US 20150292.028A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0292028A1 Spivak et al. (43) Pub. Date: Oct. 15, 2015

(54) GENETIC ASSAY TO DETERMINE Publication Classification PROGNOSIS IN POLYCYTHEMAVERA PATIENTS (51) Int. Cl. Applicant: THE JOHNS HOPKINS CI2O I/68 (2006.01) (71) G06F 9/00 (2006.01) UNIVERSITY, Baltimore, MD (US) (52) U.S. Cl. (72) Inventors: Jerry L. Spivak, Baltimore, MD (US); CPC ...... CI2O I/6886 (2013.01); G06F 19/3431 Michael Ochs, Oreland, PA (US); (2013.01); C12O 2600/158 (2013.01); C12O Michael Considine, Belair, MD (US); 2600/16 (2013.01); C12O 2600/1 18 (2013.01) Donna Rowley, Beltsville, MD (US); Alison R. Moliterno, Baltimore, MD (US) (57) ABSTRACT (21) Appl. No.: 14/441,721 (22) PCT Fled: Nov. 8, 2013 The presently disclosed subject matter provides a genetic assay to determine the prognosis in Polycythemia Vera (PV) (86) PCT NO.: PCT/US 13/69.192 patients with an indolent form of PV. This assay involves S371 (c)(1), measuring certain messenger RNAs (mRNAs) in blood cells, (2) Date: May 8, 2015 such as white blood cells. In some embodiments, the cells are CD34+ cells. These mRNA levels are inserted into an algo Related U.S. Application Data rithm that yields a predictive score of the risk of PV in the (60) Provisional application No. 61/724,707, filed on Nov. patient transforming from an indolent form to an aggressive 9, 2012. form.

ASNSIS YERS Patent Application Publication Oct. 15, 2015 Sheet 1 of 12 US 2015/0292028A1

s Patent Application Publication Oct. 15, 2015 Sheet 2 of 12 US 2015/0292028A1

o ea w ass an kia xxx

we es an

* CONS FSA Patent Application Publication Oct. 15, 2015 Sheet 3 of 12 US 2015/0292028A1

POESOEZ BOOLEDGES HEROE (ZZ XEESPORYA Z ARESSSBSEASE22222222222222 ROSEZŽiž 3 4 8 OGPYALUE) FIG. 3A

3E BESESS NUCEOEDEECISION REFAIRZ: AEGENCES HEHAE) GYOYSIS/GECOREOGENESISz ATYAMEBOSzz RATRANSPRTZZZZ

s io 5 -0GPYALE) F.G.38 Patent Application Publication Oct. 15, 2015 Sheet 4 of 12 US 2015/0292028A1

FEA Patent Application Publication Oct. 15, 2015 Sheet 5 of 12 US 2015/0292028A1

S A". S

s RS Sil (ESIS

recurroceseSESSESSEESS grossroorgos seasora reseatsasareasoostes' BSFEFGF saxerxes SSS" FG,

ESEPF38

Patent Application Publication Oct. 15, 2015 Sheet 6 of 12 US 2015/0292028A1

RISCR in fSis EE CSFfy

/ S S. Patent Application Publication Oct. 15, 2015 Sheet 7 of 12 US 2015/0292028A1

s

RISE

y Patent Application Publication Oct. 15, 2015 Sheet 8 of 12 US 2015/0292028A1

REY

3. RSR

A3 SAR Y BP3 PS SA

A. t

GAS3 A. EFEP 3A OA POS HBS Patent Application Publication Oct. 15, 2015 Sheet 9 of 12 US 2015/0292028A1

PERSORE 22% ERECEPERSIGNINGAAY 22 p53 SIGNALING PATHWAYZ (CERESIS ZZZZZZ PROSATEACER EZZZZZZZ RHSGRANG PAA, 222222222 GAP NCR ZZZZZZZ FAAHESO 2222222 SAAREPAIR 222222222. G 2ZZZZZZZZ ASSIAA ZZZZZZZZZZZ: BUTENAEDATED PROEOYSIS ZZZZZZZ mRNASURVELANCE PATHWAY ZZZZZZZZ. REBOSOME BIOGENESIS INEVKARYOTES ZZZZZZZZZZZZZZZZ2 ARPA 2222222222222222222 RRARS ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ 22222222222222222222222222222222222222. 2 3 4 5 & 7 & 9 to GPYALE FIG.9A

PAE ABS ZZZZZZ ONEAR3POOL BY FOA 2ZZZ FORFYRNRPRPY ABS Z-ZZZZ SSEC PSPSERYEATESS 222222222 SPESOE (ZZZZZZZZZZZZZ PYRIEEEABS 22222222222 RBSAE ZZZZZZZZZZZZZZZ ARAS ZZZZZZZZZZZZ SAREAR 22ZZZZZZZZZZZZZZZ2. HGSEBA EZZZZZZZZZZZZZZZZZ EYE ZZZZZZZZZZZZZZZZZZZZZYZZZZZZZZZZZZZZYZZYZZZZZZZ

3 S OGP-AE FIG.98 Patent Application Publication Oct. 15, 2015 Sheet 10 of 12 US 2015/0292028A1

Lr: es s sis s s geesecreases

"esserae essesses sessessessessess 8 gramAs s essesseemss s

ey geese geesee erseeragess s grgroggers spreeger

assessessesses

elsergessesses s ae as will Patent Application Publication Oct. 15, 2015 Sheet 11 of 12 US 2015/0292028A1

(90.80)SOINT) Patent Application Publication Oct. 15, 2015 Sheet 12 of 12 US 2015/0292028A1

87||1913

SSS

SSS US 2015/0292028 A1 Oct. 15, 2015

GENETIC ASSAY TO DETERMINE inserted into an algorithm that yields a predictive score of the PROGNOSIS IN POLYCYTHEMAVERA risk of PV in the patient transforming from an indolent form PATIENTS to an aggressive form. 0006. In one aspect, the presently disclosed subject matter CROSS-REFERENCE TO RELATED provides a method for determining the likelihood of an indo APPLICATIONS lent form of Polycythemia Vera (PV) transforming to an aggressive form of PV in a subject, the method comprising: 0001. This application claims the benefit of U.S. Provi (a) measuring the gene products of PCNA, IFI30, TSN, sional Application No. 61/724,707, filed Nov. 9, 2012, which CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 in is incorporated herein by reference in its entirety. a biological sample comprising blood cells obtained from the Subject; (b) making the following comparisons of the gene FEDERALLY SPONSORED RESEARCHOR product levels measured in (a) and recording a score of 1 for DEVELOPMENT a true result and a score of 0 for a false result: PCNAdIFI30; TSN>CTSA; SMC4>CDKN1A: PCNA->CTTN; 0002 This invention was made with United States govern SONDCTTN; TIA1DMYL9; (c) adding the scores together to ment support under P01 CA108671 awarded by the National obtain an added score and calculating a ratio of the added Institutes of Health (NIH) and W81XWH-05-1-0347 score/6 to calculate a total score; and (d) using the total score awarded by the Department of Defense (DOD). The U.S. to predict if the indolent form of PV in the subject is likely to government has certain rights in the invention. transform to an aggressive form of PV in the Subject. In some embodiments, the blood cells are white blood cells. In other BACKGROUND embodiments, the blood cells are CD34+ cells. 0003 Polycythemia Vera (PV) is a hematopoietic stem cell 0007 Accordingly, in some aspects, a total score of 5/6 or disorder characterized by the increased production of red 6/6 predicts that the indolent form of PV in a subject is likely cells, white cells and platelets and complicated by thrombotic to transform to an aggressive form of PV in a subject. In other and hemorrhagic events, extramedullary hematopoiesis, and aspects, a total score of less than 5/6 predicts that the indolent transformation to myelofibrosis or acute leukemia (AML), form of PV in a subject is not likely to transform to an albeit at variable frequencies (FIG. 1) (Spivak, 2002), and aggressive form of PV in the subject. many of these clinical features are shared in common with its 0008. In another aspect, the presently disclosed subject companion myeloproliferative disorder, primary myelofibro matter provides a diagnostic kit for determining whether an sis (PMF). PV is unique since with phlebotomy alone its indolent form of PV in a subject is likely to transform to an natural history can be measured in decades. However, not all aggressive form of PV, the kit comprising a means for mea PV patients enjoy Substantial longevity or freedom from sig suring the gene product levels of PCNA, IFI30, TSN, CTSA, nificant complications but, in contrast to PMF, no satisfactory SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 and a set clinical criteria exist for stratification with respect to the risk of instructions comprising an algorithm for predicting if the of disease transformation, and usually no cytogenetic or indolent form of PV in the subject is likely to transform to an molecular markers predictive of disease transformation are aggressive form of PV. present before the event (Gaidano et al., 1997). Although 0009 Certain aspects of the presently disclosed subject JAK2V617F is expressed in both PV and PMF, these are stem matter having been stated hereinabove, which are addressed cell disorders and hematopoietic stem cells are not dependent in whole or in part by the presently disclosed subject matter, on this tyrosine kinase for either survival or proliferation other aspects will become evident as the description proceeds (Spivak, 2010), nor has the extent of JAK2 V617F expression when taken in connection with the accompanying Examples been useful for prognostic purposes (Barbui et al., 2011). and Figures as best described herein below. Bone marrow transplantation is the only curative therapy for PV (Kerbauy et al., 2007) and pegylated interferon is the only BRIEF DESCRIPTION OF THE FIGURES drug that can induce a molecular remission, although not in 0010 Having thus described the presently disclosed sub all patients (Kiladian et al., 2008). Both have significant ject matteringeneral terms, reference will now be made to the toxicities, while all chemotherapeutic drugs employed to Sup accompanying Figures, which are not necessarily drawn to press marrow and extramedullary hematopoiesis as Support scale, and wherein: ive therapy can increase the rate of leukemic transformation (0011 FIG. 1 shows the natural history of PV as shown by ten-fold (Najean and Rain, 1997: Berket al., 1981). the evolution of PV over time with transformation to myelofi 0004 For many malignancies, gene expression profiling brosis and acute leukemia in 273 PV patients; (GEP) has been a useful approach for risk stratifying cancer 0012 FIG. 2 shows quantitative real-time polymerase patients with a shared clinical or histologic phenotype chain reaction (Q-RT-PCR) confirmation of PVCD34+ cell (Radichet al., 2006), and for developing predictors of disease gene expression using the primers described in Table 1: behavior irrespective of the clinical phenotype (Lenz et al., (0013 FIGS. 3A-3B show representative KEGG pathway 2008). analysis for: A) male and B) female patient groups; 0014 FIG. 4 shows a representative Venn diagram of the SUMMARY genes differentially expressed by the 8 men and 11 women PV patients illustrating the number of genes concordantly 0005. The presently disclosed subject matter provides a differentially regulated by both sexes: genetic assay and kits to determine the prognosis in Poly 0015 FIG. 5 shows a representative dendrogram and heat cythemia Vera (PV) patients with an indolent form of PV. The map for the unsupervised hierarchical clustering of the 19 PV presently disclosed assay involves measuring certain messen patients using the 102 genes concordantly deregulated by ger RNAs (mRNAs) in blood cells. These mRNA levels are both sexes. The green color bar indicates the normal controls; US 2015/0292028 A1 Oct. 15, 2015

the blue and red color bars indicate the PV patients. For the presently disclosed subject matter pertains having the benefit heat map, red indicates decreased gene expression and green of the teachings presented in the foregoing descriptions and increased gene expression; the associated Figures. Therefore, it is to be understood that 0016 FIG. 6 shows a representative dendrogram and heat the presently disclosed subject matter is not to be limited to map for the supervised clustering of the 19 PV patients using the specific embodiments disclosed and that modifications 30 genes identified by top scoring pair analysis. The blue and other embodiments are intended to be included within the color bar indicates the 12 PV patients with indolent disease Scope of the appended claims. and the red color bar the 7 PV patients with aggressive dis ease. For the heat map, red indicates decreased gene expres I. PREDICTIVE METHODS FOR PV sion and green increased gene expression; TRANSFORMATION 0017 FIG. 7 shows a representative dendrogram and heat 0024 PV is complicated by extramedullary hematopoie map for supervised clustering of the 19 PV patients in blue sis, myelofibrosis and acute leukemia. An explanation for this and the normal controls in red using 21 genesidentified by top clinical phenotype was provided by the discovery of an acti scoring pair analysis from the 102 core gene set; with the 21 vating mutation (V617F) in JAK2 (James et al., 2005), a genes the PV patients could be separated almost completely tyrosine kinase utilized for signal transduction by the recep from the normal controls. For the heat map, red indicates tors for erythropoietin, granulocyte colony-stimulating fac decreased gene expression and green increased gene expres tor, granulocyte-macrophage colony-stimulating factor and S1On, thrombopoietin. However, the same mutation occurs in essen 0018 FIG. 8 shows a representative dendrogram and heat tial thrombocytosis (ET) and primary myelofibrosis (PMF), map for the unsupervised hierarchical clustering of the 19 PV diseases with overlapping phenotypes but distinctly different patients using the 16 gene "stromal signature. The blue color natural histories (Jones et al., 2005). While it is undisputed bar indicates the indolent patient group and the red color bar that JAK2 V617F can produce a myeloproliferative pheno aggressive patient group. For the heat map, red indicates type, how this mutation could be responsible for the patho decreased gene expression and green increased gene expres genesis of three different diseases is a conundrum not S1On, explainable by the JAK2 V617F allele burden since it over 0019 FIGS.9A-9B show a representative KEGG pathway laps substantially amongst them (Stein et al., 2010). Several analysis for: A) indolent and B) aggressive patient groups; lines of evidence Suggest that additional genetic and epige 0020 FIG. 10 shows a representative test using standards netic events are involved. For example, in PV and ET, gene for copy number calculations (absolute quantitation). Stan expression in CD34+ marrow cells was not different in JAK2 dard curves were based on log dilutions (10°-10') of plas V617F-positive and JAK2 V617F-negative patients (Berkof mids containing targeted regions of known length of each sky-Fessler et al., 2010; Catani et al., 2009), while PV clonal gene. Copy numbers were determined using calculations granulocytes do not always express JAK2 V617F (Nussenz based upon the assumption that the average weight of a base veig et al., 2007). Furthermore, JAK2 V617F expression, pair (bp) is 650 Daltons (g/mol). By utilizing Avogadro's regardless of its allelic burden, did not influence signal trans number and converting grams to nanograms, the number of duction in circulating PVCD34+ cells (Anand et al., 2011). copies of plasmid per weight in ng was calculated by the Finally, PV is more common in women (Stein et al., 2010; equation: number of copies=(amount 6.022x10°)/ Ridell et al., 2000) in whom it presents earlier (Ranjanet al., (length 1x10*650); 2013), more often with splenomegaly (Videbaek, 1950), 0021 FIGS. 11A-11B show: A) ROC curve for the prob masked erythrocytosis (Lamy et al., 1997), hepatic vein ability score assay using the test set and B) regression and thrombosis (Stein et al., 2011; Smalberg et al., 2012) and a correlation for the probability and clinical scores for the 30 lower JAK2 V617F neutrophil allele burden than men (Stein PV patient test set; and et al., 2010). 0022 FIGS. 12A-12B show: A) serial probability scores 0025 None of the observations should be surprising since over time in 5 PV patients, with none changing from an myeloproliferative disorders (MPD) are hematopoietic stem indolent to aggressive score; and B) serial probability scores cell disorders and animal studies indicate that, unlike com over time in 2 PV patients with an indolent score, with pro mitted erythroid and megakaryocytic progenitor cells, primi gression to an aggressive score over time in association with tive hematopoietic stem cells do not require JAK2 or its leukocytosis and increasing splenomegaly in one, and trans primary substrate, STAT5, for either survival or self renewal. formation to acute leukemia in the other without any other Further, clonal dominance is a characteristic feature of the clinical change. MPD, but expansion of the involved JAK2 V617 CD34+ cell population occurs more slowly than that of committed DETAILED DESCRIPTION hematopoietic progenitor cell populations, at a different rate 0023 The presently disclosed subject matter now will be in each of the MPD, and independently of JAK2 V617F described more fully hereinafter with reference to the accom homozygosity. Importantly in this regard, clonal dominance panying Figures, in which some, but not all embodiments of at the CD34+ cell level correlated better with splenomegaly, the presently disclosed Subject matter are shown. Like num leukocytosis and anemia than did the neutrophil JAK2 V17F bers refer to like elements throughout. The presently dis allele burden and was disease-specific. Finally, gene expres closed subject matter may be embodied in many different sion studies of JAK2 V617F-positive PV CD34+ marrow forms and should not be construed as limited to the embodi cells indicated dysregulation of JAK2-independent genes, ments set forth herein; rather, these embodiments are pro while in ET, gene expression in CD34+ marrow cells did not vided so that this disclosure will satisfy applicable legal differ between JAK2V617F-positive and JAK2V617F-nega requirements. Indeed, many modifications and other embodi tive ET patients. ments of the presently disclosed subject matter set forth 0026. Accordingly, to further define the molecular abnor herein will come to mind to one skilled in the art to which the malities in PV at the stem cell level, gene expression in US 2015/0292028 A1 Oct. 15, 2015

circulating CD34+ cells from nineteen JAK2 V617F-positive score of less than 5/6 predicts that the indolent form of PV in PV patients controlling for gender as a possible confounder a subject is not likely to transform to an aggressive form of PV was examined. It was observed that CD34+ cell gene expres in the subject. sion not only differed between the PV patients and the con 0032. The presently disclosed subject matter provides a 10 trols, but also differed between men and women patients. gene Screening panel comprised of PCNA (proliferating cell Based on these differences, 102 genes were identified that nuclear antigen), TSN (translin), CDKN1A (cyclin-depen concordantly differentially regulated by both men and dent kinase inhibitor 1A (p21, Cip1)), MYL9 (myosin, light women, which likely represent a core set of genes involved in chain 9, regulatory), IFI30 (interferon, gamma-inducible pro the pathogenesis of PV. tein 30), CTSA (cathepsin A), SMC4 (structural maintenance 0027. Using this gene set and several clustering algo of chromosomes 4), CTTN (cortactin), SON (SON DNA rithms, the nineteen patients could be separated into two binding protein), and TIA1 (TIA1 cytotoxic granule-associ groups that differed significantly with respect to hemoglobin ated RNA binding protein). level, thrombosis frequency, splenomegaly, splenectomy, 0033. The biomarkers of the presently disclosed subject chemotherapy exposure, leukemic transformation and Sur matter can be used in diagnostic tests to assess or determine vival. One group had a more aggressive disease with a lower whether an indolent form of PV in a patient will transform to hemoglobin level, more thromboembolic events, larger an aggressive form of PV. In other embodiments, the biom spleens, a greater frequency of chemotherapy and splenec arkers may be used to determine if a patient has PV. tomy and a higher mortality rate despite having a JAK2 0034. The indolent form of PV is characterized by the V617F allelic burden similar to the other group. Using a unregulated production of red cells, white cells and platelets. Supervised approach, a 19 gene profile was defined, which PV patients afflicted with the indolent form of PV may be also segregated the PV patients with aggressive disease from asymptomatic or may show milder symptoms of the disease. those with a more indolent phenotype with 100% accuracy. In contrast, patients with the aggressive form show more 0028 Based on these 19 genes, a smaller gene panel was severe symptoms, such as thrombotic and hemorrhagic derived consisting of the 10 genes (PCNA, IF130, TSN, events, extramedullary hematopoiesis, myelofibrosis and CTSA, SMC4, CDKN1A, CTTN, SON, TIA1 and MYL9) acute leukemia, albeit at varying frequencies. for establishing the probability that a PV patient has an 0035. The blood cells can be obtained from different aggressive or indolent form of the disease using Q-RT-PCR Sources in a Subject. In some embodiments, the biological and scoring 1 for true and 0 for false. If PCNADIF30; sample comprises peripheral blood or bone marrow. In some TSN>CTSA SMC4DCDKN1A: PCNA-CTTN; embodiments, the blood cells are white blood cells. In other SONDCTTN; and TIA1 >MYL9, the probability that the dis embodiments, the blood cells are CD34+ cells. ease is aggressive is the total score/6. After developing abso 0036. In some embodiments, the subject is mammalian. In lute copy number standard Ct curves for the 10 genes, the other embodiments, the Subject is human. behavior of this screen on the training set PV patients was 0037. In further embodiments, the expression products of verified. PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 are measured. In other embodiments, one 0029. Further, the predictability of the screen was tested or more of these expression products are substituted with using CD34+ cell RNA from twenty-three PV patients. The other expression products that have both correlated expres presently disclosed subject matter provides a molecular sion and the same category of biological function. method for risk stratification in PV that reflects clinical phe 0038. In some embodiments, the expression products of notype and anticipates disease transformation with a high the relevant genes are measured by determining RNA levels. degree of certainty. The data herein indicate that it is now In further embodiments, the expression products are mea possible to use gene expression to identify those PV patients sured by determining mRNA expression levels. Generally, in most likely to benefit from early institution of definitive a first step, the total RNA is isolated from a biological sample. therapy. The methods for RNA extraction are well known in the art. 0030. Accordingly, in some embodiments, the presently 0039 Methods for measuring mRNA levels include meth disclosed subject matter provides a method for determining ods based on hybridization analysis of polynucleotides as the likelihood of an indolent form of Polycythemia Vera (PV) well as methods based on sequencing of polynucleotides. transforming to an aggressive form of PV in a Subject, the These methods include, but are not limited to, northern blot method comprising: (a) measuring the gene products of ting, in situ hybridization, RNase protection assays, reverse PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, transcription polymerase chain reaction (RT-PCR), real-time TIA1, and MYL9 in a biological sample comprising blood PCR (QPCR), antibodies that can recognize specific duplexes cells obtained from the subject; (b) making the following (DNA duplexes, RNA duplexes, DNA-RNA hybrid duplexes, comparisons of the gene product levels measured in (a) and DNA-protein duplexes, for example), sequence-based gene recording a score of 1 for a true result and a score of 0 for a expression analysis including Serial Analysis of Gene false result: PCNAdIFI30; TSN >CTSA; SMC4>CDKN1A: Expression (SAGE), and gene expression analysis by mas PCNA-CTTN; SONDCTTN; TIA1 dMYL9; (c) adding the sively parallel signature sequencing (MPSS). scores together to obtain an added score and calculating a 0040. In some embodiments, the mRNA expression levels ratio of the added score/6 to calculate a total score; and (d) are measured by using reverse transcription PCR (RT-PCR). using the total score to predict if the indolent form of PV in the Commonly used reverse transcriptases are avilo myeloblas subject is likely to transform to an aggressive form of PV in tosis virus reverse transcriptase (AMV-RT) and Moloney the subject. murine leukemia virus reverse transcriptase (MLV-RT). The 0031. In such embodiments, a total score of 5/6 or 6/6 reverse transcription step is typically primed using specific predicts that the indolent form of PV in a subject is likely to primers, random hexamers, or oligo-dT primers. The RT-PCR transform to an aggressive form of PV in the subject. A total reaction reverse transcribes the RNA template into cDNA. US 2015/0292028 A1 Oct. 15, 2015

