing differential regulation of genes in MPNSTs vs. NHSCs. Furthermore, we demonstrated that at least one downstream effector of PITX2, GAS2, effectively decreases MPNST cell viability when knocked down. The mechanism by which GAS2 promotes MPNST viability may be through inhibiting Calpain proteases from degrading β−catenin. Calpain proteases, unchecked, can also cause irreparable cellular damage by degrading growth factor receptors, actin, MBP and other factors essential for cell membrane stability [334].
In summary we have shown that PITX2 is over-expressed in MPNSTs and that knock down of PITX2 results in apoptosis. Analysis of downstream effector genes revealed
76 a subset of genes involved in WNT/β−catenin signaling. Further investigation demonstrated that PITX2 regulates β−catenin at the level of protein stability, possibly through the Calpain inhibitor GAS2.
3.7 Implications and Limitations The context in which a transcription factor is expressed often dictates its function.
Transcription factors work in coordinated networks to regulate genes to carry out specific processes. Developmental biology is rife with examples of transcription factor milieus specifying cell identity or cell fate. To understand key processes in
MPNST biology, we identified over-expressed transcription factors necessary for
MPNST cell survival. PITX2 is one of the transcription factors identified. Knowing that loss of PITX2 induces apoptosis; we hoped to identify factors downstream of
PITX2 that might be therapeutically exploited in MPNSTs. We have not yet identified immediately drug-able targets, but we did uncover important aspects of MPNST biology that maybe applicable to other cancers, and in the future, therapeutically viable. Our results are consistent with PITX2 acting as a key regulator of cancer survival [307,308,310,314,335]. Therefore, the mechanisms employed by PITX2 to promote cancer survival may be generalizable. Our list of potential PITX2 downstream targets in MPNSTs may be of value as more research is done on PITX2 in other systems to identify PITX2 target genes
Our preliminary studies focused on GAS2 because GAS2 is known to regulate
β−catenin protein stability [328,329]. Recently, GAS2 was identified as being over expressed and necessary for survival of myeloid leukemia and colorectal cancer
77 cells [328,329]. Further studies of GAS2 in different types of cancer are warranted, and therapeutics targeting GAS2 may represent a therapeutically viable approach to inhibiting β−catenin signaling. Therapeutically, there is one report indicating that the drug candidate XK469 might decrease the expression of GAS2 in colorectal cancer, but the mechanism by which this might occur has been not explored [336].
Our research was limited by multiple factors. PITX2 isoforms C and D, not A and B were over-expressed in MPNSTs, and therefore need to be studied in isolation. The tools available to parse out the action of each PITX2 isoform do not exist. My efforts to knockdown individual isoforms of PITX2 were unsuccessful, as designed shRNA’s failed to target mRNA. The microarray data generated from knocking down PITX2 in
MPNST cells affects all variants, not just those upregulated in MPNSTs. Hopefully future studies of PITX2 can make use from improved resources that can knockdown individual PITX2 isoforms. If specific shRNA targeting individual PITX2 isoforms is not feasible, targeting individual isoforms through crisper-Cas9 technology could be a viable option.
3.8 Future Directions for PITX2 To complete this study, the regulation of GAS2 by PITX2, whether direct or indirect, should be explored. Multiple consensus PITX2 binding sites were identified in the
GAS2 proximal promoter. ChIP analysis of these sites for PITX2 occupancy could verify or exclude direct regulation. The regulation of β−catenin by PITX2 is likely through the inhibition of Calpain proteases via GAS2. Demonstrating that re- expression of GAS2 and/or inhibition of Calpain proteases in context of PITX2
78 knockdown rescues β−catenin protein expression and/or cell survival would strengthen our arguments.
As mentioned in the introduction, β−catenin and PITX2 can interact to regulate gene transcription [319,337]. Since both PITX2 and β−catenin are over-expressed in
MPNSTs, they may complex to drive gene expression. This aspect of PITX2 and
β−catenin interaction was not addressed in this study. Understanding the interaction between PITX2 and β−catenin and its relevance in various types of cancer maybe of therapeutic value. In efforts to inhibit β−catenin signaling, drugs have been developed to prevent LEF-1 and β−catenin interaction. In a similar fashion, drugs maybe developed against β−catenin-PITX2 interactions, which may be less toxic than blocking β−catenin from, arguably, its most important co-factor
LEF-1.
79 3.9 Materials and Methods:
Viral Infection
MPNST cells were seeded at 1.5 x 105 in 6 well plates and then transduced with lentivirus when wells became 10-20% confluent. Target MOI for all infections was
10. Incubation of the virus was carried out at a minimal volume of 1 ml with polybrene (8 µg/mL) (Sigma) overnight. Cells were then incubated in DMEM containing 10% FBS and 1% penicillin/streptomycin with Puromycin (2 ug/ml).
Lentiviruses encoding shRNA targeting PITX2 (TRCN0000020480,
TRCN0000020481), GAS2 (TCRN0000117859) were acquired from Sigma. Sigma non-targeting lentivirus (SHC016H) was used as a control.
RNA preparation and Real Time Quantitative RT-PCR (qPCR)
The RNeasy kit (Qiagen) was used to isolate RNA. RNA was converted to cDNA using the ABI High capacity archive kit. Real time quantitative reverse transcriptase PCR
(qPCR) QPCR was performed using Thermo scientific SYBR-green master mix. QPCR results were replicated with 3 different experimental samples and each qPCR was performed in triplicate. Expression of each gene was normalized to β-Actin. Human primers included: β-ACTIN F-GTTGTCGACGACGAGCG and R-
GCACAGAGCCTCGCCTT, AXIN2 F-CTGGTGCAAAGACATAGCCA and R-
AGTGTGAGGTCCACGGAAAC, LEF1 F- CACTGTAAGTGATGAGGGG and R-
TGGATCTCTTTCTCCACCCA, C-MYC R-GACAAATGAACACAGCCCAA and L-
GAGTCCATGGCCAGAAAACT, CTNNB1 F- ATTGTCCACGCTGGATTTTC and R-
TCGAGGACGGTCGGACT, GAS2 F– AAAAGTTTCCCAGCCTCCTC and L-
80 CCAAGGAAGATACCGAGTG, NLK F- GACCCTTTTGCAAGAGACCA and L-
CAGCAGCAGCTGGATTATTTGA, FZD6 F- ATTCCAGATTTGCGAGAGGA and L-
AAAATGGCCTACAACATGACG. PITX2 primers, all transcripts: PITX2 Variant 3,
PITX2D.
Immunohistochemistry.
Paraffin sections were deparaffinized, hydrated and transferred to 0.1M citrate buffer (pH 6.0) for antigen retrieval. Slides were boiled for 10 minutes in citrate buffer, cooled at room temperature for 30 minutes, rinsed in water twice and in PBS
3 times. Sections were quenched with 3% hydrogen peroxide for 10 minutes, rinsed in PBS, and blocked in 10% normal goat serum with 0.3% Triton-X-100. Sections were incubated overnight in primary antibody diluted in block; rabbit anti PITX2 on human MPNST and normal peripheral nerve (Capra sciences, 1:200). Sections were then washed and incubated in goat anti rabbit biotinylated secondary antibodies
(Vector, BA-1000) for 1 hour at room temperature, incubated in ABC (Vector, PK-
6100) followed DAB (Vector, SK-4100) staining. Some sections were counterstained with Harris hemotoxylin. All microscopic images were acquired with Openlab software suites on a Zeiss Axiovert 200.
Immunoblot
Cell lysates were made with radioimmunoprecipitation assay buffer (RIPA) and western blotting was performed. Membranes were probed with antibodies for
PITX2 1:5000 (Capra Sciences), GAS2 1:3,000 (Sigma, SAB1101108), PARP 1:5000
(Cell Signaling, 9542), β-catenin 1:10,000 (Cell Signaling, 9562), HRP conjugated β-
Actin 1:50,000 (Cell Signaling, 5125). Horseradish peroxidase-conjugated secondary
81 antibodies (Jackson Labs) were incubated for 1h at room temperature. Blot development was performed with ECL Plus developing system (Amersham
Biosciences).
Cell viability assays
MPNST and iHSC cell lines (500 cells/well) were seeded in triplicate in 96-well plates. Cells were selected in Puro for 48h and absorbance was read day 4 post- infection of PITX2 or GAS2 shRNA. Absorbance reagent CellTiter 96® Aqueous One
Solution Cell Proliferation Assay (Promega) was used.
Cell Lines
The ST88-14, S462TY, and 88-3 MPNST cell lines derived from patients with NF1 mutations. The STS26T MPNST cell line is derived from a sporadic MPNST with two
WT NF1 alleles. The immortalized human Schwann cell line (iHSC) is derived from normal human sciatic nerve. The iHSC’s contains no mutations in the NF1 alleles and was immortalized through expression of hTERT and CDK4R24C (Dr. Margaret Wallace, manuscript in preparation). All MPNST cell lines and iHSCs were cultured in
Dulbecco's Modified Eagle Medium (DMEM) containing 10% FBS and 1% penicillin/streptomycin (Fisher). Normal human Schwann cells (NHSCs) were obtained from autopsy specimens and maintained as described (reference).
82 3.10 Figures and Legends
Figure 3.1: A. PITX2C (product of variant 3) protein is over-expressed in MPNST cell lines. B. PITX2 Variant 3 mRNA is over-expressed in three different MPNST cell lines. C. Rare variant PITX2D mRNA is over-expressed in 3 different MPNST cell lines. Asterisks in B and C represent statistical significance (student’s T test) (* p <
0.05, ** p < 0.01, *** p < 0.001) of 3 biological qPCR replicates performed in triplicate.
83 B
C D E
4 Cell Death Day 3
Cleaved Caspase Luminescence Unites x 10
Figure 3.2: A. PITX2 shRNA constructs effectively knockdown PITX2 mRNA in
MPNST S462-TY cell line by day 4 post infection. B. Four day treatment of PITX2 shRNA treatment decreases MPNST but not A549 cell viability as measured by MTS.
C. Bright-field micrograph shows that shPITX2 treated MPNST cells are depleted from cell culture by Day 4 post-infection. D. PITX2 knockdown does not impact proliferation as by BRDU incorporation. E. PITX2 shRNA treatment induces increased cleaved caspase 3 levels in MPNST TY-S462 cell lines. Asterisks in A, C, and F represent statistical significance (student’s T test) (* p < 0.05, ** p < 0.01, *** p
< 0.001). 3 biological replicates were performed in triplicate to generate qPCR results. MTS assays are the result of three different biological results performed in quadruplicates. Cleaved caspase 3 results are the result of 3 different biological replicates.
84
Figure 3.3: A. MPNST S462-TY cells were treated with shPITX2 and harvested 3 days post-infection. RNA was isolated and submitted for microarray analysis. B.
PITX2 shRNA treatment of MPNST cells decreases β−catenin target gene expression
, but not CTNNB1 expression. C. PITX2 knockdown in MPNST cells decreases
β−catenin protein expression. D. PITX2 knockdown in MPNST cells shows increased
Ser 9 phosphorylation of GSK-3B suggesting PITX2 regulates β−catenin independent of GSK-3B. Asterisks in C represent statistical significance (student’s T test) (* p <
0.05, ** p < 0.01, *** p < 0.001) of 3 biological qPCR replicates performed in triplicate.
85
Supplemental Figure 3.3: Heat map of genes up or down regulated by at least 3X when PITX2 is knocked down in MPNST TY-S462 cells.
86 GeneSet GeneSet Name Size Mapped Genes Enrichment Ratio Raw P Genes Cell adhesion molecules (CAMs) 133 6 10.35 2.75E-05 CD34 CLDN1 CLDN6 F11R PTPRM SDC3 Melanogenesis 101 5 11.36 8.42E-05 ADCY8 CREB3L1 EDNRB FZD6 PRKACB Drug metabolism - cytochrome P450 73 4 12.57 0.0003 GSTA4 GSTM1 GSTM4 MAOA MAPK signaling pathway 268 6 5.14 0.0012 FLNC IL1R1 MAPKAPK3 NLK PLA2G4A PRKACB Calcium signaling pathway 177 5 6.48 0.0011 ADCY8 CCKAR EDNRB PDE1A PRKACB Taste transduction 52 3 13.23 0.0015 ADCY8 PDE1A PRKACB Oocyte meiosis 112 4 8.19 0.0015 ADCY8 CDC20 CPEB1 PRKACB Glutathione metabolism 50 3 13.76 0.0014 GSTA4 GSTM1 GSTM4 Systemic lupus erythematosus 136 4 6.75 0.003 C1S HIST1H3H HIST1H4D HIST2H2BE Metabolism of xenobiotics by cytochrome P450 71 3 9.69 0.0037 GSTA4 GSTM1 GSTM4 Bile secretion 71 3 9.69 0.0037 ADCY8 PRKACB SLC2A1 Dorso-ventral axis formation 24 2 19.12 0.0049 CPEB1 PIWIL1 Protein digestion and absorption 81 3 8.5 0.0054 DPP4 PRCP SLC7A7 Hematopoietic cell lineage 88 3 7.82 0.0068 CD34 CD9 IL1R1 Progesterone-mediated oocyte maturation 86 3 8 0.0064 ADCY8 CPEB1 PRKACB Gap junction 90 3 7.65 0.0073 ADCY8 PRKACB TUBA4A GnRH signaling pathway 101 3 6.81 0.0099 ADCY8 PLA2G4A PRKACB Pancreatic secretion 101 3 6.81 0.0099 ADCY8 CCKAR PLA2G4A Amoebiasis 106 3 6.49 0.0113 IL1R1 PRKACB SERPINB2 Vascular smooth muscle contraction 116 3 5.93 0.0144 ADCY8 PLA2G4A PRKACB Leukocyte transendothelial migration 116 3 5.93 0.0144 CLDN1 CLDN6 F11R Tryptophan metabolism 42 2 10.92 0.0145 IDO1 MAOA Vasopressin-regulated water reabsorption 44 2 10.43 0.0159 CREB3L1 PRKACB Cell cycle 124 3 5.55 0.0172 CDC20 CDC6 ORC1 Tight junction 132 3 5.21 0.0203 CLDN1 CLDN6 F11R Drug metabolism - other enzymes 52 2 8.82 0.0217 DPYD TPMT Staphylococcus aureus infection 55 2 8.34 0.0241 C1S CFH Pathogenic Escherichia coli infection 56 2 8.19 0.025 CLDN1 TUBA4A Wnt signaling pathway 150 3 4.59 0.0282 FZD6 NLK PRKACB Table 3.1 KEGG pathway analysis of genes dysregulated when PITX2 is knocked down in the MPNST S462-TY cell line.
87
Figure 3.4. A. NLK, FZD6 and GAS2 expression in MPNSTs was compared to NHSC expression via qPCR. Results indicate that NLK and FZD6 are repressed in MPNSTs while GAS2 is over-expressed in MPNSTs. B. GAS2 protein is over-expressed in
MPNSTs as compared to NHSCs as determined by western blot analysis. C.
Validation of the shPITX2 microarray: qPCR results show that NLK and FZD6 increased while GAS2 decreased in expression when PITX2 was knocked down in multiple MPNST cell lines. D. PITX2 knockdown in MPNST cell lines decreased GAS2 protein expression 4 days post infection. Asterisks in A and C represent statistical significance (student’s T test) (* p < 0.05, ** p < 0.01, *** p < 0.001) of 3 biological qPCR replicates performed in triplicate.
88
Figure 3.5: A. GAS2 shRNA significantly decreases MPNST cell viability by day 5 post infection as determined by MTS. B. GAS2 shRNA has no significant effect on
NHSC viability by day 5 post infection as determined by MTS. C. Knockdown of GAS2 results in decreased β−catenin protein expression in multiple MPNST cell lines
(S462-TY and ST88-14) by day 5 post infection.
89 Chapter 4: Future Direction and Discussion
4.1 Targeting β-catenin and other survival pathways in MPNSTs. In many cancer types, including MPNSTs, there is a direct correlation between β - catenin expression/nuclear localization and tumor grade [82,99,332,338]. A major strategy that MPNSTs (and other cancers) use is to activate β -catenin signaling through down regulating or inhibiting the GSK-3 β destruction complex [80,339,340]. As mentioned earlier, Mo et al. found that the CXCR4/CXCL12 signaling axis is up regulated in NF1 deficient cells including MPNSTs [78]. Targeting this signaling axis with a CXCR4 inhibitor, AMD3100, decreased MPNST viability and decreased tumor growth in vitro and in vivo through inhibiting the cell cycle progression from the G1 to S phase [78]. Although CXCR4/CXCL12 are not core components of the WNT signaling cascade, CXCR4/CXCL12 inhibition activated GSK-3β resulting in degradation of Β-catenin through inhibition of the PI3K/AKT pathway [78].
Additionally, Watson et al demonstrated that both APC and GSK-3β were down regulated and ligands WNT5a, WNT5b, and WNT2, along with R-spondins, were all up-regulated in MPNSTs as compared to NHSCs, which also predicts a decrease in the activity of the destruction complex [80].
As β-catenin nuclear localization is directly correlated with tumor grade in MPNSTs and other cancers, increasing inhibition of GSK-3β would seem beneficial
[82,99,332,338]. However, GSK-3β is a kinase that regulates not only β-catenin stability, but also protein synthesis and glucose metabolism, which are processes necessary for cell survival [341,342]. Therefore, cells must maintain these essential activities of
GSK-3β while promoting oncogenesis through β-catenin protein stability. This is
90 likely why GSK-3β retains residual ability to regulate β-catenin, and GSK-3B inhibitors or activators significantly impact the levels of β-catenin in MPNSTs.
Therefore, further increasing β-catenin expression may require regulating processes down stream of, or independent from, GSK-3β activity. My thesis work, focusing on
CK2 and PITX2, analyzes the mechanisms employed by MPNSTs to increase β- catenin signaling while leaving GSK-3β activity untouched.
