Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. namto n ieacmlto i ciaino PPARg Xiang of Jiaqing activation via accumulation bile hepatic and inhibiting inflammation by cholestasis intrahepatic alleviates Tectorigenin boi,crhssadeetal ie alr.Eetv rg o B n S r tl iie n new promoting and and inflammation potential Abstract limited liver the Graphical still relieving hepatocyte. have by are in isoflavone, mainly bile PSC an achieved of is and tectorigenin, secretion which defines PBC the disease, study for liver This cholestatic drugs alleviate Effective cause needed. to can urgently It failure. are liver cholangitis. strategies sclerosing eventually treatment primary and and cirrhosis cholangitis fibrosis, biliary primary includes cholestasis Intrahepatic CLD. PPARg. of prevention activating summary the by for Lay export drug con- acid potential In bile a is enhanced implications: TEC and and that that activation, Conclusions suggest demonstrated and results also cholestasis. recruitment We our during together, macrophage promoter. TEC Taken increased hepatic Bsep of TEC the reduced effect that to TEC protective show binding clusion, hepatocyte PPARg results as the enhanced our well blocked through Furthermore, as expression deficiency that PPARg. activation PPARg (Bsep) demonstrated activating and pump results through recruitment export Our transporters salt macrophage results: bile bile hepatic Key of inhibiting PPARg. expression by activating the by cholestasis promoting TEC effect intrahepatic and/or protection alleviated ANIT of liver administered intervention determination its were TEC exerts by mice deficient TEC followed to PPARg simultaneously, whether intrahep- addition, (DDC) intervention determine In alleviate administration 3,5-diethoxycarbonyl-1,4-dihydrocollidine to TEC mechanisms. can intragastric involved 0.1% and the (TEC) received containing model and tectorigenin mice cholestasis cholestasis diet intrahepatic that Wild-type intrahepatic a found experimental fed approach: we an were Experimental study, establish or this PPARg. (ANIT) activating In a-naphthylisothiocyanate by CLD. impede of mice that of effects in treatment side disease cholestasis significant the limiting have atic in thus rosiglitazone, fibrosis, and application troglitazone and clinical as inflammation exerts such their ameliorating activation agonists, by PPARg (PPARg) particularly accu- existing receptor-g (CLD), However, macrophage proliferator-activated disease hepatic progression. peroxisome liver to cholestatic related that in closely indicated protection is has cholestasis liver Research human that activation. shown and has mulation evidence Increasing purpose: and Background Abstract 2020 11, September 3 2 1 Jiang Lingyun is ecigHsia fTajnUiest fTaiinlCieeMedicine Sciences Chinese Traditional Agricultural of of University Academy Tianjin Jiangxi of Hospital Teaching First Hospital People’s Shenzhen 1 1 unynYang Guangyan , hnLiang Zhen , 1 i Kang Lin , 1 hariMa Chuanrui , 1 n h yang shu and , 1 2 ilnWei Linlin , 1 3 a Wu Han , 1 ihaTao Xiuhua , 3 , Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. rtis uha ooyeceotrcatpoen(C)1i infiatyicesdi h ieso pa- of livers the in and increased significantly monocytes is of (MCP)-1 recruitment protein the chemoattractant macrophages monocyte patients, in as increased cholestasis inflammasome significantly such in is the proteins, liver that of diseased suggested mechanisms in have macrophages the cholestasis-mediated studies activating of by process clinical the inflammation ditionally, to cytokines and leads anti-inflammatory microbiome death intestinal express the cell which that po- polarity) demonstrated M1 have (M2 called studies can macrophages Recent also activated cells, phenotype, recruited alternatively pro-inflammatory monocyte-derived (a or macrophages and larity) activated macrophages classically tissue either resident into nonparenchymal of differentiate function and composed of parenchymal are loss in which ultimately Macrophages, role and microbiome detrimental fibrosis im- a in innate play of resulting the NLRs) can cells by and milieu disorder liver recognized proinflammatory (TLRs are the the receptors which unresolved, recognition products, is to liver pathogen microbe-derived via these the related to system into due mune closely (LPS) activated then lipopolysaccharide is are as cytokines cholestasis such toxins, human terial that shows composition no regimens evidence is needed. treatment urgently there Current Increasing are PSC. present, of strategies cholangitis At course treatment of treatment. the new treatment novel alter and and can this limited management therapy of symptom medical effectiveness on any nonresponders (AP) and is focus UDCA phosphatase safety there alkaline for the that FDA serum evidence confirm the decrease clinical to by could needed approved found is was was follow-up patient, agonist, CLD (FXR) in receptor treatment level X UDCA PBC farnesoid to of respond progression a not the (OCA), do decrease disease patients can of liver (UDCA) the one-third end-stage acid in approximately ursodeoxycholic however, even acids that bile and proved of fibrosis, has accumulation evidence progressive the Accumulated by apoptosis, caused necrosis, conditions hepatocellular of range in CLD, a resulting adults. describes liver, in cholestasis, (PSC), disorders, cholangitis called hepatobiliary sclerosing also primary heterogeneous is and etiological which (PBC) of cholangitis multitude biliary primary a including as mainly manifests (CLD) disease liver Cholestatic PPAR activating Introduction through expression. genes its LXR-regulated increased and and FXR-regulated IL-1 promoter as as well such as factor, NF LXR inflammatory and derived FXR its of and PPAR activation activating macrophage by CLD alleviate TEC κ -6 eitdihbto fFRadLRi eaoye )ehne h PPAR the enhanced 3) hepatocyte; in LXR and FXR of inhibition mediated b-p65 7 8] [7, nrae netnlpreblt,ehne rnlcto fptoei atraadbac- and bacteria pathogenic of translocation enhanced permeability, intestinal increased , γ, n t oeua ehnssaemil sflos )restrain 1) follows: as mainly are mechanisms molecular its and 2 [15] h xrsino aiu ooyechemotactic monocyte various of expression The . [12] [6] 9 10] [9, ffciedusfrPCadPCaestill are PSC and PBC for drugs Effective . . . [11] namsmsadproinflammatory and Inflammasomes . hnpritn ie inflammation liver persistent When β· 4 5] [4, )urgltdteexpression the upregulated 2) nsieo hs long-term this, of spite In . [3] n21,oeihlcacid obeticholic 2016, In . γ idn oBsep to binding γ [14] oblock to Ad- . [13] [1] [2] . . ; Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. Fgr H.A xetd E nevninrdcdtesrmlvlo IL-1 of liver level increased the serum significantly the in treatment reduced ANIT macrophages intervention factors. TEC that of inflammatory showed expected, recruitment As results the 1H). our (Figure in this, IL-1 with decrease of content Consistent significant and ANIT- the 1F). alleviated staining a TEC and TUNEL by Additionally, on 1E 1D). shown areas (Figure and positive as 1C results, fewer (Figure these inflammation by intervention with induced of TEC seen line In after as areas 1B). activity death, large and caspase-3 cell 1A multiple reduced (Figure apoptotic treatment and ANIT-induced TEC CLD. markers inhibited by DDC-induced relieved cholestasis-serum TEC significantly and increased be ANIT-induced can exhibits 0.1% of which model necrosis, model with experimental mouse feeding an ANIT-induced and PSC in The ANIT confirmed to relevant further disease, cholangitis was human TEC sclerosing to liver