0041. In still further embodiments, the mRNA expression A particular subject may have one or more than one of the levels are measured by using reverse transcription PCR (RT symptoms. In some embodiments, the indolent form of PV is PCR) followed by real-time PCR (Q-PCR). In the Q-PCR characterized by at least one of symptom selected from the reaction, the cDNA produced from the RT-PCR is amplified group consisting of increased production of red cells, and simultaneously quantified. The PCR step can use a vari increased production of white cells, increased production of ety of thermostable DNA-dependent DNA polymerases, such platelets, itching, gouty arthritis peptic ulcer disease, as Taq DNA polymerase, which has a 5'-3' nuclease activity enlarged liver or spleen, elevated hemoglobin levels, and low but lacks a 3'-5' proofreading endonuclease activity. Two erythropoietin levels in a subject. oligonucleotide primers are used to generate a PCR product. 0048. The aggressive form of PV in a subject is generally A third oligonucleotide, or probe, is designed to detect the characterized by more serious symptoms, some of which are PCR product. life threatening. In some embodiments, the aggressive form 0042 Generally, primer design or determining which of PV is characterized by at least one symptom selected from sequences to use for making a primer is well known in the art. the group consisting of thrombosis, heart attack, stroke, Computer programs are available to determine if a set of Budd-Chiari syndrome, myelofibrosis and acute leukemia nucleotides in a polynucleotide is optimal for initiating a PCR (AML) in a subject. reaction. Therefore, different primers can be used to initiate a PCR reaction and to detect a specific gene product. As such, 0049 PV is chronic disorder, which has a very variable the expression products of the presently disclosed subject clinical course depending on the host response to the malig matter can be detected using different primers and the pres nant clone (Spivak, 2002). In many patients, the disease ently disclosed subject matter is not limited to a specific set of remains indolent with only a requirement for phlebotomy primers. therapy to control red cell mass expansion and prevent throm botic events. In other patients, there is inexorable expansion 0043. In other embodiments, the expression products of of the malignant clone with massive splenomegaly for which PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, the treatment options include bone marrow transplantation, TIA1, and MYL9 are measured by determining protein interferon or potentially leukemogenic chemotherapy, of expression levels. Examples of detection methods for pro which the latter is at best palliative and may actually shorten teins include, but are not limited to, immunohistochemical survival (Berket al., 1981; Gruppo, 1995). To date, there is no assays, Western blot analyses, ELISAS, polyacrylamide gels, way to anticipate how the disease will evolve clinically. How and protein activity assays. Other detection methods are well ever, the presently disclosed methods can anticipate disease known in the art and include methods that are not and need not transformation and, based on this, are useful for determining be stated here. which PV patients would most benefit from the institution of 0044. In some embodiments, the expression products are definitive therapy, Such as interferon or bone marrow trans expression products of variants or fragments of PCNA, IFI30, plantation before clonal expansion is too far advanced. Cur TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, or rently the only curative therapy for PV is bone marrow trans MYL9. Therefore, a gene or gene product comprising vari plantation and the only therapy capable of inducing ants of polynucleotides according to the presently disclosed molecular remission is pegylated interferon, both of which subject matter include, but are not limited to, nucleotide have significant toxicities. All chemotherapeutic drugs used sequences which are at least 70% identical, e.g., at least 75%, to Suppress marrow and extramedullary hematopoiesis 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, increase the basal rate of leukemic transformation ten-fold or 98%, or 99% identical to the nucleotide sequence of PCNA, greater. For example, despite the lack of evidence-based data IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, (Spivak, 2002; Spivak and Hasselbalch, 2011), hydroxyurea or MYL9 may be substituted for PCNA, IFI30, TSN, CTSA, is considered to be the first-line drug of choice for PV man SMC4, CDKN1A, CTTN, SON, TIA1, or MYL9. In other agement, particularly in patients older than 65 years of age embodiments, more than one gene may be substituted. (Barbui et al., 2011). Unfortunately, hydroxyurea is leuke 0045. The biological samples used to obtain the RNA of mogenic (Najean and Rain, 1997; Kiladian et al., 2011) and the relevant genes can be any part of a Subject that comprises both age over 60 (McNally et al., 1997) and PV predispose to blood cells. In some embodiments, the biological sample acute leukemia (Berket al., 1981), creating a triply dangerous comprises peripheral blood or bone marrow. In other embodi situation for older PV patients since, in contrast to sickle cell ments, the biological sample comprises blood cells that are disease, a nonclonal disorder in which hydroxyurea improves white blood cells. In still other embodiments, the biological Survival, hydroxyurea neither prevents major vessel arterial sample is comprised of unpurified white blood cells. In fur or venous thrombosis (Harrison et al., 2005) nor improves ther embodiments, the biological sample is comprised of survival in PV (Najean and Rain, 1997). Therefore, the pres CD34+ cells isolated from unpurified circulating white blood ently disclosed methods, which identify PV patients with cells. In still further embodiments, circulating CD34+ cells nonaggressive disease can improve patient safety as well as are quantitated clinically by flow cytometry in a pretest step. reduce drug costs. In this regard, the presently disclosed 0046. In some embodiments, the RNA from a subject is methods can also be used to screen patients for the appropri not purified before being used in the presently disclosed ate use of ruxolitinib when that drug is approved for therapy methods. In other embodiments, total RNA, such as from in PV. Thus, a method to predict transformation risk is very unseparated peripheral blood mononuclear cells or from iso useful to avoid unnecessary exposure to toxic therapies. In lated neutrophils, is used in the presently disclosed assays Some embodiments, the presently disclosed methods are used without being purified. In the former case, with respect to the more than once with a patient to follow PV in the patient. For issue of sample dilution and assay sensitivity, the rate limiting example, the assay can be used for the first time as a baseline step would still be the number of circulating CD34+ cells. testand then can be used longitudinally as clinically indicated 0047. The indolent form of PV in a subject is characterized by a rising leukocyte count or advancing splenomegaly, two by many symptoms, both general and specific for the disease. signs of potentially aggressive behavior in PV. In other US 2015/0292028 A1 Oct. 15, 2015

embodiments, the presently disclosed methods display a sen 0053 As used herein, the term “level of expression” of a sitivity of at least 80% and a specificity of at least 90%. In biomarker refers to the amount of biomarker detected. Levels Some embodiments, the method further comprises informing of biomarker can be detected at the transcriptional level, the the subject or a treating physician of the likelihood of the translational level, and the post-translational level, for indolent form of PV transforming to an aggressive form of PV example. “mRNA expression levels' refers to the amount of in the subject. In other embodiments, the method is used to mRNA detected in a sample and “protein expression levels' determine if a subject should undergo further therapy for PV. refers to the amount of protein detected in a sample. In still other embodiments, the method further comprises 0054 As used herein, the term “microarray refers to an treating the patient with further therapy for PV. In further ordered arrangement of hybridizable array elements, prefer embodiments, the therapy is selected from the group consist ably polynucleotide probes, on a Substrate. ing of bone marrow transplantation, pegylated interferon, 0055 As used herein, the term “polynucleotide’ generally chemotherapy, and ruXolitinib. refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or II. KITS FOR PREDICTING PV DNA. TRANSFORMATION 0056. As used herein, the term "oligonucleotide' refers to 0050. The presently disclosed subject matter also relates a relatively short polynucleotide. This includes, without limi to kits for determining if the indolent PV in a subject will tation, single-stranded deoxyribonucleotides, single- or transform to an aggressive form of PV. In general, a presently double-stranded ribonucleotides, RNA:DNA hybrids and disclosed kit contains some or all of the components, double-stranded DNAs. reagents, Supplies, and the like to practice a method according 0057. As used herein, the term “gene product” refers to to the presently disclosed subject matter. In some embodi biochemical material. Such as RNA or protein, resulting from ments, the term "kit' refers to any intended any article of expression of a gene. A measurement of the amount of gene manufacture (e.g., a package or a container) comprising a product is sometimes used to infer how active a gene is at a means for detecting the gene products of PCNA, IFI30, TSN, particular time. CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9 0058. The term “percent identity, as known in the art, is a and a set of particular instructions for practicing the methods relationship between two or more polypeptide sequences or of the presently disclosed subject matter. In other embodi two or more polynucleotide sequences, as determined by ments, the set of particular instructions includes the algorithm comparing the sequences. In the art, “identity also means the for predicting whether the indolent PV in a subject will trans degree of sequence relatedness between polypeptide or poly form to aggressive PV. In some embodiments, the kit com nucleotide sequences, as the case may be, as determined by prises components that detect the levels of RNA transcripts, the match between strings of Such sequences. “Identity” and Such as mRNA transcripts. For example, the kit may comprise “similarity” can be readily calculated by known methods, the primers necessary to detect the mRNA levels of PCNA, including but not limited to those described in: Computa IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, tional Molecular Biology (Lesk, A. M., ed.) Oxford Univer and MYL9, the enzymes necessary to perform reverse tran sity Press, New York (1988); Biocomputing: Informatics and Scription and PCR amplification, such as a polymerase and a Genome Projects (Smith, D. W., ed.) Academic Press, New reverse transcriptase, deoxynucleotides, and a buffer. In other York (1993); Computer Analysis of Sequence Data, Part I embodiments, the kit comprises components that detect the (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New protein expression levels of PCNA, IFI30, TSN, CTSA, Jersey (1994); Sequence Analysis in Molecular Biology (von SMC4, CDKN1A, CTTN, SON, TIA1, and MYL9. The kit Heinje, G., ed.) Academic Press (1987); and Sequence Analy provided may be an ELISA kit comprising antibodies to the sis Primer (Gribskov, M. and Devereux, J., eds.) Stockton biomarkers of the presently disclosed subject matter. In still Press, New York (1991). Preferred methods to determine other embodiments, the kit is a diagnostic kit that determines identity are designed to give the best match between the whether an indolent form of PV in a subject is likely to sequences tested. Methods to determine identity and similar transform to an aggressive form of PV, the kit comprising a ity are codified in publicly available computer programs. means for measuring the gene product levels of PCNA, IFI30, Sequence alignments and percent identity calculations may TSN, CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and be performed using the Megalign program of the LASER MYL9 and a set of instructions comprising an algorithm for GENE bioinformatics computing suite (DNASTAR Inc., predicting if the indolent form of PV in the subject is likely to Madison, Wis.). Multiple alignment of the sequences may be transform to an aggressive form of PV. performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default III. DEFINITIONS parameters, including default parameters for pairwise align 0051. Unless defined otherwise, all technical and scien ments. Useful examples of percent sequence identities tific terms used herein have the meaning commonly under include, but are not limited to, 50%, 55%, 60%, 65%, 70%, stood by a person skilled in the art to which this invention 75%, 80%, 85%, 90%, or 95%, or any integer percentage belongs. from 50% to 100%. These identities can be determined using 0052. As used herein, the term “biomarker” refers to any any of the sequence analysis Software described herein. gene, RNA or protein whose level of expression in a cell or 0059. The term “sequence analysis software” refers to any tissue is altered in some way compared to that of a normal or computer algorithm or software program that is useful for the healthy cell or tissue. In some embodiments, the amount of analysis of nucleotide or amino acid sequences. “Sequence biomarker may be changed. In other embodiments, the biom analysis software may be commercially available or inde arker may be differentially modified in some way. Biomark pendently developed. Typical sequence analysis Software will ers of the presently disclosed subject matter are selective for include but is not limited to the GCG suite of programs PV. (Wisconsin Package Version 9.0, Genetics Computer Group US 2015/0292028 A1 Oct. 15, 2015

(GCG), Madison, Wis.), BLASTP. BLASTN, BLASTX ing in length from at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, (Altschuletal. (1990).J. Mol. Biol. 215:403-410, and DNAS 24, 25, 30, 39, 40, 42, 45,48, 50,51,54, 57, 60, 63, 66, 70, 75, TAR (DNASTAR, Inc., Madison, Wis.). Within the context of 78, 80,90, 100,105,120, 135, 150, 200, 300, 500, 720,900, this application it will be understood that where sequence 1000 or 1500 consecutive nucleotides of a nucleic acid analysis Software is used for analysis, that the results of the according to the presently disclosed Subject matter. analysis will be based on the “default values” of the program 0.066 Such fragments may be “free-standing, i.e. not part referenced, unless otherwise specified. As used herein of or fused to other polynucleotides, or they may be com “default values' will mean any set of values or parameters prised within a single larger polynucleotide of which they which originally load with the software when first initialized. form a part or region. Indeed, several of these fragments may 0060. The term “primer' denotes a specific oligonucle be present within a single larger polynucleotide. otide sequence which is complementary to a target nucleotide sequence and used to hybridize to the target nucleotide 0067. The term “predictive” or “predictability” is used sequence. A primer serves as an initiation point for nucleotide herein to refer to the likelihood that a patient will respond polymerization catalyzed by DNA polymerase, RNA poly either favorably or unfavorably to therapy. Therapy includes, merase, or reverse transcriptase. but is not limited to, drugs, Surgical intervention, chemo 0061 The term “probe' denotes a defined nucleic acid therapy, radiation therapy, and bone marrow transplants. segment which can be used to identify a specific polynucle 0068. As used herein, the terms “treat,” “treating.” “treat otide sequence present in samples, wherein the nucleic acid ment, and the like, are meant to decrease, Suppress, attenu segment comprises a nucleotide sequence complementary to ate, diminish, arrest, the underlying cause of a disease, disor the specific polynucleotide sequence to be identified. der, or condition, or to stabilize the development or 0062. The terms “complementary' or “complement progression of a disease, disorder, condition, and/or symp thereof are used herein to refer to the sequences of poly toms associated therewith. It will be appreciated that, nucleotides that are capable of forming Watson & Crick base although not precluded, treating a disease, disorder or condi pairing with another specified polynucleotide throughout the tion does not require that the disease, disorder, condition or entirety of the complementary region. For the purpose of the symptoms associated therewith be completely eliminated. presently disclosed subject matter, a first polynucleotide is 0069. As used herein, the terms “prevent.” “preventing.” deemed to be complementary to a second polynucleotide “prevention.” “prophylactic treatment” and the like refer to when each base in the first polynucleotide is paired with its complementary base. Complementary bases are, generally, A reducing the probability of developing a disease, disorder, or and T (or A and U), or Cand G. "Complement' is used herein condition in a subject, who does not have, but is at risk of or as a synonym from “complementary polynucleotide.” Susceptible to developing a disease, disorder, or condition. “complementary nucleic acid' and "complementary nucle 0070. As used herein, the term “diagnosing refers to the otide sequence'. These terms are applied to pairs of poly process of attempting to determine or identify a disease or nucleotides based solely upon their sequences and not any disorder. particular set of conditions under which the two polynucle 0071. As used herein, the term “comparing refers to mak otides would actually bind. ing an assessment of how the proportion, level or cellular 0063. The terms “base paired” and “Watson & Crick base localization of one or more biomarkers in a sample from a paired are used interchangeably herein to refer to nucle patient relates to the proportion, level or cellular localization otides which can be hydrogen bonded to one another by virtue of the corresponding one or more biomarkers in a standard or of their sequence identities in a manner like that found in control sample. For example, "comparing may refer to double-helical DNA with thymine or uracil residues linked to assessing whether the proportion, level, or cellular localiza adenine residues by two hydrogen bonds and cytosine and tion of one or more biomarkers in a sample from a patient is guanine residues linked by three hydrogen bonds (See Berget the same as, more or less than, or different from the propor al. (2011) Biochemistry, 7" revised international ed., ISBN tion, level, or cellular localization of the corresponding one or 10:1429276355). more biomarkers in standard or control sample. More specifi 0064 Variants of polynucleotides, as the term is used cally, the term may refer to assessing whether the proportion, herein, are polynucleotides that differ from a reference poly level, or cellular localization of one or more biomarkers in a nucleotide. A variant of a polynucleotide may be a naturally sample from a patient is the same as, more or less than, occurring variant such as a naturally occurring allelic variant, different from or otherwise corresponds (or not) to the pro or it may be a variant that is not known to occur naturally. portion, level, or cellular localization of predefined biomarker Such non-naturally occurring variants of the polynucleotide levels that correspond to, for example, a patient having an may be made by mutagenesis techniques, including those indolent form of PV that is likely to transform to an aggressive applied to polynucleotides, cells or organisms. Generally, form of PV, not having an indolent form of PV that is likely to differences are limited so that the nucleotide sequences of the transform to an aggressive form of PV, is responding to treat reference and the variant are closely similar overall and, in ment for PV, is not responding to treatment for PV, is/is not many regions, identical. likely to respond to a particular PV treatment, or having/not 0065. A polynucleotide fragment refers to a nucleotide having another disease or condition. In a specific embodi sequence of reduced length relative to the reference nucleic ment, the term "comparing refers to assessing whether the acid and comprising, over the common portion, a nucleotide level of one or more biomarkers of the presently disclosed sequence identical to the reference nucleic acid. Such a Subject matter in a sample from a patient is the same as, more nucleic acid fragment according to the presently disclosed or less than, different from other otherwise correspond (or Subject matter may be, where appropriate, included in a larger not) to levels of the same biomarkers in a control sample (e.g., polynucleotide of which it is a constituent. Such fragments predefined levels that correlate to uninfected individuals, comprise, or alternatively consist of oligonucleotides rang standard PV levels, and the like). US 2015/0292028 A1 Oct. 15, 2015

0072. As used herein, the term “transform' means that the 0077. The term “training set refers to a group of patients condition that is being transformed changes in some way. For that is used to develop the assay. The testing set is a different example, the indolent form of PV can change to the aggres group of patients with the same disease used to validate the sive form of PV. assay (i.e. reproduce the results). 0073. As used herein, the terms “indicates' or “correlates' 0078. The terms “measuring and “determining are used (or “indicating or “correlating,” or “indication' or “correla interchangeably throughout, and refer to methods which tion.” depending on the context) in reference to a parameter, include obtaining a patient sample and/or detecting the level e.g., a modulated proportion, level, or cellular localization in of a biomarker(s) in a sample. In one embodiment, the terms a sample from a patient, may mean that the patient has an refer to obtaining a patient sample and detecting the level of indolent form of PV that is likely to transform to an aggressive one or more biomarkers in the sample. In another embodi form of PV. In specific embodiments, the parameter may ment, the terms “measuring and “determining” mean detect comprise the level of one or more biomarkers of the presently ing the level of one or more biomarkers in a patient sample. disclosed Subject matter. A particular set or pattern of the Measuring can be accomplished by methods known in the art amounts of one or more biomarkers may indicate that a and those further described herein. The term “measuring is patient has an indolent form of PV that is likely to transform also used interchangeably throughout with the term “detect to an aggressive form of PV (i.e., an indolent form of PV that ing.” is likely to transform to an aggressive form of PV). In other (0079. As used herein, the term “indicative' or “likely” embodiments, a particular set or pattern of the amounts of one means that the event referred to is probable. For example, if or more biomarkers may be correlated to a patient being the methods of the presently disclosed subject matter result in unaffected (i.e., indicates a patient does not have an indolent a conclusion that the indolent form of PV in a subject is likely form of PV that is likely to transform to an aggressive form of to transforming to an aggressive form of PV in the Subject, PV). In certain embodiments, “indicating,” or “correlating.” then that means it is probable that the indolent form of PV in as used according to the presently disclosed Subject matter, the subject will transform to an aggressive form of PV. may be by any linear or non-linear method of quantifying the 0080. The terms “sample.” “patient sample.” “biological relationship between levels of biomarkers to a standard, con sample.” and the like, encompass a variety of sample types trol or comparative value for the assessment of the diagnosis, obtained from a patient, individual, or Subject and can be used prediction of PV progression or transformation, assessment in a diagnostic or monitoring assay. The patient sample may ofefficacy of clinical treatment, identification of a patient that be obtained from a healthy Subject, a diseased patient or a may respond to a particular treatment regime or pharmaceu patient having associated symptoms of PV. Moreover, a tical agent, monitoring of the progress of treatment, and in the sample obtained from a patient can be divided and only a context of a screening assay, for the identification of an anti portion may be used for diagnosis. Further, the sample, or a PV therapeutic. portion thereof, can be stored under conditions to maintain 0074 The terms “patient,” “individual,” or “subject” are sample for later analysis. The definition specifically encom used interchangeably herein, and refer to a mammal, particu passes blood and other liquid samples of biological origin larly, a human. A “subject' can include a patient afflicted with (including, but not limited to, peripheral blood, serum, or suspected of being afflicted with a condition or disease. plasma, cerebrospinal fluid, urine, Saliva, stool and synovial The patient may have mild, intermediate or severe disease. fluid), Solid tissue samples such as a biopsy specimen or The patient may be treatment naive, responding to any form tissue cultures or cells derived therefrom and the progeny of treatment, or refractory. The patient may be an individual in thereof. In a specific embodiment, a sample comprises a need of treatment or in need of diagnosis based on particular blood sample. In another embodiment, a serum sample is symptoms or family history. In some cases, the terms may used. The definition also includes samples that have been refer to treatment in experimental animals, in Veterinary manipulated in any way after their procurement, such as by application, and in the development of animal models for centrifugation, filtration, precipitation, dialysis, chromatog disease, including, but not limited to, rodents including mice, raphy, treatment with reagents, washed, or enriched for cer rats, and hamsters; and primates. Suitable animal Subjects tain cell populations. The terms further encompass a clinical include mammals including, but not limited to, primates, e.g., sample, and also include cells in culture, cell Supernatants, humans, monkeys, apes, and the like; bovines, e.g., cattle, tissue samples, organs, and the like. Samples may also com oxen, and the like; Ovines, e.g., sheep and the like; caprines, prise fresh-frozen and/or formalin-fixed, paraffin-embedded e.g., goats and the like; porcines, e.g., pigs, hogs, and the like: tissue blocks, such as blocks prepared from clinical or patho equines, e.g., horses, donkeys, Zebras, and the like; felines, logical biopsies, prepared for pathological analysis or study including wild and domestic cats; canines, including dogs; by immunohistochemistry. lagomorphs, including rabbits, hares, and the like; and I0081 Various methodologies of the instant invention rodents, including mice, rats, and the like. An animal may be include a step that involves comparing a value, level, feature, a transgenic animal. In some embodiments, the Subject is a characteristic, property, and the like, to a “suitable control.” human including, but not limited to, fetal, neonatal, infant, referred to interchangeably herein as an “appropriate control juvenile, and adult Subjects. or a “control sample. A "suitable control.” “appropriate con trol or a “control sample' is any control or standard familiar 0075. As used herein, the term “subject at risk” of getting to one of ordinary skill in the art useful for comparison pur a disease refers to estimating that a Subject will have a disease poses. In one embodiment, a “suitable control” or “appropri or disorder in the future based on the subject’s current symp ate control is a value, level, feature, characteristic, property, toms, family history, lifestyle choices, and the like. and the like, determined in a cell, organ, or patient, e.g., a 0076. As used herein, the term “disease' refers to any control or normal cell, organ, or patient, exhibiting, for condition, dysfunction or disorder that damages or interferes example, normal traits. For example, the biomarkers of the with the normal function of a cell, tissue, or organ. presently disclosed subject matter may be assayed for levels US 2015/0292028 A1 Oct. 15, 2015