Whether there is cross talk between GSK-3β and GSK-3β -independent mechanisms that stabilize β-catenin is largely unknown. We provided evidence of cross talk between these pathways, in that knockdown of PITX2 decreases β-catenin stability and GSK-3β inhibition (likely through AKT) is further increased. Increased inhibition of GSK-3β is likely a compensatory mechanism in MPNST cells sensing β- catenin depletion. The status of other known pathways regulating β-catenin in
MPNSTs have yet to be analyzed in context of PITX2 knockdown or CK2 inhibition.
How each pathway that regulates β-catenin responds to inhibition of other pathways that regulate β-catenin in MPNSTs could help direct therapeutic efforts.
For example, PITX2 knockdown results in a significant decrease in β-catenin protein expression despite apparent inhibition of GSK-3β. Perhaps through targeting both
PITX2 and GSK-3β (via tankyrase inhibitors, CK2 inhibition, and/or CXCR4 inhibition) we could cause dramatic loss of β-catenin, and decrease in MPNST cell survival. The four different mechanisms promoting β-catenin expression identified in MPNSTs are a solid foundation on which to begin devising combination treatments focused on β-catenin signaling.
91 We propose that combination therapy targeting up stream, down stream and directly upon the activity of GSK-3β could be powerful. Essentially, active GSK-3β would increase through CXCR4 inhibition, more β-catenin could be made accessible to GSK-3β through CK2 inhibition, and active GSK-3β could be further funneled to the GSK-3β destruction complex through tankyrase inhibitors. As noted, therapeutics targeting core WNT signaling components have been hampered by intolerable toxicities. However, synergistic inhibition of β-catenin signaling by the triple therapy in MPNSTs could potentially overcome the poor therapeutic index of tankyrase inhibitors. The doses of each drug could potentially be lowered, as the efficacy of each agent in the triple combination would be increased; therefore, the toxicities associated with each drug would be minimized. One promising aspect of the triple combination, in respects to toxicity, is that two of the therapeutics (CK2 and CXCR4 inhibitors) do not target core WNT signaling components and have acceptable single agent therapeutic indexes.
Combination therapies provide multiple potential benefits including the prevention of cancer resistance. However, MPNSTs could further down regulate the expression of GSK-3β. As discussed earlier, dramatically decreasing the expression of GSK-3β jeopardizes the essential GSK-3β dependent metabolic processes. Furthermore, over-time, MPNSTs could develop resistance to treatment through halting dependence on β-catenin function. There is evidence that the PI3K pathway can compensate for β-catenin loss in regulating cell proliferation [227,343]. In addition, resistance to this therapy could occur through mutating β-catenin so that it becomes
92 GSK-3β independent. Activating mutations in CTNNB1, liberating β-catenin from
GSK-3β regulation, have been identified in multiple malignancies [344–346].
The WNT/ β-catenin pathway is known to cross talk with other signaling pathways, including the RAS pathway, during development and in cancer [347–350]. There is evidence that WNT and RAS signaling pathways synergize in the oncogenesis of colorectal, liver, skin, prostate, and bladder cancers [92,351–357]. In colorectal cancer a series of mutations occur, including an activation mutation in KRAS and mutations in WNT related genes, resulting in up-regulated β-catenin signaling [92,358–360]. Cross talk between WNT and RAS pathways is of therapeutic interest in MPNSTs, as both are up regulated and inhibition of either of these pathways decreases MPNST cell viability. Combination therapy inhibiting both pathways showed promise in head and neck and colorectal cancer [255,355]. The in vitro data presented in this thesis suggests that RAS pathway inhibition coupled with β-catenin degradation through
CK2 inhibition may be a viable therapeutic, if optimized. Given the pleiotropic effects of CK2, the therapeutic advantages of inhibiting MEK in conjunction with CK2 may also target other signaling pathways in addition to WNT.
An approach to attacking β-catenin and RAS signaling in MPNSTs might be to focus on targeting the two pathways at points of intersection. There is an ever-growing body of literature describing the cross talk between these two pathways. WNT signaling can stabilize and activate RAS signaling through multiple mechanisms. For example, RAS activity depends on external activation by growth factors and their
93 receptors, including EGFR [29,361–363]. EGFR expression can be directly transcriptionally activated by β-catenin [93,364,365]. In multiple cancer types aberrant
WNT signaling has led to EGFR mediated hyper-activation of RAS and hyper- proliferation [349,366–369]. Furthermore, WNT signaling also directly activates ERK in microglia cells through LRP receptor activation of Phospholipase C (PLC) [366].
Maintenance of hyper-activated RAS in MPNSTs may result from WNT-LRP-PLC signaling, as multiple WNT ligands and multiple LRP receptors are up regulated in
MPNSTs.
Since hyper-activated RAS signaling is the first insult in the process of MPNST formation, and loss of NF1 results in β-catenin nuclear localization in Schwann cells, the activation of WNT signaling by hyper activated RAS might be critical for WNT-
RAS crosstalk in MPNSTs [81]. RAS pathway components disrupt the Cadherin, a-
Catenin, β-catenin complexes at the cell membrane, allowing β-catenin to translocate to the nucleus [370–372]. ERK facilitates the disruption of β-catenin from membrane complexes through direct phosphorylation of β-catenin at Y142 [370].
Furthermore, ERK association with and phosphorylation of CK2α is able to direct the specificity of CK2α [371]. Through the regulation of ERK, CK2α phosphorylates a- catenin, which then liberates Β-catenin from the membrane bound cadherin complexes to translocate to the nucleus in melanoma cells lines [371]. Hyper- activated RAS can also causes catenin-cadherin disruption in Caco-2 cells (colorectal cancer cell lines) through mechanisms independent of MEK and ERK [372]. The disruption of catenin-cadherin complexes due to hyper-activated RAS signaling
94 seems plausible in light of the initial hyper-activation of β-catenin signaling that occurs in Schwann cells deficient in NF1 [81].
RAS pathway signaling can also activate WNT/ β-catenin signaling through the inhibition of GSK-3β [90,91,373–376]. RAS activation leads to increased activity of MEK and ERK, and both kinases can directly regulate the activity of GSK-3β through an inhibitory phosphorylation on SER 9 [373,377]. Furthermore, ERK can indirectly regulate GSK-3β through phosphorylation of p90RSK (MAPK-activated protein kinase) [373]. ERK phosphorylation then enables p90RSK to inhibit GSK-3β through
SER9 phosphorylation[373]. Oncogenic RAS signaling can also inhibit GSK-3β through activation of the PI3K/AKT pathway [374]. As shown by in Mo et al, AKT activation inhibits GSK-3β through phosphorylation at SER9 [78].
In summary, there are potential many levels of interactions between RAS and WNT signaling that need to be explored in MPNSTs. As both of these pathways are up regulated and essential for MPNST survival, the interaction between them could be multi-factorial [48,78,80,378]. Since both pathways can activate or maintain the activity of the other [349], over time RAS and WNT signaling pathways may begin amplifying each other in positive feed-forward loops in MPNSTs. There may be significant therapeutic value in understanding the degree of inter-dependence between the
WNT and RAS signaling pathways, and in dissecting the points of cross talk.
Targeting either pathway at or above the level of crosstalk could potentially magnify the therapeutic impact of inhibiting the WNT or RAS pathway. Furthermore,
95 understanding the mechanisms of cross talk will help direct drug combination studies.
96 Bibliography:
1. Crowe FW, Schull WJ NJ. A Clinical, Pathological and Genetic Study of Multiple Neurofibromatosis. Charles C Thomas. 1956. 2. Evans DG. Birth incidence and prevalence of tumor-prone syndromes: estimates from a UK family genetic register service. Am J Med Genet A. 2010;152A:327-332. 3. Huson SM, Harper PS, Compston DA. Von Recklinghausen neurofibromatosis. A clinical and population study in south-east Wales. Brain. 1988;111:1355- 1381. http://dx.doi.org/10.1093/brain/111.6.1355. 4. Friedman JM, Birch PH. Type 1 neurofibromatosis: a descriptive analysis of the disorder in 1,728 patients. Am J Med Genet. 1997;70:138-143. http://dx.doi.org/10.1002/(SICI)1096-8628(19970516)70:2<138::AID- AJMG7>3.0.CO. 5. Huson SM, Compston DA, Harper PS. A genetic study of von Recklinghausen neurofibromatosis in south east Wales. II. Guidelines for genetic counselling. J Med Genet. 1989;26:712-721. http://dx.doi.org/10.1136/jmg.26.11.712. 6. Viskochil D. Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell. 1990;62:187-192. http://dx.doi.org/10.1016/0092-8674(90)90252-A. 7. Cawthon RM. A major segment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations. Cell. 1990;62:193-201. http://dx.doi.org/10.1016/0092-8674(90)90253-B. 8. Wallace MR. Type 1 neurofibromatosis gene: identification of a large transcript disrupted in three NF1 patients. Science (80- ). 1990;249:181-186. http://dx.doi.org/10.1126/science.2134734. 9. Maertens O. Molecular pathogenesis of multiple gastrointestinal stromal tumors in NF1 patients. Hum Mol Genet. 2006;15:1015-1023. http://dx.doi.org/10.1093/hmg/ddl016. 10. Brems H. Glomus tumors in neurofibromatosis type 1: genetic, functional, and clinical evidence of a novel association. Cancer Res. 2009;69:7393-7401. http://dx.doi.org/10.1158/0008-5472.CAN-09-1752. 11. Serra E. Schwann cells harbor the somatic NF1 mutation in neurofibromas: evidence of two different Schwann cell populations. Hum Mol Genet. 2000;9:3055-3064. http://dx.doi.org/10.1093/hmg/9.20.3055. 12. Ballester R, Marchuk D, Boguski M, Saulino A, Letcher R, Wigler M, Collins F. The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell. 1990;63(4):851-859. http://www.ncbi.nlm.nih.gov/pubmed/2121371. Accessed April 3, 2013. 13. Martin GA. The GAP-related domain of the neurofibromatosis type 1 gene product interacts with ras p21. Cell. 1990;63:843-849. http://dx.doi.org/10.1016/0092-8674(90)90150-D. 14. Xu GF, O’Connell P, Viskochil D, Cawthon R, Robertson M, Culver M, Dunn D, Stevens J, Gesteland R, White R. The neurofibromatosis type 1 gene encodes a protein related to GAP. Cell. 1990;62(3):599-608.
97 http://www.ncbi.nlm.nih.gov/pubmed/2116237. Accessed April 3, 2013. 15. Ohba Y. Regulatory proteins of R-Ras, TC21/R-Ras2, and M-Ras/R-Ras3. J Biol Chem. 2000;275:20020-20026. http://dx.doi.org/10.1074/jbc.M000981200. 16. Cox AD, Der CJ. Ras history: the saga continues. Small GTPases. 2010;1:2-27. http://dx.doi.org/10.4161/sgtp.1.1.12178. 17. Rodriguez FJ. Gliomas in neurofibromatosis type 1: a clinicopathologic study of 100 patients. J Neuropathol Exp Neurol. 2008;67:240-249. http://dx.doi.org/10.1097/NEN.0b013e318165eb75. 18. Schindeler A, Little DG. Recent insights into bone development, homeostasis, and repair in type 1 neurofibromatosis (NF1). Bone. 2008;42(4):616-622. doi:10.1016/j.bone.2007.11.006. 19. Feldmann R, Denecke J, Grenzebach M, Schuierer G, Weglage J. Neurofibromatosis type 1: motor and cognitive function and T2-weighted MRI hyperintensities. Neurology. 2003;61:1725-1728. http://dx.doi.org/10.1212/01.WNL.0000098881.95854.5F. 20. Hyman SL, Shores EA, North KN. Learning disabilities in children with neurofibromatosis type 1: subtypes, cognitive profile, and attention-deficit- hyperactivity disorder. Dev Med Child Neurol. 2006;48:973-977. http://dx.doi.org/10.1017/S0012162206002131. 21. Rieley MB. Variable expression of neurofibromatosis 1 in monozygotic twins. Am J Med Genet A. 2011;155A:478-485. 22. Easton DF, Ponder MA, Huson SM, Ponder BA. An analysis of variation in expression of neurofibromatosis (NF) type 1 (NF1): evidence for modifying genes. Am J Hum Genet. 1993;53:305-313. 23. Evans DG. Mortality in neurofibromatosis 1: in North West England: an assessment of actuarial survival in a region of the UK since 1989. Eur J Hum Genet. 2011;19:1187-1191. http://dx.doi.org/10.1038/ejhg.2011.113. 24. Evans DGR. Malignant peripheral nerve sheath tumours in neurofibromatosis 1. J Med Genet. 2002;39(5):311-314. doi:10.1136/jmg.39.5.311. 25. Kar M, Deo SVS, Shukla NK, Malik A, DattaGupta S, Mohanti BK, Thulkar S. Malignant peripheral nerve sheath tumors (MPNST)--clinicopathological study and treatment outcome of twenty-four cases. World J Surg Oncol. 2006;4:55. doi:10.1186/1477-7819-4-55. 26. Tucker T, Wolkenstein P, Revuz J, Zeller J, Friedman JM. Association between benign and malignant peripheral nerve sheath tumors in NF1. Neurology. 2005;65(2):205-211. doi:10.1212/01.wnl.0000168830.79997.13. 27. Miller SJ. Large-Scale Molecular Comparison of Human Schwann Cells to Malignant Peripheral Nerve Sheath Tumor Cell Lines and Tissues. Cancer Res. 2006;66(5):2584-2591. doi:10.1158/0008-5472.CAN-05-3330. 28. Bottillo I. Germline and somatic NF1 mutations in sporadic and NF1- associated malignant peripheral nerve sheath tumours. J Pathol. 2009;217:693-701. http://dx.doi.org/10.1002/path.2494. 29. Perrone F, Da Riva L, Orsenigo M, Losa M, Jocollè G, Millefanti C, Pastore E, Gronchi A, Pierotti MA, Pilotti S. PDGFRA, PDGFRB, EGFR, and downstream signaling activation in malignant peripheral nerve sheath tumor. Neuro Oncol. 2009;11(6):725-736. doi:10.1215/15228517-2009-003.
