Is a Recurrent Abnormality in Chronic and Acute Leukemia That Fuses PCM1 to JAK2

Research Article

The t(8;9)(p22;p24) Is a Recurrent Abnormality in Chronic and Acute Leukemia that Fuses PCM1 to JAK2

Andreas Reiter,1 Christoph Walz,1 Ann Watmore,2 Claudia Schoch,3 Ilona Blau,4 Brigitte Schlegelberger,5 Ute Berger,1 Nick Telford,6 Shilani Aruliah,7 John A. Yin,8 Danny Vanstraelen,9 Helen F. Barker,10 Peter C. Taylor,10 Aisling O’Driscoll,11 Fabio Benedetti,12 Cornelia Rudolph,5 Hans-Jochem Kolb,3 Andreas Hochhaus,1 Ru¨diger Hehlmann,1 Andrew Chase,13,14 and Nicholas C.P. Cross13,14

1III. Medizinische Universita¨tsklinik, Fakulta¨tfu¨r Klinische Medizin Mannheim der Universita¨tHeidelberg, Mannheim, Germany; 2North Trent Cytogenetics Service, Sheffield Children’s Hospital, Sheffield, United Kingdom; 3Labor fu¨r spezielle Leuka¨miediagnostik and Medizinische Klinik III, Klinikum Grohhadern, Ludwig-Maximilians-Universita¨t, Munich, Germany; 4Ha¨matologisch-onkologische Schwerpunktpraxis, Berlin, Germany; 5Medizinische Hochschule Hannover, Hannover, Germany; 6Oncology Cytogenetics Service, Christie Hospital, Manchester, United Kingdom; 7Cytogenetics Laboratory, Mayday University Hospital, Croydon, United Kingdom; 8University Department of Haematology, Manchester Royal Infirmary, Manchester, United Kingdom; 9Department of Haematology and Oncology, Virga Jesse Hospital, Hasselt, Belgium; 10Department of Haematology, Rotherham General Hospital, Rotherham, United Kingdom; 11Department of Haematology, Worthing Hospital, Worthing, United Kingdom; 12Centro Trapianto Midollo Osseo, Azienda Ospedaliera di Verona, Verona, Italy; 13Wessex Regional Genetics Laboratory, Salisbury District Hospital, Salisbury, United Kingdom; and 14Human Genetics Division, University of Southampton, Southampton, United Kingdom