in a sample from an unaffected individual (UI) or a normal bers, e.g., whole integers, including fractions thereof. Sub control individual (NC) (both terms are used interchangeably sumed within that range (for example, the recitation of 1 to 5 herein). In another embodiment, a “suitable control’ or includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5. “appropriate control' is a value, level, feature, characteristic, 2.25, 3.75, 4.1, and the like) and any range within that range. property, and the like, determined prior to performing a therapy (e.g., a PV treatment) on a patient. In yet another EXAMPLES embodiment, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic I0086. The following Examples have been included to pro or property, genotype, phenotype, and the like, can be deter vide guidance to one of ordinary skill in the art for practicing mined prior to, during, or after administering a therapy into a representative embodiments of the presently disclosed sub cell, organ, or patient. In a further embodiment, a "suitable ject matter. In light of the present disclosure and the general control’ or “appropriate control' is a predefined value, level, level of skill in the art, those of skill can appreciate that the feature, characteristic, property, and the like. A 'suitable con following Examples are intended to be exemplary only and trol can be a profile or pattern of levels of one or more that numerous changes, modifications, and alterations can be biomarkers of the presently disclosed subject matter that cor employed without departing from the scope of the presently relates to the presence of an indolent form of PV that is likely disclosed Subject matter. The synthetic descriptions and spe to transform to an aggressive form of PV, to which a patient cific examples that follow are only intended for the purposes sample can be compared. The patient sample can also be of illustration, and are not to be construed as limiting in any compared to a negative control, i.e., a profile that correlates to manner to make compounds of the disclosure by other meth not having an indolent form of PV that is likely to transform ods. to an aggressive form of PV. Example 1 0082 Following long-standing patent law convention, the terms “a,” “an and “the refer to “one or more' when used in this application, including the claims. Thus, for example, Methods reference to “a subject' includes a plurality of subjects, unless I0087. The study protocol was approved by the Johns Hop the context clearly is to the contrary (e.g., a plurality of kins University Institutional Review Board and written Subjects), and so forth. informed consent was obtained from each patient in accor 0083. Throughout this specification and the claims, the dance with the Helsinki Declaration. Patients were undergo terms “comprise.” “comprises, and “comprising are used in ing diagnostic or therapeutic phlebotomy. The diagnosis of a non-exclusive sense, except where the context requires oth PV was based on the Polycythemia Vera Study Group criteria erwise. Likewise, the term “include and its grammatical (Wasserman, 1971). Patient accrual was solely predicated on variants are intended to be non-limiting, such that recitation obtaining sufficient peripheral blood CD34+ cells for analy of items in a list is not to the exclusion of other like items that sis. Clinical data including cell counts, spleen size, history of can be substituted or added to the listed items. thromboembolic events, chemotherapy and splenectomy 0084. For the purposes of this specification and appended were extracted from patient medical records at study entry claims, unless otherwise indicated, all numbers expressing and termination. Splenomegaly was considered present if the amounts, sizes, dimensions, proportions, shapes, formula spleen was palpable on physical examination and is reported tions, parameters, percentages, parameters, quantities, char as centimeters (cm) below the left costal margin. acteristics, and other numerical values used in the specifica I0088 Neutrophil isolation and DNA preparation were per tion and claims, are to be understood as being modified in all formed as described previously (Williams et al., 2007). instances by the term “about even though the term “about Peripheral blood CD34+ cells from PV patients were isolated may not expressly appear with the value, amount or range. from Ficoll Paque-processed buffy coats (G5 Healthcare, St. Accordingly, unless indicated to the contrary, the numerical Louis, Mo.) with a purity of greater than 95% and a viability parameters set forth in the following specification and of 98% using immunomagnetic beads (Miltenyi, Auburn, attached claims are not and need not be exact, but may be Calif.) according to the manufacturers instructions, and fro approximate and/or larger or Smaller as desired, reflecting Zen at -80° C. in 10% DMSO and 90% FBS until Studied. tolerances, conversion factors, rounding off measurement I0089. The CD34+ cells were analyzed for CD34, CD38, error and the like, and other factors known to those of skill in CD33, CD41 and glycophorin expression using commer the art depending on the desired properties sought to be cially available fluorescent-labeled antibodies. Fluorescence obtained by the presently disclosed subject matter. For of at least 10,000 cells was measured on a FACS Caliber and example, the term “about, when referring to a value can be analyzed with Cellduest and Paint-a-gate software (BD Bio meant to encompass variations of, in some embodiments, sciences, San Jose, Calif.). Similar to published reports of the +100% in some embodiments +50%, in some embodiments peripheral blood CD34+ cell immunophenotype in normal +20%, in some embodiments +10%, in some embodiments individuals and MPD patients, CD34+ cells from both +5%, in some embodiments +1%, in some embodiments sources were greater than 98% CD38-positive and 85% +0.5%, and in some embodiments +0.1% from the specified CD33-positive: CD41 was expressed on less than 3% of amount, as Such variations are appropriate to perform the CD34+ cells from both sources, while glycophorin was not disclosed methods or employ the disclosed compositions. expressed by either CD34+ cell population. Cell cycle analy 0085. Further, the term “about when used in connection sis by flow cytometry using propidium iodide revealed that with one or more numbers or numerical ranges, should be 91% of the PV and 90% of the mobilized normal CD34+ cells understood to refer to all such numbers, including all numbers were in Go/G (data not shown). in a range and modifies that range by extending the bound 0090. JAK2 V617F analysis was performed using an aries above and below the numerical values set forth. The allele-specific, quantitative real-time PCR assay sensitive to recitation of numerical ranges by endpoints includes all num 5% of either the wild-type or mutant allele (Steinet al., 2010). US 2015/0292028 A1 Oct. 15, 2015

0091 For CD34+ cell isolation and analysis, peripheral and incubate with a streptavidin-phycoerythrin conjugate to blood CD34+ cells from PV patients were isolated from stain the biotinylated cRNA. The staining was amplified Ficoll Paque (G5 Healthcare, St. Louis, Mo.)-processed buffy using goat IgG as blocking reagent and biotinylated goat coats with a purity of greater than 95% and a viability of 98% streptavidin antibody, followed by a second staining step with using immunomagnetic beads (Miltenyi, Auburn, Calif.) a streptavidin-phycoerythrin conjugate. according to the manufacturers instructions, and frozen at 0.095 Fluorescence was detected using the Affymetrix -80° C. in 10% DMSO and 90% fetal bovine Serum until GS3000 GeneArray Scanner and image analysis of each studied. As controls, G-CSF mobilized peripheral blood GeneChip was done with the GeneChip Operating System CD34+ cells from three normal men and three normal women software from Affymetrix (GCOS1.1.1), using the standard were obtained from commercial sources (AllCell Technolo default settings. For comparison between different chips, glo gies LLC, Chicago, Ill. and StemCell Technologies Inc, Van bal scaling was used, Scaling all probe sets to a user-defined couver, BC). target intensity of 150. To assess the QC of the hybridization, 0092. The CD34+ cells were analyzed for CD34, CD38, chip image, and comparison between chips, the following CD33, CD41 and glycophorin expression using commer parameters were studied: the Scaling factor, related to the cially available fluorescent-labeled antibodies (Becton Dick overall intensity of the chip, to confirm the similar signal inson, San Jose Calif.). Fluorescence of at least 10,000 cells intensity and staining throughout the samples; background was measured on a FACS Caliber and analyzed with estimation of nonspecific or cross-hybridization; percentage Cellduest and Paint-a-gate software (BD Biosciences, San of transcripts that were considered significantly hybridized to Jose, Calif.). Similar to published reports of the peripheral the chip (present) by the algorithm; RNA integrity by mea blood CD34+ cell immunophenotype in normal individuals surement of the ratio of 3' to 5' regions for the housekeeping and MPD patients (Barosi et al., 2001; Andreasson et al., gene GAPDH, since its presence in the chip and a ratio close 1997), CD34+ cells from both sources were greater than 98% to 1 indicates good integrity of the target sample; spikes CD38-positive and 85% CD33-positive: CD41 was (BioB/BioC), to confirm the detection level and sensitivity expressed on less than 3% of CD34+ cells from both sources, after hybridization. while glycophorin was not expressed by either CD34+ cell 0096. To assess quality control between replicates, the population. Cell cycle analysis by flow cytometry using pro percentage of differential calls (up or down regulated) was pidium iodide revealed that 91% of the PV and 90% of the analyzed between pair-wise comparisons, and Scatter plot mobilized normal CD34+ cells were in Go/G (data not analyses from the different replicates was also conducted to shown). demonstrate reproducibility amongst the experiments. Con 0093 Total CD34+ cell RNA was isolated by the RNeasy sistently, the Pearson’s correlation coefficients obtained in technique (Qiagen, Valencia, Calif.) with an added DNAse these studies were between 0.80 and 0.95 for different com step according to the manufacturers instructions. To confirm parative analyses, and between 0.97 and 0.99 for all duplicate sample quality, duplex RT-PCR was employed to assess RNA samples. The differences in gene expression associated with integrity (Sugita et al., 2001), and the Agilent Bioanalyzer RNA amplification as opposed to the analysis of unamplified Lab on a Chip (Agilent Technologies, Inc., Santa Clara, RNA were also assessed because of the difficulty in obtaining Calif.) was used to confirm that all samples had an optimal sufficient CD34+ cell RNA for microarray analysis. The rRNA ratio (1:2, for 18S and 28S, respectively), and clean run results of this analysis indicated that 72% of the present calls patterns before microarray analysis. were conserved following amplification. 0094 For oligonucleotide microarray analysis, total RNA 0097. Using the default algorithms for image analysis pro samples were processed using the Affymetrix two-round vided by Affymetrix, approximately 30%-45% of genes rep RNA amplification protocol (Affymetrix, Santa Clara, resented in the chips were recorded as present in the RNA Calif.). Briefly, 100 ng of starting total RNA were used to samples, indicating good quality data. To achieve gene synthesize first strand cDNA using oligonucleotide probes expression signal intensity estimates with a higher precision with 24 oligo-dT plus T7 promoter as primer (Proligo LLC, and a lower false discovery rate (FDR) in differential gene Boulder, Colo.), and the SuperScript Choice System (Invit expression analysis, RMA (Robust Multiarray Analysis) was rogen, Carlsbad, Calif.). Following the double stranded used to improve the Affymetrix default algorithms. RMA also cDNA synthesis, the product was purified by Affymetrix performs quantile normalization to reduce the obscuring sample clean up columns, and unlabeled ribonucleotides variation between microarrays, which might be introduced were used in a first round of in vitro transcription cRNA during the processes of sample preparation, manufacture, amplification (MegaScript, Ambion, Austin, Tex.). The fol fluorescence labeling, hybridization and scanning. With the lowing cycle of cDNA synthesis was started with random expression signals estimated as above, a parametric empirical primers, and the oligo-dT with T7 promoter was again used as Bayes statistical modeling method, which uses a hierarchical primer at the second strand cDNA synthesis step. The ds mixture model to account for differences amongst genes in cDNA product was again column purified. Subsequently, their average expression levels and measurement fluctua biotinylated anti-sense cFNA was generated through in vitro tions, was employed for differential gene expression analysis transcription using the BioArray RNA High Yield Transcript between the PV samples and the normal controls. Based on Labeling kit (ENZO Life Sciences Inc, Plymouth Meeting, this method, posterior probabilities were obtained, from Pa.). 15ug of the biotinylated labeled cRNA was fragmented which inferences regarding differential expression patterns at 94° C. for 35 min (100 mM Tris-acetate, pH 8.2, 500 mM could be made. Specifically, the standard rule of a posterior KOAc, 150 mMMgOAC), and bug of total fragmented cRNA probability of >0.5 was taken to assert significance in differ was hybridized to the Affymetrix human genome GeneChip ential gene expression and minimize the false discovery rate. array U133A for 16 hr at 45° C. with constant rotation (60 (0098. For Q-RT-PCR validation of the microarray results, rpm). The Affymetrix Fluidics Station 450 was then used to additional CD34+ cell samples were analyzed from a subset wash and stain the chips, remove the non-hybridized target of the patients by real-time PCR (Q-RT-PCR) without prior US 2015/0292028 A1 Oct. 15, 2015

RNA amplification. For the mRNA transcripts, first-strand Example 2 cDNA synthesis was carried out on RNA extracted from the cells with the TaqMan Reverse Transcription Reagents kit Characteristics of Patients (Applied Biosystems, Carlsbad, Calif.) using the oligod (T) 0102 The clinical features of the 19 patients are listed in RT primer following the manufacturer's Suggested protocol. Tables 2 and 3. Median age and disease duration were not To quantitate miR-21 expression, CD34+ cell RNA was iso different between the men and women. All patients expressed lated using the mirVana miRNA Isolation Kit (Applied Bio JAK2V617F and the median neutrophilallele burdens in men systems) following the manufacturer's procedure for total (94%) and women (100%) were also similar; in 13, the RNA isolation. The TaqMan MicroRNA Reverse Transcrip median CD34+ cell JAK2 V617F allele burden was 82% tion Kit (Applied BioSystems) was used as directed to gener (range 50-100%, data not shown), indicating clonal domi ate cDNA. Q-RT-PCR was carried out using the gene expres nance at both the progenitor cell and neutrophil levels (Mo sion GEX or microRNA assays (Applied Biosystems) listed literno et al., 2008; Steinet al., 2011). The two groups differed in Table 1. Duplicate 20 ul reactions were set up using the significantly (p=0.016) only with respect to their platelet TaqMan(R) Universal PCR Master Mix, No Amplerase RUNG counts, with men having a lower median platelet count (421. (2x), and performed on an Applied Biosystems 7500 000x10/uL) than the women (948,000x10/uL), which may sequence detection system using the default “standard 7500 reflect a gender-related difference (Segal and Moliterno, PCR conditions (95°C. for 10 minutes followed by 40 cycles 2006). of 95°C. for 15 seconds and 60° C. for 1 minute). For each Example 3 GEX primer/probe set, a standard curve with known relative concentrations of RNA from eitherapatient or normal control Gene Expression in Men and Women Patients sample was used to calculate reaction efficiency and quanti (0103) Given the differences in disease behavior between tate the reaction products. GAPDH reactions were run in men and women PV patients, it was hypothesized that there parallel samples on the same assay plate. All the GEXQ-RT could be gender-specific differences in gene expression inde PCR results were calculated using the “Standard Curve pendent of JAK2 V617F expression. Therefore, patient gene Assay” program of the 7500 SDS system (Applied Biosys expression was compared with controls of the corresponding tems) and normalized to the GAPDH (glyceraldehyde-3- gender and it was found that there was differential gene phosphate dehydrogenase) and the data are shown in FIG. 2. expression in women patients compared to men, with 251 For the miR-21 primer/probe set, relative quantitation using genes differentially regulated (126 up and 109 down) in the AAC, calculation method was utilized rather than a stan women (Table 4) compared to 535 genes (486 up and 85 dard curve. U6 RNA was the reference RNA. down) in the men (Table 5). Despite a smaller number of 0099 For supervised analysis, EBarrays analysis was per deregulated genes, KEGG analysis revealed that over three formed for male and female patients separately. The 549 times as many molecular pathways were activated in the probes that showed a posterior probability greater than 0.5 of women patients, including one, the pentose phosphate path differential expression between aggressive and indolent phe way, which was not activated in any male patient (FIGS. notypes in both male and female patients were retained for 3A-3B). further analysis. Further analysis of these 549 probes Example 4 included both genders. 0100 Top-scoring pair analysis (Tan et al., 2005) was run Identification of Concordantly Deregulated Genes by on the 549 probes and the top 30 top-scoring pairs (TSPs) the Men and Women Patients were retained. As some genes had duplicate probes, the R 0104 Subtracting genes whose expression was gender limma package was used, an empirical Bayes test was applied specific left 102 genes (68 up regulated and 34 down regu to this data (now both genders), and the highest scoring probe lated), whose differential expression was concordant in both for each gene was retained. The list of TSPs was sorted by the men and women (FIG. 4), and could represent a core set of average difference between aggressive and indolent pheno genes involved in the pathogenesis of PV. Gene expression type for that TSP and the six best TSPs were retained. The was validated for 8 of the 102 genes by Q-RT-PCR (Table 1) validation cohort was analyzed using Q-RT-PCR with probes using CD34+ cells from a subset of the patients, and there was designed to the genes in the retained TSPs. ROC analysis was good correlation between the observed microarray gene performed. The AUC for all cases was 0.94, while the AUC expression changes and the Q-RT-PCR measurements (FIG. excluding AML cases was 0.925. The best point for calls in 2). both cases was setting the call of aggressive phenotype at 5 positive TSP calls, with sensitivity of 0.9 and 0.875 and Example 5 specificity of 1.0 and 1.0, respectively. The PPV at this thresh old was 1.0 in both cases, and the NPV was 0.95 in both cases. Unsupervised Hierarchical Clustering Using the 102 A similar approach was used for the Supervised analysis of the Concordantly Deregulated Genes 19 PV patients and the 6 normal controls. 0105 Unsupervised hierarchical clustering was employed 0101 Gene annotations were developed by collating data to determine if the 102 core gene set segregated the PV from the following databases: OMIM, Gene, KEGG, Ace patients from the normal controls. As shown in FIG. 5, the PV View, GO Ontology and IPA (Ingenuity Systems, Redwood patients clustered into two distinct groups, one of which clus City, Calif.). The microarray data were deposited in the Gene tered independently from the controls and demonstrated het Expression Omnibus MIAME compliant database (Series erogeneity with respect to core gene expression, while the number GSE47018) (Edgar et al., 2002). other was more homogeneous and overlapped with the con US 2015/0292028 A1 Oct. 15, 2015

trols. Table 6 lists the clinical features of the two patient while only 149 genes were differentially regulated (68 up and groups, which did not differ with respect to age, JAK2V617F 81 down regulated) in the aggressive group (Table 9). Fur neutrophil allele burden, leukocyte and platelet counts or thermore, the two groups also differed markedly with respect clonal dominance. However, they did differ statistically with to expression of the 102 core genes (Tables 10 and 11). KEGG respect to disease duration, hemoglobin level, thromboembo analysis (FIGS. 9A-9B) emphasized the predominance of lic events, palpable splenomegaly, splenectomy, chemo deregulated molecular pathways involving DNA and RNA therapy exposure, leukemic transformation and Survival, metabolism and function in both groups but histone gene indicating that disease behavior was aggressive in one group deregulation predominated in the aggressive group. and indolent in the other. 0106 To validate the unsupervised hierarchical clustering, Example 8 a Supervised approach based on top-scoring pairs was used (Tan et al., 2005). A 30 gene set was identified, none of which Expression of PV Core Genes in the Chronic and were in the 102 core gene set, which segregated the patients Blast Crisis Phases of Chronic Myelogenous into the same aggressive and indolent clinical groups with Leukemia 100% accuracy, validating the unsupervised hierarchical clustering results (FIG. 6). 0111 Finally, to determine if the gene expression changes in the 102 core genes were unique to PV or a nonspecific Example 6 consequence of constitutive tyrosine kinase activation, the expression of these genes was examined in the chronic and Annotation of the 102 Concordantly Deregulated blast crisis phases of chronic myelogenous leukemia (CML) Genes (Bruns et al., 2009; Diaz-Blanco et al., 2007: Graham et al., 2007: Nowicki et al., 2003; Zheng et al., 2006; Yamamoto 0107 Annotation of the 102 genes is provided in Table 7. Sugitani et al., 2011; Nakahara et al., 2010), a disease char Of note, there was differential regulation of the stem cell acterized by constitutive tyrosine kinase signaling in which maintenance genes HES1, HOXA9, PTGER4 and NR4A2, STAT5 phosphorylation has a central role in disease patho the master transcription factor SOX4 and the oncogenes genesis (Horita et al., 2000; Hantschel et al., 2012). As shown SETBP1 and miR-21. Eight antiapoptotic genes, LEPR, in Table 12, there was concordant up regulation of 16 PV core CKAP4, RRAS2, TIMP1, IER3. THSB1, POSTN, and genes in chronic phase CML, with concordant down regula LGALS3, were up regulated while five proapoptotic genes, tion of 9. This pattern was reversed in CML blast crisis, with EIF5A, EMP1, ZFP36L2, LUC7L3, HLF and HOPX and up regulation of 6 down regulated PV core genes, including three tumor suppressor genes, SSBP2, TLE4 and KLF6 were the oncogene SETBP1, and down regulation of 11 up regu down regulated. lated PV core genes. Listed are 55 genes from the 102 core PV 0108 Importantly, consistent with the propensity for gene set showing their regulation in chronic phase and blast myelofibrosis in PV, there was up regulation of 16 extracel phase CML (Bruns et al., 2009; Diaz-Blanco et al., 2007: lular matrix genes, including six collagen genes (COL1A1, Graham et al., 2007: Nowickiet al., 2003; Zheng et al., 2006: COL1A2, COL3A1, COL4A1, COL4A2 and COL6A3), and Yamamoto-Sugitani et al., 2011; Nakahara et al., 2010). the matricellular genes SPARC, POSTN, TIMP1, THES1, White background indicates concordant regulation in P and HSPE, FN1, S1OOA9, EFEMP1, LGALS3, and LTBP3, essentially comprising a "stromal gene signature’. Further grey background indicates discordant regulation in PV. more, given the inflammatory milieu that characterizes the Example 9 MPD (Slezak et al., 2009; Verstovsek et al., 2010), there was increased expression of 10 cytokine and inflammatory media tor genes, CCL3 (MIP1-C), CCL5 (RANTES), CXCL5, Discussion of Gene Expression Profiling in PV SERPINE1 (PAI-1), S100A9, LCN2, PTX3, PF4V1. FCN1 0112 PV has been scrutinized scientifically for decades and CFD, similarly comprising a “cytokine gene signature'. but its molecular basis remains an enigma. In contrast to CML 0109 Given the striking dysregulation of extracellular with its characteristic t9; 22)(q34; q11) translocation and matrix protein genes, unsupervised hierarchical clustering resulting BCR-ABL fusion tyrosine kinase gene, no genetic was used to determine whether stromal gene expression seg defect or protein marker specific for PV has yet been identi regated with a particular clinical phenotype. As shown in FIG. fied despite the use of high resolution techniques such as 8, the stromal gene set also separated the aggressive and oligonucleotide array comparative genomic hybridization indolent groups, with the latter showing the same heteroge and high resolution single nucleotide polymorphism array neity seen using the 102 core gene classifier (FIG. 5). karyotyping. 0113 Central to the success of the strategy disclosed Example 7 herein was the choice of an informative target cell population, a control cell population matched with respect to origin and Gene Expression in the Aggressive and Indolent phenotype, and avoidance of confounding effects on gene Patient Groups expression. Since PV is a stem cell disorder, CD34+ cells 0110 Analysis of differential gene expression in the were studied. Because myelofibrosis is part of its natural aggressive and indolent groups reinforced the importance of history, to ensure inclusive patient representation, as well as JAK2 V617F-independent expression of disease phenotype easy access for the repeated harvests necessary to obtain modifying genes. For example, although there was no differ sufficient cells for analysis, peripheral blood CD34+ cells ence in the JAK2 V617F allelic burdens between the two were chosen rather than their marrow counterparts. At the groups (Table 6), gene expression differed markedly with 707 same time, without being bound to any one particular theory, genes differently regulated (248 up and 459 down regulated) there is no reason to believe that there would be distinctly in the indolent group as compared to the controls (Table 8). different gene expression patterns in blood and marrow US 2015/0292028 A1 Oct. 15, 2015

