Exaiptasia Diaphana from the Great Barrier Reef: a Valuable Resource for Coral 2 Symbiosis Research

bioRxiv preprint doi: https://doi.org/10.1101/775510; this version posted September 20, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Exaiptasia diaphana from the Great Barrier Reef: a valuable resource for coral 2 symbiosis research

4 Authors and Affiliations:

5 Dungan, Ashley M.1*§, Hartman, Leon1,2§, Tortorelli, Giada1, Belderok, Roy1,3, Lamb, 6 Annika M.1,4, Pisan, Lynn1,5, McFadden, Geoffrey I.1, Blackall, Linda L.1, van Oppen, 7 Madeleine J. H.1,4

8 1School of Biosciences, University of Melbourne, Melbourne, VIC, Australia

9 2 Swinburne University of Technology, Hawthorn, VIC, Australia

10 3 Department of Freshwater and Marine Ecology, Institute for Biodiversity and Ecosystem 11 Dynamics, University of Amsterdam, Amsterdam, The Netherlands

12 4 Australian Institute of Marine Science, Townsville, QLD, Australia

13 5 Kantonsschule Zug, Zug, Switzerland

15 §Equal first authors

16 *Correspondence:

17 Ashley M. Dungan

18 [email protected]

19 Mobile: +61 403 442 289

20 ORCID: 0000-0003-0958-2177

22 Keywords: symbiosis, Exaiptasia diaphana, Exaiptasia pallida, model system, physiology, 23 Symbiodiniaceae

24 Abstract

25 The sea anemone, Exaiptasia diaphana, commonly known as Exaiptasia pallida or Aiptasia 26 pallida, has become increasingly popular as a model for cnidarian-microbiome symbiosis 27 studies due to its relatively rapid growth, ability to reproduce sexually and asexually, and 28 symbiosis with diverse prokaryotes and the same microalgal symbionts (family 29 Symbiodiniaceae) as its coral relatives. Clonal E. diaphana strains from Hawaii, the Atlantic 30 Ocean, and Red Sea are now established for use in research. Here, we introduce Great Barrier 31 Reef (GBR)-sourced E. diaphana strains as additions to the model repertoire. Sequencing of 32 the 18S rRNA gene confirmed the anemones to be E. diaphana while genome-wide single 33 nucleotide polymorphism analysis revealed four distinct genotypes. Based on Exaiptasia- 34 specific inter-simple sequence repeat (ISSR)-derived sequence characterized amplified region 35 (SCAR) marker and gene loci data, these four E. diaphana genotypes are distributed across 36 several divergent phylogenetic clades with no clear phylogeographical pattern. The GBR E. 37 diaphana genotypes comprised three females and one male, which all host Breviolum 38 minutum as their homologous Symbiodiniaceae endosymbiont. When acclimating to an 39 increase in light levels from 12 to 28 µmol photons m-2 s-1, the genotypes exhibited 40 significant variation in maximum quantum yield of Symbiodiniaceae photosystem II and 41 Symbiodiniaceae cell density. The comparatively high levels of physiological and genetic 42 variability among GBR anemone genotypes makes these animals representative of global E. 43 diaphana diversity and thus excellent model organisms. The addition of these GBR strains to 44 the worldwide E. diaphana collection will contribute to cnidarian symbiosis research, 45 particularly in relation to the climate resilience of coral reefs.

46 1 Introduction

47 1.1 Coral Reefs

48 The Great Barrier Reef (GBR) contains abundant and diverse biota, including more than 300 49 species of stony corals (Fabricius et al. 2005), making it one of the most unique and complex 50 ecosystems in the world. In addition to its tremendous environmental importance, the GBR’s 51 social and economic value is estimated at $A56 billion, supporting 64,000 jobs and injecting 52 $A6.4 billion into the Australian economy annually (O’Mahony et al. 2017).

53 Coral reef waters are typically oligotrophic, but stony corals thrive in this environment and 54 secrete the calcium carbonate skeletons that create the physical structure of the reef. Corals 55 achieve this through their symbiosis with single-celled algae of the family Symbiodiniaceae 56 that reside within the animal cells and provide the host with most of its energy (Muscatine 57 and Porter 1977). Additional support is provided by communities of prokaryotes, and 58 possibly by other microbes such as viruses, fungi and endolithic algae living in close 59 association with coral. This entity, comprising the host and its microbial partners, is termed 60 the holobiont (Rohwer et al. 2002). During periods of extreme thermal stress, the coral- 61 Symbiodiniaceae relationship breaks down. Stress-induced cellular damage creates a state of 62 physiological dysfunction, which leads to separation of the partners and, potentially, death of 63 the coral animal. This process, ‘coral bleaching’, is a substantial contributor to coral cover 64 loss globally (Baird et al. 2009; De'ath et al. 2012; Eakin et al. 2016; Hughes et al. 2017; 65 Hughes et al. 2018).

66 1.2 Exaiptasia diaphana

67 Model systems are widely used to explore research questions where experimentation on the 68 system of interest has limited feasibility or ethical constraints. Established model systems, 69 such as Drosophila melanogaster and Caenorhabditis elegans, have played crucial roles in 70 the progress of understanding organismal function and evolution in the past 50 years (Davis 71 2004). The coral model Exaiptasia diaphana was formally proposed by Weis et al. (2008) as 72 a useful system to study cnidarian endosymbiosis and has since achieved widespread and 73 successful use.

74 E. diaphana is a small sea anemone (≤60 mm long) found globally within temperate and 75 tropical marine shallow-water environments (Grajales and Rodriguez 2014). Originally 76 positioned taxonomically within the genus Aiptasia, E. diaphana and twelve other Aiptasia

77 species were combined into a new genus, Exaiptasia (Grajales and Rodriguez 2014). 78 Although Exaiptasia pallida was proposed as the taxonomic name for the twelve 79 synonymized species, the International Commission on Zoological Nomenclature (ICZN) 80 ruled against this because the species epithet diaphana (Rapp 1829) predated pallida (Verrill 81 1864) and therefore had precedence according to the Principle of Priority (ICZN 2017).

82 E. diaphana was first used to study cellular regeneration (Blanquet and Lenhoff 1966), with 83 its systematic use in the study of cnidarian-algal symbioses dating back to 1976 when the 84 regulation of in hospite Symbiodiniaceae density was explored (Steele 1976). Since then, 85 studies using E. diaphana have focused on the onset, maintenance, and disruption of 86 symbiosis with Symbiodiniaceae (Belda-Baillie et al. 2002; Fransolet et al. 2014; Bucher et 87 al. 2016; Hillyer et al. 2017; Cziesielski et al. 2018). E. diaphana has also been used in 88 studies of toxicity (Duckworth et al. 2017; Howe et al. 2017), ocean acidification (Hoadley et 89 al. 2015), disease and probiotics (Alagely et al. 2011), and cnidarian development (Chen et 90 al. 2008; Grawunder et al. 2015; Carlisle et al. 2017). Key differences between corals and E. 91 diaphana are the absence of a calcium carbonate skeleton, the constant production of asexual 92 propagates, and the greater ability to survive bleaching events in the latter. These features 93 allow researchers to use E. diaphana to investigate cellular processes that would otherwise be 94 difficult with corals, such as those that require survival post-bleaching to track re- 95 establishment of eukaryotic and prokaryotic symbionts. Further, adult anemones can be fully 96 bleached without eliciting mortality, which is often difficult for corals, thus providing a 97 system for algal reinfection studies independent of sexual reproduction and aposymbiotic 98 larvae.