Abstract hematologic and complete cytogenetic responses in the great We have identified a t(8;9)(p21-23;p23-24) in seven male majority of CML patients (1). patients (mean age 50, range 32-74) with diverse hematologic Patients with clinical characteristics of CML who lack the Ph malignancies and clinical outcomes: atypical chronic myeloid chromosome and/or the BCR-ABL fusion gene are usually leukemia/chronic eosinophilic leukemia (n = 5), secondary referred to as having atypical CML. In many cases, the acute myeloid leukemia (n = 1), and pre-B-cell acute hematologic features overlap with other recognized subtypes of lymphoblastic leukemia (n = 1). Initial fluorescence in situ chronic myeloproliferative disease or myelodysplastic/myelopro- hybridization studies of one patient indicated that the liferative disorders, particularly chronic eosinophilic leukemia and nonreceptor tyrosine kinase Janus-activated kinase 2 (JAK2) chronic myelomonocytic leukemia. The molecular pathogenesis of at 9p24 was disrupted. Rapid amplification of cDNA ends-PCR these BCR-ABL–negative diseases is largely unknown, but analysis identified the 8p22 partner gene as human autoantigen of the small proportion of affected individuals who present with pericentriolar material (PCM1), a gene encoding a large acquired reciprocal chromosomal translocations has revealed centrosomal protein with multiple coiled-coil domains. diverse tyrosine kinase fusion genes, most commonly involving Reverse transcription-PCR and fluorescence in situ hybridi- the receptors FGFR1, PDGFRA,orPDGFRB (2–11). zation confirmed the fusion in this case and also identified These fusions are believed to deregulate hematopoiesis in a PCM1–JAK2 in the six other t(8;9) patients. The breakpoints manner analogous to BCR-ABL and, consequently, it is anticipat- were variable in both genes, but in all cases the chimeric ed that affected patients may be amenable to treatment by mRNA is predicted to encode a protein that retains several of targeted signal transduction therapy. Indeed, PDGFRA and the predicted coiled-coil domains from PCM1 and the entire PDGFRB are sensitive to imatinib and patients with fusions tyrosine kinase domain of JAK2. Reciprocal JAK2–PCM1 involving the genes encoding these receptors usually exhibit mRNA was not detected in any patient. We conclude that dramatic responses to imatinib treatment (11, 12). human autoantigen pericentriolar material (PCM1)–JAK2 is a We report here five patients with CML-like disorders and two novel, recurrent fusion gene in hematologic malignancies. patients with acute leukemia in association with an acquired Patients with PCM1–JAK2 disease are attractive candidates t(8;9)(p21-23;p23-p24). We show that the translocation fuses the for targeted signal transduction therapy. (Cancer Res 2005; human autoantigen pericentriolar material (PCM1) gene to the 65(7): 2662-7) Janus-activated kinase 2 (JAK2) gene in all seven cases, further substantiating the hypothesis that deregulated tyrosine kinases play a major role in the pathogenesis of atypical CML and related Introduction myeloproliferative disorders. The diagnosis of chronic myeloid leukemia (CML) is based on specific clinical and hematologic features in combination with the presence of the Philadelphia-chromosome (Ph) and/or the BCR- Materials and Methods ABL fusion. The constitutive tyrosine kinase activity of the BCR- Case Reports ABL oncoprotein is selectively inhibited by imatinib mesylate, Case 1. A 54-year-old male presented with splenomegaly and marked which has recently been shown to induce high rates of complete pancytopenia. The bone marrow showed extensive myelofibrosis with numerous islands of blast cells. Cytogenetic analysis revealed a t(8;9)(p23;p24). A diagnosis of blastic transformation of myelofibrosis Requests for reprints: Andreas Reiter, M.D. III. Medizinische Universita¨tsklinik, was made. The patient achieved complete hematologic remission after Fakulta¨t fu¨r Klinische Medizin Mannheim der Universita¨tHeidelberg, Wiesbadener several courses of intensive chemotherapy. One year after diagnosis, IFN-a Str. 7-11, 68305 Mannheim, Germany. Phone: 49-621-383-4115; Fax: 49-621-383-4201; E-mail: [email protected]. was commenced and continued for 6 years without achievement of a I2005 American Association for Cancer Research. cytogenetic response. The patient remains off treatment in complete