98 30. Yamaguchi U, Hasegawa T, Hirose T, Chuman H, Kawai A, Ito Y, Beppu Y. Low grade malignant peripheral nerve sheath tumour: varied cytological and histological patterns. J Clin Pathol. 2003;56(11):826-830. http://www.ncbi.nlm.nih.gov/pubmed/14600126. Accessed August 2, 2016. 31. Wallace MR, Rasmussen SA, Lim IT, Gray BA, Zori RT, Muir D. Culture of cytogenetically abnormal Schwann cells from benign and malignant NF1 tumors. Genes, Chromosom Cancer. 2000;27(2):117-123. doi:10.1002/(SICI)1098-2264(200002)27:2<117::AID-GCC1>3.0.CO;2-H. 32. Miller SJ. Large-scale molecular comparison of human Schwann cells to malignant peripheral nerve sheath tumor cell lines and tissues. Cancer Res. 2006;66:2584-2591. http://dx.doi.org/10.1158/0008-5472.CAN-05-3330. 33. Legius E. TP53 mutations are frequent in malignant NF1 tumors. Genes Chromosom Cancer. 1994;10:250-255. http://dx.doi.org/10.1002/gcc.2870100405. 34. Menon AG. Chromosome 17p deletions and p53 gene mutations associated with the formation of malignant neurofibrosarcomas in von Recklinhausen neurofibromatosis. Proc Natl Acad Sci USA. 1990;87:5435-5439. http://dx.doi.org/10.1073/pnas.87.14.5435. 35. Birindelli S, Perrone F, Oggionni M, Lavarino C, Pasini B, Vergani B, Ranzani GN, Pierotti MA, Pilotti S. Rb and TP53 Pathway Alterations in Sporadic and NF1-Related Malignant Peripheral Nerve Sheath Tumors. Lab Investig. 2001;81(6):833-844. doi:10.1038/labinvest.3780293. 36. Nielsen GP, Stemmer-Rachamimov AO, Ino Y, Moller MB, Rosenberg AE, Louis DN. Malignant transformation of neurofibromas in neurofibromatosis 1 is associated with CDKN2A/p16 inactivation. Am J Pathol. 1999;155(6):1879- 1884. doi:10.1016/S0002-9440(10)65507-1. 37. Beert E, Brems H, Daniëls B, De Wever I, Van Calenbergh F, Schoenaers J, Debiec-Rychter M, Gevaert O, De Raedt T, Van Den Bruel A, de Ravel T, Cichowski K, Kluwe L, et al. Atypical neurofibromas in neurofibromatosis type 1 are premalignant tumors. Genes Chromosomes Cancer. 2011;50(12):1021- 1032. doi:10.1002/gcc.20921. 38. Ouelle DE, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell. 1995;83(6):993-1000. doi:10.1016/0092- 8674(95)90214-7. 39. Mawrin C, Kirches E, Boltze C, Dietzmann K, Roessner A, Schneider-Stock R. Immunohistochemical and molecular analysis of p53, RB, and PTEN in malignant peripheral nerve sheath tumors. Virchows Arch. 2002;440(6):610- 615. doi:10.1007/s00428-001-0550-4. 40. Carli M, Ferrari A, Mattke A, Zanetti I, Casanova M, Bisogno G, Cecchetto G, Alaggio R, De Sio L, Koscielniak E, Koscielniak E, Sotti G, Treuner J. Pediatric malignant peripheral nerve sheath tumor: the Italian and German soft tissue sarcoma cooperative group. J Clin Oncol. 2005;23(33):8422-8430. doi:10.1200/JCO.2005.01.4886. 41. Kolberg M. Survival meta-analyses for >1800 malignant peripheral nerve sheath tumor patients with and without neurofibromatosis type 1. Neuro
99 Oncol. 2013;15:135-147. http://dx.doi.org/10.1093/neuonc/nos287. 42. Kroep JR, Ouali M, Gelderblom H, Le Cesne A, Dekker TJA, Van Glabbeke M, Hogendoorn PCW, Hohenberger P. First-line chemotherapy for malignant peripheral nerve sheath tumor (MPNST) versus other histological soft tissue sarcoma subtypes and as a prognostic factor for MPNST: an EORTC soft tissue and bone sarcoma group study. Ann Oncol. 2011;22(1):207-214. doi:10.1093/annonc/mdq338. 43. Anghileri M, Miceli R, Fiore M, Mariani L, Ferrari A, Mussi C, Lozza L, Collini P, Olmi P, Casali PG, Pilotti S, Gronchi A. Malignant peripheral nerve sheath tumors: prognostic factors and survival in a series of patients treated at a single institution. Cancer. 2006;107(5):1065-1074. doi:10.1002/cncr.22098. 44. Ducatman BS, Scheithauer BW, Piepgras DG, Reiman HM, Ilstrup DM. Malignant peripheral nerve sheath tumors. A clinicopathologic study of 120 cases. Cancer. 1986;57(10):2006-2021. http://www.ncbi.nlm.nih.gov/pubmed/3082508. Accessed April 3, 2013. 45. Keng VW, Watson AL, Rahrmann EP, Li H, Tschida BR, Moriarity BS, Choi K, Rizvi TA, Collins MH, Wallace MR, Ratner N, Largaespada DA. Conditional Inactivation of Pten with EGFR Overexpression in Schwann Cells Models Sporadic MPNST. Sarcoma. 2012;2012:620834. doi:10.1155/2012/620834. 46. Rahrmann EP, Moriarity BS, Otto GM, Watson AL, Choi K, Collins MH, Wallace M, Webber BR, Forster CL, Rizzardi AE, Schmechel SC, Ratner N, Largaespada DA. Trp53 Haploinsufficiency Modifies EGFR-Driven Peripheral Nerve Sheath Tumorigenesis. Am J Pathol. 2014;184(7):2082-2098. doi:10.1016/j.ajpath.2014.04.006. 47. Wu J, Patmore DM, Jousma E, Eaves DW, Breving K, Patel A V, Schwartz EB, Fuchs JR, Cripe TP, Stemmer-Rachamimov AO, Ratner N. EGFR-STAT3 signaling promotes formation of malignant peripheral nerve sheath tumors. Oncogene. 2014;33(2):173-180. doi:10.1038/onc.2012.579. 48. Rahrmann EP, Watson AL, Keng VW, Choi K, Moriarity BS, Beckmann DA, Wolf NK, Sarver A, Collins MH, Moertel CL, Wallace MR, Gel B, Serra E, et al. Forward genetic screen for malignant peripheral nerve sheath tumor formation identifies new genes and pathways driving tumorigenesis. Nat Genet. 2013;45(7):756-766. doi:10.1038/ng.2641. 49. Albritton KH, Rankin C, Coffin CM, Ratner N, Budd GT, Schuetze SM, Randall RL, Declue JE, Borden EC. Phase II study of erlotinib in metastatic or unresectable malignant peripheral nerve sheath tumors (MPNST). ASCO Meet Abstr. 2006;24(18_suppl):9518. 50. Maki RG, D’Adamo DR, Keohan ML, Saulle M, Schuetze SM, Undevia SD, Livingston MB, Cooney MM, Hensley ML, Mita MM, Takimoto CH, Kraft AS, Elias AD, et al. Phase II Study of Sorafenib in Patients With Metastatic or Recurrent Sarcomas. J Clin Oncol. 2009;27(19):3133-3140. doi:10.1200/JCO.2008.20.4495. 51. Schuetze SM, Wathen JK, Lucas DR, Choy E, Samuels BL, Staddon AP, Ganjoo KN, von Mehren M, Chow WA, Loeb DM, Tawbi HA, Rushing DA, Patel SR, et al. SARC009: Phase 2 study of dasatinib in patients with previously treated, high- grade, advanced sarcoma. Cancer. 2016;122(6):868-874.
100 doi:10.1002/cncr.29858. 52. Chugh R, Wathen JK, Maki RG, Benjamin RS, Patel SR, Meyers PA, Myers PA, Priebat DA, Reinke DK, Thomas DG, Keohan ML, Samuels BL, Baker LH. Phase II multicenter trial of imatinib in 10 histologic subtypes of sarcoma using a bayesian hierarchical statistical model. J Clin Oncol. 2009;27(19):3148-3153. doi:10.1200/JCO.2008.20.5054. 53. Robertson KA. Imatinib mesylate for plexiform neurofibromas in patients with neurofibromatosis type 1: a phase 2 trial. Lancet Oncol. 2012;13:1218- 1224. http://dx.doi.org/10.1016/S1470-2045(12)70414-X. 54. De Raedt T, Walton Z, Yecies JL, Li D, Chen Y, Malone CF, Maertens O, Jeong SM, Bronson RT, Lebleu V, Kalluri R, Normant E, Haigis MC, et al. Exploiting Cancer Cell Vulnerabilities to Develop a Combination Therapy for Ras-Driven Tumors. Cancer Cell. 2011;20(3):400-413. doi:10.1016/j.ccr.2011.08.014. 55. Johannessen CM, Johnson BW, Williams SMG, Chan AW, Reczek EE, Lynch RC, Rioth MJ, McClatchey A, Ryeom S, Cichowski K. TORC1 Is Essential for NF1- Associated Malignancies. Curr Biol. 2008;18(1):56-62. doi:10.1016/j.cub.2007.11.066. 56. Varin J, Poulain L, Hivelin M, Nusbaum P, Hubas A, Laurendeau I, Lantieri L, Wolkenstein P, Vidaud M, Pasmant E, Chapuis N, Parfait B. Dual mTORC1/2 inhibition induces anti-proliferative effect in NF1-associated plexiform neurofibroma and malignant peripheral nerve sheath tumor cells. Oncotarget. January 2016. doi:10.18632/oncotarget.7099. 57. Jessen WJ, Miller SJ, Jousma E, Wu J, Rizvi TA, Brundage ME, Eaves D, Widemann B, Kim M-O, Dombi E, Sabo J, Hardiman Dudley A, Niwa-Kawakita M, et al. MEK inhibition exhibits efficacy in human and mouse neurofibromatosis tumors. J Clin Invest. 2013;123(1):340-347. doi:10.1172/JCI60578. 58. Patel A V., Johansson G, Colbert MC, Dasgupta B, Ratner N. Fatty acid synthase is a metabolic oncogene targetable in malignant peripheral nerve sheath tumors. Neuro Oncol. 2015;17(March):nov076. doi:10.1093/neuonc/nov076. 59. Nair JS, Schwartz GK. Inhibition of polo like kinase 1 in sarcomas induces apoptosis that is dependent on Mcl-1 suppression. Cell Cycle. 2015;14(19):3101-3111. doi:10.1080/15384101.2015.1078033. 60. Patel A V, Eaves D, Jessen WJ, Rizvi TA, Ecsedy JA, Qian MG, Aronow BJ, Perentesis JP, Serra E, Cripe TP, Miller SJ, Ratner N. Ras-driven transcriptome analysis identifies aurora kinase A as a potential malignant peripheral nerve sheath tumor therapeutic target. Clin Cancer Res. 2012;18(18):5020-5030. doi:10.1158/1078-0432.ccr-12-1072. 61. Ozawa M, Baribault H, Kemler R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 1989;8(6):1711-1717. http://www.ncbi.nlm.nih.gov/pubmed/2788574. Accessed August 3, 2016. 62. N�sslein-Volhard C, Wieschaus E, Kluding H. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster. Wilhelm Roux’s Arch Dev Biol. 1984;193(5):267-282. doi:10.1007/BF00848156. 63. Wieschaus E, Riggleman R, Bohn H, French V, Bryant PJ, Bryant SV, Garcia-
101 Bellido A, Gergen JP, Wieschaus EF, Gergen JP, Wieschaus EF, Hartenstein V, Campos-Ortega J, et al. Autonomous requirements for the segment polarity gene armadillo during Drosophila embryogenesis. Cell. 1987;49(2):177-184. doi:10.1016/0092-8674(87)90558-7. 64. Riggleman B, Schedl P, Wieschaus E, Baker NE, Baker NE, Baker NE, Ben-Zeev A, Duerr A, Solomon F, Penman S, Burghlin T, deRobertis EM, Campos-Ortega J, et al. Spatial expression of the Drosophila segment polarity gene armadillo is posttranscriptionally regulated by wingless. Cell. 1990;63(3):549-560. doi:10.1016/0092-8674(90)90451-j. 65. Aberle H, Bauer A, Stappert J, Kispert A, Kemler R. beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 1997;16(13):3797-3804. doi:10.1093/emboj/16.13.3797. 66. Spink KE, Polakis P, Weis WI. Structural basis of the Axin-adenomatous polyposis coli interaction. EMBO J. 2000;19(10):2270-2279. doi:10.1093/emboj/19.10.2270. 67. Behrens J, Jerchow BA, Würtele M, Grimm J, Asbrand C, Wirtz R, Kühl M, Wedlich D, Birchmeier W. Functional interaction of an axin homolog, conductin, with beta-catenin, APC, and GSK3beta. Science. 1998;280(5363):596-599. http://www.ncbi.nlm.nih.gov/pubmed/9554852. Accessed January 17, 2016. 68. Amit S, Hatzubai A, Birman Y, Andersen JS, Ben-Shushan E, Mann M, Ben- Neriah Y, Alkalay I. Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev. 2002;16(9):1066- 1076. doi:10.1101/gad.230302. 69. Peters JM, McKay RM, McKay JP, Graff JM. Casein kinase I transduces Wnt signals. Nature. 1999;401(6751):345-350. doi:10.1038/43830. 70. Bilic J, Huang Y-L, Davidson G, Zimmermann T, Cruciat C-M, Bienz M, Niehrs C. Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science. 2007;316(5831):1619-1622. doi:10.1126/science.1137065. 71. Schwarz-Romond T, Metcalfe C, Bienz M. Dynamic recruitment of axin by Dishevelled protein assemblies. J Cell Sci. 2007;120(Pt 14):2402-2412. doi:10.1242/jcs.002956. 72. Behrens J, von Kries JP, Kühl M, Bruhn L, Wedlich D, Grosschedl R, Birchmeier W. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature. 1996;382(6592):638-642. doi:10.1038/382638a0. 73. DasGupta R, Fuchs E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development. 1999;126(20):4557-4568. http://www.ncbi.nlm.nih.gov/pubmed/10498690. Accessed August 3, 2016. 74. Daniels DL, Weis WI. Beta-catenin directly displaces Groucho/TLE repressors from Tcf/Lef in Wnt-mediated transcription activation. Nat Struct Mol Biol. 2005;12(4):364-371. doi:10.1038/nsmb912. 75. Graham TA, Weaver C, Mao F, Kimelman D, Xu W, Aberle H, Schwartz H, Hoschuetzky H, Kemler R, Barker N, Morin PJ, Clevers H, Behrens J, et al. Crystal structure of a beta-catenin/Tcf complex. Cell. 2000;103(6):885-896.
102 doi:10.1016/s0092-8674(00)00192-6. 76. Molenaar M, van de Wetering M, Oosterwegel M, Peterson-Maduro J, Godsave S, Korinek V, Roose J, Destrée O, Clevers H, Beumer TL, Veenstra GJC, Hage WJ, Destrée OHJ, et al. XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell. 1996;86(3):391-399. doi:10.1016/s0092-8674(00)80112-9. 77. Cavallo RA, Cox RT, Moline MM, Roose J, Polevoy GA, Clevers H, Peifer M, Bejsovec A. Drosophila Tcf and Groucho interact to repress Wingless signalling activity. Nature. 1998;395(6702):604-608. doi:10.1038/26982. 78. Mo W, Chen J, Patel A, Zhang L, Chau V, Li Y, Cho W, Lim K, Xu J, Lazar AJ, Creighton CJ, Bolshakov S, McKay RM, et al. CXCR4/CXCL12 Mediate Autocrine Cell- Cycle Progression in NF1-Associated Malignant Peripheral Nerve Sheath Tumors. Cell. 2013;152(5):1077-1090. doi:10.1016/j.cell.2013.01.053. 79. Rahrmann EP, Watson AL, Keng VW, Choi K, Moriarity BS, Beckmann DA, Wolf NK, Sarver A, Collins MH, Moertel CL, Wallace MR, Gel B, Serra E, et al. Forward genetic screen for malignant peripheral nerve sheath tumor formation identifies new genes and pathways driving tumorigenesis. Nat Genet. 2013;45(7):756-766. doi:10.1038/ng.2641. 80. Watson AL, Rahrmann EP, Moriarity BS, Choi K, Conboy CB, Greeley AD, Halfond AL, Anderson LK, Wahl BR, Keng VW, Rizzardi AE, Forster CL, Collins MH, et al. Canonical Wnt/ -catenin Signaling Drives Human Schwann Cell Transformation, Progression, and Tumor Maintenance. Cancer Discov. 2013;3(6):674-689. doi:10.1158/2159-8290.CD-13-0081. 81. Luscan A, Shackleford G, Masliah-Planchon J, Laurendeau I, Ortonne N, Varin J, Lallemand F, Leroy K, Dumaine V, Hivelin M, Borderie D, De Raedt T, Valeyrie- Allanore L, et al. The activation of the WNT signaling pathway is a Hallmark in neurofibromatosis type 1 tumorigenesis. Clin Cancer Res. 2014;20(2):358- 371. doi:10.1158/1078-0432.CCR-13-0780. 82. Watson AL. Canonical Wnt/[beta]-catenin signaling drives human Schwann cell transformation, progression, and tumor maintenance. Cancer Discov. 2013;3:674-689. http://dx.doi.org/10.1158/2159-8290.CD-13-0081. 83. Wu J, Keng V, Patmore DM, Kendall JJ, Patel A V., Jousma E, Jessen WJ, Choi K, Tschida BR, Silverstein KAT, Fan D, Schwartz EB, Fuchs JR, et al. Insertional Mutagenesis Identifies a STAT3/Arid1b/β-catenin Pathway Driving Neurofibroma Initiation. Cell Rep. February 2016. doi:10.1016/j.celrep.2016.01.074. 84. Kazanskaya O, Glinka A, del Barco Barrantes I, Stannek P, Niehrs C, Wu W. R- Spondin2 Is a Secreted Activator of Wnt/β-Catenin Signaling and Is Required for Xenopus Myogenesis. Dev Cell. 2004;7(4):525-534. doi:10.1016/j.devcel.2004.07.019. 85. Li S-J, Yen T-Y, Endo Y, Klauzinska M, Baljinnyam B, Macher B, Callahan R, Rubin JS. Loss-of-function point mutations and two-furin domain derivatives provide insights about R-spondin2 structure and function. Cell Signal. 2009;21(6):916-925. http://www.ncbi.nlm.nih.gov/pubmed/19385064. Accessed August 3, 2016. 86. Kim K-A, Wagle M, Tran K, Zhan X, Dixon MA, Liu S, Gros D, Korver W,
103 Yonkovich S, Tomasevic N, Binnerts M, Abo A. R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 2008;19(6):2588-2596. doi:10.1091/mbc.E08-02-0187. 87. Hao H-X, Jiang X, Cong F. Control of Wnt Receptor Turnover by R-spondin- ZNRF3/RNF43 Signaling Module and Its Dysregulation in Cancer. Cancers (Basel). 2016;8(6). doi:10.3390/cancers8060054. 88. Chen P-H, Chen X, Lin Z, Fang D, He X. The structural basis of R-spondin recognition by LGR5 and RNF43. Genes Dev. 2013;27(12):1345-1350. doi:10.1101/gad.219915.113. 89. Zebisch M, Xu Y, Krastev C, MacDonald BT, Chen M, Gilbert RJC, He X, Jones EY. Structural and molecular basis of ZNRF3/RNF43 transmembrane ubiquitin ligase inhibition by the Wnt agonist R-spondin. Nat Commun. 2013;4:2787. doi:10.1038/ncomms3787. 90. Almeida M, Han L, Bellido T, Manolagas SC, Kousteni S. Wnt proteins prevent apoptosis of both uncommitted osteoblast progenitors and differentiated osteoblasts by beta-catenin-dependent and -independent signaling cascades involving Src/ERK and phosphatidylinositol 3-kinase/AKT. J Biol Chem. 2005;280(50):41342-41351. doi:10.1074/jbc.M502168200. 91. Ding Q, Xia W, Liu J-C, Yang J-Y, Lee D-F, Xia J, Bartholomeusz G, Li Y, Pan Y, Li Z, Bargou RC, Qin J, Lai C-C, et al. Erk Associates with and Primes GSK-3β for Its Inactivation Resulting in Upregulation of β-Catenin. Mol Cell. 2005;19(2):159-170. doi:10.1016/j.molcel.2005.06.009. 92. Lemieux E, Cagnol S, Beaudry K, Carrier J, Rivard N. Oncogenic KRAS signalling promotes the Wnt/β-catenin pathway through LRP6 in colorectal cancer. Oncogene. 2015;34(38):4914-4927. doi:10.1038/onc.2014.416. 93. Krejci P, Aklian A, Kaucka M, Sevcikova E, Prochazkova J, Masek JK, Mikolka P, Pospisilova T, Spoustova T, Weis M, Paznekas WA, Wolf JH, Gutkind JS, et al. Receptor tyrosine kinases activate canonical WNT/β-catenin signaling via MAP kinase/LRP6 pathway and direct β-catenin phosphorylation. PLoS One. 2012;7(4):e35826. doi:10.1371/journal.pone.0035826. 94. Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB, Volpin D, Bressan GM, Piccolo S. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proc Natl Acad Sci U S A. 2003;100(6):3299-3304. doi:10.1073/pnas.0434590100. 95. Huelsken J, Vogel R, Erdmann B, Cotsarelis G, Birchmeier W. β-Catenin Controls Hair Follicle Morphogenesis and Stem Cell Differentiation in the Skin. Cell. 2001;105(4):533-545. doi:10.1016/S0092-8674(01)00336-1. 96. Kramer I, Halleux C, Keller H, Pegurri M, Gooi JH, Weber PB, Feng JQ, Bonewald LF, Kneissel M. Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Mol Cell Biol. 2010;30(12):3071-3085. doi:10.1128/MCB.01428-09. 97. Fevr T, Robine S, Louvard D, Huelsken J. Wnt/ -Catenin Is Essential for Intestinal Homeostasis and Maintenance of Intestinal Stem Cells. Mol Cell Biol. 2007;27(21):7551-7559. doi:10.1128/MCB.01034-07. 98. Kahn M. Can we safely target the WNT pathway? Nat Rev Drug Discov. 2014;13(7):513-532. doi:10.1038/nrd4233.