99 Three strains of E. diaphana currently dominate the research field as models for coral 100 research. H2 (female) was originally collected from Coconut Island, Hawaii, USA (Xiang et 101 al. 2013), CC7 (male) from the South Atlantic Ocean off North Carolina, USA (Sunagawa et 102 al. 2009) and RS (female, pers.comm., but see (Schlesinger et al. 2010)) collected from the 103 Red Sea at Al Lith, Saudia Arabia (Cziesielski et al. 2018). The majority of E. diaphana 104 resources have been developed from the clonal line, CC7, including reproductive studies 105 (Grawunder et al. 2015), transcriptomes (Sunagawa et al. 2009; Lehnert et al. 2012; Lehnert 106 et al. 2014) and an anemone genome sequence (Baumgarten et al. 2015). Prior work 107 evaluating multiple E. diaphana strains has shown variation in sexual reproduction 108 (Grawunder et al. 2015), Symbiodiniaceae specificity (Thornhill et al. 2013; Grawunder et al.

109 2015), and resistance to thermal stress (Bellis and Denver 2017; Cziesielski et al. 2018). 110 However, Australian contributions to these efforts have been hampered as researchers have 111 not had access to the established strains as import permits for alien species are difficult to 112 secure.

113 The aim of the present work is to add GBR representatives to the existing suite of E. 114 diaphana model strains. We describe the establishment and maintenance of four genotypes, 115 including their provenance, taxonomy, maintenance, histology, physiology, and 116 Symbiodiniaceae symbiont type. The results highlight characteristics that make GBR-sourced 117 E. diaphana a valuable extension to this coral model, such as the physiological and genetic 118 variability between genotypes, which is more representative of a global population. This 119 foundation information will be useful to international researchers interested in using the 120 GBR-sourced animals in their research and will give Australian researchers access to this 121 valuable model.

122 2 Methods

123 2.1 Anemone acquisition and husbandry

124 Several pieces of coral rubble bearing anemones were obtained from holding tanks in the 125 National Sea Simulator (SeaSim) at the Australian Institute of Marine Science and sent to 126 Swinburne University of Technology, Melbourne (SUT) in late 2014. Additional anemones 127 from the SeaSim were sent to the Marine Microbial Symbiont Facility (MMSF) at the 128 University of Melbourne (UoM) in early 2016. Most material in the SeaSim tanks originates 129 from the central GBR; therefore, this is the likely origin of the anemones. The SUT and UoM 130 populations were consolidated at MMSF in early 2017 where they were segregated according 131 to single polynucleotide polymorphism (SNP) analysis groupings (see below). Anemones 132 were grown in 4 L polycarbonate tanks in reverse osmosis (RO) water reconstituted Red Sea 133 Salt™ (RSS) at ~34 parts per thousand (ppt), and incubated without aeration or water flow at 134 26°C under lighting of 12-20 µmol photons m–2 s–1 (light emitting diode - LED white light 135 array) on a 12h:12h light:dark cycle in a walk-in incubator. Anemones were fed ad libitum 136 with freshly hatched Artemia salina (brine shrimp, Salt Creek, UT, USA) nauplii twice 137 weekly. Tanks were cleaned each week after feeding by loosening algal debris with water 138 pressure applied through disposable plastic pipettes, removing algal biomass, and complete 139 water changes. When cleaning, ~25% of the anemones were cut into 2-6 fragments to 140 promote population expansion through regeneration of the tissue fragments into whole 141 anemones. Every third week, all anemones were transferred to clean tanks.

142 2.2 Anemone identity and genotyping

143 Anemone identity was determined by Sanger sequencing of the 18S rRNA gene. Genomic 144 DNA (gDNA) was extracted from six whole anemones following the protocol described by 145 Wilson et al. (2002), modified with a 15 min incubation in 180 µM lysozyme, and 30 s bead 146 beating at 30 Hz (Qiagen Tissue-Lyser II) with 100 mg of sterile glass beads (Sigma G8772). 147 The 18S rRNA genes were PCR amplified from all anemone samples using external 148 Actiniaria-specific 18S rRNA gene primers 18S_NA, 5’- 149 TAAGCACTTGTCTGTGAAACTGCGA-3’ and 18S_NB, 5’-TAAGCACTTGT 150 CTGTGAAACTGCGA-3’ (Grajales and Rodriguez 2016) with 0.5 U 2x Mango Mix 151 (Bioline), 2 µL of DNA template, 0.2 µM of each primer, and nuclease-free water up to 25 152 µL. PCR conditions consisted of initial denaturation at 94°C for 5 min, 35 cycles of 94°C for 153 45 s, 55°C for 45 s, and 72°C for 45 s followed by a final extension at 72°C for 5 min. PCR

154 products were purified with an ISOLATE II PCR and Gel Kit (Bioline, BIO-52059) 155 according to the manufacturers guidelines, and supplied to the Australian Genome Research 156 Facility (AGRF) for Sanger sequencing with the external primers and four internal primers: 157 18S_NL, 5’-AACAGCCCGGTCAGTAACACG-3’, 18S_NC 5’- 158 AATAACAATACAGGGCTTTTCTAAGTC-3’, 18S_NY 5’- 159 GCCTTCCTGACTTTGGTTGAA-3’, and 18S_NO 5’- 160 AGTGTTATTGGATGACCTCTTTGGC-3’. The raw 18S reads were aligned in Geneious (v 161 10.0.4) (Kearse et al. 2012) to produce the near-complete 18S rRNA gene sequence, which 162 was evaluated by BLASTn (Altschul et al. 1990) to identify the anemones.

163 For genotyping, DNA was extracted as described above from 23 whole anemones or their 164 tentacles and sent to Diversity Arrays Technology Pty Ltd (Canberra, Australia) for DArT 165 next-generation sequencing (DArTseq). DArTseq combines complexity reduction and next 166 generation sequencing to generate genomic data with a balance of genome-wide 167 representation and coverage (Cruz et al. 2013). Complexity reduction was achieved by using 168 restriction endonucleases to target low-copy DNA regions. These regions were then 169 sequenced using Illumina HiSeq2500 (Illumina, USA) with an average read depth exceeding 170 20x. The data were processed by DArT Pty Ltd to remove poor quality sequences and to 171 ensure reliable assignment of sequences to samples. DArTsoft14 was then used to identify 172 SNPs at each locus as homozygous reference, homozygous alternate or heterozygous for each 173 individual (Melville et al. 2017). Monomorphic loci, loci with <100% reproducibility or 174 missing values were removed in the R package, dartR, to improve the quality of and reduce 175 linkage within the dataset; this reduced the dataset from 8288 loci to 1743 loci (R Core Team 176 2013; Gruber et al. 2017).

177 Euclidean distances between individual anemones, based on differences in the allele 178 frequencies at each of the SNP loci, were calculated from the reduced SNP dataset in dartR, 179 then viewed as a histogram and printed into a matrix in RStudio. Although the genetic distance 180 between individuals of the same genotype should be zero, small differences may occur due to 181 sequencing errors and somatic mutations. The genetic distance between individuals of different 182 genotypes will be larger than that within individuals. Therefore, the genetic distances among 183 individuals from several genotypes should form a bi- or multi-modal distribution; one peak 184 with a relatively small mean represents genetic distances between pairs of individuals of the 185 same genotype, another represents inter-genotypic distances with a larger mean. The inter-

186 genotypic distribution can be multi-modal because different pairs of genotypes can differ by 187 different amounts. Note that two samples from the same individual were genotyped to 188 determine methodological error rates and verify the baseline for clonality. A principal 189 coordinates analysis was performed and plotted in dartR to visualize the genotype assignments.