Cancer Res 2005; 65: (7). April 1, 2005 2662 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. PCM1-JAK2 in Leukemia hematologic remission but with a slightly enlarged spleen 15 years after were PCM25/1+: 5V-CCATGTTTGAAGCTTTGCGAGATA-3V, PCM25/2+: 5V- diagnosis. CTCTTCCATGAGCTGCAGCTAC-3V; PCM28/1+: 5V-GAGCGTATGAAGACT- Case 2. A 47-year-old male was diagnosed with chronic eosinophilic GAGGCTG-3V, PCM28/2+: 5V-GTGCTGGTGCAGGTACTACAGT-3V; PCM35/ leukemia due to splenomegaly, marked eosinophilia, and myeloid 1+: 5V-AGTGCTGCCCATAAGGAGTCAC-3V or PCM35/2+: 5V-GGAACCCT- precursors in the peripheral blood. Bone marrow histology revealed TAGTGCCTAGAGTC-3V in combination with JAK2/1À: GCCTGGTTGACT- hyperplasia, myelofibrosis plus marked eosinophilia, and cytogenetic CATCTATATGG, JAK2/2À: GGTTGGGTGGATACCAGATCCT; JAK9/1À: analysis showed a translocation t(8;9)(p22;p23). A progressive debilitating 5V-GGCTTTGGGGGACAGCATTTAG-3V or JAK9/2À:5V-GAGCGAACAG- cerebellar syndrome developed shortly after diagnosis owing to TTTCCATCTGGTA-3V. Primers used to search for reciprocal JAK2-PCM1 olivopontocerebellar degeneration. The patient achieved a major fusion transcripts are not shown but are available on request. All cytogenetic response on treatment with IFN. Unfortunately, the cerebellar amplification reactions were done for 32 cycles with an annealing symptoms worsened and he ultimately developed pneumonia. He died of temperature of 60jC. respiratory failure 7.5 years after diagnosis of chronic eosinophilic leukemia. Case 3. A 74-year-old male presented with mild eosinophilia. The trephine Results biopsy showed hyperplasia caused by eosinophil precursors and areas of Identification of a novel recurrent cytogenetic abnormality. myelofibrosis. A t(8;9)(p22;p24) was identified by cytogenetic analysis. The We identified seven t(8;9) patients for whom the breakpoints patient was followed for 4 years without any treatment. Six years after assigned by cytogenetics varied from 8p21-23 and 9p23-24, diagnosis, secondary acute myeloid leukemia was diagnosed. Cytogenetic analysis showed duplication of both t(8;9) derivative chromosomes and although in some cases the precise band of breakage was trisomy 4. The patient died 1 month after diagnosis of acute myeloid reported as uncertain. To our knowledge, this translocation has leukemia. not been described before as a recurrent abnormality, although Case 4. A 50-year-old male was referred with anemia and mild one other patient with atypical CML has been described (13) and leukocytosis. A common pre-B acute lymphoblastic leukemia was we have previously reported case 2 as being negative for diagnosed by immunophenotyping. Cytogenetic analysis revealed a rearrangement of FGFR1 at 8p11-12 (14). Five patients presented t(8;9)(p21;p24). On day 32 after start of induction chemotherapy, the with a CML-like disease (atypical CML, chronic eosinophilic patient developed a bilateral pneumonia and died shortly afterward from leukemia, or related disorder), one with acute myeloid leukemia multiorgan failure. secondary to myelofibrosis, and one with pre-B acute lympho- Case 5. A 42-year-old male presented with mild leukocytosis and blastic leukemia. The characteristics of the seven patients are eosinophilia. Bone marrow features resembled CML, but cytogenetic analysis revealed a t(8;9)(p21;p24). An allogeneic stem cell transplantation from a summarized in Table 1. matched unrelated donor was done 1 year after diagnosis. The patient is The t(8;9) disrupts JAK2. Analysis of other acquired trans- currently well in complete remission with only mild graft-versus-host disease locations in CML-like diseases has revealed the presence of of the skin. diverse fusion tyrosine kinases. We, therefore, focused our Case 6. A 72-year-old male presented with massive leukocytosis, analysis on this class of gene, considering as possible candidates anemia, and thrombocytopenia. The differential was consistent with CML, PTK2B at 8p21, BLK at 8p23, and JAK2 at 9p24. FISH analysis but cytogenetics revealed a t(8;9)(p22;p23) plus an ins(1;1)(p34;p36p34). with bacterial artificial chromosome clones closely flanking JAK2 The patient rapidly developed renal failure and died 96 hours after showed a fused signal, as expected for normal chromosome 9, admission. plus a split signal in the majority of cells for three of five cases Case 7. A 32-year-old male was diagnosed with atypical CML in who had fixed cells available for analysis (cases 3, 4, and 6). This association with a t(8;9)(p21;p24). The disease transformed to acute lymphoblastic leukemia 7 months after diagnosis and the patient received strongly suggested that the t(8;9) disrupted JAK2 at least in these an allogeneic stem cell transplantation from a matched unrelated donor 2 individuals. The remaining two patients (cases 1 and 5) both months later. The patient is alive and well 53 months after transplantation showed a fusion signal on the normal chromosome 9, a 3V JAK2 with only mild graft-versus-host disease of the skin. signal on the der(9) but no reciprocal 5V JAK2 signal on the der(8), suggesting a translocation within or close to JAK2 Fluorescence In situ Hybridization accompanied by deletion of upstream sequence. Representative Bacterial artificial chromosome clones for the 5V and 3V regions of JAK2 (RP11-3H3 and RP11-28A9) and bacterial artificial chromosome clones for results from two patients are shown in Fig. 1. the 5V and 3V regions of PCM1 (RP11-49F3 and RP11-3K23) were identified Identification of the partner gene. All fusion tyrosine from http://www.ensembl.org and obtained from the Sanger Institute kinases reported to date share a common structure, with a 5V (Cambridge, United