represent of of the leading fully effect into models permeability, intestine not well-accepted intestinal leaky may are the cause from models DDC could (LPS) experimental treatment products murine DDC their or whilst and bacteria ANIT of that translocation the reported study cholestasis previous intrahepatic A experimental DDC-induced and ANIT-induced KCs. alleviated mouse TEC which primary by and mechanism (BMDMs) macrophages molecular in marrow-derived the the Results in Thus, bone investigated CLD of also of activation. polarization We development the and the regulates models. improve recruitment TEC mouse could macrophage intervention DDC-induced been hepatic TEC and has whether suppressing ANIT-induced investigated TEC by we that study, CLD present noteworthy alleviate liver the is the could It in vitro TEC functions in investigation. protective that and demon- provide further vivo have to in require reported others polarity) still widely and (M1 potential mechanisms We activation for macrophage molecular effects. inhibit source underlying antioxidant can important and TEC an that antiinflammatory strated antiproliferation, be as to such the demonstrated activities during been role have pivotal discovery (TCMs) drug a medicines exert Chinese (KCs), Traditional cells Kupffer cholestasis in namely CLD. culminating macrophages, of finally hepatic development transporters, that sterol indicates and evidence bile of suppression transcriptional proinflammatory the NF of on factor of production upregulated nuclear Activation increased are hepatocyte and activating LPS) hyperreactivity cytokine of (IL)-1 key receptor LPS interleukin primary to patients endotoxin (the cholestasis [i.e., leading in TLR4 as patients, cytokines increased of such CLD be activity signals of to and stimulation monocytes shown expression to been the also susceptible findings, have above more which patients are LPS), cholestasis patients example, of (for CLD livers the in in macrophages numbers Importantly, macrophage increasing by accompanied is macrophages liver cholestasis with tients [21] etrgnn(E) ln sflvn,hsatatdmc teto u oismultiple its to due attention much attracted has isoflavone, plant a (TEC), Tectorigenin . κ a loitreewt X n ie eetr(X)sgaig hc eut in results which signaling, (LXR) receptor X liver and FXR with interfere also can b β nmuesrm(iue1)adtemN ee fiflmaoyfcosi h liver the in factors inflammatory of level mRNA the and 1G) (Figure serum mouse in [16] nprle oteefidns – hmkn eetrtp- CR2 xrse by expressed (CCR-2) type-2 receptor chemokine C–C findings, these to parallel In . β, L6 n IL-8] and IL-6, κ [19] (NF B 3 ti eotdta arpaedrvdIL-1 macrophage-derived that reported is It . κ [24-26] ) hc stemse namto regulator. inflammation master the is which b), hseiec rmtdu ohypothesize to us prompted evidence This . 2,28] [27, β n h xrsino hepatic of expression the and hs h hepatoprotective the Thus, . 2,23] [22, [18] [14] nln ihthe with line In . [20] oee,the However, . Additionally, . h above The . β sa is [17] . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. erimn fmcohgsi h ie fmc Fgr Dad2) nacrac ihti eut the result, this with DDC-fed accordance 0.1% In in the 2E). increased increased and dramatically diet also 2D were DDC (Figure factors 0.1% mice profibrogenesis the TEC and of after that inflammatory liver liver showed of mouse the level analysis in in mRNA deposition cytometry collagen macrophages Flow and of 2C). damage recruitment tissue and of 2B areas (Figure decreased by intervention and seen (ALT) transaminase as alanine findings, hepatocyte (AST), mice these confirmed transaminase wild-type weeks aspartate to AP, compared 2 increased injury for by γ- liver DDC shown marked 0.1% showed as chow, mice containing normal DDC-fed diet liver. fed a cholestatic in in TEC TEC by with used protection fed were mice cytometry, kits in flow ELISA experiments Further by (G) *p analyzed cytometry. n=6. n=6. qRT-PCR, flow and by instructions, of F4/80 measured kit quantification (IL-1 and were the further factors CD11b following F: inflammatory shown. ALT, by for shown detect were shown. AST, determined stained to are are staining was of were (right) plots caspase-3 HE level cells statistics dot of hepatic immune quantitative representative Serum activity of liver-isolated and hepatic (A) images E: (left) The Representative (D) (E-F) staining h. (B) TUNEL 48 figure. hepatic the for n=6. in of treatment kits, images ANIT ELISA Representative by by (C) followed measured days were 3 cholestasis. AP intrahepatic for ANIT-induced TEC alleviates with TEC 1. Figure ltmlrnfrs ( glutamyltransferase γ- T Fgr A.Terslso Esann n iisrdsann losupported also staining red Sirius and staining HE of results The 2A). (Figure GT) β nsrm =.()TemN eeso TNF- of levels mRNA The (H) n=6. serum, in ) < .5 h aarpeettemean the represent data The 0.05. 4 5B/Jmc eepre-treated were mice C57BL/6J ± SD. α, C2adMCP-1 and CCR2 γ- T and GT, Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. ntelvradsrmo ie n eue h otn fbl cd nfcs hc ugse htbile that suggested which feces, in acids bile of content the reduced and mice, of experimental CLD serum the and in intervention liver TEC the DDC after or in studies metabolism ANIT previous bile by with verify Consistent induced to model. cholestasis experiments intrahepatic undertook with then mice We in dysfunction (F-G) metabolic cytometry. bile flow rescued analyzed of TEC and quantification F4/80 further and red the E: CD11b TNF- Sirius of for shown. of *p hepatic end stained are levels of the were plots mRNA images cells at dot Representative Hepatic immune sacrificed representative (C) liver-isolated cytometry, then D: inflammation. flow shown. and (D-E) by are and week, ALT, shown. staining injury 1 AST, are HE for liver of staining hepatic TEC diet-induced level of and/or images DDC Serum DDC Representative 0.1% (A) 0.1% from with fed experiment. mice were protects mice TEC C57BL/6J 2. Figure DDC. or ANIT by induced injury liver attenuated treatment TEC that the show and liver. recruitment, results the macrophage our in hepatic Overall, factors reduced profibrogenesis significantly and TEC inflammatory expected, of As 2G). expression and 2F (Figure mice < .5 h aarpeettemean the represent data The 0.05. α, IL-1 β, [29] ± Col1 SD. NTtetetaoersle nteacmlto fbl acids bile of accumulation the in resulted alone treatment ANIT , α ,TM- n M9wr esrdb R-C,n=5. qRT-PCR, by measured were MMP9 and TIMP-1 1, γ- T n Pwr esrdb LS is =.(B) n=6. kits, ELISA by measured were AP and GT, 5 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. ae oehr hs eut hwdta E teutdAI-nue n D-nue iemetabolic CLD. bile on DDC-induced results effect 3F). and the protective (Figure ANIT-induced and a liver attenuated analysis, exerted TEC mouse blot and that in western dysfunction, showed LXR by 0.1% results and determined these in FXR was together, ABCG8) of Taken LXR acid downregulation and bile and DDC-induced line (ABCG5 Ntcp), FXR restored In transporters and TEC of feces. (Oatp export that expression and showed transporters phytosterol The serum uptake and mice. liver, treatment acid Bsep) the fed DDC bile in and DDC of 0.1% size (Mrp2 expression after transporters pool transporters the export ABCG8) acid improved export bile acid TEC and the bile finding, (ABCG5 confirmed rescued this Oatp), transporters significantly transporters with and TEC export export (Ntcp Notably, phytosterol phytosterol transporters 3E). and uptake and (Figure acid acid Bsep) bile feces bile and in the hepatic decreased (Mrp2 of of but reduction serum, expression and expected the liver the the of in Analysis accumulated 3D). acids bile (Figure restored mice intervention DDC-treated TEC 3C). 