104 99. Liu J, Pan S, Hsieh MH, Ng N, Sun F, Wang T, Kasibhatla S, Schuller AG, Li AG, Cheng D, Li J, Tompkins C, Pferdekamper A, et al. Targeting Wnt-driven cancer through the inhibition of Porcupine by LGK974. Proc Natl Acad Sci U S A. 2013;110(50):20224-20229. doi:10.1073/pnas.1314239110. 100. Masuda M, Sawa M, Yamada T. Therapeutic targets in the Wnt signaling pathway: Feasibility of targeting TNIK in colorectal cancer. Pharmacol Ther. 2015;156:1-9. doi:10.1016/j.pharmthera.2015.10.009. 101. Pattabiraman DR, Weinberg RA. Tackling the cancer stem cells — what challenges do they pose? Nat Rev Drug Discov. 2014;13(7):497-512. doi:10.1038/nrd4253. 102. Pinna LA, Baggio B, Moret V, Siliprandi N. Isolation and properties of a protein kinase from rat liver microsomes. Biochim Biophys Acta - Enzymol. 1969;178(1):199-201. doi:10.1016/0005-2744(69)90152-1. 103. Kikkawa U, Mann SK, Firtel RA, Hunter T. Molecular cloning of casein kinase II alpha subunit from Dictyostelium discoideum and its expression in the life cycle. Mol Cell Biol. 1992;12(12):5711-5723. http://www.ncbi.nlm.nih.gov/pubmed/1448100. Accessed August 3, 2016. 104. Lou DY, Dominguez I, Toselli P, Landesman-Bollag E, O’Brien C, Seldin DC. The alpha catalytic subunit of protein kinase CK2 is required for mouse embryonic development. Mol Cell Biol. 2008;28(1):131-139. doi:10.1128/MCB.01119-07. 105. Xu X, Toselli PA, Russell LD, Seldin DC. Globozoospermia in mice lacking the casein kinase II alpha’ catalytic subunit. Nat Genet. 1999;23(1):118-121. doi:10.1038/12729. 106. Appel K, Wagner P, Boldyreff B, Issinger OG, Montenarh M. Mapping of the interaction sites of the growth suppressor protein p53 with the regulatory beta-subunit of protein kinase CK2. Oncogene. 1995;11(10):1971-1978. http://www.ncbi.nlm.nih.gov/pubmed/7478515. Accessed August 3, 2016. 107. Romero-Oliva F, Allende JE. Protein p21WAF1/CIP1 is phosphorylated by protein kinase CK2 in vitro and interacts with the amino terminal end of the CK2 beta subunit. J Cell Biochem. 2001;81(3):445-452. doi:10.1002/1097- 4644(20010601)81:3<445::AID-JCB1058>3.0.CO;2-2. 108. Tapia JC, Bolanos-Garcia VM, Sayed M, Allende CC, Allende JE. Cell cycle regulatory protein p27KIP1 is a substrate and interacts with the protein kinase CK2. J Cell Biochem. 2004;91(5):865-879. doi:10.1002/jcb.20027. 109. Bonnet H, Filhol O, Truchet I, Brethenou P, Cochet C, Amalric F, Bouche G. Fibroblast Growth Factor-2 Binds to the Regulatory Subunit of CK2 and Directly Stimulates CK2 Activity toward Nucleolin. J Biol Chem. 1996;271(40):24781-24787. doi:10.1074/jbc.271.40.24781. 110. Grein S, Raymond K, Cochet C, Pyerin W, Chambaz EM, Filhol O. Searching interaction partners of protein kinase CK2β subunit by two-hybrid screening. In: A Molecular and Cellular View of Protein Kinase CK2. Boston, MA: Springer US; 1999:105-109. doi:10.1007/978-1-4419-8624-5_13. 111. Olsen BB, Jessen V, Højrup P, Issinger O-G, Boldyreff B. Protein kinase CK2 phosphorylates the Fas-associated factor FAF1 in vivo and influences its transport into the nucleus. FEBS Lett. 2003;546(2-3):218-222. doi:10.1016/S0014-5793(03)00575-1.
105 112. Bolanos-Garcia VM, Fernandez-Recio J, Allende JE, Blundell TL, Meggio F, Pinna LA, Niefind K, Issinger OG, Graham KC, Litchfield DW, Sarno S, al. et, Filhol O, et al. Identifying interaction motifs in CK2beta--a ubiquitous kinase regulatory subunit. Trends Biochem Sci. 2006;31(12):654-661. doi:10.1016/j.tibs.2006.10.005. 113. Basnet H, Su XB, Tan Y, Meisenhelder J, Merkurjev D, Ohgi KA, Hunter T, Pillus L, Rosenfeld MG. Tyrosine phosphorylation of histone H2A by CK2 regulates transcriptional elongation. Nature. 2014;516(7530):267-271. doi:10.1038/nature13736. 114. Tarrant MK, Rho H-S, Xie Z, Jiang YL, Gross C, Culhane JC, Yan G, Qian J, Ichikawa Y, Matsuoka T, Zachara N, Etzkorn FA, Hart GW, et al. Regulation of CK2 by phosphorylation and O-GlcNAcylation revealed by semisynthesis. Nat Chem Biol. 2012;8(3):262-269. doi:10.1038/nchembio.771. 115. Johnston IM, Allison SJ, Morton JP, Schramm L, Scott PH, White RJ. CK2 Forms a Stable Complex with TFIIIB and Activates RNA Polymerase III Transcription in Human Cells. Mol Cell Biol. 2002;22(11):3757-3768. doi:10.1128/MCB.22.11.3757-3768.2002. 116. Salinas P, Fuentes D, Vidal E, Jordana X, Echeverria M, Holuigue L. An extensive survey of CK2 alpha and beta subunits in Arabidopsis: multiple isoforms exhibit differential subcellular localization. Plant Cell Physiol. 2006;47(9):1295-1308. doi:10.1093/pcp/pcj100. 117. Turowec JP, Duncan JS, French AC, Gyenis L, St. Denis NA, Vilk G, Litchfield DW. Chapter Twenty-Three – Protein Kinase CK2 is a Constitutively Active Enzyme that Promotes Cell Survival: Strategies to Identify CK2 Substrates and Manipulate its Activity in Mammalian Cells. In: Methods in Enzymology. Vol 484. ; 2010:471-493. doi:10.1016/B978-0-12-381298-8.00023-X. 118. Sarno S, Ghisellini P, Pinna LA. Unique activation mechanism of protein kinase CK2. The N-terminal segment is essential for constitutive activity of the catalytic subunit but not of the holoenzyme. J Biol Chem. 2002;277(25):22509-22514. doi:10.1074/jbc.M200486200. 119. Marin O, Meggio F, Marchiori F, Borin G, Pinna LA. Site specificity of casein kinase-2 (TS) from rat liver cytosol. A study with model peptide substrates. Eur J Biochem. 1986;160(2):239-244. http://www.ncbi.nlm.nih.gov/pubmed/3464423. Accessed August 4, 2016. 120. Meggio F, Pinna LA. One-thousand-and-one substrates of protein kinase CK2? FASEB J. 2003;17(3):349-368. doi:10.1096/fj.02-0473rev. 121. Salvi M, Cesaro L, Pinna LA. Variable contribution of protein kinases to the generation of the human phosphoproteome: a global weblogo analysis. Biomol Concepts. 2010;1(2):185-195. doi:10.1515/bmc.2010.013. 122. Salvi M, Sarno S, Cesaro L, Nakamura H, Pinna LA. Extraordinary pleiotropy of protein kinase CK2 revealed by weblogo phosphoproteome analysis. Biochim Biophys Acta - Mol Cell Res. 2009;1793(5):847-859. doi:10.1016/j.bbamcr.2009.01.013. 123. Nishibuchi G, Machida S, Osakabe A, Murakoshi H, Hiragami-Hamada K, Nakagawa R, Fischle W, Nishimura Y, Kurumizaka H, Tagami H, Nakayama J. N-terminal phosphorylation of HP1α increases its nucleosome-binding
106 specificity. Nucleic Acids Res. 2014;42(20):12498-12511. doi:10.1093/nar/gku995. 124. Ayoub N, Jeyasekharan AD, Bernal JA, Venkitaraman AR. HP1-beta mobilization promotes chromatin changes that initiate the DNA damage response. Nature. 2008;453(7195):682-686. doi:10.1038/nature06875. 125. Ayoub N, Jeyasekharan AD, Venkitaraman AR. Mobilization and recruitment of HP1: a bimodal response to DNA breakage. Cell Cycle. 2009;8(18):2945-2950. http://www.ncbi.nlm.nih.gov/pubmed/19657222. Accessed August 4, 2016. 126. Ayoub N, Jeyasekharan AD, Bernal JA, Venkitaraman AR. Paving the way for H2AX phosphorylation: chromatin changes in the DNA damage response. Cell Cycle. 2009;8(10):1494-1500. doi:10.4161/cc.8.10.8501. 127. Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM. A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol. 2000;10(15):886-895. doi:10.1016/S0960- 9822(00)00610-2. 128. Bassing CH, Chua KF, Sekiguchi J, Suh H, Whitlow SR, Fleming JC, Monroe BC, Ciccone DN, Yan C, Vlasakova K, Livingston DM, Ferguson DO, Scully R, et al. Increased ionizing radiation sensitivity and genomic instability in the absence of histone H2AX. Proc Natl Acad Sci U S A. 2002;99(12):8173-8178. doi:10.1073/pnas.122228699. 129. Burma S, Chen BP, Murphy M, Kurimasa A, Chen DJ. ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J Biol Chem. 2001;276(45):42462-42467. doi:10.1074/jbc.C100466200. 130. Meyer B, Voss K-O, Tobias F, Jakob B, Durante M, Taucher-Scholz G. Clustered DNA damage induces pan-nuclear H2AX phosphorylation mediated by ATM and DNA-PK. Nucleic Acids Res. 2013;41(12):6109-6118. doi:10.1093/nar/gkt304. 131. Olsen BB, Wang S-Y, Svenstrup TH, Chen BP, Guerra B, Jackson S, Bartek J, Helleday T, Petermann E, Lundin C, Hodgson B, Sharma R, Burma S, et al. Protein kinase CK2 localizes to sites of DNA double-strand break regulating the cellular response to DNA damage. BMC Mol Biol. 2012;13(1):7. doi:10.1186/1471-2199-13-7. 132. Zwicker F, Ebert M, Huber PE, Debus J, Weber K-J. A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells. Radiat Oncol. 2011;6:15. doi:10.1186/1748-717X-6-15. 133. Becherel OJ, Jakob B, Cherry AL, Gueven N, Fusser M, Kijas AW, Peng C, Katyal S, McKinnon PJ, Chen J, Epe B, Smerdon SJ, Taucher-Scholz G, et al. CK2 phosphorylation-dependent interaction between aprataxin and MDC1 in the DNA damage response. Nucleic Acids Res. 2010;38(5):1489-1503. doi:10.1093/nar/gkp1149. 134. Melander F, Bekker-Jensen S, Falck J, Bartek J, Mailand N, Lukas J. Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin. J Cell Biol. 2008;181(2):213- 226. doi:10.1083/jcb.200708210. 135. Wu L, Luo K, Lou Z, Chen J. MDC1 regulates intra-S-phase checkpoint by
107 targeting NBS1 to DNA double-strand breaks. Proc Natl Acad Sci. 2008;105(32):11200-11205. doi:10.1073/pnas.0802885105. 136. Spycher C, Miller ES, Townsend K, Pavic L, Morrice NA, Janscak P, Stewart GS, Stucki M. Constitutive phosphorylation of MDC1 physically links the MRE11– RAD50–NBS1 complex to damaged chromatin. J Cell Biol. 2008;181(2):227- 240. doi:10.1083/jcb.200709008. 137. Kolas NK, Chapman JR, Nakada S, Ylanko J, Chahwan R, Sweeney FD, Panier S, Mendez M, Wildenhain J, Thomson TM, Pelletier L, Jackson SP, Durocher D. Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science. 2007;318(5856):1637-1640. doi:10.1126/science.1150034. 138. Whitehouse CJ, Taylor RM, Thistlethwaite A, Zhang H, Karimi-Busheri F, Lasko DD, Weinfeld M, Caldecott KW. XRCC1 Stimulates Human Polynucleotide Kinase Activity at Damaged DNA Termini and Accelerates DNA Single-Strand Break Repair. Cell. 2001;104(1):107-117. doi:10.1016/S0092- 8674(01)00195-7. 139. Ström CE, Mortusewicz O, Finch D, Parsons JL, Lagerqvist A, Johansson F, Schultz N, Erixon K, Dianov GL, Helleday T. CK2 phosphorylation of XRCC1 facilitates dissociation from DNA and single-strand break formation during base excision repair. DNA Repair (Amst). 2011;10(9):961-969. doi:10.1016/j.dnarep.2011.07.004. 140. Parsons JL, Dianova II, Finch D, Tait PS, Ström CE, Helleday T, Dianov GL. XRCC1 phosphorylation by CK2 is required for its stability and efficient DNA repair. DNA Repair (Amst). 2010;9(7):835-841. doi:10.1016/j.dnarep.2010.04.008. 141. Siddiqui-Jain A, Bliesath J, Macalino D, Omori M, Huser N, Streiner N, Ho CB, Anderes K, Proffitt C, O’Brien SE, Lim JKC, Von Hoff DD, Ryckman DM, et al. CK2 inhibitor CX-4945 suppresses DNA repair response triggered by DNA- targeted anticancer drugs and augments efficacy: mechanistic rationale for drug combination therapy. Mol Cancer Ther. 2012;11(4):994-1005. doi:10.1158/1535-7163.MCT-11-0613. 142. Loizou JI, El-Khamisy SF, Zlatanou A, Moore DJ, Chan DW, Qin J, Sarno S, Meggio F, Pinna LA, Caldecott KW. The Protein Kinase CK2 Facilitates Repair of Chromosomal DNA Single-Strand Breaks. Cell. 2004;117(1):17-28. doi:10.1016/S0092-8674(04)00206-5. 143. Steinmeyer K, Maacke H, Deppert W. Cell cycle control by p53 in normal (3T3) and chemically transformed (Meth A) mouse cells. I. Regulation of p53 expression. Oncogene. 1990;5(11):1691-1699. http://www.ncbi.nlm.nih.gov/pubmed/2267135. Accessed August 4, 2016. 144. Pellegata NS, Antoniono RJ, Redpath JL, Stanbridge EJ. DNA damage and p53- mediated cell cycle arrest: a reevaluation. Proc Natl Acad Sci U S A. 1996;93(26):15209-15214. http://www.ncbi.nlm.nih.gov/pubmed/8986789. Accessed August 4, 2016. 145. Dixit D, Sharma V, Ghosh S, Mehta VS, Sen E. Inhibition of Casein kinase-2 induces p53-dependent cell cycle arrest and sensitizes glioblastoma cells to tumor necrosis factor (TNFα)-induced apoptosis through SIRT1 inhibition. Cell Death Dis. 2012;3(2):e271. doi:10.1038/cddis.2012.10.