Kingdom). Dual color fluorescence in situ hybridization partner gene fused to a 3V kinase. To identify the partner gene, (FISH) was done according to standard procedures. we, therefore, did 5V-Rapid amplification of cDNA ends-PCR on patient RNA using JAK2 primers selected according to the 5V-Rapid Amplification of cDNA Ends-PCR breakpoints identified elsewhere in cases harboring the ETV6- 5V-Rapid amplification of cDNA ends-PCR was done according to the manufacturer’s instructions (Roche Diagnostics, Mannheim, Germany). JAK2 fusion. The initial analysis was done on case 5, and the Briefly, 1 Ag RNA extracted from peripheral blood leukocytes using the resulting rapid amplification of cDNA products were found to RNeasy system (Qiagen, Hilden, Germany) was reverse transcribed using consist of sequences derived from a known 8p22 gene, human primer JAK14À:5V-CGTCTCCACAGACACATACTCC-3V. Nested PCR was autoantigen pericentriolar material 1 (PCM1; National Center for done with primer JAK13À:5V-CATGCAGTTGACCGTAGTCTCC-3V in the Biotechnology Information reference sequence NM_006197), first step and primer JAK12À:5V-GAGGTTGGTACATCAGAAACACC-3V in fused to JAK2. the second step in conjunction with rapid amplification of cDNA anchor Detection of PCM1-JAK2 by reverse transcription-PCR. primers supplied by the manufacturer. Products were cloned using the Chimeric PCM1-JAK2 fusion transcripts were confirmed by TOPO cloning kit (Invitrogen, Leek, The Netherlands) and sequenced. reverse transcription-PCR (RT-PCR) in case 5 and, in addition, Reverse Transcription-PCR the same fusion was also amplified from five of five other RNA was extracted and reverse transcribed with random hexamers patients (cases 2, 3, 4, 6, and 7) for whom cDNA was available for using standard techniques. Primers used to detect PCM1-JAK2 cDNA analysis (Fig. 2). Four different types of in-frame fusion www.aacrjournals.org 2663 Cancer Res 2005; 65: (7). April 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Cancer Research transcripts were identified (Fig. 3). Three were regular exon to Overall, FISH and/or RT-PCR identified PCM1-JAK2 in all seven exon, in-frame fusions between PCM1 exon 26 and JAK2 exon 7 t(8;9) patients (RT-PCR and FISH, n = 4; RT-PCR only, n = 2; FISH (case 3), PCM1 exon 36 and JAK2 exon 7 (case 2), or PCM1 exon only, n = 1). The finding of gross deletions at the reciprocal 36 and JAK2 exon 9 (cases 5 and 6). An unusual in-frame fusion breakpoint in three of five patients partly explains the absence between PCM1 exon 36 fused to a short 12 bp sequence derived of detectable JAK2-PCM1 transcripts. from PCM1 intron 36 and a truncated JAK2 exon 9 was found in The PCM1-JAK2 fusion protein. The PCM1-JAK2 fusion gene case 4. Transcripts with a similar structure have been reported is predicted to encode a protein of 257 to 310 kDa, depending for BCR-PDGFRA and FIP1L1-PDGFRA (8, 11) and arise from one on the positions of the breakpoints that contain the coding of the translocation breakpoints falling within an exon rather sequence for up to 96% of PCM1 and up to 61% of JAK2.PCM1is than an intron. No material was available from the time of predicted to contain multiple high probability coiled-coil domains diagnosis for case 7; however, residual PCM1-JAK2 fusion (Coils v2.1; http://www.ch.embnet.org/software/COILS_form.html; transcripts could be amplified by nested RT-PCR after the ref. 15), all of which are retained in the fusion. The predicted patient had undergone allogeneic hemopoietic stem cell trans- structure of PCM1-JAK2 is shown on Fig. 4. plantation. Two transcripts were detected with fusions between PCM1 exon 28 or PCM1 exon 29, respectively, and JAK2 exon 1. Neither of these fusions are in frame and we suggest that the Discussion genuine in-frame fusion transcript could not be detected because We report here the identification of a novel fusion between treatment had reduced it to below the detection limit of RT-PCR. PCM1 and JAK2 as a consequence of a recurrent t(8;9) in seven Minor bands were also amplified from cases 2 to 6 that resulted patients who presented with clinical and hematologic features from various out-of-frame PCM1-JAK2 fusions and reciprocal resembling chronic phase CML, chronic eosinophilic leukemia, JAK2-PCM1 transcripts were not detected in any patient using acute leukemia similar to blast crisis of CML, or BCR-ABL– several different primer combinations. positive acute lymphoblastic leukemia. Although cytogenetic Consistent PCM1-JAK2 fusion as a consequence of the t(8;9). analysis assigned the breakpoints as varying between 8p21-23 To further confirm the fusion of PCM1 to JAK2, we did additional and 9p23-24, the precise translocation based on gene assignment FISH tests. Analysis of patients with differentially labeled probes is t(8;9)(p22;p24). It is remarkable that this abnormality has not flanking PCM1 indicated that this gene was disrupted in all five been identified previously as a recurrent event. This may be due cases for whom FISH had already identified a split within JAK2. partly to the apparent variable positions of the breakpoints and For three patients (cases 3, 5, and 6), both 5V and 3V PCM1 signals also to the diversity of clinical features associated with this were seen on the der(9) and der(8), respectively. For cases 1 and 4, translocation. the 3V PCM1 signal was deleted from the der(8). Using probes 5V to The involvement of PCM1-JAK2 in both myeloid and lymphoid PCM1 and 3V to JAK2 indicated the expected fusion signal on the malignancy shows that there is no clear lineage specificity to this der(9) in all cases. Representative results are shown in Fig. 1. fusion gene and is consistent with the idea that PCM1-JAK2