190 To compare the phylogenetic relationship of the GBR-sourced anemones with the previously 191 described clonal lines, we used a set of four Exaiptasia-specific inter-simple sequence repeat 192 (ISSR)-derived sequence characterized amplified region (SCAR) markers developed by 193 Thornhill et al. (2013) and an additional six Exaiptasia-specific gene loci (Bellis and Denver 194 2017). gDNA was extracted from five animals of each genotype, as described above, and 195 amplified with each of the four SCAR marker (3, 4, 5, and 7) and gene primer pairs 196 (Thornhill et al. 2013; Bellis and Denver 2017). PCR solutions for each marker contained 197 0.5U MyTaq HS Mix polymerase (Bioline), 1 µL of DNA template, 0.4 µM of each primer, 198 and nuclease-free water up to 25 µL. Thermocycling consisted of an initial denaturation at 199 94°C for 1.5 min, 35 cycles of 94°C for 1 min, 56°C for 1 min, and 72 °C for 1.5 min 200 followed by a final extension at 72°C for 5 min. Amplified products were purified and 201 sequenced in forward and reverse directions at AGRF. Sequences were aligned and edited in 202 Geneious version 2019.2. Substantial non-specific binding of the SCAR marker 7 primers 203 generated unusable sequence data. Further, the forward and reverse sequences from two 204 anemone genotypes that were heterozygous for two or more indels at different points in the 205 sequences of SCAR markers 3 (anemone AIMS1) and 4 (anemones AIMS2-4) could not be 206 aligned and this prohibited the inclusion of those loci from analyses. Therefore, only 207 sequence data from SCAR marker 5 was used for phylogenetic analyses. For the six 208 Exaiptasia-specific gene loci, only AIPGENE19577, Atrophin-1-interacting protein 1 (AIP1) 209 contained heterozygous indels or non-specific binding of the forward primer.

210 For each genotype, the SCAR marker 5 sequences and each of the six Exaiptasia-specific 211 gene loci of the clonal replicates were aligned and a consensus sequence was generated. For 212 the SCAR marker, the consensus sequences were aligned with twelve reference sequences 213 from Thornhill et al. (2013) and three experimental anemone sequences (Grawunder et al. 214 2015), while the Exaiptasia-specific gene sequences were aligned with five reference 215 sequences from Bellis and Denver (2017). Each alignment was used to create a phylogenetic 216 tree using the Maximum Likelihood method and General Time Reversible model (Nei and 217 Kumar 2000) in MEGA X (Kumar et al. 2018). Topology, branch length, and substitution

218 rate were optimized, and branch support was estimated by bootstrap analysis of 1000 219 iterations.

220 2.3 GBR anemone gender determination

221 Over a period of two months, several anemone individuals from each genotype were reared to 222 a pedal disk diameter of ~7 mm. One animal per genotype was anesthetized in a 1:1 solution 223 of 0.37 M magnesium chloride and filter-sterilized RSS (fRSS) for 30 min, dissected and 224 viewed under a stereo microscope (Leica MZ8) to confirm the presence of gonads. When 225 gonads were observed, one animal per genotype was anesthetized as described above, fixed 226 in 4% paraformaldehyde in 1x PBS (pH 7.4) overnight, washed three times in 1x PBS and 227 processed by the Biomedical Histology Facility of The University of Melbourne. Samples 228 were embedded in paraffin and 7 µm transverse sections were cut (see supplemental 229 information Online Resource 1 for histological processing). Slides were stained with 230 hematoxylin and eosin (H&E) and viewed under a compound microscope (Leica DM6000B).

231 2.4 Symbiodiniaceae

232 The ITS2 region of Symbiodiniaceae gDNA was analyzed by metabarcoding to determine the 233 Symbiodiniaceae species associated with the GBR-sourced anemones. gDNA extracted from 234 three animals of each genotype, as described above, was amplified in triplicate with the ITS- 235 Dino (forward; 5’- 236 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATTGCAGAACTCCGTG- 237 3’) (Pochon et al. 2001) and its2rev2 (reverse; 5’- 238 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTCCGCTTACTTATATGCTT- 239 3’) (Stat et al. 2009) primers modified with Illumina adapters. PCRs included 0.5 U MyTaq 240 HS Mix polymerase (Bioline), 1 µL of DNA template, 0.25 µM of each primer, and nuclease- 241 free water up to 20 µL. Thermocycling consisted of an initial denaturation at 95.0 °C for 3 242 min, 35 cycles at 95.0 °C, 55.0 °C and 72.0 °C for 15 sec each, and 1 cycle at 72 °C for 3 243 min. Library preparation on pooled triplicates and Illumina MiSeq sequencing (2x250 bp) 244 was performed by the Ramaciotti Centre for Genomics at the University of New South 245 Wales, Sydney. Raw, demultiplexed MiSeq read-pairs were joined in QIIME2 v2018.4.0 246 (Bolyen et al. 2018). Denoising, chimera checking, and trimming was performed in DADA2 247 (Callahan et al. 2016). The remaining sequences were clustered into operational taxonomic 248 units (OTUs) at 99% sequence similarity using closed-reference OTU picking in vsearch

249 (Rognes et al. 2016). A taxonomic database adapted from Arif et al. (2014) was used to seed 250 the OTU clusters and for taxonomic classification.

251 2.5 Anemone and Symbiodiniaceae physiological properties

252 Physiological assessments were performed on anemones maintained in a healthy, unbleached 253 state for over two years. Three of the four anemone genotypes named AIMS2, AIMS3, and 254 AIMS4, with oral disk diameters of 3-4 mm were transferred from the original holding tanks 255 in the walk-in incubator and randomly distributed between three replicate (by genotype) 250 256 mL glass culture containers containing RSS. Anemones of this size were chosen as they were 257 considered sexually immature (Muller-Parker et al. 1990; Grawunder et al. 2015) and 258 therefore variability in sexual development or gonadal reserves were unlikely to influence the 259 results. AIMS1 was excluded from long-term assessment as it had poor survival at densities 260 required for the analyses.

261 Glass culture containers were transferred from the walk-in incubator to experimental growth 262 chambers (Taiwan HiPoint Corporation model 740FHC) fitted with red, white, and infrared 263 LED lights. Initial light levels were set at 12 μmol photons m-2 s-1 (HiPoint HR-350 LED 264 meter) to correspond with the walk-in incubator conditions and ramped up to 28 µmol 265 photons m-2 s-1 over a period of 72 h on a 12 h:12 h light:dark cycle to approximate 266 experimental conditions reported in E. diaphana literature (Online Resource 2; Fransolet et 267 al. 2014; Hoadley and Warner 2017). While the commonly used E. diaphana strains (CC7, 268 H2, RS) are often maintained at >50 µmol photons m–2 s–1 (pers. comm.), the GBR strains 269 appeared healthier, with extended bodies and open tentacles, at lower light intensities. The 270 anemones were maintained in RSS, fed A. salina nauplii and cleaned as described above. The 271 pH, salinity and temperature of the water and applied light levels were monitored thrice 272 weekly and were stable over time: 8.14±0.02, 35.0±0.04 ppt, 25.77±0.07°C and 28.08±0.12 273 μmol photons m-2 s-1, respectively. Culture containers were placed on a single incubator shelf 274 and randomly rearranged after each clean to minimize confounding by position.

275 The maximum dark adapted quantum yield (Fv/Fm) of photosystem II (PSII) of in hospite 276 Symbiodiniaceae provides an indication of photosynthetic performance and is useful as a bio- 277 monitoring tool (Howe et al. 2017). Fv/Fm is measured as the difference in fluorescence 278 produced by PSII reaction centers when either saturated by intense light (Fm) or in the 279 absence of light (Fo), versus Fm (i.e. (Fm–Fo)/Fm, or Fv/Fm). Symbiodiniaceae Fv/Fm was

280 measured weekly over nine weeks for each culture container after 4 hr into the incubator light 281 cycle and 30 mins dark adaption using imaging pulse amplitude modulated (iPAM) 282 fluorometry (IMAG-MAX/L, Waltz, Germany). Settings for all measurements were: 283 saturating pulse intensity 8, measuring light intensity 2 with frequency 1, actinic light 284 intensity 3, damping 2, gain 2. Average Fv/Fm values for each dish were calculated from 285 readings taken on three to five anemones (Online Resource 3).