CD34+ cells since this has not been the case for either acute myelofibrosis syndrome, and these are the same patients who myelogenous leukemia or CML. are at risk of the spontaneous evolution of a JAK2 V617F 0114. The approach used herein was facilitated by the positive acute leukemia. In this regard, it is of interest that characteristic constitutive mobilization of CD34+ cells in PV, with gene expression profiling it was possible to identify which represents an endogenous purification step with those CML patients in the chronic phase of the disease who respect to residual nonclonal marrow CD34+ cells. Although were at risk of early transformation, or who had already the presence of circulating nonclonal CD34+ cells is still a transformed at the molecular level despite a chronic phase potential confounder, clonal dominance is another feature of clinical phenotype. PV that results in suppression of polyclonal hematopoiesis I0120 In contrast to primary myelofibrosis, for which there and serves as an additional endogenous purification step. are well-validated prognostic factors for risk stratification at 0115. As demonstrated by the quantitative JAK2 V617F diagnosis and during disease progression, to date no Such neutrophil allelic burden in all 19 patients, and in CD34+ cells prognostic factors have been identified under either circum in thirteen, clonal dominance was present in all patients, stance for PV and, as the data herein indicate, neither the reducing or eliminating contamination of patient CD34+ cells JAK2 V617F allelic burden nor clonal dominance perse are by normal CD34+ cells. Additionally, since only 6 patients useful in this regard. However, the data Suggest that differen (26%) were receiving chemotherapy at the time of study and tial gene expression could be useful. Since gene expression five of these were taking hydroxyurea, which only affects appeared largely fixed from disease diagnosis for the indolent dividing cells, it is unlikely that drug effects were a significant group, it is possible that acquisition of new genetic lesions in confounder with respect to CD34+ cell gene expression. the aggressive group, whether spontaneous or treatment-re 0116 G-CSF mobilized peripheral blood CD34+ cells lated was responsible for disease transformation. The latter from normal Subjects as the control study population were appeared to be the case in one indolent group patient, who chosen because they have not been found to differ from their developed therapy-related acute leukemia associated with the steady state peripheral blood counterparts with respect to cell acquisition of a 5q-abnormality while taking hydroxyurea. cycle activity, immunophenotype and gene expression, while Thus, the presently disclosed 30 gene classifier can be used to differing significantly from marrow CD34+ cells with regards identify during the course of the disease, those patients who to these and gene expression, as well. Both G-CSF mobilized might benefit from early therapeutic intervention with pegy normal CD34+ cells and PV peripheral blood CD34+ cells lated interferon or allogeneic stem cell transplantation, while were similar with respect to immunophenotype and cell cycle sparing other patients the side effects of unnecessary treat activity, with both largely in Go/G in contrast to marrow ment. CD34+ cells, which are actively cycling. Furthermore, and I0121 Gene expression was examined in circulating PV most importantly, G-CSF exposure was unlikely to be a con CD34+ cells after removing gender as a potential confounder. founder with respect to CD34+ cell gene expression because This led to the identification of 102 genes whose importance these cells do not express G-CSF receptors, PV neutrophils in the disease process was substantiated by the fact that they are also already constitutively activated by virtue of JAK2 could be used to segregate the PV patients into two groups V617F expression, and plasma G-CSF is also increased in with distinctly different clinical features independent of the this disorder. JAK2 V617F allelic burden, leukocyte and platelet counts. 0117 Given the number of CD34+ cells required to obtain The aggressive group fit the phenotype of PV patients who sufficient mRNA for analysis, no attempt was made to frac develop the post-polycythemia myelofibrosis syndrome (Sil tionate patient or control peripheral blood CD34+ cells on the verstein, 1974; Passamonti et al., 2008), and are at risk of basis of immunophenotype before microarray analysis. This spontaneous leukemic transformation (Beer et al., 2009). In has clinical relevance since the data herein establishes that this regard, during chronic phase CML, it was possible using unfractionated patient peripheral blood CD34+ cells can gene expression to identify patients who were at risk of early serve as an informative cell population for analyzing clinical transformation, or who had already transformed at the risk assessment at the molecular level. molecular level (Radich et al., 2006). Thus, given the low 0118 Because of the differences in disease frequency, frequency of cytogenetic abnormalities in PV before disease disease manifestations, disease complications and JAK2 transformation (Gangat et al., 2008; Stein et al., 2011), gene V617F expression between men and women PV patients, it expression profiling could have prognostic relevance in PV. was hypothesized that gender might also be a confounder 0.122 With respect to disease specificity, it was informa with respect to gene expression and analyzed each patient tive to examine the expression of the 102 PV core genes in individually with a gender-specific control. As shown in FIG. chronic and blast phase CMLCD34+ cells (Bruns et al., 2009: 4, sex was, indeed, an important confounder, women patients Diaz-Blanco et al., 2007: Graham et al., 2007; Nowicki et al., differentially up or down regulated only 251 genes compared 2003; Zheng et al., 2006; Yamamoto-Sugitani et al., 2011; to 535 genes for the men. The biological basis for this differ Nakahara et al., 2010). Fifty-five of the 102 PV core genes ence is unknown but it fits with the observed suppression of were dysregulated in CML, with concordant dysregulation of the myeloproliferative clone during pregnancy, and thus 25 in chronic phase CML. could have an epigenetic, hormonal or immunologic basis. (0123. However, with blast crisis, there was a reversal of 0119 The importance of these genes in the disease process the up or down regulation of 17 PV core genes, providing a was substantiated by the fact that they could be used to seg window into the genetic mechanisms that govern the clinical regate a disorder perceived to be monolithic into two groups behavior of these two disorders and the potential relevance of with distinctly different clinical features and complication specific genes or pathways in maintaining normal differen rates that were independent of sex as well as the JAK2V617F tiation or promoting leukemic transformation. Interestingly, allelic burden (Table 2). Although the study population was the gene expression profile of the aggressive group, as in Small, the aggressive group fits the clinical phenotype of the CML blast crisis patients, was closest to that of normal 10-15% of PV patients who develop the post-polycythemia CD34+ cells (Radich et al., 2006). US 2015/0292028 A1 Oct. 15, 2015

0.124. The mechanisms driving differential gene deregula transcription to protein product and is Subject to epigenetic as tion in PV are unknown but rather than behaving like canaries well as genetic influences not controlled for in this study. in a mine shaft, gene expression appeared to be cell autono Nevertheless, the data provide new insights into the molecu mous, a contention Supported by the comparison with CML lar abnormalities of PV, establish a molecular basis for dis CD34+ cell gene expression (Table 12). The extent to which ease heterogeneity, identify genes and pathways for targeted JAK2 V617F contributed to gene expression remains unde therapy outside the canonical JAK2 signaling pathway, as fined but no significant differences in gene expression were well as previously unrecognized genes potentially involved in observed in a study of PVCD34+ marrow cells from JAK2 promoting myelofibrosis, inflammation and thrombosis. V617F-positive and negative patients (Berkofsky-Fessler). In this study, the JAK2V617Fallelic burdens were not different I0128. This study has identified a number of important between the aggressive and indolent groups even though their genes that may be worthy of consideration for targeted gene expression patterns differed both globally (Tables 8 and therapy. They include HES1, a transcriptional repressor that 9), as well as with respect to the 102 core gene set (Tables 10 negatively regulates the tumor suppressor PTEN, SPARC a and 11), Supporting an important role for other signaling multifunctional, antiadhesive matricellular protein that regu pathways in PV pathogenesis. lates extracellular matrix organization and up regulates osteopontin, a protein responsible for stem cell niche main 0.125. The 102 core gene list provides ample evidence for tenance, and LGALS3 and TIMP1, the cognate ligand for this contention and for synergistic interactions amongst these CD36, which promotes platelet aggregation, antagonizes pathways as well. For example, HES1 up regulation Suggests nitric oxide and activates TGF-?3. In addition to TIMP1, the up activation of either the Notch or Hedgehog pathways and regulation of a number of previously recognized coagulation couples these pathways with JAK2-STAT3 signaling, and genes that may contribute to the thrombotic diathesis that NF-kB and HIF-1C. activation (Kamakura et al., 2004; Wallet complicates PV were also identified. These include the fibrin al., 2009; Lee et al., 2009; Espinosa et al., 2010). LEPR, olysis inhibitor PAI-1 and the prothrombinase FGL2, as well LGALS3, LTBP3 and THBS1 activate TGF-B1 (Wang et al., as the gene PTX3. 2009; Mackinnon et al., 2012: Koli et al., 2008: Daniel et al., 2004), whose target genes include SOX4, SPARC, SER I0129 Hematopoietic stem cells do not require JAK2 for PINE1 (PAI-1) and miR-21 (Scharer et al., 2009; Shibata and either survival or proliferation and no difference was found Ishiyama, 2013; Baricos et al., 1999; Patel and Noureddine, between the size of the hematopoietic stem cell compartment 2012). SOX4 is also associated with activation of the Wnt, between PV. ET and normal controls in vivo or their behavior Notch and Hedgehog pathways (Scharer et al., 2009) and up in vitro. This is not surprising since JAK2 expression and regulation of HOXA9 (Scharer et al., 2009; Ikushima et al., activation in a JAK2-naive cell line did not appear to alter 2009); which in turn enhances the transcriptional activity of global gene transcript above that observed with unactivated SOX4 and STAT5 (Huang et al., 2012). LGALS3 also JAK2 expression. Furthermore, no significant changes in enhances Wnt pathway activity (Song et al., 2009); TIMP1 gene expression were observed in a study of PV CD34+ and SOX4 activate the PI3-K/AKT pathway (Scharer et al., marrow cells from JAK2 V617F-positive and negative 2009; Ridnouret al., 2012), while RRAS2 activates the RAF/ patients, nor was a significant difference observed when the MAPK/ERK and PI-3K/AKT pathways (Rosario et al., 2001; gene expression in PV CD34+ marrow cells was compared Rosario et al., 1999). with that following overexpression of wild type JAK2 in 0126. Other striking abnormalities were the up regulation normal CD34+ cells. Similar observations have been made of 16 genes encoding important matricellular proteins, essen with CD34+ marrow cells from JAK2 V617F-positive and tially comprising a stromal signature similar to that described negative ET patients. At the same time, it is well documented in lymphomas and breast cancer (Lenz et al., 2008; Bergam that in the nucleus, JAK2 directly modifies gene transcription aschi et al., 2008), and 10 inflammatory cytokine genes, com and enhances mitotic recombination and promotes genetic prising a cytokine signature. The Stromal signature identified instability by altering histone phosphorylation and methyla genes probably involved in PV myelofibrosis (Tripodo et al., tion and damaging DNA by generating reactive oxygen spe 2012) as well as in CML myelofibrosis (Yamamoto-Sugitani cies, which may be its most important contributions to PV et al., 2011), and confirms the importance of malignant stem cell behavior. In addition to the influence of JAK2 CD34+ cells in marrow stem cell niche maintenance and V617F, our data indicate activation of a number of other remodeling (Schepers et al., 2013). The cytokine signature signal transduction pathways. For example, HES1 expression not only adds new members to those previously identified as is dependent on either the Notch or Hedgehog pathways and involved in PV (Slezak et al., 2009; Verstovsek et al., 2010), HES1 itself activates STAT3 through either SRC or JAK2 but also identifies genes linking inflammation with coagula signaling. tion such as the complement-activating genes, CFD. FCN1 0.130. A striking abnormality was up regulation of genes and PTX3. In addition, the data Suggest a potential prothrom encoding matricellular proteins and inflammatory cytokines. botic role for PF4V1, SERPINE1 (PAI-1), HSPE and THSB1, Whether such signals are the consequence of constitutive which antagonizes both nitric oxide (Isenberg et al., 2005) JAK2 activation involving stem cell cytokine receptors is and ADAMTS13 (Bonnefoy and Hoylaerts, 2008), and the unclear but with respect to the genes whose expression is prothrombinase, FGL2 (Yuwaraj et al., 2001), a gene not normally influenced by JAK2, only two genes, SPARC and previously identified as up regulated in PV. PTX, the latter a gene normally down regulated by JAK2, 0127. The CD34+ cell population is diverse, and, although were up regulated in the PV CD34+ cells, suggesting that for technical reasons the cells could not be further fraction gene expression in these cells was driven by signal pathways ated, the study disclosed herein confirms that analysis of primarily unrelated to JAK2. This contention is supported by unfractionated circulating CD34+ cells has clinical utility the upregulation of genes involved in Notch or Hh signaling (Radich et al., 2006). Gene expression, of course, only rep such as HES1, genes involved in NFK-B signaling such as resents one component of the complex process from gene NR4A2, IER3, and RRAS2, genes involved in Wnt signaling US 2015/0292028 A1 Oct. 15, 2015

such as LGALS3, GAS2, SPARC and S100A9, and genes ways in a transformed pluripotent stem cell as can be seen in involved in TGF-B signaling such as LGALS3, TIMP1, biphenotypic leukemias. The up regulation of both embry THSB1 and LEPR. onic and fetal globin genes Supports this latter contention, as 0131 With respect to the specificity of gene expression does the observation that in vivo, the balance between eryth associated with JAK2 signaling in PV CD34+ cells, it was roid and myeloid progenitor cell pools in PV was not different informative to compare their gene expression profiles with from normal. those of chronic phase CML CD34+ cells, since constitutive tyrosine kinase signaling involving STAT5 is a central feature Example 10 of both disorders and both share a similar clinical phenotype with respect to leukocytosis, thrombocytosis, extramedullary 10 Gene Screening Panel for Predicting Aggressive hematopoiesis, myelofibrosis and transformation to acute Forms of PV leukemia, although at differing frequencies, possibly because 0.136. Since PV is a stem cell disorder, PV CD34+ cells BCR-ABL signaling is ectopic while signaling by JAK2 were examined for constructing a gene V617F occurs through physiologic pathways. screening panel for PV. Specifically, to avoid repeated mar 0.132. As shown in Table 12, there was concordant dys row aspirations to collect these cells, circulating CD34+ cells regulation of 28 of the PV 105 core gene set in chronic phase were studied. This was also technically advantageous CML, which is compatible with the observation that STAT5 is because an increase in the number of circulating CD34+ cells activated by BCR-ABL signaling. By contrast, however, in is a feature of PV, and because of clonal dominance, which is CML blast crisis, there was a reversal in the up or down also a feature of PV, the bulk of the circulating CD34+ cells regulation of 17 PV core set genes, providing a window into were likely to be from the malignant clone (Adamson et al., the genetic mechanisms that govern the different clinical 1976). Mobilized normal circulating CD34+ cells, which are courses of these two disorders and the potential relevance of immunophenotypically similar and have the same cell cycle specific genes or pathways in maintaining normal differen status, were used as the control cell population, and, because tiation or promoting leukemic transformation. In this regard, female PV patients have different clinical features than male it is interesting to note that the gene expression profile of both patients (Stein et al., 2010; Stein et al., 2011: Videbaek, the aggressive patient group and those CML patients who 1950), each patient was compared with a gender-specific developed blast crisis was not only different from the indolent control. Using oligonucleotide microarray technology, it was group or chronic phase CML patients respectively, but also found that women differentially regulated 251 genes and men closer to that of normal CD34+ cells. 535 genes, but both concordantly differentially regulated 102 0133. This study provides a snapshot of gene expression genes (FIG. 4). Using this 102 core gene set and unsupervised in a heterogenous stem cell population of a chronic disorder hierarchical clustering, PV patients were able to be segre characterized by phenotypic variability over time. The data gated into two groups (FIG. 5), with one group having a more provide insight into the molecular abnormalities of PV, iden aggressive disease with lower hemoglobin levels, more tify new candidate genes for targeted therapy outside the thromboembolic events, a higher frequency of splenomegaly, canonical JAK2 signaling pathway and as well as previously larger spleens, a greater frequency of chemotherapy and sple unrecognized genes that may be involved in promoting nectomy, more leukemic transformation and a higher mortal thrombosis in PV patients. ity rate, despite having a JAK2 V617F allelic burden similar 0134. The molecular behavior of PVCD34+ cells has been to the other group (Table 6). Using a Supervised approach, top exposed in this study. The data indicate that PV can no longer scoring pairs, a 29 gene profile was defined, which also seg be considered a monolithic disorder with bone marrow failure regated the PV patients with aggressive disease from those as an inevitable event, that patients with an aggressive form of with a more indolent phenotype with 100% accuracy (FIG. 6). the disorder can be identified early in the course of their 0.137 Based on these 19 genes, a smaller gene panel was disease and that, as has been previously argued, women PV derived consisting of 10 genes (PCNA, IF130, TSN, CTSA, patients cannot be treated as Small men, and this should be SMC4, CDKN1A, CTTN, SON, TIA1 and MYL9) for estab true both in clinical trials and in pregnancy. Whether control lishing the probability that a PV patient has an aggressive or ling for sex as a potential confounder is applicable to gene indolent form of the disease. Using qRT-PCR and scoring 1 expression analysis in other hematologic malignancies is for true and 0 for false. If PCNAdIF30; TSN >CTSA: worthy of evaluation given the remarkable insights described SMC4>CDKN1A, PCNA-CTTN; SONDCTTN; and here. TIA1 >MYL9, the probability that the disease is aggressive is 0135 Recent studies have suggested that in PV, as well as the total score/6. After developing absolute copy number in CML, the disease may arise in a later stage progenitor cell, standard curves for the 10 genes (FIG. 10), the behavior of and, in particular, one with a predilection for erythroid dif this screen on seven patients was verified in the initial training ferentiation. While the data herein do not directly speak to this set and its predictability examined in a blinded fashion using contention, in keeping with it, six globin genes were upregu CD34+ cell RNA from 30 additional PV patients as described lated in PV CD34+ cells. However, it is noteworthy that in herein below. chronic phase CML there was up regulation of the C, B, 6 and 0.138. For biomarker association with clinical measures, Y globin genes as well as an increase in the MEP population patient probability scores were correlated with the presence despite the fact that CML is phenotypically myeloid-re or absence of clinical complications as defined from the train stricted, while PV is not. Therefore, without wishing to be ing set aggressive PV group and calculated as a clinical score bound to any one particular theory, it is believed that as (0-6). These clinical complications were: anemia, palpable opposed to being associated with CD34+ maturation status, splenomegaly or history of splenectomy, spleen size, major these gene expression changes may merely reflect nonspe vessel thrombosis, chemotherapy or immunomodulatory cific up regulation of gene expression by JAK2 activation in therapy and leukemic transformation. Of the 30 patients, 8 both disorders, or aberrantactivation of multiple genetic path had clinical features compatible with the aggressive form of US 2015/0292028 A1 Oct. 15, 2015