108 146. Götz C, Kartarius S, Schwär G, Montenarh M. Phosphorylation of mdm2 at serine 269 impairs its interaction with the retinoblastoma protein. Int J Oncol. 2005;26(3):801-808. http://www.ncbi.nlm.nih.gov/pubmed/15703839. Accessed August 4, 2016. 147. Allende-Vega N, Dias S, Milne D, Meek D. Phosphorylation of the acidic domain of Mdm2 by protein kinase CK2. Mol Cell Biochem. 2005;274(1-2):85-90. http://www.ncbi.nlm.nih.gov/pubmed/16335531. Accessed August 4, 2016. 148. Götz C, Kartarius S, Scholtes P, Nastainczyk W, Montenarh M. Identification of a CK2 phosphorylation site in mdm2. Eur J Biochem. 1999;266(2):493-501. http://www.ncbi.nlm.nih.gov/pubmed/10561590. Accessed August 4, 2016. 149. Finlan LE, Nenutil R, Ibbotson SH, Vojtesek B, Hupp TR. CK2-site phosphorylation of p53 is induced in DeltaNp63 expressing basal stem cells in UVB irradiated human skin. Cell Cycle. 2006;5(21):2489-2494. http://www.ncbi.nlm.nih.gov/pubmed/17106255. Accessed January 7, 2016. 150. Keller DM, Zeng X, Wang Y, Zhang QH, Kapoor M, Shu H, Goodman R, Lozano G, Zhao Y, Lu H, Banin S, Moyal L, Shieh S, et al. A DNA damage-induced p53 serine 392 kinase complex contains CK2, hSpt16, and SSRP1. Mol Cell. 2001;7(2):283-292. doi:10.1016/s1097-2765(01)00176-9. 151. Sayed M, Pelech S, Wong C, Marotta A, Salh B. Protein kinase CK2 is involved in G2 arrest and apoptosis following spindle damage in epithelial cells. Oncogene. 2001;20(48):6994-7005. doi:10.1038/sj.onc.1204894. 152. Hanna DE, Rethinaswamy A, Glover CVC. Casein Kinase II Is Required for Cell Cycle Progression during G1 and G2/M in Saccharomyces cerevisiae. J Biol Chem. 1995;270(43):25905-25914. doi:10.1074/jbc.270.43.25905. 153. Tripodi F, Zinzalla V, Vanoni M, Alberghina L, Coccetti P. In CK2 inactivated cells the cyclin dependent kinase inhibitor Sic1 is involved in cell-cycle arrest before the onset of S phase. Biochem Biophys Res Commun. 2007;359(4):921- 927. doi:10.1016/j.bbrc.2007.05.195. 154. Ford HL, Landesman-Bollag E, Dacwag CS, Stukenberg PT, Pardee AB, Seldin DC. Cell cycle-regulated phosphorylation of the human SIX1 homeodomain protein. J Biol Chem. 2000;275(29):22245-22254. doi:10.1074/jbc.M002446200. 155. Olsen BB, Kreutzer JN, Watanabe N, Holm T, Guerra B. Mapping of the interaction sites between Wee1 kinase and the regulatory beta-subunit of protein kinase CK2. Int J Oncol. 2010;36(5):1175-1182. http://www.ncbi.nlm.nih.gov/pubmed/20372791. Accessed August 4, 2016. 156. Yde CW, Olsen BB, Meek D, Watanabe N, Guerra B. The regulatory beta- subunit of protein kinase CK2 regulates cell-cycle progression at the onset of mitosis. Oncogene. 2008;27(37):4986-4997. doi:10.1038/onc.2008.146. 157. St-Denis NA, Bailey ML, Parker EL, Vilk G, Litchfield DW, Andersen JS, Wilkinson CJ, Mayor T, Mortensen P, Nigg EA, Mann M, Avila J, Ulloa L, et al. Localization of phosphorylated CK2alpha to the mitotic spindle requires the peptidyl-prolyl isomerase Pin1. J Cell Sci. 2011;124(Pt 14):2341-2348. doi:10.1242/jcs.077446. 158. Messenger MM, Saulnier RB, Gilchrist AD, Diamond P, Gorbsky GJ, Litchfield DW. Interactions between protein kinase CK2 and Pin1. Evidence for
109 phosphorylation-dependent interactions. J Biol Chem. 2002;277(25):23054- 23064. doi:10.1074/jbc.M200111200. 159. Liu X, Kim CN, Yang J, Jemmerson R, Wang X. Induction of Apoptotic Program in Cell-Free Extracts: Requirement for dATP and Cytochrome c. Cell. 1996;86(1):147-157. doi:10.1016/S0092-8674(00)80085-9. 160. Gogvadze V, Orrenius S, Zhivotovsky B. Multiple pathways of cytochrome c release from mitochondria in apoptosis. Biochim Biophys Acta - Bioenerg. 2006;1757(5):639-647. doi:10.1016/j.bbabio.2006.03.016. 161. Cai J, Yang J, Jones D. Mitochondrial control of apoptosis: the role of cytochrome c. Biochim Biophys Acta - Bioenerg. 1998;1366(1):139-149. doi:10.1016/S0005-2728(98)00109-1. 162. Jiang X, Wang X. Cytochrome C-mediated apoptosis. Annu Rev Biochem. 2004;73:87-106. doi:10.1146/annurev.biochem.73.011303.073706. 163. Kim GS, Jung JE, Narasimhan P, Sakata H, Yoshioka H, Song YS, Okami N, Chan PH. Release of mitochondrial apoptogenic factors and cell death are mediated by CK2 and NADPH oxidase. J Cereb Blood Flow Metab. 2011;32(4):720-730. doi:10.1038/jcbfm.2011.176. 164. Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP, Wang X. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science. 1997;275(5303):1129-1132. http://www.ncbi.nlm.nih.gov/pubmed/9027314. Accessed August 4, 2016. 165. Tsujimoto Y, Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature. 1999;399(6735):483-487. doi:10.1038/20959. 166. Li H, Zhu H, Xu C, Yuan J. Cleavage of BID by Caspase 8 Mediates the Mitochondrial Damage in the Fas Pathway of Apoptosis. Cell. 1998;94(4):491- 501. doi:10.1016/S0092-8674(00)81590-1. 167. Chou JJ, Li H, Salvesen GS, Yuan J, Wagner G. Solution Structure of BID, an Intracellular Amplifier of Apoptotic Signaling. Cell. 1999;96(5):615-624. doi:10.1016/S0092-8674(00)80572-3. 168. Luo X, Budihardjo I, Zou H, Slaughter C, Wang X. Bid, a Bcl2 Interacting Protein, Mediates Cytochrome c Release from Mitochondria in Response to Activation of Cell Surface Death Receptors. Cell. 1998;94(4):481-490. doi:10.1016/S0092-8674(00)81589-5. 169. Maianski NA, Roos D, Kuijpers TW. Bid Truncation, Bid/Bax Targeting to the Mitochondria, and Caspase Activation Associated with Neutrophil Apoptosis Are Inhibited by Granulocyte Colony-Stimulating Factor. J Immunol. 2004;172(11):7024-7030. doi:10.4049/jimmunol.172.11.7024. 170. Hellwig CT, Ludwig-Galezowska AH, Concannon CG, Litchfield DW, Prehn JHM, Rehm M, Alam A, Cohen LY, Aouad S, Sekaly RP, Albeck JG, Burke JM, Aldridge BB, et al. Activity of protein kinase CK2 uncouples Bid cleavage from caspase- 8 activation. J Cell Sci. 2010;123(Pt 9):1401-1406. doi:10.1242/jcs.061143. 171. Desagher S, Osen-Sand A, Montessuit S, Magnenat E, Vilbois F, Hochmann A, Journot L, Antonsson B, Martinou J-C. Phosphorylation of Bid by Casein Kinases I and II Regulates Its Cleavage by Caspase 8. Mol Cell. 2001;8(3):601- 611. doi:10.1016/S1097-2765(01)00335-5.
110 172. Caulfield AJ, Lathem WW, Suda T, Takahashi T, Golstein P, Nagata S, Locksley R, Killeen N, Lenardo M, Strasser A, Jost P, Nagata S, Wang L, et al. Disruption of Fas-Fas Ligand Signaling, Apoptosis, and Innate Immunity by Bacterial Pathogens. Heitman J, ed. PLoS Pathog. 2014;10(8):e1004252. doi:10.1371/journal.ppat.1004252. 173. Waring P, Mullbacher A. Cell death induced by the Fas/Fas ligand pathway and its role in pathology. Immunol Cell Biol. 1999;77(4):312-317. doi:10.1046/j.1440-1711.1999.00837.x. 174. Nagata S, Golstein P. The Fas death factor. Science (80- ). 1995;267(5203):1449-1456. doi:10.1126/science.7533326. 175. McIlwain DR, Berger T, Mak TW. Caspase Functions in Cell Death and Disease. Cold Spring Harb Perspect Biol. 2013;5(4):a008656-a008656. doi:10.1101/cshperspect.a008656. 176. Cullen SP, Martin SJ. Caspase activation pathways: some recent progress. Cell Death Differ. 2009;16(7):935-938. doi:10.1038/cdd.2009.59. 177. McDonnell MA, Abedin MJ, Melendez M, Platikanova TN, Ecklund JR, Ahmed K, Kelekar A. Phosphorylation of murine caspase-9 by the protein kinase casein kinase 2 regulates its cleavage by caspase-8. J Biol Chem. 2008;283(29):20149-20158. doi:10.1074/jbc.M802846200. 178. Allan LA, Clarke PR. Apoptosis and autophagy: Regulation of caspase-9 by phosphorylation. FEBS J. 2009;276(21):6063-6073. doi:10.1111/j.1742- 4658.2009.07330.x. 179. Duncan JS, Turowec JP, Duncan KE, Vilk G, Wu C, Lüscher B, Li SS-C, Gloor GB, Litchfield DW. A peptide-based target screen implicates the protein kinase CK2 in the global regulation of caspase signaling. Sci Signal. 2011;4(172):ra30. doi:10.1126/scisignal.2001682. 180. Turowec JP, Vilk G, Gabriel M, Litchfield DW. Characterizing the convergence of protein kinase CK2 and caspase-3 reveals isoform-specific phosphorylation of caspase-3 by CK2α’: implications for pathological roles of CK2 in promoting cancer cell survival. Oncotarget. 2013;4(4):560-571. doi:10.18632/oncotarget.948. 181. BURNETT G, KENNEDY EP. The enzymatic phosphorylation of proteins. J Biol Chem. 1954;211(2):969-980. http://www.ncbi.nlm.nih.gov/pubmed/13221602. Accessed August 4, 2016. 182. Daya-Makin M, Sanghera JS, Mogentale TL, Lipp M, Parchomchuk J, Hogg JC, Pelech SL. Activation of a tumor-associated protein kinase (p40TAK) and casein kinase 2 in human squamous cell carcinomas and adenocarcinomas of the lung. Cancer Res. 1994;54(8):2262-2268. http://www.ncbi.nlm.nih.gov/pubmed/7513612. Accessed August 4, 2016. 183. MUNSTERMANN U, FRITZ G, SEITZ G, YIPING L, SCHNEIDER HR, ISSINGER O- G. Casein kinase II is elevated in solid human tumours and rapidly proliferating non-neoplastic tissue. Eur J Biochem. 1990;189(2):251-257. doi:10.1111/j.1432-1033.1990.tb15484.x. 184. Ahmed K. Significance of the casein kinase system in cell growth and proliferation with emphasis on studies of the androgenic regulation of the prostate. Cell Mol Biol Res. 1994;40(1):1-11.
111 http://www.ncbi.nlm.nih.gov/pubmed/7528596. Accessed August 4, 2016. 185. Ruzzene M, Pinna LA. Addiction to protein kinase CK2: a common denominator of diverse cancer cells? Biochim Biophys Acta. 2010;1804(3):499-504. doi:10.1016/j.bbapap.2009.07.018. 186. Ortega CE, Seidner Y, Dominguez I, Seldin D, Landesman-Bollag E, Farago M, Currier N, Lou D, Hauck L, Harms C, An J, Rohne J, Gertz K, et al. Mining CK2 in Cancer. Calogero RA, ed. PLoS One. 2014;9(12):e115609. doi:10.1371/journal.pone.0115609. 187. Trembley JH, Wang G, Unger G, Slaton J, Ahmed K. Protein kinase CK2 in health and disease: CK2: a key player in cancer biology. Cell Mol Life Sci. 2009;66(11-12):1858-1867. doi:10.1007/s00018-009-9154-y. 188. Györffy B, Lanczky A, Eklund AC, Denkert C, Budczies J, Li Q, Szallasi Z. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast Cancer Res Treat. 2010;123(3):725-731. doi:10.1007/s10549-009-0674-9. 189. Liu R, Wang X, Chen GY, Dalerba P, Gurney A, Hoey T, Sherlock G, Lewicki J, Shedden K, Clarke MF. The prognostic role of a gene signature from tumorigenic breast-cancer cells. N Engl J Med. 2007;356(3):217-226. doi:10.1056/NEJMoa063994. 190. Gyorffy B, Lánczky A, Szállási Z. Implementing an online tool for genome-wide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients. Endocr Relat Cancer. 2012;19(2):197- 208. doi:10.1530/ERC-11-0329. 191. Borgo C, Franchin C, Salizzato V, Cesaro L, Arrigoni G, Matricardi L, Pinna LA, Donella-Deana A. Protein kinase CK2 potentiates translation efficiency by phosphorylating eIF3j at Ser127. Biochim Biophys Acta - Mol Cell Res. 2015;1853(7):1693-1701. doi:10.1016/j.bbamcr.2015.04.004. 192. Dixit D, Ahmad F, Ghildiyal R, Joshi SD, Sen E. CK2 inhibition induced PDK4- AMPK axis regulates metabolic adaptation and survival responses in glioma. Exp Cell Res. 2016;344(1):132-142. doi:10.1016/j.yexcr.2016.03.017. 193. Stark F, Pfannstiel J, Klaiber I, Raabe T. Protein kinase CK2 links polyamine metabolism to MAPK signalling in Drosophila. Cell Signal. 2011;23(5):876- 882. doi:10.1016/j.cellsig.2011.01.013. 194. Al Quobaili F, Montenarh M. CK2 and the regulation of the carbohydrate metabolism. Metabolism. 2012;61(11):1512-1517. doi:10.1016/j.metabol.2012.07.011. 195. Hanif IM, Hanif IM, Shazib MA, Ahmad KA, Pervaiz S. Casein Kinase II: An attractive target for anti-cancer drug design. Int J Biochem Cell Biol. 2010;42(10):1602-1605. doi:10.1016/j.biocel.2010.06.010. 196. Cozza G, Pinna LA, Moro S. Kinase CK2 inhibition: an update. Curr Med Chem. 2013;20(5):671-693. http://www.ncbi.nlm.nih.gov/pubmed/23210774. Accessed August 4, 2016. 197. Herzog NK, Bargmann WJ, Bose HR. Oncogene expression in reticuloendotheliosis virus-transformed lymphoid cell lines and avian tissues. J Virol. 1986;57(1):371-375. http://www.ncbi.nlm.nih.gov/pubmed/2867231. Accessed August 4, 2016.
112 198. Walker WH, Stein B, Ganchi PA, Hoffman JA, Kaufman PA, Ballard DW, Hannink M, Greene WC. The v-rel oncogene: insights into the mechanism of transcriptional activation, repression, and transformation. J Virol. 1992;66(8):5018-5029. http://www.ncbi.nlm.nih.gov/pubmed/1321284. Accessed August 4, 2016. 199. Zhi H, Yang L, Kuo Y-L, Ho Y-K, Shih H-M, Giam C-Z. NF-κB Hyper-Activation by HTLV-1 Tax Induces Cellular Senescence, but Can Be Alleviated by the Viral Anti-Sense Protein HBZ. Emerman M, ed. PLoS Pathog. 2011;7(4):e1002025. doi:10.1371/journal.ppat.1002025. 200. Sun S-C, Yamaoka S. Activation of NF-κB by HTLV-I and implications for cell transformation. Oncogene. 2005;24(39):5952-5964. doi:10.1038/sj.onc.1208969. 201. Catz SD, Johnson JL. Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene. 2001;20(50):7342- 7351. doi:10.1038/sj.onc.1204926. 202. Tak PP, Firestein GS, Baldwin A, Chen F, Castranova V, Shi X, Demers L, Franzoso G, Vincenti M, Coon C, Brinckerhoff C, Miyazawa K, Mori A, et al. NF- κB: a key role in inflammatory diseases. J Clin Invest. 2001;107(1):7-11. doi:10.1172/JCI11830. 203. Hoesel B, Schmid JA, Sen R, Baltimore D, May M, Ghosh S, Caamaño J, Hunter C, May M, Ghosh S, Marienfeld R, Hayden M, Ghosh S, et al. The complexity of NF- κB signaling in inflammation and cancer. Mol Cancer. 2013;12(1):86. doi:10.1186/1476-4598-12-86. 204. Hinz M, Krappmann D, Eichten A, Heder A, Scheidereit C, Strauss M. NF- kappaB function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol Cell Biol. 1999;19(4):2690-2698. http://www.ncbi.nlm.nih.gov/pubmed/10082535. Accessed August 4, 2016. 205. Kanda K, Hu H-M, Zhang L, Grandchamps J, Boxer LM. NF- B Activity Is Required for the Deregulation of c-myc Expression by the Immunoglobulin Heavy Chain Enhancer. J Biol Chem. 2000;275(41):32338-32346. doi:10.1074/jbc.M004148200. 206. Lv N, Shan Z, Gao Y, Guan H, Fan C, Wang H, Teng W. Twist1 regulates the epithelial–mesenchymal transition via the NF-κB pathway in papillary thyroid carcinoma. Endocrine. 2016;51(3):469-477. doi:10.1007/s12020-015-0714- 7. 207. Kumar M, Allison DF, Baranova NN, Wamsley JJ, Katz AJ, Bekiranov S, Jones DR, Mayo MW. NF-κB regulates mesenchymal transition for the induction of non-small cell lung cancer initiating cells. PLoS One. 2013;8(7):e68597. doi:10.1371/journal.pone.0068597. 208. Huber MA, Azoitei N, Baumann B, Grünert S, Sommer A, Pehamberger H, Kraut N, Beug H, Wirth T, Orlowski R, Jr. AB, Karin M, Cao Y, et al. NF-κB is essential for epithelial-mesenchymal transition and metastasis in a model of breast cancer progression. J Clin Invest. 2004;114(4):569-581. doi:10.1172/JCI21358. 209. Takino T, Nakada M, Li Z, Yoshimoto T, Domoto T, Sato H. Tip60 regulates MT1-MMP transcription and invasion of glioblastoma cells through NF-κB
113 pathway. Clin Exp Metastasis. 2016;33(1):45-52. doi:10.1007/s10585-015- 9756-8. 210. Cheng C-Y, Hsieh H-L, Hsiao L-D, Yang C-M. PI3-K/Akt/JNK/NF-κB is essential for MMP-9 expression and outgrowth in human limbal epithelial cells on intact amniotic membrane. Stem Cell Res. 2012;9(1):9-23. doi:10.1016/j.scr.2012.02.005. 211. Philip S, Bulbule A, Kundu GC. Matrix metalloproteinase-2: mechanism and regulation of NF-kappaB-mediated activation and its role in cell motility and ECM-invasion. Glycoconj J. 2004;21(8-9):429-441. doi:10.1007/s10719-004- 5533-7. 212. Oeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009;1(4):a000034. doi:10.1101/cshperspect.a000034. 213. Wu BY, Woffendin C, MacLachlan I, Nabel GJ. Distinct domains of IkappaB- alpha inhibit human immunodeficiency virus type 1 replication through NF- kappaB and Rev. J Virol. 1997;71(4):3161-3167. http://www.ncbi.nlm.nih.gov/pubmed/9060679. Accessed August 4, 2016. 214. Kato T, Delhase M, Hoffmann A, Karin M. CK2 Is a C-Terminal IκB Kinase Responsible for NF-κB Activation during the UV Response. Mol Cell. 2003;12(4):829-839. doi:10.1016/S1097-2765(03)00358-7. 215. Braccini L, Ciraolo E, Martini M, Pirali T, Germena G, Rolfo K, Hirsch E. PI3K keeps the balance between metabolism and cancer. Adv Biol Regul. 2012;52(3):389-405. doi:10.1016/j.jbior.2012.04.002. 216. Cerniglia GJ, Dey S, Gallagher-Colombo SM, Daurio NA, Tuttle S, Busch TM, Lin A, Sun R, Esipova T V, Vinogradov SA, Denko N, Koumenis C, Maity A. The PI3K/Akt Pathway Regulates Oxygen Metabolism via Pyruvate Dehydrogenase (PDH)-E1α Phosphorylation. Mol Cancer Ther. 2015;14(8):1928-1938. doi:10.1158/1535-7163.MCT-14-0888. 217. Chang F, Lee JT, Navolanic PM, Steelman LS, Shelton JG, Blalock WL, Franklin RA, McCubrey JA. Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: a target for cancer chemotherapy. Leukemia. 2003;17(3):590-603. doi:10.1038/sj.leu.2402824. 218. Liang J, Slingerland JM. Multiple roles of the PI3K/PKB (Akt) pathway in cell cycle progression. Cell Cycle. 2(4):339-345. http://www.ncbi.nlm.nih.gov/pubmed/12851486. Accessed August 4, 2016. 219. Wu Y-T, Tan H-L, Huang Q, Ong C-N, Shen H-M. Activation of the PI3K-Akt- mTOR signaling pathway promotes necrotic cell death via suppression of autophagy. Autophagy. 2009;5(6):824-834. http://www.ncbi.nlm.nih.gov/pubmed/19556857. Accessed August 4, 2016. 220. Gao N, Zhang Z, Jiang B-H, Shi X. Role of PI3K/AKT/mTOR signaling in the cell cycle progression of human prostate cancer. Biochem Biophys Res Commun. 2003;310(4):1124-1132. doi:10.1016/j.bbrc.2003.09.132. 221. Ornelas IM, Silva TM, Fragel-Madeira L, Ventura ALM, Stokoe D, Stephens L, Copeland T, Gaffney P, Reese C, Sarbassov D, Guertin D, Ali S, Sabatini D, et al. Inhibition of PI3K/Akt Pathway Impairs G2/M Transition of Cell Cycle in Late Developing Progenitors of the Avian Embryo Retina. Nelson B, ed. PLoS One.