Table 1. Patients’ characteristics and summary of results

Case no.

12 3

Diagnosis AL CEL aCML Age 54 47 74 Gender M M M Cytogenetics t(8;9)(p23;p24) t(8;9)(p22;p23) t(8;9)(p22;p24) FISH + NA + RT-PCR NA PCM1 exon 36-JAK2 exon 7 PCM1 exon 26-JAK2 exon 7

Clinical course . Secondary acute leukemia, . IFN initiated 16 mo after diagnosis with . No treatment extensive myelofibrosis achievement of complete remission . Intensive chemotherapy . Death due to neurodegenerative . Secondary acute myeloid leukemia disease 7.5 y after diagnosis 60 mo after diagnosis . Maintenance with IFN for 6 y . Death 61 mo after diagnosis

. Alive 15 y after diagnosis Myelofibrosis +++ + + Eosinophilia NA ++ +

(Continued on the following page)

Cancer Res 2005; 65: (7). April 1, 2005 2664 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. PCM1-JAK2 in Leukemia disease, like CML, is a stem cell disorder. Of note, the marrow cell cycle–dependent association with the centrosome complex displayed variable degrees of myelofibrosis when reported with (25). The protein is predicted to contain multiple coiled-coil one patient diagnosed as transformation of myelofibrosis due to motifs and is believed to be involved in recruitment of specific the extensive presence of fibers in the trephine biopsy. proteins to the centrosome (26). Interestingly, the gene encoding Eosinophilia was prominent in some, but not all, patients. Similar one of these recruited proteins, NIN, has recently been shown to to typical CML, the clinical course was highly variable with fuse to PDGFRB in an imatinib-responsive chronic myeloprolif- survival ranging from a few days to >15 years. A significant erative disease (27) and two further centrosomal genes, FOP and response, but not complete cytogenetic remission, was seen in CEP1, are fused to FGFR1 in the 8p11 myeloproliferative one patient with IFN; however, allogeneic stem cell transplanta- syndrome with the t(6;8) and t(8;9), respectively (5, 6). PCM1 tion may be the only curative treatment currently available. also fuses to RET in papillary thyroid carcinoma (28). It remains PCM1-JAK2 is the third fusion gene that involves JAK2, the other to be established whether centrosomal proteins are recurrent two being ETV6/TEL-JAK2, which arises as a consequence of a partners for tyrosine kinases in malignancy simply because they t(9;12) or variant translocations in patients with a chronic are widely expressed and contain self-association motifs, or myeloproliferative disease or acute lymphoblastic leukemia whether the fusions also result in a pathologic alteration of (16, 17), and BCR-JAK2 in a single individual with atypical CML centrosome function. (18). Remarkably, all seven PCM1-JAK2 cases reported here were The four members of the nonreceptor Janus tyrosine kinase male. The three cases with ETV6-JAK2 in the literature were also family, JAK1, JAK2, JAK3, and TYK2, normally regulate tyrosine males, although the BCR-JAK2 case was female. Nevertheless, phosphorylation of a number of essential signaling pathways via the male bias is significant (P = 0.00049, n = 11), assuming a male- coupling a variety of cytokine, IFN, and other growth factor to-female ratio of 1:1 in the healthy population and random receptors to downstream intracellular signaling molecules, sampling of patients. A similar significant male bias is seen for particularly signal transducers and activators of transcription patients with PDGFRA and PDGFRB fusion genes (9, 11, 19–22) and, proteins. Constitutive activation of different JAKs and signal currently, the reasons for this remain obscure. No sex bias is seen transducers and activators of transcriptions are believed to for patients with FGFR1 fusions (7), although a small but significant mediate neoplastic transformation and promote abnormal cell male excess is seen in BCR-ABL–positive CML (23). Significant proliferation in various malignancies (29), and JAK2 may be male excesses have also been described in subsets of other specifically involved in abnormal cell growth induced by BCR-ABL hematologic malignancies (e.g., young patients with non-Hodgkin’s in CML (30). As has been found for other tyrosine kinase fusion lymphoma or Hodgkin’s disease and middle aged patients with proteins, it is very likely that one or more of the coiled-coil motifs chronic lymphocytic leukemia or lymphocytic lymphoma; ref. 24). from PCM1 result in dimerization or oligomerization of the PCM1 was originally identified as an autoantigen in a patient PCM1-JAK2 chimera, with consequent constitutive activation of with systemic sclerosis and was first characterized as a the JAK2 kinase domain. By analogy with BCR-ABL, it is likely ubiquitously expressed 228 kDa protein that exhibits a distinct that PCM1-JAK2 is the sole abnormality in the chronic phase of