PV with a median clinical score of 3.0 (range, 2-4) and a 0.925. The best point for calls in both cases was setting the median probability score of 5/6 (range, 5-6) using the 10 gene call of aggressive phenotype at 5 positive TSP calls, with panel. In these 8 patients, each of the clinical complications sensitivity of 0.9 and 0.875 and specificity of 1.0 and 1.0, occurred at a significantly higher frequency than in the indo respectively. The PPV at this threshold was 1.0 in both cases, lent group. Of the 22 patients who did not have an aggressive and the NPV was 0.95 in both cases. (AUC-area under the clinical phenotype, the median clinical score was 1 (range curve; FN=falsely negative: FP=falsely positive: TP=total 0-3) and the median probability score was 3/6 (range 0-4) positives; TN=total negatives). (Table 13). The difference in clinical scores between the two 0.141. The power of a diagnostic test to correctly predict groups was statistically significant (p<0.001), and the prob status is commonly measured as the sensitivity of the assay, ability score was also significantly different between the the specificity of the assay or the area under a receiver oper groups at p<0.001 with a ROC curve with an AUC of 0.94 ated characteristic (“ROC) curve. Sensitivity is the percent (FIG. 11A). There was good correlation between the prob age of true positives that are predicted by a test to be positive, ability score and the clinical score in this group of patients while specificity is the percentage of true negatives that are (p=0.002: FIG. 11B). Median disease duration was 15.5 years predicted by a test to be negative. A ROC curve provides the (range, 9-39) in the aggressive group and 7.0 years (range, sensitivity of a test as a function of 1-specificity. The greater 1-27; p=0.011) in the indolent group (p=0.003), while the the area under the ROC curve, the more powerful the predic median JAK2 V617F allelic burden was not different in the tive value of the test. Positive predictive value is the percent aggressive group compared to the indolent group (94% vs age of people who test positive that are actually positive. 81%), though 5 of the indolent group, but none of the aggres Negative predictive value is the percentage of people who test sive group, had allele burdens of 50% or less. In 7 patients, it negative that are actually negative. was possible to obtain repeat measurements over a period of 3-5 years and in 5, the probability score remained constant at 0142 Relevant equations are defined below: 476 or less with similar JAK2 V617F allelic burdens and Sensitivity=TP (TP+FN) clinical scores (FIG. 12A). In one patient with a probability score of 1-2/6, the probability score increased to 5/6 in Specificity=TN/(TN+FP) advance of AML transformation in one (FIG. 12B). PPV(positive predictive value)=TP (TP+FP) 0139 Table 14 discloses the genes and context sequences (probe sequences: Applied Biosystems primer/probe kits) NPV(negative predictive value)=TN/(TN+FN) comprising the 10 gene Screening panel for the presently 0143. The positive predictive value is often reported as it disclosed methods. Table 15 shows representative NCBI gives the probability that a patient who tests positive is truly Accession numbers for each gene and Table 16 discloses the positive for a phenotype, and therefore is an indication of how probes (Life Technologies, Carlsbad, Calif.) used to detect much the test can be trusted clinically to reflect the pheno each gene. type. The sensitivity gives the probability that a patient who is 0140. After cloning the appropriate probes and developing positive actually tests positive. absolute copy numberstandard Ct curves for the 10 genes, the behavior of this screen on PV patients in the training set was 0144. In summary, a molecular method for risk stratifica verified. The predictability of this screen was examined using tion in PV that reflects clinical phenotype but also anticipates CD34+ cell RNA from a test set of 23 PV patients (Tables 18 disease transformation has been identified. The presently dis and 19). Patient probability scores were correlated with the closed subject matter provides a clinical assay that uses gene presence or absence of clinical features defined by the train expression (Table 14) and a specific algorithm (Table 17) to ing set aggressive PV group and calculated as a clinical score. identify those PV patients most likely to benefit from early Of the 23 patients, 7 had clinical features compatible with the institution of definitive therapy. aggressive form of PV with a median clinical score of 3.0 (range, 1-6) and a median probability score of 6/6 (range, Example 11 3-6), with one patient having a score of 3/6. Of the 16 patients who did not have an aggressive clinical phenotype, the Embodiment of a 10 Gene Panel Assay median clinical score was 0 (range 0-1) and the median prob ability score was 3/6 (range 1-4). The difference in clinical 0145 The starting tissue can be either peripheral blood scores between the two groups was statistically significant collected in standard EDTA vacutainer tubes or buffy coat (p<0.001) and the probability score was also significantly cells isolated from a unit of whole blood. different between the groups at p=0.001. Median disease 0146 For CD34+ cell isolation, peripheral blood mono duration was 13.0 years (range, 9-39) in the aggressive group nuclear cells (PBMCs) are isolated from fresh samples by and 6.0 years (range, 1-17) in the indolent group (p=0.003), Ficoll-Paque (GE Healthcare Cat. No. 17-1440-03) density while the median JAK2 V617F allelic burden was greater in gradient centrifugation. CD34+ cells are isolated from the the aggressive group (95% vs 82.5%; p=0.04) with 5 of the PBMCs using the Miltenyi Biotech CD34 Microbead Kit indolent group, but none of the aggressive group, having (Cat. No. 130-097-047) following the manufacturers allele burdens of 50% or less. In 2 patients, it was possible to instructions. In an embodiment, the required amount of obtain repeat measurements over a period of 3-5 years and in CD34+ cells is approximately 1-4x10'. both the probability score remained constant at 4/6 with simi 0147 For optional CD34+ cell storage, purified CD34+ lar Jak2 V617F allelic burdens and clinical scores. In one cells can be resuspended in freezing media (10% DMSO patient with a probability score of 3/6, the score increased to (Sigma Cat. No. D2650) 90% Fetal Bovine Serum (Gibco 6/6 in advance of AML transformation. ROC (Receiver Oper Cat. No. 26140)) and stored frozen at -80° C. using a slow ating Characteristic) analysis revealed that the AUC for all cooling freezing unit (Thermo Scientific Cat. No. 5100 cases was 0.94, while the AUC excluding AML cases was 0001). Cells can also be transferred to liquid nitrogen for long US 2015/0292028 A1 Oct. 15, 2015

term storage. Before RNA isolation, the cells are washed in by reference. It will be understood that, although a number of Phosphate Buffered Saline pH 7.4 (Gibco Cat No. 10010 patent applications, patents, and other references are referred 023) to remove all media. to herein, Such reference does not constitute an admission that 0148 For RNA isolation, RNA is extracted using the any of these documents forms part of the common general Qiagen RNeasy mini kit (Cat. No. 74104) with the QIA knowledge in the art. shredder (Cat. No. 79654) and on-column DNase treatment 0153. Adamson J. W. Fialkow PJ, Murphy S. Prchal J F, (Cat. No. 79254) following the manufacturer's instructions. Steinmann L. Polycythemia Vera: stem-cell and probable Beta Actin levels (ACTB endogenous control: Applied Bio clonal origin of the disease. N. Engl. J. Med. 1976; 295: systems, Cat. No. 4333762F) for each sample are measured to 913-916. determine if the concentration and quality was acceptable for further analysis. This assay is based upon a 10 gene signature 0154 Anand S. Stedham F. Gudgin E et al. Increased basal and an algorithm (Table 17) which stratifies PV patients into intracellular signaling patterns do not correlate with JAK2 indolent and aggressive forms of the disease. A qRT-PCR genotype in human myeloproliferative neoplasms. Blood probability score of 5 or 6 indicates an aggressive form of PV. 2011; 118(6):1610-1621. Each of the six described ratios must always be >2 to be 0155 Andreasson B, Swolin B, Kutti J. Increase of CD34 scored as positive. Scores of 5/6 or 6/6 are considered indica positive cells in polycythaemia Vera. Eur. J. Haematol. tive of an aggressive PV phenotype based on the Supervised 1997: 59(3):171-176. analysis of our initial gene expressing profiling results using 0156 BarbuiT, Barosi G, Birgegard G. et al. Philadelphia top scoring pairs. Transcript expression levels are measured negative classical myeloproliferative neoplasms:critical (in absolute copy numbers). The assay can be performed with concepts and management recommendations from Euro a plurality of Samples using a high throughput qRT-PCR pean LeukemiaNet. J. Clin. Oncol. 2011; 29:761-770. platform. 0157 Baricos W. H. Cortez SL, Deboisblanc M, Xin S. 0149 Because this assay compares different genes within Transforming growth factor-beta is a potent inhibitor of a single patient sample, absolute quantitation calculations are extracellular matrix degradation by cultured human performed rather than compare relative expression levels. mesangial cells. J. Am. Soc. Nephrol. 1999; 10(4):790 Therefore, plasmids containing either full length or partial 795. cDNA of the targeted region for each gene are cloned and used to generate standard curves (FIG. 10). Once optimized, 0158 Barosi G. Viarengo G. Pecci A et al. Diagnostic and three standard dilutions can be chosen to use in the assay clinical relevance of the number of circulating CD34+ cells based upon the observed expression range of each gene. Copy in myelofibrosis and myeloid metaplasia. Blood 2001; numbers are calculated based on the known size and concen 98(12):3249-3255. tration of each plasmid. In addition to the standard curves and 0159 Beer PA, Delhommeau F, Le Couedic J Petal. Two no template control, at least one patient sample with a previ routes to leukemic transformation following a JAK2 muta ously determined qRT-PCR probability score is included in tion-positive myeloproliferative neoplasm. Blood 2009; each run as a quality control. 115:2891-29OO. 0150 Intra-assay precision is assessed by running all 0160 Bergamaschi A, Tagliabue E, Sorlie T et al. Extra samples in duplicate. Replicate Ct values with standard cellular matrix signature identifies breast cancer Subgroups deviations of greater than 0.5 are re-evaluated. Inter-assay with different clinical outcome. J. Pathol. 2008; 214(3): precision is assessed by performing replicate assays on dif 357-367. ferent days with fresh template cDNA from the same RNA (0161 Berk P D, Goldberg J D, Silverstein M N et al. sample of separate patients. In an example, the applied algo Increased incidence of acute leukemia in polycythemia rithm on samples from 8 patients generated the same call, Vera associated with chlorambucil therapy. N. Engl. J. either >4/6 or <5/6. In another example, four sets of patient Med. 1981: 304:441-447. samples using RNA extracted from CD34+ samples isolated (0162 Berkofsky-Fessler W. Buzzai M. Kim M K et al. from separate blood draws within the same twelve month Transcriptional profiling of polycythemia Vera identifies period were run with no reported disease progression. Again, gene expression patterns both dependent and independent in each case there was no difference in the stratification of the patients using the methods of the presently disclosed subject from the action of JAK2V617F. Clin. Cancer Res. 2010; matter. 16(17):4339-4352. 0151. In an example, the clinical sensitivity of the assay 0163 Bonnefoy A, Hoylaerts MF. Thrombospondin-1 in using 5-6/6 as indicative of an aggressive phenotype was 0.9. von Willebrand factor function. Curr Drug Targets 2008; The clinical specificity of the assay using 5-6/6 as indicative 9(10):822-832. ofan aggressive phenotype was 1.0. The PPV at this threshold 0.164 Bruns I, Czibere A, Fischer J C et al. The hemato was 1.0 and the NPV was 0.95. poietic stem cell in chronic phase CML is characterized by a transcriptional profile resembling normal myeloid pro REFERENCES genitor cells and reflecting loss of quiescence. Leukemia 0152 All publications, patent applications, patents, and 2009; 23(5):892-899. other references mentioned in the specification are indicative (0165 Catani L, Zini R, Sollazzo Detal. Molecular profile of the level of those skilled in the art to which the presently of CD34+ stem/progenitor cells according to JAK2V617F disclosed subject matter pertains. All publications, patent mutation status in essential thrombocythemia. Leukemia applications, patents, and other references are herein incor 2009; 23(5):997-1000. porated by reference to the same extent as if each individual (0166 Daniel C, Wiede J. Krutzsch H C et al. Thrombo publication, patent application, patent, and other reference spondin-1 is a major activator of TGF-beta in fibrotic renal was specifically and individually indicated to be incorporated disease in the ratin vivo. Kidney Int2004; 65(2):459-468. US 2015/0292028 A1 Oct. 15, 2015

0167 Diaz-Blanco E. Bruns I, Neumann Fetal. Molecular 0183 Kerbauy D. M. Gooley TA, Sale G E et al. Hemato signature of CD34(+) hematopoietic stem and progenitor poietic cell transplantation as curative therapy for idio cells of patients with CML in chronic phase. Leukemia pathic myelofibrosis, advanced polycythemia Vera, and 2007: 21(3):494-504. essential thrombocythemia. Biol. Blood Marrow Trans 0168 Edgar R, Domrachev M. Lash AE. Gene Expression plant. 2007; 13:355-365. Omnibus: NCBI gene expression and hybridization array 0.184 Kiladian J.J. Cassinat B, Chevret Set al. Pegylated data repository. Nucleic Acids Res. 2002:30(1):207-210. interferon-alfa-2a induces complete hematologic and (0169. Espinosa L., Cathelin S, D'Altri Tet al. The Notch/ molecular responses with low toxicity in polycythemia Hes1 pathway sustains NF-kappaB activation through vera. Blood 2008: 112:3065-3072. CYLD repression in T cell leukemia. Cancer Cell 2010; 0185. Kiladian JJ, Chevret S, Dosquet C, Chomienne C, 18(3):268-281. Rain J D. Treatment of polycythemia vera with hydrox (0170 Gaidano G. Pastore C, Santini V et al. Genetic yurea and pipobroman: final results of a randomized trial lesions associated with blastic transformation of poly initiated in 1980. J. Clin. Oncol. 2011; 29:3907-3913. cythemia Vera and essential thrombocythemia. Genes 0186 Koli K, Ryynanen M. J. Keski-Oja J. Latent TGF Chromosomes. Cancer 1997; 19:250-255. beta binding proteins (LTBPs)-1 and -3 coordinate prolif 0171 Gangat N. Strand J. Lasho T L et al. Cytogenetic eration and osteogenic differentiation of human mesenchy studies at diagnosis in polycythemia Vera: clinical and mal stem cells. Bone 2008; 43(4):679-688. JAK2V617F allele burden correlates. Eur. J. Haematol. 0187 Lamy T. Devillers A, Bernard Met al. Inapparent 2008: 80(3):197-200. polycythemia Vera: an unrecognized diagnosis. Am. J. (0172 Graham S. M. Vass J K, Holyoake TL, Graham G.J. Med. 1997: 102(1):14-20. Transcriptional analysis of quiescent and proliferating 0188 Lee J H, Suk J. Park Jet al. Notch signal activates CD34+ human hemopoietic cells from normal and chronic hypoxia pathway through HES1-dependent SRC/signal myeloid leukemia sources. StemCells 2007; 25(12):3111 transducers and activators of transcription3 pathway. Mol. 312O. Cancer Res. 2009; 7(10): 1663-1671. 0173 Gruppo Italiano Studio Policitemia. Polycythemia (0189 Lenz G. Wright G, Dave S S et al. Stromal gene Vera: the natural history of 1213 patients followed for 20 signatures in large-B-cell lymphomas. N. Engl. J. Med. years. Ann. Intern. Med. 1995; 123:656-664. 2008; 359(22):2313-2323. 0.174 Hantschel O. Warsch W. Eckelhart E et al. BCR (0190. Lenz G. Wright G. W. Emre N C et al. Molecular ABL uncouples canonical JAK2-STAT5 signaling in subtypes of diffuse large B-cell lymphoma arise by distinct chronic myeloid leukemia. Nat. Chem. Biol. 2012; 8(3): genetic pathways. Proc. Natl. Acad. Sci. U.S.A. 2008: 105: 285-293. 13520-13525. (0175 Harrison CN, Campbell PJ, Buck Get al. Hydrox (0191 Mackinnon AC, Gibbons MA, Farnworth SL et al. yurea compared with anagrelide in high-risk essential Regulation of transforming growth factor-beta1-driven thrombocythemia. N. Engl. J. Med. 2005: 353(1):33-45. lung fibrosis by galectin-3. Am. J. Respir. Crit. Care Med. (0176 Horita M, Andreu EJ, Benito A et al. Blockade of 2012; 185(5):537-546. the Bcr-Abl kinase activity induces apoptosis of chronic myelogenous leukemia cells by Suppressing signal trans (0192 McNally RJ, Rowland D, Roman E. Cartwright R ducer and activator of transcription 5-dependent expres A. Age and sex distributions of hematological malignan sion of Bcl-XL. J. Exp. Med. 2000; 191(6):977-984. cies in the U.K. Hematol. Oncol. 1997: 15:173-189. 0177 Huang Y. Sitwala K. Bronstein Jet al. Identification (0193 Moliterno A R, Williams D M, Rogers 0, Isaacs M and characterization of Hoxa9 binding sites in hematopoi A, Spivak J. L. Phenotypic variability within the JAK2 etic cells. Blood 2012: 119(2):388-398. V617F-positive MPD: Roles of progenitor cell and neutro 0.178 Ikushima H. Todo T, Ino Y. Takahashi M. Miyazawa phil allele burdens. Exp. Hematol. 2008; 36(11): 1480 K. Miyazono K. Autocrine TGF-beta signaling maintains 1486. tumorigenicity of glioma-initiating cells through Sry-re (0194 Najean Y. Rain J. Treatment of Polycythemia Vera: lated HMG-box factors. Cell Stem Cell 2009; 5(5):504 The use of Hydroxyurea and Pipobroman in 292 Patients 514. Under the Age of 65 Years. Blood 1997: 90:3370-3377. (0179 Isenberg JS, Ridnour LA, Perruccio EM. Espey M 0.195 Nakahara F. Sakata-Yanagimoto M. KomenoYetal. G, Wink D. A. Roberts D D. Thrombospondin-1 inhibits Hesl immortalizes committed progenitors and plays a role endothelial cell responses to nitric oxide in a coMP-de in blast crisis transition in chronic myelogenous leukemia. pendent manner. Proc. Natl. Acad. Sci. U.S.A. 2005: 102 Blood 2010: 115(14):2872-2881. (37): 13141-13146. 0196. Nowicki MO, Pawlowski P. Fischer T, Hess G, 0180 James C, Ugo V. Le Couedic J P et al. A unique Pawlowski T. Skorski T. Chronic myelogenous leukemia clonal JAK2 mutation leading to constitutive signaling molecular signature. Oncogene 2003; 22(25):3952-3963. causes polycythaemia Vera. Nature 2005; 434(7037): 1144 (0197) Nussenzweig R H, Swierczek S I, Jelinek Jet al. 1148. Polycythemia vera is not initiated by JAK2V617F muta 0181 Jones A. V. Kreil S. Zoi Ketal. Widespread occur tion. Exp. Hematol. 2007: 35(1):32-38. rence of the JAK2 V617F mutation in chronic myelopro 0198 Passamonti F. Rumi E. Caramella M et al. A liferative disorders. Blood 2005: 106:2162-2168. dynamic prognostic model to predict Survival in post-poly 0182 Kamakura S. Oishi K. Yoshimatsu T. Nakafuku M, cythemia vera myelofibrosis. Blood 2008: 111 (7):3383 Masuyama N. Gotoh Y. Hes binding to STAT3 mediates 3387. crosstalk between Notch and JAK-STAT signaling. Nat. (0199 Patel V. Noureddine L. MicroRNAs and fibrosis. Cell. Biol. 2004; 6(6):547-554. Curr. Opin. Nephrol. Hypertens. 2012; 21 (4):410-416. US 2015/0292028 A1 Oct. 15, 2015

(0200 Radich J P Dai H, Mao Metal. Gene expression 0217 Stein BL, Rademaker A, Spivak J. L. Moliterno A R. changes associated with progression and response in Gender and Vascular Complications in the JAK2 V617F chronic myeloid leukemia. Proc. Natl. Acad. Sci. U.S.A. Positive Myeloproliferative Neoplasms. Thrombosis 2006; 103(8):2794-2799. 2011; 2011:874.146. 0201 Ranjan A, Penninga E. JelsigAM, Hasselbalch HC, 0218. Stein B L. Williams DM, O'Keefe Cetal. Disrup Bjerrum OW. Inheritance of the chronic myeloprolifera tion of the ASXL1 gene is frequent in primary, post-essen tive neoplasms. A systematic review. Clin. Genet. 2013; tial thrombocytosis and post-polycythemia Vera myelofi 83(2):99-107. brosis, but not essential thrombocytosis or polycythemia (0202 Ridell B, Carneskog J, Wedel Het al. Incidence of Vera: analysis of molecular genetics and clinical pheno chronic myeloproliferative disorders in the city of Gote types. Haematologica 2011; 96(10): 1462-1469. borg, Sweden 1983-1992. Eur. J. Haematol. 2000; 65(4): 0219. Stein B L. Williams D M, Rogers O, Isaacs MA, 267-271. Spivak J. L., Moliterno A. R. Disease burden at the progeni 0203 Ridnour LA, Barasch KM, Windhausen A Net al. tor level is a feature of primary myelofibrosis: a multivari Nitric oxide synthase and breast cancer: role of TIMP-1 in able analysis of 164.JAK2V617F-positive myeloprolifera NO-mediated Akt activation. PLoS ONE 2012; 7(9): tive neoplasm patients. Exp. Hematol. 2011;39(1):95-101. e44081. 0220 Stein B L. Williams D M, Wang NY et al. Sex 0204 Rosario M. Paterson HF, Marshall C.J. Activation of differences in the JAK2 V617F allele burden in chronic the Raf/MAP kinase cascade by the Ras-related protein myeloproliferative disorders. Haematologica 2010:95(7): TC21 is required for the TC21-mediated transformation of 1090-1097. NIH 3T3 cells. EMBO J. 1999; 18(5):1270-1279. 0205 Rosario M. Paterson HF, Marshall C.J. Activation of 0221) Sugita M, Haney J. L. Gemmill RM, Franklin WA. the Ral and phosphatidylinositol 3' kinase signaling path One-step duplex reverse transcription-polymerase chain ways by the ras-related protein TC21. Mol. Cell. Biol. reaction for quantitative assessment of RNA degradation. 2001; 21 (11):3750-3762. Anal. Biochem. 2001; 295(1): 113-116. 0206 Scharer CD, McCabe CD, Ali-Seyed M, Berger M 0222 Tan AC, Naiman DQ, Xu L. Winslow R L. Geman F. Bulyk ML, Moreno C S. Genome-wide promoter analy D. Simple decision rules for classifying human cancers sis of the SOX4 transcriptional network in prostate cancer from gene expression profiles. Bioinformatics 2005; cells. Cancer Res. 2009; 69(2):709-717. 21 (20):3896-3904. 0207 Schepers K, Pietras E. M. Reynaud D et al. Myelo 0223 Tripodo C, Sangaletti S, Guarnotta C et al. Stromal proliferative Neoplasia Remodels the Endosteal Bone SPARC contributes to the detrimental fibrotic changes Marrow Niche into a Self-Reinforcing Leukemic Niche. associated with myeloproliferation whereas its deficiency Cell Stem Cell 2013. favors myeloid cell expansion. Blood 2012; 120(17):3541 0208 Segal JB, Moliterno A. R. Platelet counts differ by 3554. sex, ethnicity, and age in the United States. Ann. Epide 0224 Verstovsek S. Kantarian H, Mesa R A et al. Safety miol. 2006; 16(2):123-130. and efficacy of INCB018424, a JAK1 and JAK2 inhibitor, 0209 Shibata S, Ishiyama J. Secreted protein acidic and in myelofibrosis. N. Engl. J. Med. 2010; 363(12): 1117 rich in cysteine (SPARC) is upregulated by transforming 1127. growth factor (TGF)-beta and is required for TGF-beta 0225 Videbaek A. Polycythemia Vera. Course and Prog induced hydrogen peroxide production in fibroblasts. Fib nosis. Acta Med. Scand. 1950; 138:179-187. rogenesis Tissue Repair 2013; 6(1):6. 0226 Wall DS, Mears AJ, McNeill Betal. Progenitor cell 0210 Silverstein MN. Postpolycythemia myeloid meta proliferation in the retina is dependent on Notch-indepen plasia. Arch. Intern. Med. 1974; 134(1): 113-117. dent Sonic hedgehog/Hes1 activity. J. Cell. Biol. 2009: 0211 Slezak S. Jin P. Caruccio L et al. Gene and 184(1): 101-112. microRNA analysis of neutrophils from patients with poly 0227 Wang J. Leclercq I, Brymora J Metal. Kupffer cells cythemia Vera and essential thrombocytosis: down-regula mediate leptin-induced liver fibrosis. Gastroenterology tion of microRNA-1 and -133a.J. Transl. Med. 2009; 7:39. 0212. Smalberg J.H. Arends L. R. Valla DC, Kiladian JJ, 2009; 137(2):713-723. Janssen H L. Leebeek F. W. Myeloproliferative neoplasms 0228 Wasserman L. The Management of Polycythemia in Budd-Chiari syndrome and portal vein thrombosis: a Vera. British Journal of Hematology 1971; 21:371-376. meta-analysis. Blood 2012; 120(25):4921-4928. 0229 Williams D M, Kim A. H. Rogers O, Spivak J. L. 0213 Song S. MazurekN, Liu Cetal. Galectin-3 mediates Moliterno A. R. Phenotypic variations and new mutations nuclear beta-catenin accumulation and Wnt signaling in in JAK2 V617F-negative polycythemia vera, erythrocyto human colon cancer cells by regulation of glycogen syn sis, and idiopathic myelofibrosis. Exp. Hematol. 2007; thase kinase-3beta activity. Cancer Res. 2009; 69(4): 1343 35(11): 1641-1646. 1349. 0230 Yamamoto-Sugitani M. Kuroda J, Ashihara E et al. 0214 Spivak J. L. Polycythemia vera:myths, mechanisms, Galectin-3 (Gal-3) induced by leukemia microenviron and management. Blood 2002; 100:4272-4290. ment promotes drug resistance and bone marrow lodgment 0215 Spivak J. L. Narrative review: Thrombocytosis, in chronic myelogenous leukemia. Proc. Natl. Acad. Sci. polycythemia Vera, and JAK2 mutations: The phenotypic U.S.A. 2011; 108(42):17468-17473. mimicry of chronic myeloproliferation. Ann. Intern. Med. 0231. Yuwaraj S, Ding J, Liu M, Marsden PA, Levy GA. 2010; 152:300-306. Genomic characterization, localization, and functional 0216 Spivak J. L. Hasselbalch H. Hydroxycarbamide: a expression of FGL2, the human gene encoding fibroleukin: user's guide for chronic myeloproliferative disorders. a novel human procoagulant. Genomics 2001; 71(3):330 Expert. Rev. Anticancer Ther. 2011; 11:403-414. 338. US 2015/0292028 A1 Oct. 15, 2015 19