286 Anemones from each culture container were individually homogenized in a sterile glass 287 homogenizer in 1 mL fRSS, and 100 µL of homogenate was collected and stored at -20 °C 288 for total protein measurement. The remaining 900 µL of homogenate was centrifuged at 5000 289 g for 5 min at 4°C to pellet the Symbiodiniaceae while leaving the anemone cells in 290 suspension. A volume of 100 µL of supernatant was collected and stored at –20 °C for host 291 protein measurement. The pelleted Symbiodiniaceae were twice washed with 500 µL fRSS 292 and centrifuged at 5000 g for 5 min at 4 °C, and the final pellet resuspended in 500 µL fRSS 293 and stored at –20 °C for Symbiodiniaceae counts. Triplicate cell counts (cells mL–1) were 294 completed within 48 hrs of sample collection on a Countess II FL automated cell counter 295 (Life Technologies) and normalized to host protein (mg mL–1). This process was repeated 15 296 times over the course of nine weeks for a total of 45 replicates per genotype.

297 Samples for protein analysis stored at –20 °C (see above) were used within one month of 298 collection to determine total and host protein (mg mL–1) by the Bradford assay (Bradford 299 1976) against bovine serum albumin standards (Bio-Rad 500-0207). Readings were taken at 300 595 nm (EnSpire microplate reader MLD2300).

301 Fv/Fm values and Symbiodiniaceae cell densities were assessed for genotype-specific 302 responses. All variables were tested for normality and homoscedasticity prior to parametric 303 analyses, which were completed in R (v 3.6.0). Genotypic responses of Fv/Fm were 304 compared using a linear model in the R package nlme (Pinheiro et al. 2017) to evaluate 305 independent and interaction relationships between the factors of genotype and time. F- 306 statistics were obtained using the analysis of variance (ANOVA) function, nlme, and 307 pairwise post hoc analyses were performed using the glht function in the R package 308 multcomp (Hothorn et al. 2016) with Tukey’s correction for multiple comparisons. 309 Symbiodiniaceae cell densities were pooled across time by genotype and analyzed with a 310 one-way ANOVA with a post hoc Tukey test to determine pairwise significance.

311 Results and Discussion

312 3.1 Anemones

313 The assembled 18S rRNA gene sequences of two genotypes (AIMS2 and AIMS4) covered 314 1591 and 1594 bp, respectively, with two mismatches between the sequences. BLASTn 315 against the NCBI database identified the samples as either Aiptasia pulchella or Exaiptasia 316 pallida. A. pulchella has been synonymised with E. pallida (Grajales and Rodríguez, 2014). 317 However, since E. diaphana has precedence (ICZN 2017), all samples were designated E. 318 diaphana.

319 Four SNP genotypes of E. diaphana, which were of GBR-origin but AIMS-sourced, were 320 identified and designated AIMS1, AIMS2, AIMS3 and AIMS4 (Fig. 1). The clonal 321 distribution of Euclidean distances was identified (range of 0-9.61) and pairs of individuals 322 with Euclidean distances within this distribution were inferred to have the same genotype 323 (Online Resource 3-4). The Euclidean distance between the originally named Ed.11a and 324 Ed.11b (replicates from the same individual; assigned AIMS3) is in the upper percentiles of 325 the defined clonal distribution, confirming this cut-off is valid.

326 Using phylogenetic analysis with our data, previously described SCAR marker 5, and the 327 Exaiptasia-specific gene sequence data (Thornhill et al. 2013; Grawunder et al. 2015; Bellis 328 and Denver 2017), we placed the GBR anemones into a phylogeographical context. The 329 alignment of SCAR5 sequences was 706 bp long and contained 19 variable nucleotide 330 positions (Fig. 2), while the concatenated Exaiptasia-specific gene sequences were 3276 bp 331 long with 92 variable nucleotide positions (Fig. 3).

332

333 Figure 1: PCoA ordination of Exaiptasia diaphana genotypes based on Euclidean genetic distance measurements 334 of SNP data using allele frequencies within individuals to calculate genetic distance between them (AIMS1, n=8; 335 AIMS2, n=5, AIMS3, n=7; AIMS4, n=3). Individuals of the same genotype may overlap in the plot due to their 336 high similarity.

337

338 Figure 2: The phylogenetic relationships of the four GBR E. diaphana compared to other conspecific anemones 339 sampled across the globe inferred from SCAR marker 5 using the Maximum Likelihood method and General 340 Time Reversible model (Nei and Kumar 2000). The tree with the highest log likelihood is shown with bootstrap 341 values next to the nodes. Initial trees for the heuristic search were obtained automatically by applying the 342 Maximum Parsimony method. The tree is drawn to scale, with branch lengths measured in the number of 343 substitutions per site. This analysis involved 19 E. diaphana sequences and 706 nucleotide positions were 344 included. Sequences were from our E. diaphana genotypes (AIMS1-4), globally distributed E. diaphana from

345 Thornhill et al. (2013), indicated with an asterisk, and from experimental genotypes CC7, H2, and F003 346 (Grawunder et al. 2015).

347

348 Figure 3: The phylogenetic relationships of the four GBR E. diaphana (AIMS1-4) compared to other 349 experimental anemones using the Maximum Likelihood method and General Time Reversible model (Nei and 350 Kumar 2000) on six concatenated Exaiptasia-specific gene sequences (Bellis and Denver 2017). Data from Bellis 351 and Denver (2017) was downloaded from GenBank (accession numbers KU847812-KU847847); tree branches 352 are named as strain name followed by the alternative strain name in parentheses. Bootstrap values are shown next 353 to the nodes. Initial trees for the heuristic search were obtained automatically by applying the Maximum 354 Parsimony method. The tree is drawn to scale, with branch lengths measured in the number of substitutions per 355 site. This analysis involved 10 E. diaphana sequences and 3267 nucleotide positions were included.

356 Based on SCAR marker data, E. diaphana is regarded as a single pan-global species with two 357 distinct genetic lineages: one from the USA Atlantic coast, and a second consisting of all other 358 E. diaphana worldwide (Thornhill et al. 2013). The SCAR5 allele sequenced for genotype 359 AIMS1 is identical with that from anemones originally collected off Heron Island, Australia 360 and Bermuda, while that of AIMS2 is nearly identical to (two base pair differences, both with 361 an ambiguous base) samples from Hawaii, Japan and the Red Sea. AIMS3 and AIMS4 are 362 most closely related to anemones from Florida and North Carolina, USA and are identical to 363 one another in this region.

364 Similar to Bellis and Denver (2017), our data from the Exaiptasia-specific gene sequences 365 (Fig. 3) show that, while anemone strains are genetically distinct, there is not a strong

366 phylogenetic separation between individuals collected from distant geographic locations. 367 Again, AIMS1-4 show genetic variation, with AIMS1 and AIMS2 clustering with anemone 368 strains originating from Coconut Island, Hawaii, USA which were collected independently in 369 1979 and early 2000’s, respectively. Corresponding with the SCAR5 loci data, AIMS3-4 have 370 near identical sequences in the sequenced regions (differences at two heterozygous sites). 371 Because the available data for SCAR5 and the Exaiptasia-specific gene targets are not from all 372 the same individuals, with the exception of CC7 and H2, comparing between the two is not 373 feasible. However, given the larger number of alignment positions and variable sites in the 374 gene regions with better PCR results, we suggest that researchers use the primers presented in 375 Bellis and Denver (2017) for future comparisons between E. diaphana used in experiments. 376 The diversity that is revealed by whole genome SNP analysis (Fig. 1) is hidden with these six 377 Exaiptasia-specific gene sequences, suggesting that there are more informative loci not yet 378 published for E. diaphana genotyping.