0.1% ABCG8 that (Figure in and Additionally, showed LXR ABCG5 results and of bile the FXR regulator of and in important regulator ANIT- performed, an decrease master Similarly, was is ANIT-induced the feces. analysis LXR in is while blotting content FXR Ntcp), western acid intervention. and Therefore, bile TEC Mrp2 the after bile (Bsep, increased reversed the markedly transporters was and acids decreased transporters serum, significantly of and TEC liver inhibition 3B). the induced (Figure in CLD size were ANIT-induced Oatp) pool (Ntcp, with acid transporters ABCG5 mice uptake by and in with ABCG8) encoded suppressed and associated significantly sterolin2, (ABCG5 was transporters and phytosterol mice sterolin1 bilirubin Bsep), and in Abcb11), heterodimer (Mrp2 by CLD (the encoded 3A). phytosterols (Bsep ABCG8) and (Figure salts and bile intestine Abcc2), of by the transporters encoded to canalicular (Mrp2, of liver expression the gene from hepatic reduced obstructed mainly was flow 2,2,30] 29, [20, ocmtn ihbohmclcoetss RAepeso fepr transporters export of expression mRNA cholestasis, biochemical with Concomitant . 6 [20] . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. etr ltaayi a efre odtrietepoenlvlo X n X nmuelvr and liver, mouse in LXR PPAR and on export FXR dependent *p activation acid of n=5. macrophage bile level F: panel, regulates Ntcp), protein right liver, n=5. TEC qRT-PCR, (Oatp, the the the by in uptake in determine determined shown size acid to were are bile pool performed genes statistics acid E: quantitative ABCG8) was feces bile and and analysis kits. D: (ABCG5 serum blot ELISA transporters 2. Liver, western by sterol Figure (D-F) determined and in n=5. was LXR Bsep) mice panel, and (Mrp2, treated n=5, right FXR TEC feces, the of and/or and level in DDC (Oatp, protein serum shown determined uptake from the are were acid collected determine statistics genes bile were to quantitative ABCG8) B: performed samples and and was kits. liver, (ABCG5 analysis ELISA mouse blot transporters by western in bile sterol determined C: A: was and 1. n=5. n=6, Bsep) qRT-PCR, Figure feces, (Mrp2, by in and export mice serum treatment acid dysfunction. liver, TEC bile metabolic and/or the Ntcp), ANIT acid in from size bile collected were pool hepatic samples acid DDC-induced feces and and serum ANIT Liver, restored C) TEC 3. Figure 7 γ < .5 h aarpeettemean the represent data The 0.05. ± SD. (A- Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. r-,Rtl,C26 hntetdwt W62i h rsneo P Fgr B.Aaoia results Analogical 4B). (Figure LPS of presence the (PPAR in GW1929 PPAR GW9662 with cotreatment with by treated obtained were when CD206) Retnla, Arg-1, vitro, (TNF- activation In PPAR on (TNF- macrophage the dependent markers mice. was increased M1 (PPAR C57BL/6J polarity markedly the GW9662 KCs from decreased Then, TEC of and 4A). isolated that CD80) (Figure KCs proved iNOS) and and primary CD163 which CXCL1 Retnla, used KCs, Arg-1, we of (IL-10, activation markers KCs, M2 LPS-induced in inhibited TEC treatment of TEC regulation the activation confirm macrophage receptor- To alternative proliferator-activated promotes peroxisome and partial macrophages, and a monocytes is IC TEC an that with agonist shown have studies Previous aigptwyeiie inflammation pathway-elicited naling PPAR PPAR that chanically, PPAR suggests when evidence activation Accumulated macrophage CD206/CD80, LPS-induced of inhibit shPPAR ratio not with the S2B). treated did isolated BMDMs (Figure increased TEC were S2A). TEC that (Figure BMDMs findings CD163) expected, Thus, and our As Retnla conditions. ILPS. Arg-1, CLD (IL-10, and/or (TNF- genes under TEC genes liver marker with the M1 treated decreased infiltrated and BMDMs mice, that from noting worth 4D). is and It 4C (Figure LPS of presence the arpaeatvto a eedn ntePPAR the on dependent was activation macrophage oevr E euae arpaeatvto hc a eedn natvtn PPAR of activating macrophages. inhibition on of that activation dependent was showed LPS-induced which inhibited results activation notably Our macrophage TEC regulated S1B). that TEC (Figure indicate Moreover, LPS results of these together, presence Taken the in KCs treat NF to used were TEC κ ciiyaoihdteTCmdae euaino C activation. KCs of regulation TEC-mediated the abolished activity b γ xrsindfiinydaaial upesdTCmdae niiino arpaeatvto in activation macrophage of inhibition TEC-mediated suppressed dramatically deficiency expression γ 50 sa 3lgs htidcstedgaaino NF of degradation the induces that ligase E3 an is au f13.3 of value α, XL,iO n C2 n arpaeatraieatvto (IL-10, activation alternative macrophage and CCL2) and iNOS CXCL1, μ α, M NS IL-1 iNOS, [33] [31] γ. nlgto hs efrhrdtrie hte TEC-regulated whether determined further we this, of light In . PPAR . u eut hwdta E ramn i o ute influence further not did treatment TEC that showed results Our γ teutsiflmainb upesn NF suppressing by inflammation attenuates β γ n C2 n peuae h xrsino 2marker M2 of expression the upregulated and CCL2) and ciainihbt h rdcino TNF- of production the inhibits activation γ/ γ 8 gns)adTC(iueSAadSB.Importantly, S1B). and S1A (Figure TEC and agonist) NF γ κ niio)wsue ocnr htTCregulation TEC that confirm to used was inhibitor) aha.BY1-05(NF 11-7085 BAY pathway. b κ -6 otriaeNF terminate to b-p65 [32] . γ κ n E supported TEC and niio)and/or inhibitor) b γ κ a nce out knocked was α, γ. ciiy Me- activity. b α INF- n IL-1 and γ (PPAR γ, κ CCL2, sig- B β γ in ) Ποστεδ ον Αυτηορεα 11 Σεπ 2020 ͺ Τηε ςοπψριγητ ηολδερ ις τηε αυτηορ/φυνδερ. Αλλ ριγητς ρεσερvεδ. Νο ρευσε ωιτηουτ περμισσιον. ͺ ηττπς://δοι.οργ/10.22541/αυ.159986113.39831843 ͺ Τηις α πρεπριντ ανδ ηας νοτ βεεν πεερ ρεvιεωεδ. Δατα μαψ βε πρελιμιναρψ. nhptctsbokdtergltr ffcso E nNF on TEC of PPAR effects via regulatory LXR the LPS-inhibited and blocked the FXR hepatocytes whether reversed determine of To in TEC 5D). activity (Figure addition, ABCG5 and shPPAR and In expression Bsep LPS, 5A-C). of the expression (Figure the regulates as promoter well TEC as LXR reversed FXR LXR, and TEC and FXR of that FXR of found the expression activity the NF was in to it the of and binding resulting activation inhibit TEC, p65 transporters, LPS-induced and/or further LPS suppress bile then with NF directly of treated would LPS-induced were could expression Phytosterol hepatocytes TEC Primary decreased whether the hepatocytes. phytosterol. investigated to and we lead acids formation Therefore, been and bile bile has LXR, of canalicular and and retention for hepatocytes FXR NF important in that of transporters examined reported expression several been previously was of mainly it expression has Mechanically, cholestasis decreased hepatocytes LPS-induced to in for attributed LXR basis and molecular FXR on The insults LPS-induced TNF- the improved of directly levels TEC mRNA *p the n=5. D: qRT-PCR, by assay. detected blot primary western The shPPAR of with (B) images treated KCs n=5. (C-D) qRT-PCR, TNF- (PPAR n=5. of GW9662 by qRT-PCR, level and/or measured mRNA TEC The were with LPS. CD163) treated of was and KCs CD206 of Retnla, culture ΠΠΑΡγ. Arg-1, αςτιvατινγ (IL-10, (TNF- βψ markers markers (0.1 αςτιvατιον activation LPS macrophage with μαςροπηαγε of treated ινηιβιτς was KCs ΤΕ῝ of culture 4. Φιγυρε γ n E sidctdi iue5.Terslssoe htPPAR that showed results The 5E. Figure in indicated as TEC and κ -6 ciain ssonb erae hshrlto fNF of phosphorylation decreased by shown as activation, b-p65 < α, .5 h aarpeettemean the represent data The 0.05. NS IL-1 iNOS, α, μ /L iho ihu E (10 TEC without or with g/mL) NS IL-1 iNOS, β, C2 L1,Ag1 enaadC13wsdtrie by determined was CD163 and Retnla Arg-1, IL-10, CCL2, κ γ, -6 a idt X n X rmtr,ihbtthe inhibit promoters, LXR and FXR to bind can b-p65 E n P ssoni h gr.C representative C: figure. the in shown as LPS and TEC 9 β n C2 n arpaeatraieactivation alternative macrophage and CCL2) and α, κ -6 ciiy h xrsino X,Bsep, FXR, of expression the activity, b-p65 γ IL-1 naoit 10 antagonist, β, ± C2 L1,Ag1adRtl were Retnla and Arg-1 IL-10, CCL2, SD. γ, μ eaoye eetetdwith treated were hepatocytes )fr2 .TemN levels mRNA The h. 24 for M) μ )fr2 ntepresence the in h 24 for m) κ -6 n eue NF reduced and b-p65 γ xrsindeficiency expression A h primary The (A) κ -6 in b-p65 3,35] [34, [36] κ b- . . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. ute euaeteepeso fBe oprdwt W99o W62tetetaoe(iue6B). not (Figure did alone TEC treatment GW9662, GW9662 and or TEC GW1929 or with GW1929 compared and Bsep TEC of with expression PPAR treated not the were but regulate cells Bsep, NF further of HepG2 of expression When the independent 6A). increased Bsep, Bsep TEC understood (Figure of that of fully showed expression expression analysis not the blotting the increase still Western regulated can is (TZDs) TEC mechanism compounds molecular results, thiazolidinedione exact that the found but have studies vitro Bsep LXR, In FXR, of expression mRNA PPAR the promoted by determine TEC to determined used were *p was qRT-PCR ABCG5 n=5. F: and ABCG5, shPPAR n=5. Bsep and right, with the NF LXR, transfected on of FXR, data shown level were are PCR protein of Hepatocytes quantitative and levels phosphorylation F) and mRNA E: (left) and LPS. the data (E semiquantitative D: as n=5. (right). represented qRT-PCR, (C) primers LXR specific mouse with of NF promotor for ηεπατοςψτες the antibodies NF or ιν specific of with τρανσπορτερς phosphorylation hepatocytes the βιλε of detect ον to ινσυλτς used was ΛΠΣ-ινδυςεδ ρεστορεδ ΠΠΑΡγ. ΤΕ῝ τηρουγη 5. Φιγυρε PPAR activating by hepatocytes dependent of partly dysfunction was which LPS-induced Bsep, Bsep restored of of directly PPAR expression results TEC on the the the regulated relied with on TEC Combined completely TEC that S4A-B). and of suggested (Figure FXR in influence this Bsep genes on the 5F, not LXR-regulated abolished and but 5D and deficiency ABCG8, Figure LXR FXR-regulated and in or as ABCG5 FXR well Finally, Mrp2, as S3A-C). of LXR (Figure expression and LPS NF FXR of of when presence Furthermore, expression the the 5F). enhance and further 5E not (Figure ABCG5 and LXR < γ .5 h aarpeettemean the represent data The 0.05. AD eaoye utrdwt P n/rTCfr2 .A :wsenblot western B: A, h. 24 for TEC and/or LPS with cultured Hepatocytes (A-D) idn oteBe rmtrrgo n prgltdisexpression its up-regulated and region promoter Bsep the to binding γ. κ κ -6 uuisbnigt h rmtro os X (B) FXR mouse of promotor the to binding subunits b-p65 -6,n5 ,C hoai muorcptto (ChIP) immunoprecipitation Chromatin C: B, n=5. b-p65, κ -6 a esrdb etr ltadqatttv data quantitative and blot western by measured was b-p65 10 ± SD. κ -6 a niie,TCtetetcould treatment TEC inhibited, was b-p65 [37] κ ossetwt u urn research current our with Consistent . ciiyi eaoye Fgr 5D). (Figure hepatocytes in activity b γ n/rTCi h rsneof presence the in TEC and/or γ. γ nHp2cells HepG2 in Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. t-50t 24 aepis(p ntehmnBe ee *p gene. Bsep human the PPAR in predicted PPAR (bp) the or in pairs of with base promoter Depiction Luc3) (G) -2541 Bsep to to n=5. the -2560 G, (Luc1 of immunoglobulin at gene bp IgG, bp/-2178 reporter treatment. -3218 TEC luciferase without region into the cloned in fragments analysis promoter Bsep for TEC of PPAR of without series concentrations were various a cells with of incubated HepG2 assays PPAR were (C) cells and n=5. HepG2 qRT-PCR, h, (D) by 24 n=5. determined qRT-PCR, was by Bsep determined of was level mRNA shPPAR the with and transfected h, 24 for (GW9662) το βινδινγ διρεςτ τηρουγη PPAR τρανσςριπτιον προμοτερ. Βσεπ Βσεπ ρεγυλατες ποσιτιvελψ τηε ΠΠΑΡγ 6. Φιγυρε PPAR of binding the increased expression. treatment its 6E). upregulating TEC PPAR thereby (Figure that the region, PPAR (bp) indicated on promoter putative collectively based Bsep pairs predicted ttggtccacagtgacctcca) results the JASPAR base These bp: tool –2235 6G). -2541 analysis and (Figure to promoter bp –2948 The PPAR (-2560 6F). the that that sequences (Figure confirm between found bp to was was –2235 used it was promoter and and assay Bsep (ChIP) system, immunoprecipitation the reporter Chromatin within luciferase the site series into a binding TEC, cloned by Bsep were PPAR of mutants of regulation overexpression the deletion of promoter PPAR mechanism molecular of Bsep the into binding of insight the further gain increased To TEC transcription. that that showed hypothesized assay PPAR we luciferase on PPAR the Thus, of Importantly, dependent 6C). activity completely (Figure transcriptional was TEC the by Bsep enhanced Bsep TEC of of regulation regulation the TEC blocked deficiency that revealed analysis Further γ eedtce ywsenbotn,n5 B eG el eeicbtdwt E n/rGW1912 and/or TEC with incubated were cells HepG2 (B) n=5. blotting, western by detected were γ- rnfcino eG el,n5 F hoai muorcptto CI)assay–qPCR (ChIP) immunoprecipitation Chromatin (F) n=5. cells, HepG2 of transfection γ rncitoa ciiywsmaue ylcfrs sa,n5 E uieaereporter Luciferase (E) n=5. assay, luciferase by measured was activity transcriptional γ γ A eG el eeicbtdwt E o 4h h rti ee fBe and Bsep of level protein The h. 24 for TEC with incubated were cells HepG2 (A) nacdBe ciiyol nteLc osrcs ugsigta h PPAR the that suggesting constructs, Luc1 the in only activity Bsep enhanced o 4h hntetdwt E o nte 4h n h RAlvlo Bsep of level mRNA the and h, 24 another for TEC with treated then h, 24 for γ 11 nads-eedn anr(iue6D). (Figure manner dose-dependent a in < .5 h aarpeettemean the represent data The 0.05. γ oteBe rmtradpooe its promoted and promoter Bsep the to γ- rnfce eG el ihor with cells HepG2 transfected γ γ osnu euneoutlined sequence consensus a erie ote–2948 the to recruited was γ γ idn motif binding γ, idn sites binding sPPAR as ± SD. γ to γ γ Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. PPAR ofrhrcnr h hsooia oe fPPAR of roles physiological the confirm further To utemr,teepeso fFRadLRi os ie a nlzd n h eut hwdthat showed PPAR results in the transporters and PPAR bile of analyzed, and lack LXR was the FXR, liver together, Taken of mouse 7H). expression PPAR in and the in LXR 7G genes enhance and these not compared decrease FXR did factors significantly TEC of profibrogenesis not expression and did factors TEC the proinflammatory while Furthermore, F4/80, and alone, 7E) increased treatment (Figure by ANIT factors shown with proinflammatory as PPAR of liver, levels findings. mouse mRNA these The supported in increase also 7D). significant 7F) bile (Figure a (Figure liver of by factors the content evidenced profibrogenesis in the as level NC, on mRNA with influence F4/80 compared significant in recruitment no PPAR macrophage PPAR was promoted of in there markedly feces treatment that and alone showed serum TEC liver, size the after pool in area acid acid ANIT- bile in necrosis the protection and of hepatic exert Quantification AP not ALT, did AST, TEC expected, in As PPAR of method. CLD experimental induced the in described as TEC shPPAR γ sesnilfrTCt leit NTidcdeprmna nrhptccholestasis intrahepatic experimental ANIT-induced alleviate to TEC for essential is γ a netdit 5B/Jmc i h alvi.Nx,temc eetetdwt NTand/or ANIT with treated were mice the Next, vein. tail the via mice C57BL/6J into injected was γ ecetmc,wihwsspotdb h atta hr a oovosdifference obvious no was there that fact the by supported was which mice, deficient γ- ecetmc fe E ramn Fgr C.AI treatment ANIT 7C). (Figure treatment TEC after mice deficient γ xrsinaoihdhptcpoeto yTEC. by protection hepatic abolished expression 12 γ nTCmdae eai rtcini io Ad- vivo, in protection hepatic TEC-mediated in γ- γ ecetmc Fgr Aad7B). and 7A (Figure mice deficient ecec grvtdinflammation aggravated deficiency γ- ecetmc (Figure mice deficient γ ecetmice. deficient Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. rao erss C ieai olsz a eemndb LS isi h ie,srmadfcs n=6. feces, and serum liver, the (TNF- in were factors kits the inflammatory AP ELISA estimate (F4/80), by and to recruitment determined used (ALT) was macrophage were transaminase size of HE alanine level with pool stained acid mRNA (AST), sections Bile The transaminase Representative (C) (D-F) (B) aspartate necrosis. n=6. of of kit, area levels ELISA ςηολεστασις serum an by ιντραηεπατις The determined ΑΝΙΤ-ινδυςεδ (A) αγαινστ ΠΠΑΡγ. προτεςτς 1). αςτιvατινγ τρεατμεντ ον ΤΕ῝ δεπενδεντ 7. Φιγυρε nadto,PPAR addition, In PPAR PPAR by that modulation demonstrated have studies Various ABCG5 Bsep, PPAR Mrp2, of Ntcp, expression Oatp, the Discussion confirm of to level used mRNA was the analysis *p blot determine Western n=5. to (H) used n=6. was ABCG8, analysis and qRT-PCR (TGF (G) genes n=6. fibrosis-related and CCR2) and < .5 h aarpeettemean the represent data The 0.05. γ niistetasrpinlatvto fiflmaoyrsos ee n represses and genes response inflammatory of activation transcriptional the inhibits γ iad a eo hrpui eeti euigblayiflmaini PBC in inflammation biliary reducing in benefit therapeutic of be may ligands 5B/Jmc eetetda rvosymnind(Figure mentioned previously as treated were mice C57BL/6J β ,MP,TM- n col1 and TIMP-1 MMP9, 1, ± γ SD. gnsshv oeta nteteteto L.Immune CLD. of treatment the in potential have agonists 13 α )wr esrdb qRT-PCR, by measured were 1) γ, α, X n LXR, and FXR IL-1 β, MCP-1 [38] . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. E ietyicesdteepeso fBe,ti a eaohrmlclrmcaimo E nthe in TEC of mechanism molecular another be may this Bsep, of CLD. expression of the treatment increased directly TEC cholestasis intrahepatic familial progressive in result may cassette deficiency (ATP)-binding it triphosphate and adenosine responsible basically acids, the is bile 2 and of membranes of type canalicular member a secretion hepatocyte a on had the expressed is TEC mainly for ABCB11, is of It gene dose transporters. the this (ABC) Collectively, by S3A). encoded (Figure Bsep, group NF control complete the by in induced NF injury that on than effect level inhibitory NF of stronger lower phosphorylation even the decreased an markedly to TEC and inhibitory as stronger staining dose much same TUNEL a the had of TEC area that in PPAR positive suggest hepatocytes of results the of Our study of NF D). apoptosis vivo down-regulation on and the in effect 1C the An increased (Figure by 5A). than activity shown (Figure caspase-3 rather LPS as reduced decreased of mice, TEC presence model the where in ANIT-induced findings, treatment these NF TEC of supported after NF phosphorylation hepatocytes also The of control S2D). phosphorylation in (Figure the that BMDMs than blocked and almost S1C) (Figure treatment KCs TEC in that showed results Our PPAR while NF tion, complete with associated PPAR injury Interestingly, liver in increase the avoid to NF on effect moderate ducts bile portal (BDL) NF ligation for duct important bile after apoptosis cyte NF mice experimental of hep- various activation LPS-induced as that well suggested as CLD PPAR activation have a PPAR macrophage as studies LPS-induced CLD the multiple inhibited of via treatment TEC the dysfunction that for vitro atocyte strategy in therapeutic shown potential was that together, a Taken It PPAR confirmed be 7). may we on (Figure TEC Importantly, hepatocytes dependent in that expression was effects. found transporter we bile side injury enhance PPAR obvious and liver macrophages without partial of ANIT-induced activation 2) a of and TEC, alleviation 1 that TEC (Figure model demonstrated mouse we experimental study, this In available limiting are glitazones thereby PPAR developed. other inflammation, of on feasibility and data the clinical fibrosis suggests or liver experimental of PPAR no improvement a and troglitazone, atotoxicity the this, dyslipi- for Despite cholestasis-associated especially progression. disease CLD, and of cholestasis treatment intrahepatic the ANIT cholangiocytes improve in by rosiglitazone as induced well that demia as shown cells have inflammatory in studies signaling receptor toll-like cellular upr ute netgto fterltosi ewe spadTC codn oorfidns TEC findings, our to According TEC. and Bsep PPAR between of Bsep relationship binding gene target the the FXR promoted of the investigation inhibiting of further and expression support concentrations the salt regulated bile pioglitazone, serum cholestasisor liver increasing rat of in by treatment expression cholestasis the Bsep intrahepatic in induce export can canalicular troglitazone acid bile in role 2,41] [20, [49] γ env rrtree aaiua xrsino sphsbe ofimdt lya important an play to confirmed been has Bsep of expression canalicular retargeted or novo De . eei rpamclgclihbto fNF of inhibition pharmacological or Genetic . xrsini C n eaoye.Adtoal,NF Additionally, hepatocytes. and KCs in expression κ nmcohgscmae ihhptctswihcudb trbtdt h ieetlevels different the to attributed be could which hepatocytes with compared macrophages in b [45] γ κ ciainadgntcalto fI of ablation genetic and activation b hrfr,aporaetreso h dnicto fdusta ihreetol a only exert either that drugs of identification the or targets appropriate Therefore, . xrsini eaieylwi eaoye ne omlpyilgclconditions physiological normal under hepatocytes in low relatively is expression γ shgl xrse nmcohgsweei a nipratrl nimn modula- immune in role important an has it where macrophages in expressed highly is κ ciiyo htcnb pcfial eiee onnaecya el r essential are cells nonparenchymal to delivered specifically be can that or activity b [29] 4,43] [42, 4,52] [40, hs aaidctdta PPAR that indicated data These . κ γ κ oee,ihbto fNF of inhibition However, . γ lcaei hepatocytes. in blockade b ncnrs,aohrsuysoe httoltzn,btntrosiglitazone not but troglitazone, that showed study another contrast, In . ciaini arpae oprdwt eaoye,adaoddliver avoided and hepatocytes, with compared macrophages in activation b n sppooe ein n rmtdterepeso Fgr ) As 5). (Figure expression their promoted and regions promoter Bsep and gnssa hrpui taeyfrCD e gnsssilne obe to need still agonists new CLD, for strategy therapeutic a as agonists γ/ NF κ aha Fgr n ) nacrac ihorfindings, our with accordance In 5). and 4 (Figure pathway b [44] diinly K1adIK r I are IKK2 and IKK1 Additionally, . 14 γ κ iad a ihrw rmtemre u ohep- to due market the from withdrawn was ligand, κ ly nipratrl ntedvlpetof development the in role important an plays b κ iae ol edt namtr aaeto damage inflammatory to lead could kinases B rvne hlsai-nue ie aaein damage liver cholestasis-induced prevented b κ a on ola oa nraei hepato- in increase an to lead to found was b γ γ agonist ciainmyb neetv taeyfor strategy effective an be may activation κ κ 5,51] [50, lcaei hepatocytes in blockade b niio BY1-05 ramn at treatment 11-7085) (BAY inhibitor b κ -6 nue yLSi hepatocytes, in LPS by induced b-p65 [37] [31] rvossuishv hw that shown have studies Previous . nsmay hseiec could evidence this summary, In . γ a leit hlsai nan in cholestasis alleviate can , κ ordc h erimn and recruitment the reduce to -6 a tl .8fl higher 1.78-fold still was b-p65 [40] lhuhti evidence this Although . [39] κ -6 nue yLPS by induced b-p65 κ motnl,recent Importantly, . iae hc are which kinases B [46] . γ agonist. 