0232 Zheng C, Li L, Haak Metal. Gene expression pro filing of CD34+ cells identifies a molecular signature of chronic myeloid leukemia blast crisis. Leukemia 2006; 20(6):1028-1034. 0233. Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifica tions can be practiced within the scope of the appended claims. Tables 0234 TABLE 1. QPCR using the Gene Expression GEX Assays GEX Target ABIGEX Gene Exon Assay ID Symbol Gene Name Boundaries HsOO188259 m1 WARS tryptophanyl-tRNA synthetase 9-10 Hs99999.139 m1 TIMP1 TIMP metallopeptidase inhibitor 1 2-3 HsOO180737 m1 HPSE heparanase 8-9 HsOO172743 m1 DNTT deoxynucleotidyltransferase, terminal 10-11 Hs00181810 ml. CRHBP corticotropin releasing hormone binding protein 6-7 Hs00365956 m1 HOXA9 homeobox A9 1-2 HsO0202825 m1 SSBP2 single-stranded DNA binding protein 2 7-8 HsOO261238 m1 HOPX HOP homeobox 2-3 Hs99999905 m1 GAPDH glyceraldehyde-3-phosphate dehydrogenase 3-3 OOO397 miR-21 Human microRNA-21 (hsa-miR-21-5p) NA OO1093 RNU6B U6 small nuclear 2, Small nuclear RNA NA

TABLE 2 TABLE 2-continued Polycythenia Vera Study Population Demographics Polycythenia Vera Study Population Demographics Men (8) Women (11) Men (8) Women (11) Median Age s'. : a". Median Leukocyte Count 16,690* 19,970 (years; range) (57-82) (46-76) (10 IL; range) (4430-177,190) (5080-50,070) Median Disease Duration 11.5 9 (years; range) (138) (1-18) Median Platelet Count 421,000** 948,000 Mr. E. V617F 94 1OO (10/IL; range) (151,000-810,000) (191,100-1,480,000) Neutrophil (55-100)* (60-100) Median Spleen size 10.2 S.O Allele Burden (cm; range) (0-32) (0-20) (%; range) Median Hemoglobin 13.2 11.7 *Not significantly different (gm 96; range) (8.3-15.9)* (10.4-14.7) **p = 0.016

TABLE 3 Demographics and Clinical Features of the 19 Polycythenia Vera Patients at Study Entry Disease Leukocyte Platelet Spleen size (cm JAK2 V617F Age. In Duration Hemoglobin count count below the left Neutro-phil Thrombosis, Gender Years In Years (gm 96) (10°/L) (10/L) costal margin) Splenectomy allele burden (%). TIA Therapy M 74 7 12.9 17,620 388,000 32 No 100 No Phlebotomy, Anagrelide, Hydroxyurea, Busulfan M 66 2O 8.3 177,190 454,000 25 Yes 100 Arterial Phlebotomy, Thalidomide, Cytoxan F 55 13 11.1 33,110 802,000 2O Yes 100 Portal and Phlebotomy, hepatic Hydroxyurea, veins; TIA Cytoxan, Anagrelide F 74 8 11.7 10,720 366,000 8 No 68 Hepatic Anagrelide, vein Hydroxyurea US 2015/0292028 A1 Oct. 15, 2015 20

TABLE 3-continued Demographics and Clinical Features of the 19 Polycythenia Vera Patients at Study Entry Disease Leukocyte Platelet Spleen size (cm JAK2 V617F Age In Duration Hemoglobin count count below the left Neutro-phil Thrombosis Gender Years In Years (gm 96) (10/L) (10/L) costal margin) Splenectomy allele burden (%) TIA Therapy M 63 16 9.3 10,020 171,000 8 Yes 86 No Phlebotomy, droxyurea F 48 18 0.4 50,070 1,017,000 5 Yes 100 Arterial Phlebotomy, and Hydroxyurea, WelOS BuSulfan, matinib 72 1 3.7 16.490 712,000 O No 68 No botomy 68 11 3.0 11,980 865,000 5 No 67 No botomy 73 4 4.3 16,610 151,000 12.5 No 95 No botomy 82 25 5.9 4,430 197,000 O No 50 Arterial botomy, roxyurea 76 10 1.5 5,080 948,000 O No 52 TIA i botomy, roxyurea 57 4 3.6 19,970 810,000 O No 88 No botomy M 57 12 3.0 19,530 1,119,000 8 No 60 No botomy, roxyurea 51 5 0.7 19,130 1,052,000 5 No 100 No botomy 46 4 1.1 20,520 1480,000 O No 82 No botomy 67 7 4.5 27,270 191,000 14 No 100 No botomy 60 9 2.5 13,870 1,176,000 4 No 49 No botomy 71 33 2.5 16,770 491,000 2O Yes 100 No Phlebotomy, Hydroxyurea

TABLE 4 Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 204805 s at H1FX H1 histone family, member X 8971 91935 O.00114 O. O19 202888 s at ANPEP alanyl (membrane) 290 431.97 O.OO1209 O. O19 aminopeptidase 213326 at WAMP1 vesicle-associated membrane 6843 380311 O.OO1564 O. O19 protein 1 (synaptobrevin 1) 212543 at AIM1 absent in melanoma 1 2O2 .689059 O.002053 O19 201427 s at SEPP1 Selenoprotein P. plasma, 1 6414 42747S O.OO3366 2598 206674 at FLT3 ims-related tyrosine kinase 3 2322 701 119 O.OO3846 2598 206385 S at ANK3 ankyrin 3, node of Ranvier 288 257882 O.OO4488 s 2598 (ankyrin G) 2094.87 at RBPMS RNA binding protein with 11030 23478 O. 2598 multiple splicing 219871 at FLJ13197 uncharacterized FLJ13197 79667 3O1817 O.OOSTO4 O. 2598 2094.88 s at RBPMS RNA binding protein with 11030 275396 O.OO6845 2598 multiple splicing 221645 S. at ZNF83 Zinc finger protein 83 55769 20O283 O. 2598 213005 s at KANK1 KN motif and ankyrin repeat 231.89 707475 2598 domains 1 213817 at RAK3 interleukin-1 receptor 11213 218239 O.O10346 2598 associated kinase 3 202039 at MYO18A myosin XVIIIA 3996.87 175294 O.O11058 2598 2 O644 S at LAIR1 eukocyte-associated 3903 348313 O.O11154 9. 2598 immunoglobulin-like receptor 1 2 04352 at TRAFS TNF receptor-associated factor 5 7188 12S428 O.O12268 2598 2 4290 s. at HIST2H2AA4 histone cluster 2, H2aa4 723790 8796OS O.O13116 2598 2 22146 s at TCF4 transcription factor 4 6925 385756 O.O1315S 2598 5.9375 at MYO15B myosin XVB pseudogene 80O22 108.123 O.O13372 2598 206486 at LAG3 ymphocyte-activation gene 3 3902 O.994,363 O.O14533 2598 2 2794 S at KIAA1033 KLAA1033 23325 287389 O.O14972 2598 2 8086 at NPDC1 neural proliferation, 56.654 O13593 O.O15204 2598 differentiation and control. 1 2 8280 x at HIST2H2AA4 histone cluster 2, H2aa4 723790 830.191 O.O1535 O. 2598 213655 at YWHAE tyrosine 3 7531 -140323 O.O15549 2598 monooxygenase/tryptophan 5 monooxygenase activation protein, epsilon polypeptide US 2015/0292028 A1 Oct. 15, 2015 21

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 219173 at MYO15B myosin XVB pseudogene 80O22 147267 O.O16111. O.127919 212587 s at PTPRC protein tyrosine phosphatase, 5788 942O28 O.O16627 O.128539 receptor type, C 218312 s at ZSCAN18 Zinc finger and SCAN domain 65982 S39329 O.O17836 0.128539 containing 18 207836 s at RBPMS RNA binding protein with 11030 O91491 O.O18254 0.128539 multiple splicing 207426 s at TNFSF4 tumor necrosis factor (ligand) 7292 381424 O.O19204 0.129221 Superfamily, member 4 212762 s at TCF7L2 transcription factor 7-like 2 (T. 6934 O46634 O.O.198.13 O.129892 cell specific, HMG-box) 209398 at HIST1H1C histone cluster 1, H1c 3006 60SSS O.O2O228 O.129892 211675 S. at MDFIC MyoD family inhibitor domain 29969 155886 O.O2O685 0.129892 containing 206133 at XAF1 XIAP associated factor 1 54739 158372 O.O2O857 0.129892 218966 at MYOSC myosin VC 55930 S36923 O.O2O94 O.129892 214455 at HIST1H2BC histone cluster 1, H2bc 8347 4824O3 O.O232OS 0.131273 205471 S. at DACH1 dachshund homolog 1 1602 O.95962 O.O23854. O.131273 (Drosophila) 21834.6 s at SESN1 sestrin 1 27244 O57229 O.O24057 0.131273 209993 at ABCB1 ATP-binding cassette, sub- S243 O12543 O.O24783 0.131273 family B (MDR/TAP), member 1 206710 S. at EPB41L3 erythrocyte membrane protein 23136 O.9772O2 O.O24.885 0.131273 band 4.1-like 3 20270.8 s at HIST2H2BE histone cluster 2, H2be 8349 .7691.14 O.O2667 O.131273 200986 at SERPING1 Serpin peptidase inhibitor, 710 O48714 O.O26758 0.131273 clade G (C1 inhibitor), member 1 207111 at EMR1 egf-like module containing, 2015 O4867 O.O26977 O.131273 mucin-like, hormone receptor like 1 219355 at CXorf57 chromosome X open reading 55086 O.956366 0.027482 0.131273 frame 57 201196 s at AMD1 adenosylmethionine 262 127364 O.O2763 O.131273 decarboxylase 1 207564 x at OGT O-linked N-acetylglucosamine 8473 1809SS O.O27 642 O.131273 (GlcNAc) transferase 202686 s at AXL AXL receptor tyrosine kinase 558 -1.17476 O.O278O8 O.131273 208268 at ADAM28 ADAM metallopeptidase 10863 222576 O.O281 06 0.131273 domain 28 215307 at ZNF529 Zinc finger protein 529 57711 O29099 O.O28782 0.132865 219571 S. at ZNF12 Zinc finger protein 12 7559 O33403 O.O3O225 0.136525 209994 S at ABCB1 ATP-binding cassette, sub- S243 O.988532 0.030956 O.136.933 amily B (MDR/TAP), member 1 212560 at SORL1 sortilin-related receptor, 6653 23237 S O.O31193 0.136933 L(DLR class) A repeats containing 205767 at EREG epiregulin 2069 S76209 O.O32309 O.137923 221718 S at AKAP13 A kinase (PRKA) anchor 11214 O.99057S O.O33371 O.139481 protein 13 214472 at HIST1H2AD histone cluster 1, H2ad 3013 221 696 O.O34306 0.139481 209447 at SYNE1 spectrin repeat containing, 23345 O26492 O.O34672 0.139481 nuclear envelope 1 207571 x at THEMIS2 hymocyte selection associated 9473 23688 O.O3S236 0.139481 amily member 2 210785 s at THEMIS2 hymocyte selection associated 9473 .258674 0.035631 O.139481 amily member 2 209543 s at CD34 CD34 molecule 947 31764 O.O37479 0.144.458 220952 S at PLEKHAS pleckstrin homology domain 54477 O591.86 O.O39091. O.147854 containing, family A member 5 2014.48 at TLA1 TIA1 cytotoxic granule- 7072 289342 O.O3910S 0.147854 associated RNA binding protein 221543 s at ERLIN2 ER lipid raft associated 2 11160 O19463 O.O40859 O.15O196 206715 at TFEC transcription factor EC 22797 291151 O.O42627 O.153844 22O122 at MCTP1 multiple C2 domains, 79772 O2S269 O.O43486 0.1 SS532 transmembrane 1 209318 X at PLAGL1 pleiomorphic adenoma gene- 5325 31SSOS O.O46285 0.160061 ike 1 208056 s at CBFA2T3 core-binding factor, runt 863 .116738 0.04637 O.16OO61 domain, alpha Subunit 2: translocated to, 3 US 2015/0292028 A1 Oct. 15, 2015 22

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 204972 at OAS2 2'-5'-oligoadenylate synthetase 4939 1.090829 O.046707 O.16OO61 2, 69/71 kDa 201236 s at BTG2 BTG family, member 2 7832 1.091134 O.O46768. O.16OO61 214218 s at XIST X inactive specific transcript 7503 1.3244 O.04853 O.163276 (non-protein coding) 220940 a ANKRD36B ankyrin repeat domain 36B 57730 1.168735 0.049352 0.163699 209930 S. at NFE2 nuclear factor (erythroid- 4778 1.3317SS O.OSO315 O.163699 derived 2), 45 kDa 205239 a AREG amphiregulin 374 120SS71 O.OS 1692 O.163838 217593 a ZSCAN18 Zinc finger and SCAN domain 65982 O.84O704 O.OS4O78 O.167SS1 containing 18 222067 x at HIST1H2BD histone cluster 1, H2bd 3017 1.198697 0.063984 O.189566 213094 a GPR126 G protein-coupled receptor 126 57211 1.17747 0.06522 O.191029 212775 a. OBSL1 obscurin-like 1 23363 1.331391 0.06S586 O.191029 221249 s at FAM117A amily with sequence similarity 81558 1.637593 0.066403 O.191029 17, member A 210172 a SF1 splicing factor 1 7536 O.997S88 OO67011. O.191391 207496 a MS4A2 membrane-spanning 4- 22O6 O.7726O1 O.O69284 O.193702 domains, subfamily A, member 2 218589 a LPAR6 ySophosphatidic acid receptor 6 101.61 1.080018 0.071983 O.1998.41 204749 a NAP1L3 nucleosome assembly protein 4675 1.2964O6 0.073554 0.2O2786 -like 3 211302 s at PDE4B phosphodiesterase 4B, cAMP- S142 O.858839 O.O76239 O.2O7306 specific 215779 s at HIST1H2BG histone cluster 1, H2bg 8339 O.902184 O.076987 O.2O7917 213293 s at TRIM22 tripartite motif containing 22 10346 468514 O.O77S35 0.207984 218352 at RCBTB1 regulator of chromosome 55213 O8448 O.O82823 O.214891 condensation (RCC1) and BTB (POZ) domain containing protein 1 220918 at RUNX1-IT1 RUNX1 intronic transcript 1 80215 110688 O.O830O8 0.214891 (non-protein coding) 204116 at L2RG interleukin 2 receptor, gamma 3561 O.8929.53 O.O85322 O.217134 210254 at MS4A3 membrane-spanning 4- 932 O32003 0.088393 0.223S17 domains, subfamily A, member 3 (hematopoietic cell-specific) 213998 s at DDX17 DEAD (Asp-Glu-Ala-Asp) box 10521 29709 O.O90384 O.22S675 helicase 17 206631 at PTGER2 prostaglandin E receptor 2 5732 O.863461 O.O94568 0.233 189 (subtype EP2), 53 kDa 219737 s at PCDH9 protocadherin 9 S101 423384 O.O95952 O.23S143 206067 s at WT1 Wilms tumor 1 7490 -O.97SO9 O.O97098 0.23S18.9 212813 at AM3 iunctional adhesion molecule 3 83700 O.851683 0.0971S6 O.23S189 203708 at PDE4B phosphodiesterase 4B, cAMP- S142 258787 0.098.941 O.236,778 specific 213734 at WSB2 WD repeat and SOCS box SS884 -1.03595 0.103178 O.243147 containing 2 212382 at TCF4 transcription factor 4 6925 222721 0.103S06 0.243147 212044 S at RPL27A ribosomal protein L27a 6157 -1.30359 O. 11014 O.2SS2O3 209774 X at CXCL2 chemokine (C-X-C motif) 2920 -1.35733 0.111447 0.255748 igand 2 204420 at FOSL1 FOS-like antigen 1 8061 0.777712 0.125065 O.28372 219352 at HERC6 HECT and RLD domain 55008 O.731325 O.126978 O.286421 containing E3 ubiquitin protein igase family member 6 219371 S. at KLF2 Kruppel-like factor 2 (lung) 1036S O.952494 O.1338O8 O.29512 208436 s at RF7 interferon regulatory factor 7 3665 O.817301 0.142117 O.308.309 208490 X at HIST1H2BF histone cluster 1, H2bf 8343 O.823714 O. 153384 O.325493 217168. S. at HERPUD1 homocysteine-inducible, 9709 -1.02O32 0.153554. O.325493 endoplasmic reticulum stress inducible, ubiquitin-like domain member 1 218.723 s at RGCC regulator of cell cycle 28984 1.1783S3 0.16831 O.3472O2 221943 x at RPL38 ribosomal protein L38 6169 -0.87S37 0.169666 0.3472O2 202912 at ADM adrenomedullin 133 -O.9O139 O.175228 O.356746 202086 at MX1 myxovirus (influenza virus) 4599 1.08.2812 O.179388 O.362009 resistance 1, interferon inducible protein p78 (mouse) 204794 at DUSP2 dual specificity phosphatase 2 1844 -1.056O7 0.185851 0.370769 200878 at EPAS1 endothelial PAS domain 2O34 -O.94127 0.187138 0.371469 protein 1 US 2015/0292028 A1 Oct. 15, 2015 23

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 214395 X at EEF1D eukaryotic translation 1936 -O.75421 O.221404 O418581 elongation factor 1 delta (guanine nucleotide exchange protein) 39248 at AQP3 aquaporin 3 (Gill blood group) 360 -1.0387 O.221416 0.418581 201590 X at ANXA2 annexin A2 3O2 -O.83364 O.224.539 O.422475 202087 s at CTSL1 cathepsin L1 1514 -O.72277 0.227S35 0.426091 201897 s at CKS1B CDC28 protein kinase 1163 -0.75777 0.23559 O.436O77 regulatory subunit 1B 202869 at OAS1 2'-5'-oligoadenylate synthetase 4938 O.6456O4 O.239395 O.44 , 40.46 kDa 204351 at S1 OOP S100 calcium binding protein P 6286 -1.19041 0.248298 O.447645 205220 at HCAR3 hydroxycarboxylic acid 8843 -O.75269 O.248.929 O.447645 receptor 3 201289 at CYR61 cysteine-rich, angiogenic 3491 -O. 94996 O.249.241 O.447645 inducer, 61 213943 at TWIST1 twist basic helix-loop-helix 7291 -O.76051 O.2S1394 O.447645 transcription factor 1 201566 X at ID2 inhibitor of DNA binding 2, 3398 O.738.645 0.252916 0.448249 dominant negative helix-loop helix protein 204286 s at PMAIP1 phorbol-12-myristate-13- S366 O.658217 O.254968 O.449876 acetate-induced protein 1 203038 at PTPRK protein tyrosine phosphatase, 5796 -O.89732 0.259282 0.45O102 receptor type, K 212097 at CAV1 caveolin 1, caveolae protein, 857 -O.8953 O.2597.04 O.45O102 22 kDa 202733 at P4HA2 prolyl 4-hydroxylase, alpha 8974 -O.88S47 0.26O765 0.45O102 polypeptide II 203917 at CXADR coxsackie virus and adenovirus 1525 -0.70323 O.261975 0.45O233 receptor 204103 at CCL4 chemokine (C-C motif) ligand 4 63S1 -O-93799 0.264919 0.453331 202458 at PRSS23 protease, serine, 23 11098 -O.7SO62 0.266945 0.454838 213539 at CD3D CD3d molecule, delta (CD3- 915 -O.74368 0.268679 0.455836 TCR complex) 210321 at GZMH granzyme H (cathepsin G-like 2999 -0.6763 0.279967 O.472525 2, protein h-CCPX) 214453 s at IFI44 interferon-induced protein 44 10561 O.80743 O.28O897 O.472S25 211560 s at ALAS2 aminolevulinate, delta-, 212 -O.96058 0.293.731 O.486931 synthase 2 201744 is at LUM lumican 4O60 -O.724.81 0.298.238 0.491288 211340 S at MCAM melanoma cell adhesion 4.162 -0.77567 0.306814 0.4992O1 molecule 204959 at MINDA myeloid cell nuclear 4332 -O.90O22 O.316701 O.SO4456 differentiation antigen 202587 s at AK1 adenylate kinase 1 2O3 -0.63641 (0.317949 OSO4456 218959 at HOXC10 homeobox C10 3226 -0.61573 0.319085 OSO4456 205495 S at GNLY granulysin 10578 -0.68517 O.320209 O.SO4456 221958. S. at WLS wntless homolog (Drosophila) 79971 -0.70884 0.324929 O.SO696 202688 at TNFSF10 tumor necrosis factor (ligand) 8743 O.618043 O.32S629 O.SO696 Superfamily, member 10 20908.7 x at MCAM melanoma cell adhesion 4.162 -O.81432 O.3269S4 OSO7034 molecule 209210 s. at FERMT2 fermitin family member 2 10979 -1.11824 0.329723 O.SO854 205488 at GZMA granzyme A (granzyme 1, 3OO1 -O.S9006 0.330487 O.SO854 cytotoxic T-lymphocyte associated serine esterase 3) 201739 at SGK1 serum glucocorticoid regulated 6446 -10293 O.33S357 O.SO8988 kinase 1 211506 s at IL8 interleukin 8 3576 -0.69682 0.336251 O.SO8988 204962 s at CENPA centromere protein A 1058 -0.67424 O.336317 O.SO8988 212698 s at 10-Sep septin 10 151011 -O.74724 O.3371.88 OSO8988 33322 i at SFN stratifin 2810 -O.7S4O1 O.341463 O.SO9458 218705 S at SNX24 Sorting nexin 24 28966 -O.S7987 0.342374 OSO9458 205552 s at OAS1 2'-5'-oligoadenylate synthetase 4938 O.S.0836 0.344124 OSO9458 1, 40.46 kDa 201506 at TGFBI transforming growth factor, 7045 -0.66233 0.345804 OSO9458 beta-induced, 68 kDa 202011 at TJP1 tightjunction protein 1 7082 -0.64431 O.347774 OSO9458 204517 at PPIC peptidylprolyl isomerase C S48O -O.S9936 O.349374 OSO9458 (cyclophilin C) US 2015/0292028 A1 Oct. 15, 2015 24