Table 1. Patients’ characteristics and summary of results (Cont’d)

45 6 7

Pre-B ALL aCML aCML aCML 50 42 72 32 MM M M t(8;9)(p21;p24) t(8;9)(p21;p24) t(8;9)(p22;p23) t(8;9)(p21;p24) ++ + NA PCM1 exon 36-ins-DJAK2 PCM1 exon 36-JAK2 exon 9 PCM1 exon 36-JAK2 exon 9 PCM1 exon 28-JAK2 exon 1 (no ORF)* exon 9 PCM1 exon 29-JAK2 exon 1(no ORF)* . Induction chemotherapy . IFN for 10 mo . Death within 96 h after . Lymphoid blast crisis admission 10 mo after diagnosis . Death 5 wk after start . Allogeneic hematopoietic . Allogeneic stem cell transplantation of chemotherapy due stem cell transplantation from matched unrelated donor 12 mo to pneumonia and from matched unrelated after diagnosis multiorgan failure donor 10 mo after diagnosis . Alive 13 mo after transplant . Alive +53 mo after transplant À +NANA À +NANA

Abbreviations: NA, not available; AL, acute leukemia; CEL, chronic eosinophilic leukemia; ALL, acute lymphoblastic leukemia; aCML, atypical CML; À, normal; +, elevated; ++, strongly elevated; +++, extensively elevated. *Transcripts were amplified by nested PCR after allogeneic stem cell transplantation.

www.aacrjournals.org 2665 Cancer Res 2005; 65: (7). April 1, 2005

Figure 3. The four different in-frame PCM1-JAK2 fusion junctions identified in this study. PCM1 sequences are in plain type, JAK2 sequences in bold, the 12 bp intron-derived insert seen in case 4 is shown in lower case with the corresponding amino acids underlined.

the disease, but additional mutations may be required for transformation to acute leukemia. Although the activity of JAK2 is not inhibited by imatinib, it is abrogated by the tyrphostin AG- 490, opening up the possibility of targeted signal transduction therapy for patients with JAK2 fusion genes (31). In summary, we have identified a novel PCM1-JAK2 fusion in seven patients with diverse hematologic malignancies. This Figure 1. FISH analysis for cases 1 and 3. Both cases show a fusion signal with 5V finding further supports a prominent role for deregulated tyrosine PCM1 and 3VJAK2 probes corresponding to PCM1-JAK2 as indicated by the arrows on the bottom of the two panels. Case 3 shows separation of one set kinases in the pathogenesis of BCR-ABL–negative chronic of JAK2 and PCM1 probes, confirming disruption of these genes (top and myeloproliferative diseases and provides the basis for more center, right), with the overlapping/fused signals corresponding to the normal accurate diagnosis, a mechanism to monitor response to chromosomes 9 and 8, respectively. Case 1 shows loss of both derivative (5VJAK2 and 3VPCM1) signals, indicating a deletion on the derived chromosome 8 treatment and, potentially, targeted therapy. (top and center, left).