114 2013;8(1):e53517. doi:10.1371/journal.pone.0053517. 222. Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C. PI3K/Akt and apoptosis: size matters. Oncogene. 2003;22(56):8983-8998. doi:10.1038/sj.onc.1207115. 223. Xue G, Hemmings BA. PKB/Akt-dependent regulation of cell motility. J Natl Cancer Inst. 2013;105(6):393-404. doi:10.1093/jnci/djs648. 224. KIM D, KIM S, KOH H, YOON S-O, CHUNG A-S, CHO KS, CHUNG J. Akt/PKB promotes cancer cell invasion via increased motility and metalloproteinase production. FASEB J. 2001;15(11):1953-1962. doi:10.1096/fj.01-0198com. 225. Niswender KD, Morrison CD, Clegg DJ, Olson R, Baskin DG, Myers MG, Seeley RJ, Schwartz MW. Insulin activation of phosphatidylinositol 3-kinase in the hypothalamic arcuate nucleus: a key mediator of insulin-induced anorexia. Diabetes. 2003;52(2):227-231. http://www.ncbi.nlm.nih.gov/pubmed/12540590. Accessed August 4, 2016. 226. Davis NM, Sokolosky M, Stadelman K, Abrams SL, Libra M, Candido S, Nicoletti F, Polesel J, Maestro R, D’Assoro A, Drobot L, Rakus D, Gizak A, et al. Deregulation of the EGFR/PI3K/PTEN/Akt/mTORC1 pathway in breast cancer: possibilities for therapeutic intervention. Oncotarget. 2014;5(13):4603-4650. doi:10.18632/oncotarget.2209. 227. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR pathways: cross- talk and compensation. Trends Biochem Sci. 2011;36(6):320-328. doi:10.1016/j.tibs.2011.03.006. 228. Castellano E, Downward J. RAS Interaction with PI3K: More Than Just Another Effector Pathway. Genes Cancer. 2011;2(3):261-274. doi:10.1177/1947601911408079. 229. Rhee SG. Regulation of phosphoinositide-specific phospholipase C. Annu Rev Biochem. 2001;70:281-312. doi:10.1146/annurev.biochem.70.1.281. 230. Park WS, Heo W Do, Whalen JH, O’Rourke NA, Bryan HM, Meyer T, Teruel MN. Comprehensive identification of PIP3-regulated PH domains from C. elegans to H. sapiens by model prediction and live imaging. Mol Cell. 2008;30(3):381- 392. doi:10.1016/j.molcel.2008.04.008. 231. Dieterle AM, Böhler P, Keppeler H, Alers S, Berleth N, Drießen S, Hieke N, Pietkiewicz S, Löffler AS, Peter C, Gray A, Leslie NR, Shinohara H, et al. PDK1 controls upstream PI3K expression and PIP3 generation. Oncogene. 2014;33(23):3043-3053. doi:10.1038/onc.2013.266. 232. Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P, Coffer P, Woodgett J, Jones P, Jakubowicz T, Pitossi F, Maurer F, et al. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol. 1997;7(4):261-269. doi:10.1016/s0960-9822(06)00122-9. 233. Calleja V, Alcor D, Laguerre M, Park J, Vojnovic B, Hemmings BA, Downward J, Parker PJ, Larijani B. Intramolecular and Intermolecular Interactions of Protein Kinase B Define Its Activation In Vivo. Kuriyan J, ed. PLoS Biol. 2007;5(4):e95. doi:10.1371/journal.pbio.0050095. 234. Fang D, Hawke D, Zheng Y, Xia Y, Meisenhelder J, Nika H, Mills GB, Kobayashi R, Hunter T, Lu Z. Phosphorylation of beta-catenin by AKT promotes beta-
115 catenin transcriptional activity. J Biol Chem. 2007;282(15):11221-11229. doi:10.1074/jbc.M611871200. 235. Liu P-P, Liao J, Tang Z-J, Wu W-J, Yang J, Zeng Z-L, Hu Y, Wang P, Ju H-Q, Xu R- H, Huang P. Metabolic regulation of cancer cell side population by glucose through activation of the Akt pathway. Cell Death Differ. 2014;21(1):124-135. doi:10.1038/cdd.2013.131. 236. Mester J, Eng C. When overgrowth bumps into cancer: the PTEN-opathies. Am J Med Genet C Semin Med Genet. 2013;163C(2):114-121. doi:10.1002/ajmg.c.31364. 237. Ali IU, Schriml LM, Dean M. Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid phosphatase activity. J Natl Cancer Inst. 1999;91(22):1922-1932. http://www.ncbi.nlm.nih.gov/pubmed/10564676. Accessed August 4, 2016. 238. Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, Wu H. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A. 1999;96(11):6199-6204. doi:10.1073/pnas.96.11.6199. 239. Shehata M, Schnabl S, Demirtas D, Hilgarth M, Hubmann R, Ponath E, Badrnya S, Lehner C, Hoelbl A, Duechler M, Gaiger A, Zielinski C, Schwarzmeier JD, et al. Reconstitution of PTEN activity by CK2 inhibitors and interference with the PI3-K/Akt cascade counteract the antiapoptotic effect of human stromal cells in chronic lymphocytic leukemia. Blood. 2010;116(14):2513-2521. doi:10.1182/blood-2009-10-248054. 240. Barata JT. The impact of PTEN regulation by CK2 on PI3K-dependent signaling and leukemia cell survival. Adv Enzyme Regul. 2011;51(1):37-49. doi:10.1016/j.advenzreg.2010.09.012. 241. Torres J, Pulido R. The tumor suppressor PTEN is phosphorylated by the protein kinase CK2 at its C terminus. Implications for PTEN stability to proteasome-mediated degradation. J Biol Chem. 2001;276(2):993-998. doi:10.1074/jbc.M009134200. 242. Al-Khouri AM, Ma Y, Togo SH, Williams S, Mustelin T. Cooperative phosphorylation of the tumor suppressor phosphatase and tensin homologue (PTEN) by casein kinases and glycogen synthase kinase 3beta. J Biol Chem. 2005;280(42):35195-35202. doi:10.1074/jbc.M503045200. 243. Seldin DC, Landesman-Bollag E, Farago M, Currier N, Lou D, Dominguez I. CK2 as a positive regulator of Wnt signalling and tumourigenesis. Mol Cell Biochem. 2005;274(1-2):63-67. doi:10.1007/s11010-005-3078-0. 244. Song DH, Dominguez I, Mizuno J, Kaut M, Mohr SC, Seldin DC. CK2 Phosphorylation of the Armadillo Repeat Region of -Catenin Potentiates Wnt Signaling. J Biol Chem. 2003;278(26):24018-24025. doi:10.1074/jbc.M212260200. 245. Willert K, Brink M, Wodarz A, Varmus H, Nusse R. Casein kinase 2 associates with and phosphorylates dishevelled. EMBO J. 1997;16(11):3089-3096. doi:10.1093/emboj/16.11.3089. 246. Oosterwegel MA, van de Wetering ML, Holstege FC, Prosser HM, Owen MJ,
116 Clevers HC. TCF-1, a T cell-specific transcription factor of the HMG box family, interacts with sequence motifs in the TCR beta and TCR delta enhancers. Int Immunol. 1991;3(11):1189-1192. http://www.ncbi.nlm.nih.gov/pubmed/1836958. Accessed August 5, 2016. 247. Wang S, Jones KA, Gregorieff A, Clevers H, Song DH, Dominguez I, Mizuno J, Kaut M, Mohr SC, Seldin DC, Seldin DC, Landesman-Bollag E, Farago M, et al. CK2 controls the recruitment of Wnt regulators to target genes in vivo. Curr Biol. 2006;16(22):2239-2244. doi:10.1016/j.cub.2006.09.034. 248. Sun J, Weis WI. Biochemical and structural characterization of β-catenin interactions with nonphosphorylated and CK2-phosphorylated Lef-1. J Mol Biol. 2011;405(2):519-530. doi:10.1016/j.jmb.2010.11.010. 249. Pierre F, Chua PC, O’Brien SE, Siddiqui-Jain A, Bourbon P, Haddach M, Michaux J, Nagasawa J, Schwaebe MK, Stefan E, Vialettes A, Whitten JP, Chen TK, et al. Pre-clinical characterization of CX-4945, a potent and selective small molecule inhibitor of CK2 for the treatment of cancer. Mol Cell Biochem. 2011;356(1- 2):37-43. doi:10.1007/s11010-011-0956-5. 250. Gao Y, Wang H -y. Casein Kinase 2 Is Activated and Essential for Wnt/beta- Catenin Signaling. J Biol Chem. 2006;281(27):18394-18400. doi:10.1074/jbc.M601112200. 251. Miller SJ, Jessen WJ, Mehta T, Hardiman A, Sites E, Kaiser S, Jegga AG, Li H, Upadhyaya M, Giovannini M, Muir D, Wallace MR, Lopez E, et al. Integrative genomic analyses of neurofibromatosis tumours identify SOX9 as a biomarker and survival gene. EMBO Mol Med. 2009;1(4):236-248. doi:10.1002/emmm.200900027. 252. Bian Y, Ye M, Wang C, Cheng K, Song C, Dong M, Pan Y, Qin H, Zou H. Global screening of CK2 kinase substrates by an integrated phosphoproteomics workflow. Sci Rep. 2013;3:3460. doi:10.1038/srep03460. 253. Deshiere A, Duchemin-Pelletier E, Spreux E, Ciais D, Combes F, Vandenbrouck Y, Couté Y, Mikaelian I, Giusiano S, Charpin C, Cochet C, Filhol O. Unbalanced expression of CK2 kinase subunits is sufficient to drive epithelial-to- mesenchymal transition by Snail1 induction. Oncogene. 2013;32(11):1373- 1383. doi:10.1038/onc.2012.165. 254. Chung D-WD, Frausto RF, Ann LB, Jang MS, Aldave AJ. Functional impact of ZEB1 mutations associated with posterior polymorphous and Fuchs’ endothelial corneal dystrophies. Invest Ophthalmol Vis Sci. 2014;55(10):6159-6166. doi:10.1167/iovs.14-15247. 255. Bian Y, Han J, Kannabiran V, Mohan S, Cheng H, Friedman J, Zhang L, VanWaes C, Chen Z. MEK inhibitor PD-0325901 overcomes resistance to CK2 inhibitor CX-4945 and exhibits anti-tumor activity in head and neck cancer. Int J Biol Sci. 2015;11(4):411-422. doi:10.7150/ijbs.10745. 256. R. F. Marschke, M. J. Borad, R. W. McFarland, R. H. Alvarez, J. K. Lim, C. S. Padgett, D. D. Von Hoff, S. E. O’Brien DWN. Findings from the phase I clinical trials of CX-4945, an orally available inhibitor of CK2. | 2011 ASCO Annual Meeting | Abstracts | Meeting Library. http://meetinglibrary.asco.org/content/84525-102. Accessed March 10, 2016.
117 257. Jang MH, Kim HJ, Kim EJ, Chung YR, Park SY. Expression of epithelial- mesenchymal transition-related markers in triple-negative breast cancer: ZEB1 as a potential biomarker for poor clinical outcome. Hum Pathol. 2015;46(9):1267-1274. doi:10.1016/j.humpath.2015.05.010. 258. Ford HL, Landesman-Bollag E, Dacwag CS, Stukenberg PT, Pardee AB, Seldin DC. Cell cycle-regulated phosphorylation of the human SIX1 homeodomain protein. J Biol Chem. 2000;275(29):22245-22254. doi:10.1074/jbc.M002446200. 259. Pierre F, Chua PC, O’Brien SE, Siddiqui-Jain A, Bourbon P, Haddach M, Michaux J, Nagasawa J, Schwaebe MK, Stefan E, Vialettes A, Whitten JP, Chen TK, et al. Discovery and SAR of 5-(3-chlorophenylamino)benzo[c][2,6]naphthyridine-8- carboxylic acid (CX-4945), the first clinical stage inhibitor of protein kinase CK2 for the treatment of cancer. J Med Chem. 2011;54(2):635-654. doi:10.1021/jm101251q. 260. Siddiqui-Jain A, Drygin D, Streiner N, Chua P, Pierre F, O’Brien SE, Bliesath J, Omori M, Huser N, Ho C, Proffitt C, Schwaebe MK, Ryckman DM, et al. CX- 4945, an Orally Bioavailable Selective Inhibitor of Protein Kinase CK2, Inhibits Prosurvival and Angiogenic Signaling and Exhibits Antitumor Efficacy. Cancer Res. 2010;70(24):10288-10298. doi:10.1158/0008-5472.CAN-10-1893. 261. Zheng Y, McFarland BC, Drygin D, Yu H, Bellis SL, Kim H, Bredel M, Benveniste EN. Targeting protein kinase CK2 suppresses prosurvival signaling pathways and growth of glioblastoma. Clin Cancer Res. 2013;19(23):6484-6494. doi:10.1158/1078-0432.CCR-13-0265. 262. Padgett CS, 1, Lim JKC, 1, Marschke RF, 2, Northfelt DW, 3, Andreopoulou E, 4, Hoff DD Von, 5, Anderes K, et al. 414 Clinical pharmacokinetics and pharmacodynamics of CX-4945, a novel inhibitor of protein kinase CK2: Interim report from the phase 1 clinical trial | Donald Northfelt - Academia.edu. http://www.academia.edu/18731800/414_Clinical_pharmacokinetics_and_p harmacodynamics_of_CX- 4945_a_novel_inhibitor_of_protein_kinase_CK2_Interim_report_from_the_phas e_1_clinical_trial. Accessed March 7, 2016. 263. Whitecar JP, Bodey GP, Freireich EJ, McCredie KB, Hart JS. Cyclophosphamide (NSC-26271), vincristine (NSC-67574), cytosine arabinoside (NSC-63878), and prednisone (NSC-10023) (COAP) combination chemotherapy for acute leukemia in adults. Cancer Chemother reports. 1972;56(4):543-550. http://www.ncbi.nlm.nih.gov/pubmed/5081596. Accessed August 5, 2016. 264. Karon M, Freireich EJ, Frei E, Taylor R, Wolman IJ, Djerassi I, Lee SL, Sawitsky A, Hananian J, Selawry O, James D, George P, Patterson RB, et al. The role of vincristine in the treatment of childhood acute leukemia. Clin Pharmacol Ther. 7(3):332-339. http://www.ncbi.nlm.nih.gov/pubmed/5327856. Accessed August 5, 2016. 265. Freireich EJ, Bodey GP, Harris JE, Hart JS. Therapy for acute granulocytic leukemia. Cancer Res. 1967;27(12):2573-2577. http://www.ncbi.nlm.nih.gov/pubmed/5237353. Accessed August 5, 2016. 266. Rosenbaum T, Rosenbaum C, Winner U, Müller HW, Lenard HG, Hanemann
118 CO. Long-term culture and characterization of human neurofibroma-derived Schwann cells. J Neurosci Res. 2000;61(5):524-532. http://www.ncbi.nlm.nih.gov/pubmed/10956422. Accessed March 7, 2016. 267. Semina E V., Reiter R, Leysens NJ, Alward WLM, Small KW, Datson NA, Siegel- Bartelt J, Bierke-Nelson D, Bitoun P, Zabel BU, Carey JC, Murray JC. Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet. 1996;14(4):392-399. doi:10.1038/ng1296-392. 268. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M, Bellusci S, et al. Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, heart, extra- and periocular mesoderm and right pulmonary isomerism. Development. 1999;126(24):5749-5758. doi:10.1007/bf02401419. 269. Gage PJ, Camper SA. Pituitary homeobox 2, a novel member of the bicoid- related family of homeobox genes, is a potential regulator of anterior structure formation. Hum Mol Genet. 1997;6(3):457-464. doi:10.1093/hmg/6.3.457. 270. PJ Gage, H Suh SC. Gage: Genetic Analysis of the Bicoid-Related Homeobox... - Google Scholar.; 1999. https://scholar.google.com/scholar_lookup?author=P. J. Gage&author=H. Suh&author=S. A. Camper&publication_year=1999&journal=Dev. Biol.&volume=210&pages=234. 271. Shiratori H, Sakuma R, Watanabe M, Hashiguchi H, Mochida K, Sakai Y, Nishino J, Saijoh Y, Whitman M, Hamada H. Two-Step Regulation of Left–Right Asymmetric Expression of Pitx2: Initiation by Nodal Signaling and Maintenance by Nkx2. Mol Cell. 2001;7(1):137-149. doi:10.1016/S1097- 2765(01)00162-9. 272. Cox CJ, Espinoza HM, McWilliams B, Chappell K, Morton L, Hjalt TA, Semina E V., Amendt BA. Differential Regulation of Gene Expression by PITX2 Isoforms. J Biol Chem. 2002;277(28):25001-25010. doi:10.1074/jbc.M201737200. 273. Amendt BA, Sutherland LB, Russo AF. Multifunctional role of the Pitx2 homeodomain protein C-terminal tail. Mol Cell Biol. 1999;19(10):7001-7010. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=84695&tool=p mcentrez&rendertype=abstract. Accessed April 20, 2013. 274. Amendt BA, Sutherland LB, Semina E V., Russo AF. The Molecular Basis of Rieger Syndrome: ANALYSIS OF PITX2 HOMEODOMAIN PROTEIN ACTIVITIES. J Biol Chem. 1998;273(32):20066-20072. doi:10.1074/jbc.273.32.20066. 275. Lines MA, Kozlowski K, Kulak SC, Allingham RR, Héon E, Ritch R, Levin A V, Shields MB, Damji KF, Newlin A, Walter MA. Characterization and prevalence of PITX2 microdeletions and mutations in Axenfeld-Rieger malformations. Invest Ophthalmol Vis Sci. 2004;45(3):828-833. http://www.ncbi.nlm.nih.gov/pubmed/14985297. Accessed August 5, 2016. 276. Footz T, Idrees F, Acharya M, Kozlowski K, Walter MA. Analysis of mutations of the PITX2 transcription factor found in patients with Axenfeld-Rieger syndrome. Invest Ophthalmol Vis Sci. 2009;50(6):2599-2606.