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 209230 S. at NUPR1 nuclear protein, transcriptional 264.71 -0.65323 O.3SO449 O.SO9458 regulator, 1 219073 s at OSBPL10 oxysterol binding protein-like 114884 -O.S9261 O.3S1262 O.SO9458 10 205476 at CCL20 chemokine (C-C motif) ligand 6364 -O-6399 O.357651 O.S12993 2O 221577 x at GDF15 growth differentiation factor 15 9518 -0.65491 O-364519 O.S16042 202718 at IGFBP2 insulin-like growth factor 3485 -O.S7195 O.365259 O.S16042 binding protein 2,36 kDa 207039 at CDKN2A cyclin-dependent kinase 1029 -O.71306 0.36807 0.517873 inhibitor 2A 204920 at CPS1 carbamoyl-phosphate synthase 1373 -O.81774 0.3691.64 O.S17873 1, mitochondrial 200771 at LAMC1 laminin, gamma 1 (formerly 3915 -0.65676 O.37062 O.S1808S LAMB2) 219454 at EGFL6 EGF-like-domain, multiple 6 25975 -O.S6974 0.374S12 O.S18966 212328 at LIMCH1 LIM and calponin homology 22998 -O.72S38 0.37SSS O.S18966 domains 1 207076 s at ASS1 argininosuccinate synthase 1 445 -O.96506 0.376.479 O.S18966 201983 s at EGFR epidermal growth factor 1956 -0.56631 0.379717 O.5.19326 receptor 203438 at STC2 Stanniocalcin 2 8614 -O.S4.868 0.385726 O.S2O981 212012 at PXDN peroxidasin homolog 7837 -0.6990S 0.3859 O.S2O981 (Drosophila) 203153 at FIT1 interferon-induced protein with 3434 O.SSS37 0.389138 O.S2O981 tetratricopeptide repeats 1 206785 s at KLRC1 killer cell lectin-like receptor 38.21 -0.5784 O.393476 O.S2O981 Subfamily C, member 1 217564 S at CPS1 carbamoyl-phosphate synthase 1373 -O.79731 O.394.672 O.S2O981 1, mitochondrial 202052 s at RAI14 retinoic acid induced 14 26064 -0.5724 O.3967 O.S2O981 204992 S at PFN2 profilin 2 5217 -0.772 O.396957 O.S2O981 204007 at FCGR3B Fc fragment of IgG, low 2215 -0.64158 0.397187 O.S2O981 affinity IIIb, receptor (CD16b) 210095 s at GFBP3 insulin-like growth factor 34.86 -0.60O33 O.397625 O.S2O981 binding protein 3 200798 X at MCL1 myeloid cell leukemia 4170 O.S4O947 0.39956 O.S21124 sequence 1 (BCL2-related) 212364 a MYO1B myosin IB 4430 -O.SSS26 0.4O1476 O.S21124 212765 a CAMSAP2 calmodulin regulated spectrin- 23271 -0.56269 O.4O1672 0.521124 associated protein family, member 2 204284 a PPP1R3C protein phosphatase 1, 5507 -0.54464 0.406184 O.5.23753 regulatory subunit 3C 201976 S. at MYO10 myosin X 4651 -0.55951 0.406337 O.S237S3 208079 s at AURKA aurora kinase A 6790 -0.6SS13 0.408O2S O.S24226 219959 a MOCOS molybdenum cofactor Sulfurase 55034 -O.85667 O.41OS21 O.S25731 213139 a SNAI2 Snail homolog 2 (Drosophila) 6591 -O.S5315 0.414603 O.S26676 201292 a TOP2A topoisomerase (DNA) II alpha 7153 -0.61773 0.41473 O.S26676 170 kDa 209101 a CTGF connective tissue growth factor 1490 -0.63969 O.416358 O.S26676 210587 a INHIBE inhibin, beta E 83729 -0.6.1908 O.4.19791 O.S26676 202768 a FOSB FBJ murine osteosarcoma viral 23S4 O.785327 O.421407 O.S26676 oncogene homolog B 219148 a PBK PDZ binding kinase 55872 -0.62389 0.422616 O526676 201505 a. LAMB1 laminin, beta 1 3912 -O.S9203 0.422812 O.S26676 204439 a IFI44L interferon-induced protein 44- 10964 O.779572 0.423198 OS26676 like 204688 a SGCE sarcoglycan, epsilon 8910 -O.S3807 0.427.632 O.S30004 210274 a MAGEA8 melanoma antigen family A, 8 4107 -O.SS437 0.44OO77 O.S3411 218400 a OAS3 2'-5'-oligoadenylate synthetase 4940 O401878 O.441825 O.S3411 3, 100 kDa 204033 a TRIP13 thyroid hormone receptor 93.19 -0.53242 0.443536 O53411 interactor 13 205033 s at DEFA1 defensin, alpha 1 1667 -0.68446 0.443688 OS3411 209921 a SLC7A11 Solute carrier family 7 (anionic 23657 -0.67363 0.443971 OS3411 amino acid transporter light chain, Xc-system), member 11 204415 a. IFI6 interferon, alpha-inducible 2537 O.448113 O.446822 OS3412 protein 6 US 2015/0292028 A1 Oct. 15, 2015 25

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 203510 at MET met proto-oncogene 4233 -0.59266 0.449267 O.S3412 (hepatocyte growth factor receptor) 33323 r at SFN stratifin 2810 -0.63466 0.4506.23 O.S3412 212671 s at HLA-DQA1 major histocompatibility 3117 -0.73617 O.45086 O.S3412 complex, class II, DQ alpha 1 205047 s at ASNS asparagine synthetase 440 -0.622O8 O.454.871 OS34967 (glutamine-hydrolyzing) 200606 at DSP desmoplakin 1832 -0.6615 O.4SS463 O.S34967 205573 s at SNX7 Sorting nexin 7 51.375 -O.SO744 0.46O196 O.S38.931 204684 at NPTX1 neuronal pentraxin I 4.884 -0.48978 O.463571 OS4O181 204483 at ENO3 enolase 3 (beta, muscle) 2027 -O.S7582 0.463984 O.S4O181 221008 S. at AGXT2L1 alanine-glyoxylate 648SO -O.S9789 O.47 1814 O.S4S637 aminotransferase 2-like 1 200795 at SPARCL1 SPARC-like 1 (hevin) 8404 -O.SO481 0.47SS62 O.S4651.7 21161.8 s a ALPI alkaline phosphatase, intestinal 248 -0.48827 0.477352 O.S4651.7 207140 at ALPI alkaline phosphatase, intestinal 248 -O.90959 O.477868 OS4651.7 204288. S. at SORBS2 sorbin and SH3 domain 847O -O.S2462 0.481567 O.S4651.7 containing 2 201681 s at DLG5 discs, large homolog 5 9231 -O.472O2 (0.48294 OS4651.7 (Drosophila) 203881 S. at DMD dystrophin 1756 -0.49SO4 0.483193 OS4651.7 219599 at EIF4B eukaryotic translation initiation 1975 -0.53684 0.487369 O.548489 factor 4B 203636 at MID1 midline 1 (Opitz/BBB 4281 -0.45754 O.488.315 O.S48489 syndrome) 214240 at GAL galanin GMAP prepropeptide S1083 -OSO116 0.489081 0.548489 209094 at DDAH1 dimethylarginine 23576 -O.S1772 0.495452 O.SS4O68 dimethylaminohydrolase 1 2186.31 at AVP1 arginine vasopressin-induced 1 60370 -0.49809 O.SOO2O8 O.SS6142 204540 at EEF1A2 eukaryotic translation 1917 -042637 O.SOO471 OSS6142 elongation factor 1 alpha 2 210016 at MYT1L. myelin transcription factor 1- 23040 -O.SS739 O.S.02376 O.SS6142 like 205289 at BMP2 bone morphogenetic protein 2 6SO -O.S.1385 OSO342 O.SS6142 205751 at SH3GL2 SH3-domain GRB2-like 2 6456 -0.43617 O.SO431 O.SS6142 218541 s at C8orf24 chromosome 8 open reading 56892 -O.S2893 O.SO917.4 O.S.S9951 frame 4 214247 s at DKK3 dickkopf 3 homolog (Xenopus 27122 -O.S146S O.S11216 O.S60643 laevis) 214212 X at FERMT2 fermitin family member 2 10979 -044903 0.514141 0.562297 208209 s at C4BPB complement component 4 725 -0.49739 O.S182S1 O.S.6523S binding protein, beta 208396 s at PDE1A phosphodiesterase 1A, S136 -0.46854 0.526142 O.S71827 calmodulin-dependent 209942 X at MAGEA3 melanoma antigen family A, 3 4102 -O-58148 0.5289 0.572135 214612 X at MAGEA6 melanoma antigen family A, 6 41OS -0.6O458 O.S32798 OS 7304 201660 at ACSL3 acyl-CoA synthetase long- 2181 -0.42544 O.S33497 O.S7304 chain family member 3 204975 at EMP2 epithelial membrane protein 2 2013 -O.47324 O.S36232 O.S7304 201667 at GA1 gap junction protein, alpha 1, 2697 -O.SS978 O.S36604 O.S7304 43 kDa 201291 s at TOP2A topoisomerase (DNA) II alpha 7153 -O.S1625 O.S369S4 O.S7304 170 kDa 204653 at TFAP2A transcription factor AP-2 alpha 7020 -0.434O6 O.S4.4838 (O.S79895 (activating enhancer binding protein 2 alpha) 205132 at ACTC1 actin, alpha, cardiac muscle 1 70 -0.38632 O.SS232 O.S84901 217127 at CTH cystathionase (cystathionine 1491 -0.44229 O.552489 O.584901 gamma-lyase) 205381 at LRRC17 leucine rich repeat containing 17 10234 -O.3995S O.SS4O73 O.S85O19 209967 s at CREM cAMP responsive element 1390 -0.45103 O.SS7616 O.S871.98 modulator 202672 s at ATF3 activating transcription factor 3 467 O4904O4 O.S60O82 O.S87586 209631 S. at GPR37 G protein-coupled receptor 37 2861 -0.44217 O.S60945 O.S87586 (endothelin receptor type B like) 221730 at COLSA2 collagen, type V, alpha 2 1290 -0.40443 0.562469 O.S87632 210467 X at MAGEA12 melanoma antigen family A, 12 4111 -0.46SO3 O.S66943 O.S907 S2 203083 at THEBS2 thrombospondin 2 7058 -O.37936 O.S69007 O.S913S 215034 S. at TM4SF1 transmembrane 4 L six family 4O71 -0.4484 O.S71318 O.S922O2 member 1 US 2015/0292028 A1 Oct 15, 2015 26

TABLE 4-continued Gene Expression in Women Patients Symbol (Na32 Gene Title (Na32 Entrez GeneD Adjusted ProbesetID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2(FC) P-Value P-Value 206377 at FOXF2 orkhead box F2 2295 -0.36443 O.S85328 O.6OS143 213131 at OLFM1 olfactomedin 1 10439 -O.35953 0.610643 O.629676 202976 S. at RHOBTB3 Rho-related BTB domain 22836 -O.3467 O.614674 O.63219 containing 3 202887 s at DDIT4 DNA-damage-inducible 54541 -0.45548 0.618537 0.634.52 transcript 4 203984 S at CASP9 caspase 9, apoptosis-related 842 -O.35376 O.632586 O.647259 cysteine peptidase 205290 s. at BMP2 bone morphogenetic protein 2 6SO -O.47882 0.64O799 0.653977 204337 at RGS4 regulator of G-protein 5999 -O.26477 0.708833 0.717874 signaling 4 217867 X at BACE2 beta-site APP-cleaving enzyme 2 25825 -O-2906 O.71423 O.721499 212327 at LIMCH1 LIM and calponin homology 22998 -O.281.39 O.723O86 0.728591 domains 1 202391 at BASP1 brain abundant, membrane 104.09 0.338672 0.73503 0.738752 attached signal protein 1

TABLE 5 Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 208730 X at RAB2A RAB2A, member RAS S862 -2.23913 0.00173 O.2246 oncogene family 201242 S at ATP1B1 ATPase, Na+/K+ transporting, 481 -2.30995 O.OO1936 O.2246 beta 1 polypeptide 206.857 s at FKBP1B FK506 binding protein 1B, 2281 -2.18904 O.OO3742 (0.2246 12.6 kDa 208.636 at ACTN1 actinin, alpha 1 87 -191968 0.005679 0.2246 206493 at ITGA2B integrin, alpha2b (platelet 3674 -2.94275 O.OO6689 (0.2246 glycoprotein IIb of IIb, IIIa complex, antigen CD41) 211986 at AHNAK AHNAKnucleoprotein 79026 1.54422 O.OO875 O.2246 203509 at SORL1 sortilin-related receptor, 6653 1.561462 O.OO9157 0.2246 L(DLR class) A repeats containing 206494 s at ITGA2B integrin, alpha2b (platelet 3674 -32O741 O.OO9481 0.2246 glycoprotein IIb of IIb, IIIa complex, antigen CD41) 201846 s at RYBP RING1 and YY1 binding 23429 -1.62523 O.OO97O1 O.2246 protein 213229 at DICER1 dicer 1, ribonuclease type III 234OS -1.70923 O.O1 O2SS O.2246 202620 S. at PLOD2 procollagen-lysine, 2- 5352 -1.86792 O.O1 OS35 0.2246 oxoglutarate 5-dioxygenase 2 202760 s at AKAP2 A kinase (PRKA) anchor 11217 -166558 0.010984 O.2246 protein 2 215813 s at PTGS1 prostaglandin-endoperoxide 5742 -2.12304 O.O11371 O.2246 synthase 1 (prostaglandin GH synthase and cyclooxygenase) 219054 at NPR3 natriuretic peptide receptor 4883 815762 O.O12117 O.2246 Ciguanylate cyclase C (atrionatriuretic peptide receptor C) 37462 i at SF3A2 splicing factor 3a, Subunit 2, 8175 -1.7347S O.O1271 O.2246 66 kDa 212266 s at SRSFS serinefarginine-rich splicing 6430 814328 O.O12914 O.2246 factor 5 2014.89 at PPIF peptidylprolyl isomerase F 101OS -1.57807 O.O13197 0.2246 203096 s at RAPGEF2 Rap guanine nucleotide 9693 -1901.84 O.O133O8 O.2246 exchange factor (GEF)2 205128 x at PTGS1 prostaglandin-endoperoxide 5742 -198263 O.O13941 O.2246 synthase 1 (prostaglandin GH synthase and cyclooxygenase) 22105.9 s at COTL1 coactosin-like 1 23406 -2.38475 O.O14419 0.2246 (Dictyostelium) 212268 at SERPINB1 Serpin peptidase inhibitor, clade 1992 1.576.065 O.O15209 O.2246 B (ovalbumin), member 1 US 2015/0292028 A1 Oct. 15, 2015 27

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 201012 at ANXA1 annexin Al 301 431866 OO15821 O.2246 207808 S. at PROS1 protein S (alpha) 5627 -2.54684 O.O1834 O.2246 206302 s at NUDT4 nudix (nucleoside diphosphate 11163 -1.35819 O.O1853 O.2246 linked moiety X)-type motif 4 203320 at SH2B3 SH2B adaptor protein 3 10019 -1481.25 O.O19452 0.2246 205647 at RADS2 RAD52 homolog (S. 5893 244884 O.O19524 O.2246 cerevisiae) 2101.05 s at FYN FYN oncogene related to SRC, 2534 -1.57809 O.O2OOST O.2246 FGR, YES 200598 s at HSP90B1 heat shock protein 90 kDa beta 7184 -1.77815 O.O2O317 O.2246 (Grp94), member 1 200964 at UBA1 ubiquitin-like modifier 7317 -1.39778 O.O2O397 0.2246 activating enzyme 1 221493 at TSPYL1 TSPY-like 1 7259 .744517 O.O21178 O.2246 206174 s at PPP6C protein phosphatase 6, catalytic 5537 -135248 0.02.1364 O.2246 Subunit 202284 S at CDKN1A cyclin-dependent kinase 1026 -2.00033 O.O23319 O.2246 inhibitor 1A (p21, Cip1) 206207 at CLC Charcot-Leyden crystal protein 1178 -1.888.11 O.O23511 O.2246 206655 s at GP1BB glycoprotein Ib (platelet), beta 2812 -292989 O.O23S14 0.2246 polypeptide 206571 S. at MAP4K4 mitogen-activated protein 9448 -1.25865 O.O2388 O.2246 kinase kinase kinase kinase 4 209651 at TGFB11 transforming growth factor beta 7041 -2.18243 O.O24567 0.2246 1 induced transcript 1 204689 at HHEX hematopoietically expressed 3O87 462O27 O.O24863 0.2246 homeobox 205067 at IL1B interleukin 1, beta 3553 2554O4 O.O2S653 0.2246 203380 x at SRSFS serinefarginine-rich splicing 6430 SO3237 O.O2S756 0.2246 factor 5 200923 at LGALS3BP lectin, galactoside-binding, 3959 -1.56O76 O.O2S836 O.2246 Soluble, 3 binding protein 202949 s at FHL2 four and a half LIM domains 2 2274 -137209 O.O26399 0.2246 201695 s at PNP purine nucleoside 4860 -141068 0.0264.58 0.2246 phosphorylase 220748 S. at ZNF580 Zinc finger protein 580 51157 -1.34215 O.O281.23 O.2246 217901 at DSG2 desmoglein 2 1829 320976 O.O288O3 0.2246 219798 s at MEPCE methylphosphate capping 56257 -133OO1 O.O29245 0.2246 enzyme 209381 X at SF3A2 splicing factor 3a, Subunit 2, 8175 -141034 O.O29259 0.2246 66 kDa 204222 S at GLIPR1 GLI pathogenesis-related 1 11010 439903 O.O3O437 0.2246 221004 s at ITM2C integral membrane protein 2C 81618 219859 O.O307S3 O.2246 206049 at SELP Selectin P (granule membrane 6403 -2.17111 O.O311 11 O.2246 protein 140 kDa, antigen CD62) 37966 at PARVB parvin, beta 2978O -2.06542 O.O31383 0.2246 219681 s at RAB11 FIP1 RAB11 family interacting 80223 -135248 0.031529 O.2246 protein 1 (class I) 212242 at TUBA4A tubulin, alpha 4a 7277 -2.39641 (0.03153 O.2246 218237 S at SLC38A1 solute carrier family 38, 81539 S47237 O.O32294 0.2246 member 1 213726 X at TUBB4B tubulin, beta 4B class IVb 10383 -130164 O.O32486 0.2246 394.02 at IL1B interleukin 1, beta 3553 23S287 O.O32639 O.2246 2098.20 s at TBL3 transducin (beta)-like 3 106O7 -1.20712 O.O32649 0.2246 212312 at BCL2L1 BCL2-like 1 598 -1395.62 O.O33632 0.2246 211600 at PTPRO protein tyrosine phosphatase, S800 -145225 O.O3416 O.2246 receptor type, O 214783 s at ANXA11 annexin A11 311 -1.22688 O.O34.175 0.2246 200616 S. at MLEC malectin 9761 -1.20495 O.O34386 O.2246 211926 S. at MYH9 myosin, heavy chain 9, non- 4627 -1.2641 O.O34926 O.2246 USCG 202059 s at KPNA1 karyopherin alpha 1 (importin 3836 -1.12248 0.034962 0.2246 alpha 5) 221899 at N4BP2L2 NEDD4 binding protein 2-like 2 10443 316587 O.O3S008 O.2246 210347 s at BCL11A B-cell CLL/lymphoma 1 1A 53335 27390S O.O3SO19 O.2246 (Zinc finger protein) 221748 S. at TNS1 tensin 1 7145 -14894 O.O35747 0.2246 203940 S at WASH1 vasohibin 1 22846 -1.35628 0.037032 0.2246 204610 S. at CCDC85B coiled-coil domain containing 85B 11007 -1.5951 O.O37663 O.2246 222231 s a LRRC59 leucine rich repeat containing 59 55379 -1.11855 O.038092 O.2246 212177 at PNISR PNN-interacting 25957 175547 O.O3821 1 0.2246 serinefarginine-rich protein US 2015/0292028 A1 Oct. 15, 2015 28