379 There are several possible explanations for the AIMS1-4 anemones to be spread throughout 380 the phylogenetic trees. First, due to small sample sizes at all sampling locations, only a subset 381 of the alleles have been sampled and location-specific alleles may have been missed. Second, 382 it is conceivable that the GBR is the source of all other E. diaphana populations and founder 383 effects mean that other geographic locations have E. diaphana that represent only some of the 384 diversity. Third, it is possible that the GBR E. diaphana was a distinct lineage and the GBR 385 has since been invaded by E. diaphana from other lineages, or the GBR lineage has been 386 introduced elsewhere. Introductions over such vast spatial scales may have occurred via ship 387 ballast water or attached to ships hulls in fouling biomass, which is notorious for transporting 388 marine life and introducing invasive animals and plants, or via the aquarium trade or marine 389 farms. Irrespective of the cause, the genetic variation across the four GBR genotypes is more 390 representative of global diversity than a single localized population. Because strain-specific 391 responses to environmental variables have been observed among E. diaphana strains (Bellis 392 and Denver 2017; Cziesielski et al. 2018) it is critical to conduct experiments, such as those 393 regarding climate change and symbiosis, with a diverse set of individuals, much like the 394 diversity presented by the GBR-sourced E. diaphana.

395 3.2 Symbiosis with Symbiodiniaceae

396 According to a global survey by Thornhill et al. (2013), Pacific Ocean E. diaphana (e.g., H2) 397 associate exclusively with the Symbiodiniaceae species Breviolum minutum (formerly ITS2

398 type Symbiodinium Clade B, sub-clade B1 (LaJeunesse et al. 2018)). Symbiodiniaceae 399 sequences from the four GBR E. diaphana genotypes were almost exclusively Breviolum 400 minutum (>99.6%), thus concurring with Thornhill et al. (2013). Two as-yet unnamed species 401 of Breviolum (previously known as Symbiodinium sub-clades B1i and B1L (LaJeunesse et al. 402 2018)) were also identified in E. diaphana. Their very low relative abundance suggests they 403 are either intragenomic variants or rare strains.

404 Stable endosymbiotic relationships between corals and Symbiodiniaceae are vital for 405 sustaining coral reef ecosystems; this symbiotic relationship is the focus of much coral reef 406 research. Interestingly, while the GBR anemones are genetically diverse, all host B. minutum 407 as their sole Symbiodiniaceae. Given this, we may be able to investigate the symbiotic 408 mechanisms of the host-algal relationship and answer questions about this symbiosis that are 409 not restricted by anemone strain.

410 3.3 Sex of E. diaphana

411 E. diaphana lacks obvious gender defining morphological features, but gonad development is 412 related to size (Chen et al. 2008). Partially developed oocytes with germinal vesicles (i.e., the 413 nucleus of an oocyte arrested in prophase of meiosis I) were observed in histological slides in 414 animals of AIMS1, AIMS3 and AIMS4 and Stage V spermaries were observed in AIMS2 (Fig. 415 4). In Stage V, the spermary is made up of a mass of spermatozoa with their tails facing in the 416 same direction. In this advanced stage the spermatozoa are capable of fertilization (Fadlallah 417 and Pearse 1982; Goffredo et al. 2012). While most AIMS1 anemones grew to only 5 mm in 418 pedal disk diameter, gonad development was still observed. Differences between male and 419 female gonads were present but were macroscopically cryptic. Male gonads have been 420 observed to be smaller and lighter colored than female gonads in E. diaphana (Grawunder et 421 al. 2015), and this was also the case in the GBR-sourced females (AIMS1, AIMS3 and AIMS4) 422 and male (AIMS2) E. diaphana.

423

424 Figure 4: (A) Dissected male anemone with developing gonads (AIMS2, ~1 cm pedal disk diameter); (B) H&E 425 stained tissue section, with stage 5 spermary; (C) Increased magnification of stage 5 spermary; (D) dissected 426 female anemone with developed gonads (AIMS4, ~1 cm pedal disk diameter); (E) H&E stained tissue section 427 with oocytes; (F) increased magnification of female gonad with developing oocyte (o) and germinal vesicle (g).

428 3.4 E. diaphana and Symbiodiniacease Physiology

429 Throughout the nine-week evaluation period all E. diaphana maintained a healthy 430 appearance, including in hospite Symbiodiniaceae, tentacle extension, active feeding of A. 431 salina nauplii and asexual propagation. Average Symbiodiniaceae cell densities (normalized 432 to host protein) were significantly different between genotypes (one-way ANOVA 6 433 (F(3,200)=3.985, p=0.00872; Fig. 5; Online Resource 6). All anemones hosted ~10 434 Symbiodiniaceae cells mg-1 host protein, which is comparable to densities reported for other 435 lab cultured model E. diaphana systems (Hoadley et al. 2015; Hawkins et al. 2016b; 436 Rädecker et al. 2018) and is similar to Symbiodiniaceae cell densities found in scleractinian 437 corals (Cunning and Baker 2014; Ziegler et al. 2015; Kenkel and Bay 2018). The only 438 statistically significant difference observed was the lower Symbiodiniaceae cell density of 439 AIMS2 (mean ± SE; 7.17 x 106 ± 2.73 x 105 per mg host protein, n=66) compared to AIMS3 440 (mean ± SE; 8.46 x 106 ± 2.96 x 105 per mg host protein, n=66) (Fig. 5).

441

442 Figure 5: Mean ± 1SEM Symbiodiniaceae cells mg–1 host protein for GBR E. diaphana genotypes AIMS2-4. 443 Seventy-five AIMS2-4 anemones were collected over a period of nine weeks. Asterisk indicates significant 444 difference, p<0.05.

445 All genotypes experienced a nearly identical drop in Fv/Fm after the light intensity was 446 increased from 12 to 28 µmol photons m-2 s-1, from an average of 0.53 on day 0, to an 447 average of 0.40 by day 21 (Online Resource 7; Fig. 6). However, by day 36 the Fv/Fm values 448 had returned to initial levels.

449 Changes in environmental variables, such as light intensity, are known to influence 450 photobiological behavior of Symbiodiniaceae (Wangpraseurt et al. 2014; Hoadley and

451 Warner 2017). A change in light intensitycan alter photosynthetic efficiency as measured by 452 Fv/Fm (Hoadley and Warner 2017). GBR anemone genotypes AIMS2, AIMS3 and AIMS4 453 took 36 d to recover from this environmental change and return to photosynthetic efficiencies 454 recorded at 12 µmol photons m-2 s-1. Such information is critical for planning and conducting 455 symbiosis studies. Most of the statistical differences between the genotypes occurred between 456 days 19-28 (Online Resource 8) when Fv/Fm was lowest. Once acclimated at day 36, average 457 Fv/Fm values for all genotypes were not significantly different (mean ± SE; 0.479 ± 0.003, 458 n=80), except for day 40 where the Fv/Fm of AIMS2 was significantly higher than AIMS3 459 (p=0.0068).

460 As all the GBR-sourced anemones harbour Breviolum minutum as their homologous 461 symbiont type, it is not unexpected that the different genotypes would have similar maximum 462 Fv/Fm values. Furthermore, similar Fv/Fm values have been reported for other anemones 463 hosting homologous B. minutum (Hawkins et al. 2016b; Hillyer et al. 2017). However, it is 464 noteworthy that AIMS2 is not only able to recover its photosynthetic efficiency quicker from 465 changing light levels with a milder dip in Fv/Fm values (Fig. 6), but also hosts significantly 466 fewer Symbiodiniaceae cells mg-1 host protein compared to AIMS3 (Fig. 5). Reductions in 467 the maximum quantum yield of photosystem II (PSII) (Fv/Fm) is observed in the early phases 468 of natural bleaching events (Gates et al. 1992; Franklin et al. 2004) and the ability of AIMS2 469 to maintain a higher efficiency of PSII photochemistry during changing environmental 470 conditions could translate into higher thermal tolerance (Suggett et al. 2008; Ragni et al. 471 2010; Goyen et al. 2017).