119 doi:10.1167/iovs.08-3251. 277. Seifi M, Footz T, Taylor SAM, Elhady GM, Abdalla EM, Walter MA. Novel PITX2 gene mutations in patients with Axenfeld-Rieger syndrome. Acta Ophthalmol. March 2016. doi:10.1111/aos.13030. 278. Tümer Z, Bach-Holm D. Axenfeld-Rieger syndrome and spectrum of PITX2 and FOXC1 mutations. Eur J Hum Genet. 2009;17(12):1527-1539. doi:10.1038/ejhg.2009.93. 279. Gürbüz-Köz O, Atalay T, Köz C, Ilgin-Ruhi H, Yarangümeli A, Kural G. Axenfeld- Rieger syndrome associated with truncus arteriosus: a case report. Turk J Pediatr. 49(4):444-447. http://www.ncbi.nlm.nih.gov/pubmed/18246752. Accessed August 5, 2016. 280. Cunningham ET, Eliott D, Miller NR, Maumenee IH, Green WR. Familial Axenfeld-Rieger anomaly, atrial septal defect, and sensorineural hearing loss: a possible new genetic syndrome. Arch Ophthalmol (Chicago, Ill 1960). 1998;116(1):78-82. http://www.ncbi.nlm.nih.gov/pubmed/9445211. Accessed August 5, 2016. 281. Ji Y, Buel SM, Amack JD. Mutations in zebrafish pitx2 model congenital malformations in Axenfeld-Rieger syndrome but do not disrupt left-right placement of visceral organs. Dev Biol. 2016;416(1):69-81. doi:10.1016/j.ydbio.2016.06.010. 282. Hanes SD, Brent R, Aggarwal AK, Rodgers DW, Drotter M, Ptashne M, Harrison SC, Ausubel FM, Brent R, Kingston R, Moore D, Seidman J, Smith J, et al. DNA specificity of the bicoid activator protein is determined by homeodomain recognition helix residue 9. Cell. 1989;57(7):1275-1283. doi:10.1016/0092- 8674(89)90063-9. 283. Jin Y, Hoskins R, Horvitz HR. Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature. 372(6508):780-783. doi:10.1038/372780a0. 284. Simeone A, Acampora D, Mallamaci A, Stornaiuolo A, D’Apice MR, Nigro V, Boncinelli E. A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 1993;12(7):2735-2747. http://www.ncbi.nlm.nih.gov/pubmed/8101484. Accessed August 5, 2016. 285. Gehring WJ, Qian YQ, Billeter M, Furukubo-Tokunaga K, Schier AF, Resendez- Perez D, Affolter M, Otting G, Wüthrich K, Affolter M, Percival-Smith A, Müller M, Leupin W, et al. Homeodomain-DNA recognition. Cell. 1994;78(2):211-223. doi:10.1016/0092-8674(94)90292-5. 286. Hjalt TA, Semina E V., Amendt BA, Murray JC. The Pitx2 protein in mouse development. Dev Dyn. 2000;218(1):195-200. doi:10.1002/(SICI)1097- 0177(200005)218:1<195::AID-DVDY17>3.0.CO;2-C. 287. Waite MR, Skidmore JM, Micucci JA, Shiratori H, Hamada H, Martin JF, Martin DM. Pleiotropic and isoform-specific functions for Pitx2 in superior colliculus and hypothalamic neuronal development. Mol Cell Neurosci. 2013;52:128- 139. doi:10.1016/j.mcn.2012.11.007. 288. Quentien M-H, Vieira V, Menasche M, Dufier J-L, Herman J-P, Enjalbert A, Abitbol M, Brue T. Truncation of PITX2 differentially affects its activity on
120 physiological targets. J Mol Endocrinol. 2011;46(1):9-19. doi:10.1677/JME- 10-0063. 289. Cox CJ, Espinoza HM, McWilliams B, Chappell K, Morton L, Hjalt TA, Semina E V, Amendt BA. Differential regulation of gene expression by PITX2 isoforms. J Biol Chem. 2002;277(28):25001-25010. doi:10.1074/jbc.M201737200. 290. Quentien M-H, Pitoia F, Gunz G, Guillet M-P, Enjalbert A, Pellegrini I. Regulation of prolactin, GH, and Pit-1 gene expression in anterior pituitary by Pitx2: An approach using Pitx2 mutants. Endocrinology. 2002;143(8):2839- 2851. doi:10.1210/endo.143.8.8962. 291. Suh H, Gage PJ, Drouin J, Camper SA. Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification. Development. 2002;129(2):329-337. doi:10.1016/0888- 7543(90)90050-5. 292. Amendt BA, Sutherland LB, Russo AF. Multifunctional Role of the Pitx2 Homeodomain Protein C-Terminal Tail. Mol Cell Biol. 1999;19(10):7001- 7010. doi:10.1128/MCB.19.10.7001. 293. Campione M, Steinbeisser H, Schweickert A, Deissler K, van Bebber F, Lowe LA, Nowotschin S, Viebahn C, Haffter P, Kuehn MR, Blum M, Biben C, Harvey RP, et al. The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development. 1999;126(6):1225-1234. doi:10.1101/gad.11.11.1357. 294. Yoshioka H, Meno C, Koshiba K, Sugihara M, Itoh H, Ishimaru Y, Inoue T, Ohuchi H, Semina E V, Murray JC, Hamada H, Noji S. Pitx2, a Bicoid-Type Homeobox Gene, Is Involved in a Lefty-Signaling Pathway in Determination of Left-Right Asymmetry. Cell. 1998;94(3):299-305. doi:10.1016/S0092- 8674(00)81473-7. 295. Shiratori H, Yashiro K, Shen MM, Hamada H. Conserved regulation and role of Pitx2 in situs-specific morphogenesis of visceral organs. Development. 2006;133(15):3015-3025. doi:10.1242/dev.02470. 296. Schweickert A, Campione M, Steinbeisser H, Blum M. Pitx2 isoforms: involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left–right asymmetry. Mech Dev. 2000;90(1):41-51. doi:10.1016/S0925- 4773(99)00227-0. 297. Belmonte JCI, Ryan AK, Blumberg B, Rodriguez-Esteban C, Yonei-Tamura S, Tamura K, Tsukui T, de la Peña J, Sabbagh W, Greenwald J, Choe S, Norris DP, Robertson EJ, et al. Pitx2 determines left|[ndash]|right asymmetry of internal organs in vertebrates. Nature. 1998;394(6693):545-551. doi:10.1038/29004. 298. Schweickert A, Campione M, Steinbeisser H, Blum M. Pitx2 isoforms: involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left–right asymmetry. Mech Dev. 2000;90(1):41-51. doi:10.1016/S0925- 4773(99)00227-0. 299. Ganga M, Espinoza HM, Cox CJ, Morton L, Hjalt TA, Lee Y, Amendt BA. PITX2 Isoform-specific Regulation of Atrial Natriuretic Factor Expression: SYNERGISM AND REPRESSION WITH Nkx2.5. J Biol Chem. 2003;278(25):22437-22445. doi:10.1074/jbc.M210163200. 300. Mommersteeg MTM, Brown NA, Prall OWJ, de Gier-de Vries C, Harvey RP,
121 Moorman AFM, Christoffels VM. Pitx2c and Nkx2-5 Are Required for the Formation and Identity of the Pulmonary Myocardium. Circ Res. 2007;101(9):902-909. doi:10.1161/CIRCRESAHA.107.161182. 301. Boldt L-H, Posch MG, Perrot A, Polotzki M, Rolf S, Parwani AS, Huemer M, Wutzler A, Özcelik C, Haverkamp W. Mutational Analysis of the PITX2 and NKX2-5 Genes in Patients with Idiopathic Atrial Fibrillation. Vol 145.; 2010. doi:10.1016/j.ijcard.2009.11.023. 302. McCulley DJ, Black BL. Transcription factor pathways and congenital heart disease. Curr Top Dev Biol. 2012;100:253-277. doi:10.1016/B978-0-12- 387786-4.00008-7. 303. Ganga M, Espinoza HM, Cox CJ, Morton L, Hjalt TA, Lee Y, Amendt BA. PITX2 isoform-specific regulation of atrial natriuretic factor expression: synergism and repression with Nkx2.5. J Biol Chem. 2003;278(25):22437-22445. doi:10.1074/jbc.M210163200. 304. Huang Y, Guigon CJ, Fan J, Cheng S, Zhu G-Z. Pituitary homeobox 2 (PITX2) promotes thyroid carcinogenesis by activation of cyclin D2. Cell Cycle. 2010;9(7):1333-1341. doi:10.4161/cc.9.7.11126. 305. Dietrich D, Hasinger O, Liebenberg V, Field JK, Kristiansen G, Soltermann A. DNA methylation of the homeobox genes PITX2 and SHOX2 predicts outcome in non-small-cell lung cancer patients. Diagn Mol Pathol. 2012;21(2):93-104. doi:10.1097/PDM.0b013e318240503b. 306. Zhang J-X, Tong Z-T, Yang L, Wang F, Chai H-P, Zhang F, Xie M-R, Zhang A-L, Wu L-M, Hong H, Yin L, Wang H, Wang H-Y, et al. PITX2: A promising predictive biomarker of patients’ prognosis and chemoradioresistance in esophageal squamous cell carcinoma. Int J Cancer. 2013;132(11):2567-2577. doi:10.1002/ijc.27930. 307. Vela I, Morrissey C, Zhang X, Chen S, Corey E, Strutton GM, Nelson CC, Nicol DL, Clements JA, Gardiner EM. PITX2 and non-canonical Wnt pathway interaction in metastatic prostate cancer. Clin Exp Metastasis. 2014;31(2):199-211. doi:10.1007/s10585-013-9620-7. 308. Hirose H, Ishii H, Mimori K, Tanaka F, Takemasa I, Mizushima T, Ikeda M, Yamamoto H, Sekimoto M, Doki Y, Mori M. The significance of PITX2 overexpression in human colorectal cancer. Ann Surg Oncol. 2011;18(10):3005-3012. doi:10.1245/s10434-011-1653-z. 309. Zhang J-X, Tong Z-T, Yang L, Wang F, Chai H-P, Zhang F, Xie M-R, Zhang A-L, Wu L-M, Hong H, Yin L, Wang H, Wang H-Y, et al. PITX2: a promising predictive biomarker of patients’ prognosis and chemoradioresistance in esophageal squamous cell carcinoma. Int J cancer. 2013;132(11):2567-2577. doi:10.1002/ijc.27930. 310. Basu M, Bhattacharya R, Ray U, Mukhopadhyay S, Chatterjee U, Roy SS. Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A. Mol Cancer. 2015;14:162. doi:10.1186/s12943-015- 0433-y. 311. Lee W-K, Chakraborty PK, Thévenod F. Pituitary homeobox 2 (PITX2) protects renal cancer cell lines against doxorubicin toxicity by transcriptional activation of the multidrug transporter ABCB1. Int J cancer. 2013;133(3):556-
122 567. doi:10.1002/ijc.28060. 312. Basu M, Roy SS. Wnt/ -Catenin Pathway Is Regulated by PITX2 Homeodomain Protein and Thus Contributes to the Proliferation of Human Ovarian Adenocarcinoma Cell, SKOV-3. J Biol Chem. 2013;288(6):4355-4367. doi:10.1074/jbc.M112.409102. 313. Baek SH, Kioussi C, Briata P, Wang D, Nguyen HD, Ohgi KA, Glass CK, Wynshaw-Boris A, Rose DW, Rosenfeld MG. Regulated subset of G1 growth- control genes in response to derepression by the Wnt pathway. Proc Natl Acad Sci U S A. 2003;100(6):3245-3250. doi:10.1073/pnas.0330217100. 314. Fung FKC, Chan DW, Liu VWS, Leung THY, Cheung ANY, Ngan HYS, Singh A, Senapati S, Ponnusamy M, Jain M, Lele S, Auersperg N, Maines-Bandiera S, et al. Increased Expression of PITX2 Transcription Factor Contributes to Ovarian Cancer Progression. Wang Q, ed. PLoS One. 2012;7(5):e37076. doi:10.1371/journal.pone.0037076. 315. Lozano-Velasco E, Chinchilla A, Martínez-Fernández S, Hernández-Torres F, Navarro F, Lyons GE, Franco D, Aránega AE. Pitx2c modulates cardiac-specific transcription factors networks in differentiating cardiomyocytes from murine embryonic stem cells. Cells Tissues Organs. 2011;194(5):349-362. doi:10.1159/000323533. 316. Hayashi S, Inoue A. Cardiomyocytes re-enter the cell cycle and contribute to heart development after differentiation from cardiac progenitors expressing Isl1 in chick embryo. Dev Growth Differ. 2007;49(3):229-239. doi:10.1111/j.1440-169X.2007.00923.x. 317. Heldring N, Joseph B, Hermanson O, Kioussi C. Pitx2 expression promotes p21 expression and cell cycle exit in neural stem cells. CNS Neurol Disord Drug Targets. 2012;11(7):884-892. http://www.ncbi.nlm.nih.gov/pubmed/23131154. Accessed August 5, 2016. 318. Kioussi C, Briata P, Baek SH, Rose DW, Hamblet NS, Herman T, Ohgi KA, Lin C, Gleiberman A, Wang J, Brault V, Ruiz-Lozano P, Nguyen HD, et al. Identification of a Wnt/Dvl/beta-Catenin --> Pitx2 pathway mediating cell- type-specific proliferation during development. Cell. 2002;111(5):673-685. doi:10.1016/s0092-8674(02)01084-x. 319. Vadlamudi U, Espinoza HM, Ganga M, Martin DM, Liu X, Engelhardt JF, Amendt BA. PITX2, beta-catenin and LEF-1 interact to synergistically regulate the LEF- 1 promoter. J Cell Sci. 2005;118(Pt 6):1129-1137. doi:10.1242/jcs.01706. 320. Hilton T, Gross MK, Kioussi C. Pitx2-dependent occupancy by histone deacetylases is associated with T-box gene regulation in mammalian abdominal tissue. J Biol Chem. 2010;285(15):11129-11142. doi:10.1074/jbc.M109.087429. 321. Venugopalan SR, Amen MA, Wang J, Wong L, Cavender AC, D’Souza RN, Akerlund M, Brody SL, Hjalt TA, Amendt BA. Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis. Hum Mol Genet. 2008;17(23):3643-3654. doi:10.1093/hmg/ddn258. 322. Abu-Elmagd M, Robson L, Sweetman D, Hadley J, Francis-West P, Münsterberg A. Wnt/Lef1 signaling acts via Pitx2 to regulate somite myogenesis. Dev Biol. 2010;337(2):211-219. doi:10.1016/j.ydbio.2009.10.023.