Figure 2. RT-PCR to confirm the presence of PCM1-JAK2 fusion transcripts in six patients (lanes 1-6). Cases 5, 6, 4, and 2 were amplified with primers derived from PCM1 exon 35 and JAK2 exon 9(lanes 1-4). Case 3 was amplified with primers derived from PCM1 exon 25 and JAK2 exon 9 (lane 5). Case 7 was amplified by nested PCR with primers derived from PCM1 exon 28 and JAK2 exon 2 (lane 6). Additional lanes represent negative controls with cDNA from patients with CML and healthy individuals.

Cancer Res 2005; 65: (7). April 1, 2005 2666 www.aacrjournals.org

Figure 4. Diagrammatic representation of normal JAK2, normal PCM1, and the PCM1-JAK2 fusion protein.

Acknowledgments and Technological Development and the Leukemia Research Fund, United Kingdom. Received 11/29/2004; revised 1/18/2005; accepted 1/25/2005. The costs of publication of this article were defrayed in part by the payment of page Grant support: The Competence Network Acute and chronic leukemias, charges. This article must therefore be hereby marked advertisement in accordance sponsored by the German Bundesministerium fu¨r Bildung und Forschung with 18 U.S.C. Section 1734 solely to indicate this fact. (Projekttra¨ger Gesundheitsforschung; DLR e.V.-01GI9980/6, the European Leuke- We thank the technical assistance of Maike Haas and the statistical advice of miaNet within the 6th European Community Framework Programme for Research Markus Pfirrmann.

References 11. Cools J, DeAngelo DJ, Gotlib J, et al. A tyrosine 21. Vandenberghe P, Wlodarska I, Michaux L, et al. kinase created by fusion of the PDGFRA and FIP1L1 Clinical and molecular features of FIP1L1-PDFGRA 1. Goldman JM, Melo JV. Chronic myeloid leukemia— genes as a therapeutic target of imatinib in idiopathic (+) chronic eosinophilic leukemias. Leukemia 2004;18: advances in biology and new approaches to treatment. hypereosinophilic syndrome. N Engl J Med 2003; 734–42. N Engl J Med 2003;349:1451–64. 348:1201–14. 22. Pardanani A, Brockman SR, Paternoster SF, et al. 2. Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of 12. Apperley JF, Gardembas M, Melo JV, et al. Response to FIP1L1-PDGFRA fusion: Prevalence and clinicopatho- h PDGF receptor to a novel ets-like gene, tel, in chronic imatinib mesylate in patients with chronic myeloprolif- logic correlates in 89 consecutive patients with moderate myelomonocytic leukemia with t(5;12) chromosomal erative diseases with rearrangements of the platelet- to severe eosinophilia. Blood 2004;104:3038–45. translocation. Cell 1994;77:307–16. derived growth factor receptor h. N Engl J Med 2002;347: 23. Ries LAG, Eisner MP, Kosary CL, et al. SEER cancer 3. Xiao S, Nalabolu SR, Aster JC, et al. FGFR1 is fused with 481–7. statistics review, 1975–2000. Bethesda (MD): National a novel zinc-finger gene, ZNF198, in the t(8;13) leukae- 13. Stewart K, Carstairs KC, Dube ID, Keating A. Cancer Institute; 2003. mia/lymphoma syndrome. Nat Genet 1998;18:84–7. Neutrophilic myelofibrosis presenting as Philadelphia 24. Cartwright RA, Gurney KA, Moorman AV. Sex ratios 4. Reiter A, Sohal J, Kulkarni S, et al. Consistent fusion of chromosome negative BCR non-rearranged chronic and the risks of haematological malignancies. Br ZNF198 to the fibroblast growth factor receptor-1 in the myeloid leukemia. Am J Hematol 1990;34:59–63. J Haematol 2002;118:1071–7. t(8;13)(p11;q12) myeloproliferative syndrome. Blood 1998; 14. Sohal J, Chase A, Mould S, et al. Identification of four 25. Balczon R, Bao L, Zimmer WE. PCM-1, a 228-kD 92:1735–42. new translocations involving FGFR1 in myeloid disor- centrosome autoantigen with a distinct cell cycle 5. Popovici C, Zhang B, Gregoire MJ, et al. The ders. Genes Chromosomes Cancer 2001;32:155–63. distribution. J Cell Biol 1994;124:783–93. t(6;8)(q27;p11) translocation in a stem cell myeloprolif- 15. Lupas A, Van Dyke M, Stock J. Predicting coiled coils erative disorder fuses a novel gene, FOP, to fibroblast 26. Dammermann A, Merdes A. Assembly of centroso- from protein sequences. Science 1991;252:1162–4. growth factor receptor 1. Blood 1999;93:1381–9. mal proteins and microtubule organization depends on 6. Guasch G, Mack GJ, Popovici C, et al. FGFR1 is fused 16. Peeters P, Raynaud SD, Cools J, et al. Fusion of TEL, PCM-1. J Cell Biol 2002;159:255–66. to the centrosome-associated protein CEP110 in the the ETS-variant gene 6 (ETV6), to the receptor- 27. Vizmanos JL, Novo FJ, Roman JP, et al. NIN, a gene 8p12 stem cell myeloproliferative disorder with associated kinase JAK2 as a result of t(9;12) in a encoding a CEP110-like centrosomal protein, is fused to t(8;9)(p12;q33). Blood 2000;95:1788–96. lymphoid and t(9;15;12) in a myeloid leukemia. Blood PDGFRB in a patient with a t(5;14)(q33;q24) and an 7. Macdonald D, Reiter A, Cross NC. The 8p11 myelo- 1997;90:2535–40. imatinib-responsive myeloproliferative disorder. Cancer proliferative syndrome: a distinct clinical entity caused 17. Lacronique V, Boureux A, Valle VD, et al. A TEL-JAK2 Res 2004;64:2673–6. by constitutive activation of FGFR1. Acta Haematol fusion protein with constitutive kinase activity in 28. Corvi R, Berger N, Balczon R, Romeo G. RET/PCM-1: 2002;107:101–7. human leukemia. Science 1997;278:1309–12. a novel fusion gene in papillary thyroid carcinoma. 8. Baxter EJ, Hochhaus A, Bolufer P, et al. The 18. Griesinger F, Podleschny M, Steffens R, et al. A novel Oncogene 2000;19:4236–42. t(4;22)(q12;q11) in atypical chronic myeloid leukaemia BCR-JAK2 fusion gene is the result of a translocation 29. Verma A, Kambhampati S, Parmar S, Platanias LC. fuses BCR to PDGFRA. Hum Mol Genet 2002;11:1391–7. (9;22)(p24;q11) in a case of CML. Blood 2000;96:352a. Jak family of kinases in cancer. Cancer Metastasis Rev 9. Steer EJ, Cross NC. Myeloproliferative disorders with 19. Bain BJ. Eosinophilic leukaemias and the idiopathic 2003;22:423–34. translocations of chromosome 5q31–35: role of the hypereosinophilic syndrome. Br J Haematol 1996;95:2–9. 30. Xie S, Wang Y, Liu J, et al. Involvement of Jak2 platelet-derived growth factor receptor h. Acta Haema- 20. Pardanani A, Ketterling RP, Brockman SR, et al. CHIC2 tyrosine phosphorylation in Bcr-Abl transformation. tol 2002;107:113–22. deletion, a surrogate for FIP1L1-PDGFRA fusion, occurs Oncogene 2001;20:6188–95. 10. Cross NCP, Reiter A. Tyrosine kinase fusion genes in in systemic mastocytosis associated with eosinophilia 31. Meydan N, Grunberger T, Dadi H, et al. Inhibition of chronic myeloproliferative diseases. Leukemia 2002;16: and predicts response to Imatinib therapy. Blood acute lymphoblastic leukaemia by a Jak-2 inhibitor. 1207–12. 2003;102:3093–6. Nature 1996;379:645–8. www.aacrjournals.org 2667 Cancer Res 2005; 65: (7). April 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. The t(8;9)(p22;p24) Is a Recurrent Abnormality in Chronic and Acute Leukemia that Fuses PCM1 to JAK2

Andreas Reiter, Christoph Walz, Ann Watmore, et al.

Cancer Res 2005;65:2662-2667.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/7/2662

Cited articles This article cites 30 articles, 11 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/7/2662.full#ref-list-1

Citing articles This article has been cited by 36 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/7/2662.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/7/2662. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.