472 These individuals are genetically diverse based on SNP genotyping (Fig. 1) and phylogenetic 473 analysis (Fig. 2-3); the phenotypic feature of AIMS2 being more robust to increasing light 474 levels compared to AIMS3 and AIMS4 could be a host genotypic effect. There is evidence 475 that genetic variation of E. diaphana may influence holobiont response to heat stress, though 476 this hypothesis has only been tested on anemone strains hosting different Symbiodiniaceae 477 species (Bellis and Denver 2017; Cziesielski et al. 2018) or after experimentally bleaching 478 anemones and inoculating with new heterologous algal cells (Perez et al. 2001). As we have 479 four GBR-sourced E. diaphana genotypes with inherent genetic variability and all contain B. 480 minutum as their homologous symbiont, we will be able to explore the roles of host and 481 symbiont in the bleaching response.

482 An alternative possibility is that the GBR anemones’ Symbiodiniaceae communities 483 comprise diversity that may be hidden under the resolution of the ITS2 sequences we used in 484 this experiment, which are driving the differences in photosynthetic efficiency. Distinct 485 strains of a given Symbiodiniaceae species can have different susceptibilities to thermal 486 stress (Ragni et al. 2010; Howells et al. 2012; Hawkins et al. 2016a), with evidence that these 487 variations in thermal optima can drive host-Symbiodiniaceae interactions (Hawkins et al. 488 2016a). Thus, varying rates of recovery of Fv/Fm among Symbiodiniaceae strains (Fig. 6) 489 could provide a mechanism for the emergence of novel and potentially resilient cnidarian- 490 Symbiodiniaceae associations in a rapidly warming environment.

491 Another explanation for the physiological differences between AIMS2 and AIMS3 (Fig. 5) is 492 through algal cell density moderation by the host. It is thought that the coral host controls 493 Symbiodiniaceae densities through nitrogen limitation (Falkowski et al. 1993), although the 494 mechanisms are not well understood (Davy et al. 2012). During temperature stress, higher 495 densities of Symbiodiniaceae have been implicated in increasing the susceptibility of corals 496 to bleaching, potentially as a result of the higher reactive oxygen species production relative 497 to corals’ antioxidant capacity (Cunning and Baker 2012). Altogether, our data suggest that 498 AIMS2, which hosted fewer algal symbionts and recovered from increased light conditions 499 faster than AIMS3, may be more resilient to thermal stress, while AIMS3 could be more 500 susceptible to bleaching with AIMS4 as an intermediate.

501

502 Figure 6: Fv/Fm measurements for anemones AIMS2, AIMS3 and AIMS4 over a 63-day period. Anemones 503 were initially exposed to light levels (black line) of 12 µmol photons m-2 s-1 (12:12 light:dark cycle), which were 504 then increased to 28 µmol photons m-2 s-1 over a 72 h period. Day 0 marks the start of light ramping. The 505 anemones took ~35 d to recover their maximum quantum yield due to the increase in light exposure although 506 Symbiodiniaceae densities remained largely constant. Asterisks indicate significant differences in pairwise 507 comparisons between genotypes at given time points (Online Resource 8)

508 4 Conclusions and Future Directions

509 The study of E. diaphana anemones of GBR origin described here provide further 510 information on phenotypic and genetic variation within this species and complements data on 511 the more widely used E. diaphana strains CC7 and H2. The four genotypes in our collections 512 capture a level of genetic diversity previously observed in animals from different oceans and 513 are therefore a hugely valuable addition to the model collections. Knowledge of their 514 characteristics enhances and broadens the potential of this model system for climate change 515 research in corals, particularly, but not exclusively, for Australian researchers. We propose 516 future research on this collection should focus on characterization of associated prokaryotes 517 to explore the value of these animals as models for coral-prokaryote symbiotic interactions. 518 Future research in cnidarian-prokaryotic interactions would be enhanced by the development 519 of axenic (germ-free) or gnotobiotic (with a known microbial community) E. diaphana 520 cultures. They could be used to test the influence of native and non-native microbiota on 521 holobiont performance, and the ability of probiotic inocula to support animal health during 522 stress (Alagely et al. 2011; Damjanovic et al. 2017; Rosado et al. 2018).

523 5 Acknowledgments

524 This research was funded by Australian Research Council Discovery Project grants 525 DP160101468 (to MJHvO and LLB) and DP160101539 (to GIM and MJHvO). We thank 526 Lesa Peplow for facilitating transport of the initial anemone cultures from AIMS to SUT and 527 UoM and Rebecca Alfred from SUT for initial anemone culture maintenance. We 528 acknowledge Anton Cozijnsen, Keren Maor-Landaw, Samantha Girvan, Ruby Vanstone and 529 Gabriela Rodriguez from University of Melbourne for assisting with anemone husbandry and 530 Laura Leone, Lisa Foster, and Lona Dinha from the Melbourne Histology Platform for 531 histological sample preparation and sectioning. SCAR marker reference sequences were 532 provided by Dan Thornhill and Liz Hambleton (AG Guse Lab, Centre for Organismal Studies 533 (COS), Universität Heidelberg). MJHvO acknowledges Australian Research Council 534 Laureate Fellowship FL180100036.

535 Alagely A, Krediet CJ, Ritchie KB, Teplitski M (2011) Signaling-mediated cross-talk 536 modulates swarming and biofilm formation in a coral pathogen Serratia marcescens 537 ISME J 5:1609-1620 doi:10.1038/ismej.2011.45 538 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search 539 tool Journal of molecular biology 215:403-410 doi:10.1016/s0022-2836(05)80360-2 540 Arif C et al. (2014) Assessing Symbiodinium diversity in scleractinian corals via next- 541 generation sequencing-based genotyping of the ITS2 rDNA region Mol Ecol 23:4418- 542 4433 doi:10.1111/mec.12869 543 Baird AH, Bhagooli R, Ralph PJ, Takahashi S (2009) Coral bleaching: the role of the host 544 Trends Ecol Evol 24:16-20 doi:10.1016/j.tree.2008.09.005 545 Baumgarten S et al. (2015) The genome of Aiptasia, a sea anemone model for coral 546 symbiosis Proc Natl Acad Sci U S A 112:11893-11898 547 doi:10.1073/pnas.1513318112 548 Belda-Baillie CA, Baillie BK, Maruyama T (2002) Specificity of a model cnidarian- 549 dinoflagellate symbiosis Biol Bull 202:74-85 doi:10.2307/1543224 550 Bellis ES, Denver DR (2017) Natural Variation in Responses to Acute Heat and Cold Stress 551 in a Sea Anemone Model System for Coral Bleaching Biol Bull 233:168-181 552 doi:10.1086/694890 553 Blanquet R, Lenhoff HM (1966) A disulfide-linked collagenous protein of nematocyst 554 capsules Science 154:152-153 555 Bolyen E et al. (2018) QIIME 2: Reproducible, interactive, scalable, and extensible 556 microbiome data science. PeerJ Preprints, 557 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 558 quantities of protein utilizing the principle of protein-dye binding Analytical 559 biochemistry 72:248-254 560 Bucher M, Wolfowicz I, Voss PA, Hambleton EA, Guse A (2016) Development and 561 Symbiosis Establishment in the Cnidarian Endosymbiosis Model Aiptasia sp Sci Rep 562 6:19867 doi:10.1038/srep19867 563 Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: 564 high-resolution sample inference from Illumina amplicon data Nature methods 13:581 565 Carlisle JF, Murphy GK, Roark AM (2017) Body size and symbiotic status influence gonad 566 development in Aiptasia pallida anemones Symbiosis 71:121-127 567 doi:10.1007/s13199-016-0456-1 568 Chen C, Soong K, Chen CA (2008) The smallest oocytes among broadcast-spawning 569 actiniarians and a unique lunar reproductive cycle in a unisexual population of the 570 sea anemone, Aiptasia pulchella (Anthozoa : Actiniaria) Zool Stud 47:37-45 571 Cruz VM, Kilian A, Dierig DA (2013) Development of DArT marker platforms and genetic 572 diversity assessment of the U.S. collection of the new oilseed crop lesquerella and 573 related species PLoS One 8:e64062 doi:10.1371/journal.pone.0064062 574 Cunning R, Baker AC (2012) Excess algal symbionts increase the susceptibility of reef 575 corals to bleaching Nature Climate Change 3:259-262 doi:10.1038/nclimate1711 576 Cunning R, Baker AC (2014) Not just who, but how many: the importance of partner 577 abundance in reef coral symbioses Front Microbiol 5:400 578 doi:10.3389/fmicb.2014.00400 579 Cziesielski MJ, Liew YJ, Cui G, Schmidt-Roach S, Campana S, Marondedze C, Aranda M 580 (2018) Multi-omics analysis of thermal stress response in a zooxanthellate cnidarian 581 reveals the importance of associating with thermotolerant symbionts Proc Biol Sci 582 285 doi:10.1098/rspb.2017.2654 583 Damjanovic K, Blackall LL, Webster NS, van Oppen MJH (2017) The contribution of 584 microbial biotechnology to mitigating coral reef degradation Microbial biotechnology 585 10:1236-1243 doi:10.1111/1751-7915.12769 586 Davis RH (2004) The age of model organisms Nature Reviews Genetics 5:69 587 doi:10.1038/nrg1250 588 Davy SK, Allemand D, Weis VM (2012) Cell biology of cnidarian-dinoflagellate symbiosis 589 Microbiol Mol Biol Rev 76:229-261 doi:10.1128/MMBR.05014-11