123 323. Zacharias AL, Gage PJ. Canonical Wnt/β-catenin signaling is required for maintenance but not activation of Pitx2 expression in neural crest during eye development. Dev Dyn. 2010;239(12):3215-3225. doi:10.1002/dvdy.22459. 324. Davis SW, Mortensen AH, Keisler JL, Zacharias AL, Gage PJ, Yamamura K, Camper SA, Northcutt RG, Northcutt R, Gans C, Steventon B, Mayor R, Streit A, et al. β-catenin is required in the neural crest and mesencephalon for pituitary gland organogenesis. BMC Dev Biol. 2016;16(1):16. doi:10.1186/s12861-016- 0118-9. 325. Ishitani S, Inaba K, Matsumoto K, Ishitani T. Homodimerization of Nemo-like kinase is essential for activation and nuclear localization. Mol Biol Cell. 2011;22(2):266-277. doi:10.1091/mbc.E10-07-0605. 326. Zhang M, Mahoney E, Zuo T, Manchanda PK, Davuluri R V., Kirschner LS, Siddappa R, Mulder W, Steeghs I, Klundert C van de, Fernandes H, Westendorf J, Kahler R, et al. Protein Kinase A Activation Enhances β-Catenin Transcriptional Activity through Nuclear Localization to PML Bodies. Kelly GM, ed. PLoS One. 2014;9(10):e109523. doi:10.1371/journal.pone.0109523. 327. Hino S, Tanji C, Nakayama KI, Kikuchi A. Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase stabilizes beta-catenin through inhibition of its ubiquitination. Mol Cell Biol. 2005;25(20):9063-9072. doi:10.1128/MCB.25.20.9063-9072.2005. 328. Huang W, Zhou W, Saberwal G, Konieczna I, Horvath E, Katsoulidis E, Platanias LC, Eklund EA. Interferon consensus sequence binding protein (ICSBP) decreases beta-catenin activity in myeloid cells by repressing GAS2 transcription. Mol Cell Biol. 2010;30(19):4575-4594. doi:10.1128/MCB.01595-09. 329. Benetti R, Copetti T, Dell’Orso S, Melloni E, Brancolini C, Monte M, Schneider C. The calpain system is involved in the constitutive regulation of beta-catenin signaling functions. J Biol Chem. 2005;280(23):22070-22080. doi:10.1074/jbc.M501810200. 330. Patmore DM. In vivo regulation of TGF[beta] by R-Ras2 revealed through loss of the RasGAP protein Nf1. Cancer Res. 2012;72:5317-5327. http://dx.doi.org/10.1158/0008-5472.CAN-12-1972. 331. Zhang J, Shemezis JR, McQuinn ER, Wang J, Sverdlov M, Chenn A, Gotz M, Huttner W, Fietz S, Huttner W, Zhang J, Woodhead G, Swaminathan S, et al. AKT activation by N-cadherin regulates beta-catenin signaling and neuronal differentiation during cortical development. Neural Dev. 2013;8(1):7. doi:10.1186/1749-8104-8-7. 332. Nakata A, Yoshida R, Yamaguchi R, Yamauchi M, Tamada Y, Fujita A, Shimamura T, Imoto S, Higuchi T, Nomura M, Kimura T, Nokihara H, Higashiyama M, et al. Elevated β-catenin pathway as a novel target for patients with resistance to EGF receptor targeting drugs. Sci Rep. 2015;5:13076. doi:10.1038/srep13076. 333. Stauffer JK, Scarzello AJ, Andersen JB, De Kluyver RL, Back TC, Weiss JM, Thorgeirsson SS, Wiltrout RH. Coactivation of AKT and β-catenin in mice rapidly induces formation of lipogenic liver tumors. Cancer Res. 2011;71(7):2718-2727. doi:10.1158/0008-5472.CAN-10-2705.
124 334. Momeni HR. Role of calpain in apoptosis. Cell J. 2011;13(2):65-72. http://www.ncbi.nlm.nih.gov/pubmed/23507938. Accessed August 8, 2016. 335. Fung FKC, Chan DW, Liu VWS, Leung THY, Cheung ANY, Ngan HYS. Increased expression of PITX2 transcription factor contributes to ovarian cancer progression. PLoS One. 2012;7(5):e37076. doi:10.1371/journal.pone.0037076. 336. Huang C-J, Lee C-L, Yang S-H, Chien C-C, Huang C-C, Yang R-N, Chang C-C. Upregulation of the growth arrest-specific-2 in recurrent colorectal cancers, and its susceptibility to chemotherapy in a model cell system. Biochim Biophys Acta. 2016;1862(7):1345-1353. doi:10.1016/j.bbadis.2016.04.010. 337. Amen M, Liu X, Vadlamudi U, Elizondo G, Diamond E, Engelhardt JF, Amendt BA. PITX2 and -Catenin Interactions Regulate Lef-1 Isoform Expression. Mol Cell Biol. 2007;27(21):7560-7573. doi:10.1128/MCB.00315-07. 338. MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009;17(1):9-26. doi:10.1016/j.devcel.2009.06.016. 339. Liu W, Dong X, Mai M, Seelan RS, Taniguchi K, Krishnadath KK, Halling KC, Cunningham JM, Boardman LA, Qian C, Christensen E, Schmidt SS, Roche PC, et al. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating beta-catenin/TCF signalling. Nat Genet. 2000;26(2):146- 147. doi:10.1038/79859. 340. Satoh S, Daigo Y, Furukawa Y, Kato T, Miwa N, Nishiwaki T, Kawasoe T, Ishiguro H, Fujita M, Tokino T, Sasaki Y, Imaoka S, Murata M, et al. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat Genet. 2000;24(3):245-250. doi:10.1038/73448. 341. Lee J, Kim M-S. The role of GSK3 in glucose homeostasis and the development of insulin resistance. Diabetes Res Clin Pract. 2007;77 Suppl 1:S49-S57. doi:10.1016/j.diabres.2007.01.033. 342. Shin S, Wolgamott L, Tcherkezian J, Vallabhapurapu S, Yu Y, Roux PP, Yoon S- O. Glycogen synthase kinase-3β positively regulates protein synthesis and cell proliferation through the regulation of translation initiation factor 4E-binding protein 1. Oncogene. 2014;33(13):1690-1699. doi:10.1038/onc.2013.113. 343. Tenbaum SP, Ordóñez-Morán P, Puig I, Chicote I, Arqués O, Landolfi S, Fernández Y, Herance JR, Gispert JD, Mendizabal L, Aguilar S, Cajal SR y, Schwartz S, et al. β-catenin confers resistance to PI3K and AKT inhibitors and subverts FOXO3a to promote metastasis in colon cancer. Nat Med. 2012;18(6):892-901. doi:10.1038/nm.2772. 344. Clements WM, Wang J, Sarnaik A, Kim OJ, MacDonald J, Fenoglio-Preiser C, Groden J, Lowy AM. beta-Catenin mutation is a frequent cause of Wnt pathway activation in gastric cancer. Cancer Res. 2002;62(12):3503-3506. doi:10.1126/science.275.5307.1790. 345. Austinat M, Dunsch R, Wittekind C, Tannapfel A, Gebhardt R, Gaunitz F, Bruix J, Hessheimer A, Forner A, Boix L, Vilana R, Llovet J, Buendia M, et al. Correlation between β-catenin mutations and expression of Wnt-signaling target genes in hepatocellular carcinoma. Mol Cancer. 2008;7(1):21.
125 doi:10.1186/1476-4598-7-21. 346. Wang L, Shalek AK, Lawrence M, Ding R, Gaublomme JT, Pochet N, Stojanov P, Sougnez C, Shukla SA, Stevenson KE, Zhang W, Wong J, Sievers QL, et al. Somatic mutation as a mechanism of Wnt/β-catenin pathway activation in CLL. Blood. 2014;124(7):1089-1098. doi:10.1182/blood-2014-01-552067. 347. Thompson M, Nejak-Bowen K, Monga SPS. Crosstalk of the Wnt Signaling Pathway. In: Targeting the Wnt Pathway in Cancer. New York, NY: Springer New York; 2011:51-80. doi:10.1007/978-1-4419-8023-6_4. 348. Morris S-AL, Huang S. Crosstalk of the Wnt/β-catenin pathway with other pathways in cancer cells. Genes Dis. 2016;3(1):41-47. doi:10.1016/j.gendis.2015.12.003. 349. Zeller E, Hammer K, Kirschnick M, Braeuning A. Mechanisms of RAS/β-catenin interactions. Arch Toxicol. 2013;87(4):611-632. doi:10.1007/s00204-013- 1035-3. 350. Song L, Li Z-Y, Liu W-P, Zhao M-R. Crosstalk between Wnt/β-catenin and Hedgehog/Gli signaling pathways in colon cancer and implications for therapy. Cancer Biol Ther. 2015;16(1):1-7. doi:10.4161/15384047.2014.972215. 351. Pearson HB, Phesse TJ, Clarke AR. K-ras and Wnt signaling synergize to accelerate prostate tumorigenesis in the mouse. Cancer Res. 2009;69(1):94- 101. doi:10.1158/0008-5472.CAN-08-2895. 352. Ahmad I, Patel R, Liu Y, Singh LB, Taketo MM, Wu X-R, Leung HY, Sansom OJ. Ras mutation cooperates with β-catenin activation to drive bladder tumourigenesis. Cell Death Dis. 2011;2:e124. doi:10.1038/cddis.2011.7. 353. Delmas V, Beermann F, Martinozzi S, Carreira S, Ackermann J, Kumasaka M, Denat L, Goodall J, Luciani F, Viros A, Demirkan N, Bastian BC, Goding CR, et al. Beta-catenin induces immortalization of melanocytes by suppressing p16INK4a expression and cooperates with N-Ras in melanoma development. Genes Dev. 2007;21(22):2923-2935. doi:10.1101/gad.450107. 354. Damsky WE, Curley DP, Santhanakrishnan M, Rosenbaum LE, Platt JT, Gould Rothberg BE, Taketo MM, Dankort D, Rimm DL, McMahon M, Bosenberg M. β- catenin signaling controls metastasis in Braf-activated Pten-deficient melanomas. Cancer Cell. 2011;20(6):741-754. doi:10.1016/j.ccr.2011.10.030. 355. Mologni L, Brussolo S, Ceccon M, Gambacorti-Passerini C, Kantarjian H, Sawyers C, Hochhaus A, Guilhot F, Schiffer C, Oxnard G, Miller V, Sharma S, Settleman J, et al. Synergistic Effects of Combined Wnt/KRAS Inhibition in Colorectal Cancer Cells. Hotchin NA, ed. PLoS One. 2012;7(12):e51449. doi:10.1371/journal.pone.0051449. 356. Vilchez V, Turcios L, Marti F, Gedaly R. Targeting Wnt/β-catenin pathway in hepatocellular carcinoma treatment. World J Gastroenterol. 2016;22(2):823- 832. doi:10.3748/wjg.v22.i2.823. 357. Galuppo R, Maynard E, Shah M, Daily MF, Chen C, Spear BT, Gedaly R. Synergistic inhibition of HCC and liver cancer stem cell proliferation by targeting RAS/RAF/MAPK and WNT/β-catenin pathways. Anticancer Res. 2014;34(4):1709-1713. http://www.ncbi.nlm.nih.gov/pubmed/24692700. Accessed September 13, 2016.
126 358. Rowan AJ, Lamlum H, Ilyas M, Wheeler J, Straub J, Papadopoulou A, Bicknell D, Bodmer WF, Tomlinson IP. APC mutations in sporadic colorectal tumors: A mutational "hotspot" and interdependence of the "two hits". Proc Natl Acad Sci U S A. 2000;97(7):3352-3357. doi:10.1073/pnas.97.7.3352. 359. Fodde R. The APC gene in colorectal cancer. Eur J Cancer. 2002;38(7):867- 871. doi:10.1016/S0959-8049(02)00040-0. 360. Phipps AI, Buchanan DD, Makar KW, Win AK, Baron JA, Lindor NM, Potter JD, Newcomb PA. KRAS-mutation status in relation to colorectal cancer survival: the joint impact of correlated tumour markers. Br J Cancer. 2013;108(8):1757-1764. doi:10.1038/bjc.2013.118. 361. Rojas M, Yao S, Lin Y-Z. Controlling Epidermal Growth Factor (EGF)- stimulated Ras Activation in Intact Cells by a Cell-permeable Peptide Mimicking Phosphorylated EGF Receptor. J Biol Chem. 1996;271(44):27456- 27461. doi:10.1074/jbc.271.44.27456. 362. Margolis B, Skolnik EY. Activation of Ras by receptor tyrosine kinases. J Am Soc Nephrol. 1994;5(6):1288-1299. http://www.ncbi.nlm.nih.gov/pubmed/7893993. Accessed September 13, 2016. 363. Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell J. Receptor Tyrosine Kinases and Ras. 2000. 364. Paul I, Bhattacharya S, Chatterjee A, Ghosh MK. Current Understanding on EGFR and Wnt/β-Catenin Signaling in Glioma and Their Possible Crosstalk. Genes Cancer. 2013;4(11-12):427-446. doi:10.1177/1947601913503341. 365. Hu T, Li C. Convergence between Wnt-β-catenin and EGFR signaling in cancer. Mol Cancer. 2010;9:236. doi:10.1186/1476-4598-9-236. 366. Halleskog C, Schulte G. Pertussis toxin-sensitive heterotrimeric Gαi/o proteins mediate WNT/β-catenin and WNT/ERK1/2 signaling in mouse primary microglia stimulated with purified WNT-3A. Cell Signal. 2013;25(4):822-828. doi:10.1016/j.cellsig.2012.12.006. 367. Faivre EJ, Lange CA. Progesterone receptors upregulate Wnt-1 to induce epidermal growth factor receptor transactivation and c-Src-dependent sustained activation of Erk1/2 mitogen-activated protein kinase in breast cancer cells. Mol Cell Biol. 2007;27(2):466-480. doi:10.1128/MCB.01539-06. 368. Civenni G, Holbro T, Hynes NE. Wnt1 and Wnt5a induce cyclin D1 expression through ErbB1 transactivation in HC11 mammary epithelial cells. EMBO Rep. 2003;4(2):166-171. doi:10.1038/sj.embor.embor735. 369. Musgrove EA. Wnt signalling via the epidermal growth factor receptor: a role in breast cancer? Breast Cancer Res. 2004;6(2):65-68. doi:10.1186/bcr737. 370. Krejci P, Aklian A, Kaucka M, Sevcikova E, Prochazkova J, Masek JK, Mikolka P, Pospisilova T, Spoustova T, Weis M, Paznekas WA, Wolf JH, Gutkind JS, et al. Receptor tyrosine kinases activate canonical WNT/β-catenin signaling via MAP kinase/LRP6 pathway and direct β-catenin phosphorylation. PLoS One. 2012;7(4):e35826. doi:10.1371/journal.pone.0035826. 371. Ji H, Wang J, Nika H, Hawke D, Keezer S, Ge Q, Fang B, Fang X, Fang D, Litchfield DW, Aldape K, Lu Z. EGF-induced ERK activation promotes CK2-
127 mediated disassociation of alpha-Catenin from beta-Catenin and transactivation of beta-Catenin. Mol Cell. 2009;36(4):547-559. doi:10.1016/j.molcel.2009.09.034. 372. Li J, Li X, Qian J, Lu X, Yang H. [Effects of K-ras gene mutation on colon cancer cell line Caco-2 metastasis by regulating E-cadherin/beta-catenin/p120 protein complex formation and RhoA protein activity]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2010;32(1):46-50. doi:10.3881/j.issn.1000- 503X.2010.01.012. 373. Stambolic V, Woodgett JR. Mitogen inactivation of glycogen synthase kinase-3 beta in intact cells via serine 9 phosphorylation. Biochem J. November 1994:701-704. http://www.ncbi.nlm.nih.gov/pubmed/7980435. Accessed September 13, 2016. 374. Li J, Mizukami Y, Zhang X, Jo W-S, Chung DC. Oncogenic K-ras stimulates Wnt signaling in colon cancer through inhibition of GSK-3beta. Gastroenterology. 2005;128(7):1907-1918. http://www.ncbi.nlm.nih.gov/pubmed/15940626. Accessed September 13, 2016. 375. Takahashi-Yanaga F, Shiraishi F, Hirata M, Miwa Y, Morimoto S, Sasaguri T. Glycogen synthase kinase-3beta is tyrosine-phosphorylated by MEK1 in human skin fibroblasts. Biochem Biophys Res Commun. 2004;316(2):411- 415. doi:10.1016/j.bbrc.2004.02.061. 376. Götschel F, Kern C, Lang S, Sparna T, Markmann C, Schwager J, McNelly S, von Weizsäcker F, Laufer S, Hecht A, Merfort I. Inhibition of GSK3 differentially modulates NF-kappaB, CREB, AP-1 and beta-catenin signaling in hepatocytes, but fails to promote TNF-alpha-induced apoptosis. Exp Cell Res. 2008;314(6):1351-1366. doi:10.1016/j.yexcr.2007.12.015. 377. Ding Q, Xia W, Liu J-C, Yang J-Y, Lee D-F, Xia J, Bartholomeusz G, Li Y, Pan Y, Li Z, Bargou RC, Qin J, Lai C-C, et al. Erk associates with and primes GSK-3beta for its inactivation resulting in upregulation of beta-catenin. Mol Cell. 2005;19(2):159-170. doi:10.1016/j.molcel.2005.06.009. 378. Guha A, Lau N, Huvar I, Gutmann D, Provias J, Pawson T, Boss G. Ras-GTP levels are elevated in human NF1 peripheral nerve tumors. Oncogene. 1996;12(3):507-513. http://www.ncbi.nlm.nih.gov/pubmed/8637706. Accessed September 13, 2016.
128