4,48] [47, . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. h ffiayadtxct fTC ncnlso,w aedmntae htTCeetlvrpoeto na in protection liver verify exert to TEC needed that still demonstrated have are we doses conclusion, CLD different In DDC-induced and TEC. and of PPAR models ANIT toxicity in cholestatic and injury additional efficacy liver the alleviated effects, significantly side mpk) significant (50 without TEC that found we Although eeotie rmtelvr fml 5B/Jmc 8weso g)adclue speiul reported previously hepatocytes as cultured mouse and Primary age) of macrophages. weeks with (8 differentiate medium(10%FBS) mice fully C57BL/6J RPMI1640 male to in of days livers cultured the 5 then from previously and for obtained FBS described were marrow (Peprotech) 10% as bone M-CSF in prepared tibia cultured ng/mL was and and 100 livers mice femoral form C57BL/6 from male suspension isolated 9-week-old single-cell were to .A 8- medium of livers 1640 the RPMI from prepared were performed KCs was Primary intestine and liver mouse Culture in Cell (TBA) acids bile total reported all of previously (Ad- as determination while luciferase and gavage, against Extraction after (sh)RNA before. hr shorthairpin 48 expressing PPAR 200 adenovirus sacrificed daily against in the control PPAR shRNA were administered of expressing with constructed was animals adenovirus vein time For or mpk) treated tail the shCtrl) feeding. (75 ANIT the at after TEC through All before, days weeks feeding, days 5 i.v. 2 DDC week. 3 for mice the gavage one mpk) treated During oral (75 for was 1%DDC by TEC feeding mice after. TEC with DDC 24h to with treated after and were treated used ANIT ANIT, 3,5-diethoxycarbonyl- mice mice or TEC 1% C57BL/6J of oil) C57BL/6J containing of (corn of administration of diet vehicle subset mice subset dose with a a C57BL/6J another either with the while treated in and fed gavage, study, were or induced mice oral gavage previous was C57BL/6J by oral induced the (100mg/kg) weeks. by was 2 University hr on for Cholestasis 48 Nanjing (DDC) Based for 1,4-dihydrocollidine of (mpk). ANIT weight Center of water. Hospital administration body Animal People’s and by mg/day/kg Shenzhen the of food 75 Center from as to Animal purchased converted the Hospital. access at were People’s maintained free were old) Shenzhen mice University, with weeks These the Jinan Use by (8 China). of approved and Jiangsu, and mice Care College (Nanjing, 1996) the Medical type revised for Clinical 85-23, wild Guide Second no. the C57BL/6J the publication to (NIH of conformed NIH studies Committee the vivo Ethics by in published for Animals protocols Laboratory experimental of and care animal obtained All were animals reagents with other studies All vivo CA). In Cruz, (Santa indicated. Biotechnology where dyestuff except Cruz LXR Sigma-Aldrich HE Santa sc-155894), from from and (Cat#: obtained (Cat#:G1018), shRNA(m) were dyestuff FXR PPAR29456) Red China). sc-38829), (Wuhan, Sirius servicebio (Cat#: ( G1501), from shRNA(m) Transferase obtained (Cat#: (FITC) were Glutamyl IL-1 Fluorescein G1005) Kit Gamma Mouse China). (Cat#: Detection MA). (Beijing, and Ltd (Cambridge, Apoptosis Co, ab267583), Technology Abcam Cell & from Solarbio Tunel from (Cat#: Activity obtained obtained was were Kit Caspase-3 SEKM-0002) ab241029) Assay ab241035), (Cat#: (Cat#: AP Kit (Cat#: Kit ELISA ab252897), Assay Kit AST GT) Assay from (Cat#: alpha- Mouse ALT and obtained Kit ab263882), China). L2630) Assay were (Shanghai, (Cat#: HY-10257) Sigma-Aldrich (Cat#: Aminotransferase) from (LPS) (Aspartate (Cat#: obtained Lipopolysaccharides GW9662 were BAY11-7085 and HY-N0792), (ANIT) HY-15655), NJ), naphtylisocyanate (Cat#: Junction, (TEC) (Cat#: (Monmouth Tectorigenin GW1929 MedChemExpress of HY-16578), Reagents MA). (Cvambridge, (Cat#: Abcam PPAR ab181602), from (Cat#: obtained GAPDH ab176323), (Cat#: p-NF LXR ab178860), ab129089), (Cat#: FXR for Antibodies Reagents methods and Materials NF restrain γ- μ aie[4mo/ al) t2wesatrifcin iepromdeprmnsa mentioned as experiments performed mice infection, after weeks 2 At NaCl]). mmol/l [54 saline l eedn anr hc ntr nii arpaeatvto n eaoyedsucinthrough dysfunction hepatocyte and activation macrophage inhibit turn in which manner, dependent κ ciaina ela nac spepeso,tu leitditaeai cholestasis. intrahepatic alleviated thus expression, Bsep enhance as well as activation b κ /6 Ct:a732,NF ab76302), (Cat#: b/P65 [29] . γ hN()(a# c245V,adPPAR and sc-29455-V), (Cat#: shRNA(h) κ /6 Ct:a152,adBe Ct:a152)were ab155421) (Cat#: Bsep and ab16502), (Cat#: b/P65 15 γ (Ad-shPPAR γ γ ncdw ie iewr injected were mice mice, knockdown (0.5–1.5 ) × γ 10 hN()(a# sc- (Cat#: shRNA(m) 9 cievrlparticles viral active β [53] LS KIT ELISA BMDMs . γ (Cat#: [54] γ- α . Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. C eeicbtdwt niC1/D2(D534)F eetrfr5mna T n hnclswere cells then And RT. at min 5 for receptor FC 553141) (BD anti-CD16/CD32 with incubated were KCs cytometry Flow Backward μΤΓΦβ1 mF4/80 mLXR mFXR mCD163 mCD206 mRetnla mArg1 mIL10 mCCL2 μΙΛ-1β miNOS mABCG8 mABCG5 hBsep mBsep mMrp2 mNtcp mOatp mMMP9 mTIMP-1 mCol1a1 Forward mMCP-1 mCCR2 μΤΝΦ-α Gene 2– equation the using analyzed was genes target of level mRNA relative The ( StepOnePlus 1). (Table ABI primers the specific and using ChIP performed was blotting, qRT–PCR Western (qRT–PCR), medium. reaction serum-free chain in ELISA treatment polymerase received real-time confluence) Quantitative (˜90% penicillin/streptomycin mg/mL Cells 50 0027) (FBS), glutamine. CVCL serum RRID: mmol/L bovine USA, fetal 2 VA, 10% (Manassas, and containing ATCC medium from DMEM purchased were in cultured line, and cell hepatic human a cells, HepG2 al .Tesqecso rmr o R-C analysis qRT-PCR manufacturer’s ALT, for the primers AST, to of of according sequences (Abcam) level The kit of 1. ELISA levels 5’- Table commercial The a forward: using measured -3’. sequences: were primer agcagcagcctcctcattac protocol. etc., Bsep 5’- AP primers, -3’, and with reverse: GT, aatctatgcaaagcgctggt analysis and PCR 5’- -3’ time reverse: real tccaaattggtccacagtga to and subjected -3’ was ccactggagatccaaaagga DNA chromatin the LXR purification, and PPAR elution (LXR and After LXR, Nr1h3 FXR, the for from antibodies using performed NF- were experiments previously blotting described Western 1. as Δ t=C ftetre ee–C of Ct – gene target the of Ct = Ct κ α: 6 Acm a#a152 rPPAR or ab16502) cat# (Abcam, p65 B owr:5-agagtagaaa 3 n ees:5-ggcggtggac 3,FR owr:5’- forward: FXR: -3’, gaggctgtgcttgtgaaaca 5’- reverse: and -3’ aaggaagctcaggcacaaaa 5’- forward: TCGGCTTGG GCCTTAGTTTGGACAGGATCTG CTTCCCAGAATCCAGTCTTTCC GACCACGATGTAGGCAGAGC CGTGGTGATGGTTGAATGTCC CAGGAGCGTTAGTGACAGCAG CGGAATTTCTGGGATTCAGCTTC ACCCAGTAGCAGTCATCCCA AGGAGCTGTCATTAGGGACATC CGCAGCTCTAGGAGCATGTG GCATTAGCTTCAGATTTACGGGT ATCTTTTGGGGTCCGTCAACT GTGGACGGGTCGATGTCAC GCTGACGCTGTAGGACACAT GTTGGACTGACCACTGTAGGT CTCCCGTGGCTTCTAGTGC TGACTCACCTTGTGGTCCTAA CACAACGAACACCTGCTTGG ATGTCTTCCCCCACAAGTTCT GCTTGATGTGCTACAAAAGCTG GTAGGAGGATTATTCCCGTTGTG GGAGTTATGCGGACACTTCTCATGGGTGGACACAGAATGGTT CTCGCGGCAAGTCTTCAGAG CTCTGTTCAGCTATTGGACGC CCACGTCTCACCATTGGGG CGGCCCGTGATGAGAAACT CCAATCCAGCTAACTATCCCTCC CTCCAAGCCAAAGTCCTTAGAG GCTCTTACTGACTGGCATGAG GCATTAGCTTCAGATTTACGGGTTTAAAAACCTGGATCGGAACCAA CAAGGCTCACCATCATCGTAG TTGGTGGTTTGTGAGTGTGAGGCAACTGTTCCTGAACTCAACT GTTCTCAGCCCAACAATACAAGA CTGTGGAATGGGACTGTACTTC AGGGCCTCACATCAACAGAG GAATTGCAGTCAAACCACCCTAT CCCATAAACATCAGCCAGTTGT