590 De'ath G, Fabricius KE, Sweatman H, Puotinen M (2012) The 27-year decline of coral cover 591 on the Great Barrier Reef and its causes Proc Natl Acad Sci U S A 109:17995-17999 592 doi:10.1073/pnas.1208909109 593 Duckworth CG, Picariello CR, Thomason RK, Patel KS, Bielmyer-Fraser GK (2017) 594 Responses of the sea anemone, Exaiptasia pallida, to ocean acidification conditions 595 and zinc or nickel exposure Aquat Toxicol 182:120-128 596 doi:10.1016/j.aquatox.2016.11.014 597 Eakin CM et al. (2016) Global Coral Bleaching 2014-2017 Status and an Appeal for 598 Observations Reef Encounter 31:20-26 599 Fabricius K, De’ath G, McCook L, Turak E, Williams DM (2005) Changes in algal, coral and 600 fish assemblages along water quality gradients on the inshore Great Barrier Reef 601 Marine pollution bulletin 51:384-398 602 Fadlallah Y, Pearse J (1982) Sexual reproduction in solitary corals: overlapping oogenic and 603 brooding cycles, and benthic planulas in Balanophyllia elegans Marine Biology 604 71:223-231 605 Falkowski PG, Dubinsky Z, Muscatine L, Mccloskey L (1993) Population-Control in 606 Symbiotic Corals Bioscience 43:606-611 doi:Doi 10.2307/1312147 607 Franklin DJ, Hoegh-Guldberg O, Jones R, Berges JA (2004) Cell death and degeneration in 608 the symbiotic dinoflagellates of the coral Stylophora pistillata during bleaching Marine 609 Ecology Progress Series 272:117-130 610 Fransolet D, Roberty S, Plumier J-C (2014) Impairment of symbiont photosynthesis 611 increases host cell proliferation in the epidermis of the sea anemone Aiptasia pallida 612 Marine Biology 161:1735-1743 doi:10.1007/s00227-014-2455-1 613 Gates RD, Baghdasarian G, Muscatine L (1992) Temperature stress causes host cell 614 detachment in symbiotic cnidarians: implications for coral bleaching The Biological 615 Bulletin 182:324-332 616 Goffredo S et al. (2012) Unusual pattern of embryogenesis of Caryophyllia inornata 617 (scleractinia, caryophylliidae) in the mediterranean sea: Maybe agamic reproduction? 618 Journal of morphology 273:943-956 619 Goyen S, Pernice M, Szabó M, Warner ME, Ralph PJ, Suggett DJ (2017) A molecular 620 physiology basis for functional diversity of hydrogen peroxide production amongst 621 Symbiodinium spp.(Dinophyceae) Marine biology 164:46 622 Grajales A, Rodriguez E (2014) Morphological revision of the genus Aiptasia and the family 623 Aiptasiidae (Cnidaria, Actiniaria, Metridioidea) Zootaxa 3826:55-100 624 doi:10.11646/zootaxa.3826.1.2 625 Grajales A, Rodriguez E (2016) Elucidating the evolutionary relationships of the Aiptasiidae, 626 a widespread cnidarian-dinoflagellate model system (Cnidaria: Anthozoa: Actiniaria: 627 Metridioidea) Mol Phylogenet Evol 94:252-263 doi:10.1016/j.ympev.2015.09.004 628 Grawunder D, Hambleton EA, Bucher M, Wolfowicz I, Bechtoldt N, Guse A (2015) Induction 629 of Gametogenesis in the Cnidarian Endosymbiosis Model Aiptasia sp Sci Rep 630 5:15677 doi:10.1038/srep15677 631 Gruber B, Georges A, Berry O, Unmack P (2017) dartR: Importing and Analysing Snp and 632 Silicodart Data Generated by Genome-Wide Restriction Fragment Analysis. CRAN, 633 Hawkins TD, Hagemeyer JC, Warner ME (2016a) Temperature moderates the 634 infectiousness of two conspecific Symbiodinium strains isolated from the same host 635 population Environmental microbiology 18:5204-5217 636 Hawkins TD, Hagemeyer JCG, Hoadley KD, Marsh AG, Warner ME (2016b) Partitioning of 637 Respiration in an Animal-Algal Symbiosis: Implications for Different Aerobic Capacity 638 between Symbiodinium spp Frontiers in Physiology 7:128 639 doi:10.3389/fphys.2016.00128 640 Hillyer KE, Dias DA, Lutz A, Roessner U, Davy SK (2017) Mapping carbon fate during 641 bleaching in a model cnidarian symbiosis: the application of 13 C metabolomics New 642 Phytol 214:1551-1562 doi:10.1111/nph.14515 643 Hoadley KD, Rollison D, Pettay DT, Warner ME (2015) Differential carbon utilization and 644 asexual reproduction under elevatedpCO2conditions in the model