GCCGCAGCTCGTCAGATAC TCTGACTCAGTGATTCTTCGCA GTGTGGATTCCCTTGGGCTTT CAAACCTCAGAAGGACCAAACA GGGAACATGCTTCGTGGGATA CTGGACAGCCAGACACTAAAG GCAACTCGGACCTGGTCATAA GCTCCTCTTAGGGGCCACT TTAAAAACCTGGATCGGAACCAA ATCCACGGCATACTATCAACATC GACGTGGAACTGGCAGAAGAG [22] α hPwspromda described as performed was ChIP . ,N14(X)adBe ee sn pcfi rmrst n usqetPCR; subsequent and sets primer specific using genes Bsep and (FXR) Nr1h4 ), β- ci)adnraie sn h ee eetdi h oto group control the in detected level the using normalized and actin) γ Ct:a186) n mlfiaino rmtrsequences promoter of amplification and ab178860), (Cat#: 16 TM eltm C ytm(ple isse)with Biosystem) (Applied system PCR Real-time [21] hPwsdn sn pcf nioisfor antibodies specifc using done was ChIP . γ t. as etc., Δ Ct γ- Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 1 yo K ta. oe hrpui agt nPiayBlayCirrhosis. Biliary Primary in Targets Therapeutic Novel hepatology al., & et terology JK, Dyson [1] interest. of References conflict no state authors the All work. HW this GY, interests to experiments; Competing contribution the vivo equal edited manuscript. make in XT the authors performed and wrote These LW CM and ZL, #: and results LK, interpreted JX assays; experiments, biochemical work. and designed experiments SY this biological manuscript; to molecular equally completed contributed LJ and CM and GY JX, Research Contributions (2019KJ044). (19JCQNJC12600); commission Tianjin of education Foundation Tianjin Science Natural of tectorigenin; from project grants by TEC, supported was work medicines; This chinese traditional TCMs, Acknowledgments acids; acid. ursodeoxycholic bile UDCA, total compounds; TZDs,thiazolidinedione TBA, PPAR cholestatic cholangitis; NF cholangitis; receptor; CLD, sclerosing protein; biliary chemoattractant type-2; X primary marrow-derived monocyte receptor PBC, farnesoid MCP, chemokine bone FXR, receptor; C–C BMDMs, X CCR-2, 3,5-diethoxycarbonyl-1,4-dihydrocollidine; ligation; IL-1 pump; DDC, duct glutamyltransferase; export bile disease; salt BDL, liver bile Bsep, ; macrophages; triphosphate ATP,adenosine ANIT, variance. transaminase; of transaminase; analysis alanine 1-way data of The ALT, test test). hoc nonparametric post of statistic, K-S parametric (1-sample Abbreviations subjected the software initially conducted were SPSS were data with raw distribution the analysis normal All anal in experiments. distribution independent normal 3 least a at to from generated were data the software All processing image with analysis quantified Data morphometrically paraf- were in cells embedded Positive and (ImageJ). dehydrated instructions. solution, standard a paraformaldehyde as 4% by (4 with measured sections preserved then fin.The were were tissues activities mice The luciferase renilla and corresponding USA). analysis Firefly WI, with Histological Madison, transfected (Promega, were luciferase. system DNA HepG2 renilla by gene assays, confirmed -2178 reporter as were gene Luc, dual-luciferase constructs well (-3218 All reporter promoter template. as luciferase gene a dual Bsep as plasmids, the For Luc -3218 of using luciferase constructs analysis. PCR pGL3-basic truncated by sequencing a promoter 5’ prepared into were gene inserted of Luc) and Bsep series -1363 DNA mouse A Luc, genomic The mouse Luc). cDNA. using (-3218 HepG2 PCR vector by from reporter amplified PCR was by bp) amplified -198 was to (-3218 gene stain Bsep in Cytometer. mouse Flow full-length fixed DXFLEX The and assay Beckman a washed gene on were reporter 557659),CD11b-FITC(BD performed KCs luciferase were cy7(BD Dual analyses CD45-APC Finally, 4. 554656). incubationat dilutions. (BD minute FBS indicate 30 buffer at the antibody 565410),after following 557391),F4/80-PE(BD the with labeled μ )wr sdfrhsooia nlss E iu e n UE tiigperformed staining TUNEL and red Sirus HE, analysis. histological for used were m) 05 2()147-158. (3) 12 2015. , β, nelui ea C,Kpe el;LS iooyacaie X,liver LXR, lipopolysaccharide; LPS, cells; Kupffer KCs, beta; 1 interleukin α- ahhlsticaae P laiepopaaeAT aspartate phosphatase;AST, alkaline AP, naphthylisothiocyanate; γ, eoioepoieao-ciae receptor- proliferator-activated peroxisome 17 κ ,ncerfactor nuclear b, κ auerves Gastroen- reviews. Nature ;OA btcoi acid; obeticholic OCA, B; γ· S,primary PSC, γ- GT, γ- Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 2]Yn ,e l,Tcoiei teutsDaei ehoah yIpoigVsua Endothelium Vascular Improving by Nephropathy Diabetic Attenuates Pathway. Tectorigenin Adipor1/2 Activating al., through et Dysfunction S, Sra and Yang Klf4 [22] between Interaction Regulating Via Mice. Atherosclerosis Attenuates Apoe Formononetin Il-1 in al., in et Lps Macrophage-Derived C, Ma to [21] al., Hypersensitive et Monocytes on KC, Cholestasis. Rp105 Kasmi Associated Homolog El Tlr of [20] Expression Cirrhosis. Altered Biliary Biliary Primary al., Primary with et in Patients Cells Y, Epithelial Honda Biliary [19] in Endotoxin Cholangitis. of Sclerosing Accumulation Primary Abnormal and Liver al., Cirrhosis the et K, of Sasatomi Study [18] the for Association International Primary Steatohepatitis. in the Nonalcoholic Monocytes/Macrophages and of Hepatic C Cd14-Positive Hepatitis for Chronic Findings Cirrhosis, Differential Cirrhosis. Biliary al., Biliary et Primary KL, in Leicester [17] Granulomas Cholangitis. 216-221. Liver (3) of Biliary Immunopathology 39 Primary The 2012. al., with , et Patients Z, in You [16] Abnormalities 1979) Immunological Liver : al., Cholestatic England (London, et to science WT, Contributes Ma Crosstalk [15] Microbiome-Macrophage Permeability. Intestinal Intestinal al., Promoting by et Disease Subsets. A, Macrophage Isaacs-Ten of [14] Functions Pathogenic and Protective al., Dis- munology et Bowel PJ, Murray Inflammatory Cirrhosis. [13] Liver with al., Disease. et and Patients EA, Health Tsochatzis in in [12] Inflammasomes Permeability al., et Intestinal T, Strowig Increased [11] al., et ease. K, Welcker Cirrhosis. Biliary Restored [10] Primary Partially in and Permeability Cholangitis Intestinal Biliary Abnormal 1607-1613. al., (9) Primary et in JJ, Altered Feld Is [9] Profile Microbial Ibd. Therapy. Gut of Udca al., That after et to R, Distinct Tang Is [8] Psc-Ibd of Microbiota Cholangitis. Gut-Adherent The Sclerosing 386-388. al., (2) Primary et and MN, Quraishi Cholangitis [7] Biliary Cholangitis. Primary Biliary gastroenterology Primary al., of in and et journal Acid Cirrhosis RT, Obeticholic Yokoda Biliary of [6] Primary Trial medicine Placebo-Controlled with of A Patients journal al., England in et New Acid F, Obeticholic Nevens of [5] Acid. Efficacy Ursodeoxycholic al., to Response et Inadequate GM, Hirschfield Biliary [4] ’Cholangitis’. Primary to ’Cirrhosis’ From with Pbc: Patients for Nomenclature of Md.) Changing Management al., et and U, Beuers Diagnosis [3] The Guidelines: Practice Cholangitis. Clinical Easl [2] uoenjunlo eia research medical of journal European 05 2()1620-1622. (5) 62 2015. , 01 1(1 723-737. (11) 11 2011. , ora fhepatology of Journal Theranostics Gut auecommunications Nature 08 7()534-541. (3) 67 2018. , 09 1 1)1593-1605. (10) 114 2019. , 00 0()1090-1106. (3) 10 2020. , 06 7 7 631-643. (7) 375 2016. , 09 3 6 741-760. (6) 133 2019. , 07 7()145-172. (1) 67 2017. , ora fhepatology of Journal 04 1)456-460. (10) 9 2004. , act(odn England) (London, Lancet ora fhepatology of Journal Gastroenterology eaooy(atmr,Md.) (Baltimore, Hepatology 08 1 1393. (1) 9 2018. , 18 hrao.Res. Pharmacol. β/ Nf- 06 6()559-565. (5) 26 2006. , Κ Nature inln eitsPrnea Nutrition- Parenteral Mediates Signaling b 07 7()404-411. (3) 47 2007. , 05 4 4 751-761.e758. (4) 148 2015. , 98 9()409-416. (3) 29 1998. , 02 8 78)278-286. (7381) 481 2012. , 04 8 93)1749-1761. (9930) 383 2014. , 00 5 104678. 153 2020. , ie nentoa ffiiljournal official : international Liver 2020. , i.Ds Sci. Dis. Dig. eaooy(Baltimore, Hepatology auerves Im- reviews. Nature .Autoimmun. J. Gut h American The 07 66 2017. , 06 51 2006. , Clinical The Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 4]Fac ,e l,Eet fEdtxno ye3Ioio ,,-rshsht eetri Human in Receptor 1,4,5-Trisphosphate Inositol 3 Pathway. Inflammasome al., Type Tlr4/Nf-B/Nlrp3 et on Z, Endotoxin Li [42] of Effects (Bsep) al., Pump et Export Cholangiocytes. Salt A, Bile Franca Troglitazone- Canalicular to [41] the Contributing at Factor Interaction Possible Vitro a Rat. in as the and Troglitazone in Vivo of Potential In Cholestatic Hepatotoxicity: Modulation. al., Induced and et Function C, Funk Immunity: [40] Innate Diseases. Biliary Liver al., 2010. Cholestatic et 2010. in K, Targets Harada Drug [39] as Thiazo- Receptors the Nuclear by al., Pathway Signaling et disease Parenteral Receptor E, in X Halilbasic Farnesoid Activation [38] of Cell Modulation Kupffer Differential and al., Injury lidinediones. et R, Liver Kaimal Promote [37] Phytosterols al., Disease. et Liver KC, Impaired Nutrition-Associated Kasmi Rats: Endotoxemic El in Anions [36] Organic and Intra- Acids in Bile Secretion. of Down-Regulated Transport and Is Hepatocyte Uptake (Mrp2) al., et Pump U, Export Bolder [35] Conjugate Canalicular Cholestasis. Rat Obstructive The and al., hepatic et M, Trauner [34] 1300. 3 2012. Ppar , al., et Y, Macrophages Hou M2 [33] Alternative into Monocytes Human Properties. Primes Activation Anti-Inflammatory Ppargamma with al., et MA, Bouhlel Ppar [32] Via Secretion Adipocytokines and Differentiation Adipogenic Ikk/Nf- Regulates Tectorigenin and Ppar al., and et QY, Sirt1 Li Hepatic [31] Regulating by Cholestasis Commun. Ameliorates Res. Formononetin al., Biophys. et S, Yang 15-Deoxy- by [30] Circulating Induced of Cholestasis Role Intrahepatic The Alleviates Rosiglitazone Mice: al., in Fibrosis. et Biliary S, and Zhang Cholangitis [29] Sclerosing of pathology Model of Mouse journal Xenobiotic-Induced American New (Psc). A The Cholangitis al., et Sclerosing P, Primary Fickert [28] for Models Animal of Characterization hepatology al., of et Liver P, Thun- Fickert the Pueraria [27] of of Study Flower the the Injury. for from Association Liver Isolated Tetrachloride-Induced International Tectorigenin Inhibitor Carbon Beta-Glucuronidase Protects al., bergiana et HW, Lee [26] Hyperoxide-Induced Tert-Butyl on Rats Tectorigenin in and Tectoridin Fibrosis of Injury. Liver Effect Hepatoprotective Liver Induced al., Chemically et HU, on Lee Tectorigenin [25] of Murine Investigation. Effects Metabonomic in Therapeutic Associated The Responses an al., and Inflammatory et XX, Ifn-Gamma/Lps-Induced Gao Inhibits [24] Tectorigenin Cells. al., 264.7 Raw et Macrophage CH, Pan [23] 03 7()161-189. (2) 17 2013. , o.Pharmacol. Mol. Κ h ora fpamclg n xeietltherapeutics experimental and pharmacology of Journal The ora fpamclgclsciences pharmacological of Journal Signaling. b 04 0()1290-1303. (6) 60 2014. , Κ eaooy(atmr,Md.) (Baltimore, Hepatology ehn-ihSln oneat hlsai-nue ie aaeVaRgltn the Regulating Via Damage Liver Cholestasis-Induced Counteracts Saline methane-Rich γ Gastroenterology sa 3Lgs htIdcsteDgaaino Nf of Degradation the Induces That Ligase E3 an Is 09 1 4 770-778. (4) 512 2019. , hr.Biol. Pharm. 01 9()627-635. (3) 59 2001. , rhvso hraa research pharmacal of Archives 07 7 2 525-536. (2) 171 2007. , cec rnltoa medicine translational Science elmetabolism Cell Gastroenterology 97 1 1 214-225. (1) 112 1997. , 05 3(1 1567-1575. (11) 53 2015. , xdtv eiieadclua longevity cellular and medicine Oxidative - Δ 09 9()817-830. (2) 69 2019. , g n Nogo. and Pgj rhvso hraa research pharmacal of Archives 05 7()541-544. (4) 97 2005. , 19 03 3()221-226. (4) 23 2003. , 07 2 137-143. (2) 6 2007. , 97 1 1 255-264. (1) 113 1997. , r .Pharmacol. J. Br. 08 1(1 1447-1456. (11) 31 2008. , ie nentoa ffiiljunlo the of journal official : international Liver 03 26 206ra137. (206) 5 2013. , 09 3 1 125-134. (1) 330 2009. , κ b/P65. eitr finflammation of Mediators 02 5()1479-1493. (8) 35 2012. , Α- 00 7 5 1041-1060. (5) 177 2020. , Naphthylisothiocyanate auecommunications Nature 09 096565283. 2019 2019. , lnc nliver in Clinics α. Biochem. Journal γ , Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 5]Gu ,e l,Hptct yotssadRlaeo namsm atce nueSelt elActi- Cell Stellate Induce Particles Inflammasome of Release and Fibrosis. Pyroptosis Liver Hepatocyte and al., vation et S, Gaul [54] Troglitazone in Ror Steatohepatitis. Difference and Nonalcoholic al., Troglitazone Gender against et by the (Bsep) YH, with Pump Han Export Correlation [53] Salt Bile Rats. Canalicular Female the of and Sulfate. Hepatobiliary Inhibition Troglitazone the Male the with in and Interference Formation an Acids FailureSulfate by Bile Secretory Cholestasis Salt Intrahepatic of Troglitazone-Induced Bile Export al., Improves et Aquaporin-1 C, Funk Human [52] of Transfer Cholestasis. Gene Estrogen-Induced Hepatic with Pro- Rats al., in in et Pathway J, Fxr/Bsep Marrone Stimulating Progressive Bile. Via [51] Accumulated in Cholestasis of Mutated Intrahepatic Export Rescues Is Canalicular Emodin Transporter the al., moting Abc et Liver-Specific XL, a Xiong [50] Encoding Gene Liver A Fatty Cholestasis. al., Non-Alcoholic Intrahepatic et Familial in SS, Receptors Strautnieks Proliferator-Activated [49] Peroxisome of Role al., Inflammation. et Disease AKS, Silva [48] 557-566. (5) 19 Ppar 2013. al., , et M, Ahmadian [47] Liver. the Nf- hepatology in al., & Integrity Gastroenterology America et Duct of reviews. Bile T, States Maintain United Luedde Injury. to the [46] Liver Cooperate of Reduce Sciences Ikk2 of and to Academy Ikk1 Functions National al., and the et Cholestasis T, in Luedde Tlr4-Nf- Activated [45] Causes Is and pathology Nf-Kappab Immunity of al., Innate journal et Epithelium American H, Biliary Miyoshi Affects [44] Cftr Mice. of in Loss Response al., Inflammatory et Mediated R, Fiorotto [43] Toxicology ellradmlclrlf cecs:CMLS : sciences life molecular and Cellular α Κ ora fhepatology of Journal nue l4Mdae 2Plrzto nteLvrMcohgsTa Protect That Macrophages Liver the in Polarization M2 Klf4-Mediated Induces nteLvrLnigIjr,Fboi n eaoellrCarcinoma. Hepatocellular and Fibrosis Injury, Liver–Linking the in b γ 01 5 3 967-975. (3) 158 2001. , inln n eaoim h od h a n h Future. the and Bad the Good, The Metabolism: and Signaling 01 6 1 83-98. (1) 167 2001. , a.Genet. Nat. elreports Cell 01 2 108-118. (2) 8 2011. , Gastroenterology eaooy(atmr,Md.) (Baltimore, Hepatology 98 0()233-238. (3) 20 1998. , 2020. , 07 0()124-135. (1) 20 2017. , 20 rnir npharmacology in Frontiers 01 4 4 4810,1508.e1491-1495. 1498-1508, (4) 141 2011. , 08 0 2)9733-9738. (28) 105 2008. , 08 5(6 2951-2961. (16) 75 2018. , 06 4()535-548. (2) 64 2016. , 09 0522. 10 2019. , rceig of Proceedings a.Med. Nat. Nature The Κ b- Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 21 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 22 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 23 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 24 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 25 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 26 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 27 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 28 Posted on Authorea 11 Sep 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159986113.39831843 — This a preprint and has not been peer reviewed. Data may be preliminary. 29