645 anemone,Exaiptasia pallida, hosting different symbionts Limnology and 646 Oceanography 60:2108-2120 doi:10.1002/lno.10160 647 Hoadley KD, Warner ME (2017) Use of Open Source Hardware and Software Platforms to 648 Quantify Spectrally Dependent Differences in Photochemical Efficiency and 649 Functional Absorption Cross Section within the Dinoflagellate Symbiodinium spp 650 Frontiers in Marine Science 4 doi:10.3389/fmars.2017.00365 651 Hothorn T, Bretz F, Westfall P, Heiberger RM, Schuetzenmeister A, Scheibe S, Hothorn MT 652 (2016) Package ‘multcomp’ Simultaneous inference in general parametric models 653 Project for Statistical Computing, Vienna, Austria 654 Howe PL, Reichelt-Brushett AJ, Clark MW, Seery CR (2017) Toxicity estimates for diuron 655 and atrazine for the tropical marine cnidarian Exaiptasia pallida and in-hospite 656 Symbiodinium spp. using PAM chlorophyll-a fluorometry J Photochem Photobiol B 657 171:125-132 doi:10.1016/j.jphotobiol.2017.05.006 658 Howells E, Beltran V, Larsen N, Bay L, Willis B, Van Oppen M (2012) Coral thermal 659 tolerance shaped by local adaptation of photosymbionts Nature Climate Change 660 2:116 661 Hughes TP et al. (2017) Global warming and recurrent mass bleaching of corals Nature 662 543:373-377 doi:10.1038/nature21707 663 Hughes TP et al. (2018) Global warming transforms coral reef assemblages Nature 556:492- 664 496 doi:10.1038/s41586-018-0041-2 665 ICZN (2017) Opinion 2404 (Case 3633) —Dysactis pallida Agassiz in Verrill, 1864 (currently 666 Aiptasia pallida; Cnidaria, Anthozoa, Hexacorallia, Actiniaria): precedence over 667 Aiptasia diaphana (Rapp, 1829), Aiptasia tagetes (Duchassaing de Fombressin & 668 Michelotti, 1864), Aiptasia mimosa (Duchassaing de Fombressin & Michelotti, 1864) 669 and Aiptasia inula (Duchassaing de Fombressin & Michelotti, 1864) not approved 670 The Bulletin of Zoological Nomenclature 74:130-132, 133 671 Kearse M et al. (2012) Geneious Basic: an integrated and extendable desktop software 672 platform for the organization and analysis of sequence data Bioinformatics (Oxford, 673 England) 28:1647-1649 doi:10.1093/bioinformatics/bts199 674 Kenkel CD, Bay LK (2018) Exploring mechanisms that affect coral cooperation: symbiont 675 transmission mode, cell density and community composition bioRxiv:067322 676 doi:10.1101/067322 677 Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: molecular evolutionary 678 genetics analysis across computing platforms Molecular biology and evolution 679 35:1547-1549 680 LaJeunesse TC, Parkinson JE, Gabrielson PW, Jeong HJ, Reimer JD, Voolstra CR, Santos 681 SR (2018) Systematic Revision of Symbiodiniaceae Highlights the Antiquity and 682 Diversity of Coral Endosymbionts Curr Biol 28:2570-2580 e2576 683 doi:10.1016/j.cub.2018.07.008 684 Lehnert EM, Burriesci MS, Pringle JR (2012) Developing the anemone Aiptasia as a 685 tractable model for cnidarian-dinoflagellate symbiosis: the transcriptome of 686 aposymbiotic A. pallida BMC Genomics 13:271 doi:10.1186/1471-2164-13-271 687 Lehnert EM, Mouchka ME, Burriesci MS, Gallo ND, Schwarz JA, Pringle JR (2014) 688 Extensive differences in gene expression between symbiotic and aposymbiotic 689 cnidarians G3 (Bethesda) 4:277-295 doi:10.1534/g3.113.009084 690 Melville J et al. (2017) Identifying hybridization and admixture using SNPs: application of the 691 DArTseq platform in phylogeographic research on vertebrates Royal Society open 692 science 4:161061 693 Muller-Parker G, Cook CB, D'Elia CF (1990) Feeding affects phosphate fluxes in the 694 symbiotic sea anemone Aiptasia pallida Marine Ecology Progress Series 60:283-290 695 Muscatine L, Porter JW (1977) Reef corals: mutualistic symbioses adapted to nutrient-poor 696 environments Bioscience 27:454-460 697 Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford university press,

698 O’Mahony J, Simes R, Redhill D, Heaton K, Atkinson C, Hayward E, Nguyen M (2017) At 699 what price? The economic, social and icon value of the Great Barrier Reef. Deloitte 700 Access Economics, Brisbane, QLD, Australia 701 Perez SF, Cook CB, Brooks WR (2001) The role of symbiotic dinoflagellates in the 702 temperature-induced bleaching response of the subtropical sea anemone Aiptasia 703 pallida Journal of Experimental Marine Biology and Ecology 256:1-14 704 Pinheiro J, Bates D, DebRoy S, Sarkar D, Heisterkamp S, Van Willigen B, Maintainer R 705 (2017) Package ‘nlme’ Linear and Nonlinear Mixed Effects Models, version:3-1 706 Pochon X, Pawlowski J, Zaninetti L, Rowan R (2001) High genetic diversity and relative 707 specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid 708 foraminiferans Marine Biology 139:1069-1078 doi:10.1007/s002270100674 709 Rädecker N et al. (2018) Using Aiptasia as a Model to Study Metabolic Interactions in 710 Cnidarian-Symbiodinium Symbioses Frontiers in physiology 9:214-214 711 doi:10.3389/fphys.2018.00214 712 Ragni M, Airs RL, Hennige SJ, Suggett DJ, Warner ME, Geider RJ (2010) PSII 713 photoinhibition and photorepair in Symbiodinium (Pyrrhophyta) differs between 714 thermally tolerant and sensitive phylotypes Marine Ecology Progress Series 406:57- 715 70 716 Rapp W (1829) Über die Polypen im Allgemeinen und die Actinien Verlag des 717 Großherzoglich Sächsischen privileg Landes-Industrie-Comptoirs, Weimar 718 Rognes T, Flouri T, Nichols B, Quince C, Mahé F (2016) VSEARCH: a versatile open source 719 tool for metagenomics PeerJ 4:e2584 720 Rohwer F, Seguritan V, Azam F, Knowlton N (2002) Diversity and distribution of coral- 721 associated bacteria Mar Ecol Prog Ser 243:10 722 Rosado PM et al. (2018) Marine probiotics: increasing coral resistance to bleaching through 723 microbiome manipulation The ISME Journal doi:10.1038/s41396-018-0323-6 724 Schlesinger A, Kramarsky-Winter E, Rosenfeld H, Armoza-Zvoloni R, Loya Y (2010) Sexual 725 plasticity and self-fertilization in the sea anemone Aiptasia diaphana PLoS One 726 5:e11874 doi:10.1371/journal.pone.0011874 727 Stat M, Pochon X, Cowie RO, Gates RD (2009) Specificity in communities of Symbiodinium 728 in corals from Johnston Atoll Marine Ecology Progress Series 386:83-96 729 Steele RD (1976) Light intensity as a factor in the regulation of the density of symbiotic 730 zooxanthellae in Aiptasia tagetes (Coelenterata, Anthozoa) Journal of Zoology 731 179:387-405 doi:doi:10.1111/j.1469-7998.1976.tb02302.x 732 Suggett DJ, Warner ME, Smith DJ, Davey P, Hennige S, Baker NR (2008) Photosynthesis 733 and production of hydrogen peroxide by Symbiodinium (pyrrhophyta) phylotypes with 734 different thermal tolerances 1 Journal of Phycology 44:948-956 735 Sunagawa S et al. (2009) Generation and analysis of transcriptomic resources for a model 736 system on the rise: the sea anemone Aiptasia pallida and its dinoflagellate 737 endosymbiont BMC Genomics 10:258 doi:10.1186/1471-2164-10-258 738 Team RC (2013) R: A language and environment for statistical computing 739 Thornhill DJ, Xiang Y, Pettay DT, Zhong M, Santos SR (2013) Population genetic data of a 740 model symbiotic cnidarian system reveal remarkable symbiotic specificity and 741 vectored introductions across ocean basins Mol Ecol 22:4499-4515 742 doi:10.1111/mec.12416 743 Verrill AE Revision of the polypi of the eastern coast of the United States. In, 1864. Boston 744 Society of Natural History, 745 Wangpraseurt D, Larkum AW, Franklin J, Szabo M, Ralph PJ, Kuhl M (2014) Lateral light 746 transfer ensures efficient resource distribution in symbiont-bearing corals J Exp Biol 747 217:489-498 doi:10.1242/jeb.091116 748 Weis VM, Davy SK, Hoegh-Guldberg O, Rodriguez-Lanetty M, Pringle JR (2008) Cell 749 biology in model systems as the key to understanding corals Trends Ecol Evol 750 23:369-376 doi:10.1016/j.tree.2008.03.004

751 Wilson K et al. (2002) Genetic mapping of the black tiger shrimp Penaeus monodon with 752 amplified fragment length polymorphism Aquaculture 204:297-309 753 doi:https://doi.org/10.1016/S0044-8486(01)00842-0 754 Xiang T, Hambleton EA, DeNofrio JC, Pringle JR, Grossman AR (2013) Isolation of clonal 755 axenic strains of the symbiotic dinoflagellate Symbiodinium and their growth and host 756 specificity(1) J Phycol 49:447-458 doi:10.1111/jpy.12055 757 Ziegler M, Roder CM, Büchel C, Voolstra CR (2015) Mesophotic coral depth acclimatization 758 is a function of host-specific symbiont physiology Frontiers in Marine Science 2:4 759