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 201692 at SIGMAR1 sigma non-opioid intracellular 1028O -1.06876 O.O38307 O.2246 receptor 1 202112 at VWF von Willebrand factor 7450 -1.36382 O.O39327 O.2246 206310 at SPINK2 serine peptidase inhibitor, 6691 S688S1 O.O394.66 0.2246 Kazal type 2 (acrosin-trypsin inhibitor) 218899 s at BAALC brain and acute leukemia, 79870 S1143 O.O39771 0.2246 cytoplasmic 208308 s at GPI glucose-6-phosphate isomerase 2821 -124247 0.04O139 O.2246 221834 at LONP2 on peptidase 2, peroxisomal 83752 261036 O.O4O3O3 O.2246 210719 s at HMG20B high mobility group 20B 10362 -1.39762 0.040525 O.2246 200808 s at ZYX Zyxin 7791 -154764 O.O41293 0.2246 20994.5 S at GSK3B glycogen synthase kinase 3 2932 -1.28118 0.041713 O.2246 beta 208.637 X at ACTN1 actinin, alpha 1 87 -1.74284 0.04.1994 O.2246 20908.8 s at UBN1 ubinuclein 1 298.55 -114187 0.042143 0.2246 211005 at LAT inker for activation of T cells 27040 -1.83145 0.042364 O.2246 218131 s at GATAD2A GATA zinc finger domain S4815 -1.22531 O.O42653 0.2246 containing 2A 202729 s a LTBP1 atent transforming growth 4052 -1.87245 O.O42694 O.2246 actor beta binding protein 1 219357 at GTPBP1 GTP binding protein 1 9567 -1.11964 O.O42776 O.2246 201980 S. at RSU1 Ras Suppressor protein 1 6251 -133636 0.043967 O.2246 211671 S. at NR3C1 nuclear receptor Subfamily 3, 2908 257541 O.O441.83 0.2246 group C, member 1 (glucocorticoid receptor) 203007 x at LYPLA1 ySophospholipase I 10434 -124485 0.04487 O.2246 210299 S at FHL1 our and a half LIM domains 1 2273 459962 O.O4S279 0.2246 210783 X at CLEC11A C-type lectin domain family 632O -1.14617 O.O45531 O.2246 1, member A 209154 at TAX1BP3 Tax1 (human T-cell leukemia 3O851 -1.8O171 O.O45558 O.2246 virus type I) binding protein 3 212279 at TMEM97 transmembrane protein 97 27346 -1.2O825 0.046373 (0.2246 202102 s at BRD4. bromodomain containing 4 23476 -131832 0.046377 0.2246 200719 at SKP1 S-phase kinase-associated 6SOO -118511 O.046416 O.2246 protein 1 213416 at ITGA4 integrin, alpha 4 (antigen 3676 SOO306 0.046971 O.2246 CD49D, alpha 4subunit of VLA-4 receptor) 201251 at PKM pyruvate kinase, muscle 5315 -1.61415 0.04732 O.2246 220094 S at CCDC90A coiled-coil domain containing 63933 -133066 0.048464 O.2246 90A 202275 at G6PD glucose-6-phosphate 2539 -146785 0.04883 O.2246 dehydrogenase 21414.6 s at PPBP pro-platelet basic protein 5473 -244242 0.049566 0.2246 (chemokine (C-X-C motif) igand 7) 204081 at NRGN neurogranin (protein kinase C 4900 -2.56374 0.049579 0.2246 Substrate, RC3) 209868. S. at RBMS1 RNA binding motif, single 5937 165728 O.OSO155 0.2246 stranded interacting protein 1 211922 s at CAT catalase 847 232958 O.OS1088 0.2246 222310 at SCAF4 SR-related CTD-associated 57466 O77534 O.OS119 O.2246 actor 4 200697 at HK1 hexokinase 1 3098 -11627 O.OS1949 O.2246 200706 S. at LITAF ipopolysaccharide-induced 9516 O91394 O.OS2104 O.2246 TNF factor 220964 s at RAB1B RAB1B, member RAS 81876 -1.24O67 0.052429 O.2246 oncogene family 210215 at TFR2 transferrin receptor 2 7036 -1.65926 O.OS2589 0.2246 201260 S at SYPL1 synaptophysin-like 1 6856 S19931 O.OS2716 0.2246 221771 s at MPHOSPH8 M-phase phosphoprotein 8 54.737 277S64 O.OS3O33 0.2246 210986 s at TPM1 tropomyosin 1 (alpha) 71.68 -154226 O.OS33O8 O.2246 203674 at HELZ. helicase with Zinc finger 9931 115528 O.OS3318 0.2246 207238 s at PTPRC protein tyrosine phosphatase, 5788 189131 O.OS3365 0.2246 receptor type, C 201864 at GDI1 GDP dissociation inhibitor 1 2664 -1.17328 O.OS3513 O.2246 212036 s at PNN pinin, desmosome associated S411 S1428S O.OS3837 0.2246 protein 213521 at PTPN18 protein tyrosine phosphatase, 26469 -132436 0.05412 O.2246 non-receptor type 18 (brain derived) US 2015/0292028 A1 Oct. 15, 2015 29

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 202644 S at TNFAIP3 tumor necrosis factor, alpha- 7128 -1.72O75 O.OS4213 O.2246 induced protein 3 219090 at SLC24A3 solute carrier family 24 57419 -1.33752 0.054392 O.2246 (sodium/potassium calcium exchanger), member 3 2091.17 at WBP2 WW domain binding protein 2 23558 -1.30969 O.OS4585 0.2246 2091.60 at AKR1C3 aldo-keto reductase family 1, 8644 .332339 O.OS4731 O.2246 member C3 203085 S at TGFB1 transforming growth factor, 7040 -1.7S422 O.OSS437 0.2246 beta 1 200613 at AP2M1 adaptor-related protein 1173 -1.26768. O.OS 634 0.2246 complex 2, mu 1 subunit 212406 S. at PCMTD2 protein-L-isoaspartate (D- 55.251 40919 O.OS7779 0.2246 aspartate) O-methyltransferase domain containing 2 212281 s at TMEM97 transmembrane protein 97 27346 -1.25212 O.OS8007 O.2246 222113 s at EPS15L1 epidermal growth factor 58513 -1.22321 O.OS8228 O.2246 receptor pathway substrate 15 like 1 41047 at C9orf16 chromosome 9 open reading 79095 -13784 O.OS8369 O.2246 frame 16 202083 s at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -1.6O251 (0.058462 0.2246 43544 at MED16 mediator complex subunit 16 10O2S -137264 O.OS9358 0.2246 208398 s at TBPL1 TBP-like 1 9519 -1.0928S 0.06O3S3 O.2246 200001 at CAPNS1 calpain, Small subunit 1 826 -138469 O.O60708 O.2246 203321 S at ADNP2 ADNP homeobox2 228SO -114224 OO60952 O.2246 214752 x at FLNA filamin A, alpha 2316 -151816 OO61564 O.2246 221539 at EIF4EBP1 eukaryotic translation initiation 1978 -1.09846 0.062496 O.2246 factor 4E binding protein 1 208860 S at ATRX alpha thalassemiamental S46 305128 0.06313 O.2246 retardation syndrome X-linked 215933 s at HHEX hematopoietically expressed 3O87 399.528 O.O632S1 O.2246 homeobox 214753 at N4BP2L2 NEDD4 binding protein 2-like 2 10443 O43575 0.063268 0.2246 208284 x at GGT1 gamma-glutamyltransferase 1 2678 -113931 OO63281 O.2246 203163 at KATNB1 katanin p80 (WD repeat 1O3OO -1.04468 OO6434 0.2246 containing) subunit B 1 209301 at CA2 carbonic anhydrase II 760 -1.80993 OO64349 O.2246 204480 s at C9orf16 chromosome 9 open reading 79095 -1. SO337 O.064729 O.2246 frame 16 205668 at LY75 lymphocyte antigen 75 406S 143917 O.O64806 0.2246 211047 X at AP2S1 adaptor-related protein 1175 -1.1541 O.O65359 O.2246 complex 2, Sigma 1 subunit 201563 at SORD Sorbitol dehydrogenase 6652 -1.02865 0.066229 O.225836 214246 x at MINK1 misshapen-like kinase 1 SO488 -1.37631 O.066383 0.225836 212563 at BOP1 block of proliferation 1 23246 -1.07647 0.067OSS O.226454 215706 x at ZYX Zyxin 7791 -114429 OO67.478 O.226454 215116 s at DNM1 dynamin 1 1759 -1.02496 OO67.568. O.226454 209044 x at SF3B4 splicing factor 3b, Subunit 4, 10262 -1.14403 0.069176 O.227703 49 kDa 208977 x at TUBB4B tubulin, beta 4B class IVb 10383 -1.06783 0.06938S O.227703 203175 at RHOG ras homolog family member G 391 -1.12466 O.O7026 0.227703 212739 S at NMEA NMENM23 nucleoside 4833 -1.18 O.O70482 0.227703 diphosphate kinase 4 200734 S. at ARF3 ADP-ribosylation factor 3 377 -1.10487 O.O70887 O.227703 21303.6 X at ATP2A3 ATPase, Ca++ transporting, 489 -1.2.1253 O.O7161 0.227703 ubiquitous 210428 s at HGS hepatocyte growth factor- 9146 -108114 0.071709 O.227703 regulated tyrosine kinase Substrate 206272 at SPHAR S-phase response (cyclin 10638 -1.37986 0.071711 O.227703 related) 200742 s at TPP1 tripeptidyl peptidase I 1200 -144492 O.O71977 O.227703 202944 at NAGA N-acetylgalactosaminidase, 4668 -1.0861 O.O73258 0.2294.57 alpha 216841 s at SOD2 Superoxide dismutase 2, 6648 -107023 O.073344 0.2294.57 mitochondrial 203414 at MMD monocyte to macrophage 23531 -1.57415 0.073626 O.2294.57 differentiation-associated 215438 x at GSPT1 G1 to S phase transition 1 2935 -1.03476 O.O74204 0.2294.57 217918 at DYNLRB1 dynein, light chain, roadblock- 83658 -1.21177 0.07474. O.229995 type 1 US 2015/0292028 A1 Oct. 15, 2015 30

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 204628 S. at ITGB3 integrin, beta 3 (platelet 3690 -1.70942 O.O76434 0.233122 glycoprotein IIIa, antigen CD61) 214450 at CTSW cathepsin W 1521 -1.09904 0.076.703 0.233122 203262 s at FAMSOA family with sequence similarity 91.30 -1.05318 0.077683 0.23356S 50, member A 216956 S at ITGA2B integrin, alpha2b (platelet 3674 -2.02417 O.O7797 0.23356S glycoprotein IIb of IIb, IIIa complex, antigen CD41) 201639 s at CPSF1 cleavage and polyadenylation 298.94 -1.0534S O.O7936S O.234598 specific factor 1, 160 kDa 36711 at MAFF V-maf musculoaponeurotic 23764 -2.66779 0.0797O2 O.234598 fibrosarcoma oncogene homolog F (avian) 210910 S. at POMZP3 POM121 and ZP3 fusion 22932 -O.98043 O.O80921 O.234,598 206390 x at PF4 platelet factor 4 S196 -2.17632 0.081141 0.234,598 218443 s at DAZAP1 DAZ associated protein 1 26S28 -O-990 13 0.08140S 0.234598 20105.2 s at PSMF1 proteasome (prosome, 9491 -1.17083 0.081493 0.234598 macropain) inhibitor Subunit 1 (PI31) 211716 X at ARHGDIA Rho GDP dissociation inhibitor 396 -1.05994 O.O81516 O.234598 (GDI) alpha 200839 S at CTSB cathepsin B 1508 -1.238SS O.O81791 0.234598 203561 at FCGR2A Fc fragment of IgG, low 2212 -1. SO392 O.O82O39 O.234598 affinity IIa, receptor (CD32) 218611 at IERS immediate early response 5 51278 -141626 O.O82127 O.234,598 202619 s at PLOD2 procollagen-lysine, 2- 5352 -1.06567 0.082911 O.234.625 oxoglutarate 5-dioxygenase 2 204627 s at ITGB3 integrin, beta 3 (platelet 3690 -2.11954 0.083412 O.234.625 glycoprotein IIIa, antigen CD61) 201224 S at SRRM1 serinefarginine repetitive 1 O2SO -1.23842 0.08352 O.234.625 matrix 1 217736 s at EIF2AK1 eukaryotic translation initiation 27102 -1.07432 O.083557 0.234.625 factor 2-alpha kinase 1 200649 at NUCB1 nucleobindin 1 4924 -1.0434 O.O85339 O.23596 209555 S at CD36 CD36 molecule 948 -1.82889 0.086873 0.23596 (thrombospondin receptor) 212520 s at SMARCA4 SWI/SNF related, matrix 6597 -1.12786 0.086976 O.23596 associated, actin dependent regulator of chromatin, Subfamily a member 4 209367 at STXBP2 Syntaxin binding protein 2 6813 -1.12693 0.087289 0.23596 53071 s at OGFOD3 2-oxoglutarate and iron- 797O1 -1.02384 O.O87372 0.23596 dependent oxygenase domain containing 3 221953 s at MMP24 matrix metallopeptidase 24 10893 -114292 0.087422 O-23596 (membrane-inserted) 212640 at PTPLB protein tyrosine phosphatase- 2O1562 184144 O.O877O3 O-23596 ike (proline instead of catalytic arginine), member b 201797 s at WARS valyl-tRNA synthetase 74O7 -0.95792 O.O87831 O.23596 204232 at FCER1G Fc fragment of IgE, high 22O7 -1.72735 0.088324 O.236346 affinity I, receptor for; gamma polypeptide 202201 at BLVRB biliverdin reductase B (flavin 645 -1.03625 0.088981 0.236552 reductase (NADPH)) 203192 at ABCB6 ATP-binding cassette, sub- 10OS8 -1.03424 O.O90022 O-237141 amily B (MDR/TAP), member 6 221829 S. at TNPO1 transportin 1 3.842 -1.16481 0.090459 O.237366 213016 at BBX bobby Sox homolog 56987 -1.01796 0.091OO7 O.237691 (Drosophila) 20757.4 S at GADD45B growth arrest and DNA- 4616 -153642 0.091SO7 O.237691 damage-inducible, beta 207134 x at TPSB2 tryptase beta 2 64499 -1.2023 O.O92O2S 0.237791 (gene pseudogene) 211962 s at ZFP36L1 ZFP36 ring finger protein-like 1 677 -1.08806 0.094727 O.239603 201412 at LRP10 ow density lipoprotein 26O20 -1.16907 0.095687 0.239603 receptor-related protein 10 200859 x at FLNA filaminA, alpha 2316 -1.28906 0.09598 0.239603 201760 S at WSB2 WD repeat and SOCS box SS884 -0.9579 O.O97393 0.239.603 containing 2 US 2015/0292028 A1 Oct. 15, 2015 31

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 212256 at GALNT10 UDP-N-acetyl-alpha-D- 55568 -O.93SS O.097486 0.2396O3 galactosamine:polypeptide N acetylgalactosaminyltransferase 10 (GalNAc-T10) 202411 at IFI27 interferon, alpha-inducible 3429 -1.2O38 O.O97807 O.239.603 protein 27 209190 s. at DIAPH1 diaphanous homolog 1 1729 -1.O3246 0.097812 O.2396O3 (Drosophila) 212886 at CCDC69 coiled-coil domain containing 26112 -1.0779 O.O98162 0.239.603 69 215087 at C15orf59 chromosome 15 open reading 56.905 -1.19136 0.09937 O.2396O3 frame 39 211417 X at GGT1 gamma-glutamyltransferase 1 2678 -O.97792 O.09942 O.2396O3 218039 at NUSAP1 nucleolar and spindle S12O3 -1.1681 1 0.1OO2O1 O.2396O3 associated protein 1 215535 s at AGPAT1 1-acylglycerol-3-phosphate O- 10554 -114266 0.1OO71 O.2396O3 acyltransferase 1 219938 s at PSTPIP2 proline-Serine-threonine 90SO -1022O1 O.10O884 O2396O3 phosphatase interacting protein 2 213746 s at FLNA filamin A, alpha 2316 -1.37828 O.100915 0.2396O3 200611 S. at WDR1 WD repeat domain 1 9948 -108654 (0.101143 O.2396O3 208615 S. at PTP4A2 protein tyrosine phosphatase 8073 -1.16457 0.101.287 0.2396O3 type IVA, member 2 208002 s at ACOT7 acyl-CoA thioesterase 7 11332 -O.98943 O.101855 O.2396O3 201280 S. at DAB2 Dab, mitogen-responsive 16O1 -147352 0.101.99 O.2396O3 phosphoprotein, homolog 2 (Drosophila) 217529 at ORAI2 ORAI calcium release- 80228 -0.948SS O. 102013 O.2396O3 activated calcium modulator 2 214054 at DOK2 docking protein 2, 56 kDa 9046 -144148 (0.1O2476 O.2396O3 222043 at CLU clusterin 1.191 -1.34754 O. 102489 O.2396O3 201059 at CTTN cortactin 2017 -1.75221 O. 102546 O.2396O3 220239 at KLHL7 kelch-like family member 7 55975 -104556 (0.102824 O2396O3 201950 X. at CAPZB capping protein (actin filament) 832 -O.9793 O.10316 O.2396O3 muscle Z-line, beta 20719.6 s at TNIP1 TNFAIP3 interacting protein 1 103.18 -100708. O.103374 0.2396O3 211160 x at ACTN1 actinin, alpha 1 87 -1.26927 0.103783 0.2396O3 209350 S at GPS2 G protein pathway suppressor 2 2874 -110209 (0.103921 O.2396O3 219667 s at BANK1 B-cell scaffold protein with SSO24 -1.OO3O8 (0.104821 O.2396O3 ankyrin repeats 1 21.0075 at MARCH2 membrane-associated ring 51257 -1.43742 (0.104896 O2396O3 finger (C3HC4) 2, E3 ubiquitin protein ligase 201170 S. at BHLHE40 basic helix-loop-helix family, 8553 -152602 0.105204 0.2396O3 member e40 204254 S at WDR vitamin D (1,25- 7421 -104354 (0.10546 O2396O3 dihydroxyvitamin D3) receptor 21.0128 S. at LTB4R eukotriene B4 receptor 1241 -O.92SS3 0.105789 0.2396O3 221210 S. at NPL N-acetylneuraminate pyruvate 8O896 -1.20989 O. 105822 O.2396O3 yase (dihydrodipicolinate synthase) 210512 s at VEGFA vascular endothelial growth 7422 -1.15461 O.10674 O240343 actor A 202499 s at SLC2A3 solute carrier family 2 6515 -158.321 O. 106858 O240343 (facilitated glucose transporter), member 3 201125 s at ITGB5 integrin, beta 5 3693 -1.33107 0.107SSS O.24O3S 206414 S at ASAP2 Arf6AP with SH3 domain, 8853 -1.34473 0.107S72 0.24O3S ankyrin repeat and PH domain 2 201360 at CST3 cystatin C 1471 -1.68937 0.108964 O.242661 215047 at TRIMS8 tripartite motif containing 58 25893 -O.99092 O. 11023 O.243627 204493 at BID BH3 interacting domain death 637 -O.98.25 O. 110478 O.243627 agonist 202728 S. at LTBP1 latent transforming growth 4052 -1.27115 0.113678 O.246714 factor beta binding protein 1 209969 s at STAT1 signal transducer and activator 6772 -1.15673 (0.113691 O-246714 of transcription 1, 91 kDa 205241 at SCO2 SCO2 cytochrome c oxidase 99.97 -14845 0.114175 O246714 assembly protein 203017 s at SSX2IP synovial sarcoma, X breakpoint 1171.78 -O.94238 0.114827 O246714 2 interacting protein US 2015/0292028 A1 Oct. 15, 2015 32

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 203833 s at TGOLN2 trans-golgi network protein 2 10618 -0.93445 0.11SOS9 O.246714 205269 at LCP2 lymphocyte cytosolic protein 2 3937 -O.97O27 O.115226 O246714 (SH2 domain containing leukocyte protein of 76 kDa) 209522 S at CRAT carnitine O-acetyltransferase 1384 -1.O1234 0.116038 O246714 204629 at PARVB parvin, beta 2978O -133625 0.116976 O.246714 200609 S at WDR1 WD repeat domain 1 9948 -0.99605 0.11718 O246714 203680 at PRKAR2B protein kinase, cAMP- 5577 -123212 0.117344 O246714 dependent, regulatory, type II, beta 208918 S at NADK NAD kinase 65220 -1.16887 O. 119342 O.248.598 213716 s a SECTM1 Secreted and transmembrane 1 6398 -1.08.088 O. 119767 0.248718 221269 s at SH3BGRL3 SH3 domain binding glutamic 83442 -135229 O.12O323 O.24911 acid-rich protein like 3 212492 s at KDM4B lysine (K)-specific demethylase 23O3O -O.91067 0.121784 O.251366 4B 209729 at GAS2L1 growth arrest-specific 2 like 1 10634 -1.27348 O.12433 O2SSO74 204928 S. at SLC10A3 solute carrier family 10 8273 -1.17192 O.124419 0.255074 (sodiumbile acid cotransporter family), member 3 205390 s. at ANK1 ankyrin 1, erythrocytic 286 -O.882S3 O.124711 O2SSO74 211795 s at FYB FYN binding protein 2533 -1.18122 O.125242 O2SS154 31845 at ELF4 E74-like factor 4 (ets domain 2OOO -0.94729 O.125919 O2SS154 transcription factor) 212573 at ENDOD1 endonuclease domain 23052 -140577 0.12639S O2SS154 containing 1 209560 s at DLK1 delta-like 1 homolog 8788 -1.19672 0.1265.33 O2SS154 (Drosophila) 201095 at DAP death-associated protein 1611 -1.11419 0.126929 O.255154 212840 at UBXN7 UBX domain protein 7 26043 -1.O1058 0.127011 O2SS154 221267 s at FAM108A1 family with sequence similarity 81926 -1.O1634 0.1281 63 0.2567OS 108, member A1 208074 S at AP2S1 adaptor-related protein 1175 -O.99964 O.128569 O.256758 complex 2, Sigma 1 subunit 200990 at TRIM28 tripartite motif containing 28 1O155 -1.OOSS8 O. 129664 O.257321 209839 at DNM3 dynamin 3 26052 -1.34338 0.130264. O.257321 201714 at TUBG1 tubulin, gamma 1 7283 -O.88297 0.13O361 O.257321 20075.2 s at CAPN1 calpain 1, (mu? I) large subunit 823 -O.92096 O.131139 O.258O85 220751 s at FAXDC2 fatty acid hydroxylase domain 10826 -1.324O3 0.1321.72 O.258731 containing 2 210357 s at SMOX spermine oxidase S4498 -1.O3467 0.132612 O.258731 218175 at CCDC92 coiled-coil domain containing 92 80212 -1.09884 O. 132796 O2S8731 204000 at GNBS guanine nucleotide binding 10681 -1.19778 O.1331.64 O2S8731 protein (G protein), beta 5 217748 at ADIPOR1 adiponectin receptor 1 S1094 -O.93.144 O. 13362 O.258731 207389 at GP1BA glycoprotein Ib (platelet), alpha 2811 -1.24O2S 0.134OS1 O.258731 polypeptide 217992 S at EFHD2 EF-hand domain family, 7918O -1.0245 0.134143 0.258731 member D2 200884 at CKB creatine kinase, brain 1152 -088314 O. 13483 0.25.9317 206145 at RHAG Rh-associated glycoprotein 600S -1.17935 0.13531 O.259.504 220757 s at UBXN6 UBX domain protein 6 807OO -O.88.851 0.136128 0.259746 213274 S at CTSB cathepsin B 1508 -O.90S6S 0.136204 0.259746 202464 s at PFKFB3 6-phosphofructo-2- 5209 -1.06242 O.137167 0.26039 kinase? fructose-2,6- biphosphatase 3 202665 s at WIPF1 WAS/WASL interacting 7456 -1.08477 0.13731 O.26039 protein family, member 1 20648.8 s at CD36 CD36 molecule 948 -153958 0.138985 0.260645 (thrombospondin receptor) 212089 at LMNA amin AC 4OOO -O.92285 0.14O733 0.261597 205436 S. at H2AFX H2A histone family, member X 3.014 -1.00358 0.140821 O.261597 206834 at HBD hemoglobin, delta 3O45 -142844 0.141235 0.261597 209919 X at GGT1 gamma-glutamyltransferase 1 2678 -O.89741. O.141427 O.261597 2O7741 x at TPSAB1 tryptase alphabeta 1 7177 -1064O6 (0.142116 O.261597 31874 at GAS2L1 growth arrest-specific 2 like 1 10634 -1.54272 0.142456 0.261597 201700 at CCND3 cyclin D3 896 -O.99741. O.142709 O.261597 205683 X at TPSAB1 tryptase alphabeta 1 7177 -1.O1525 0.142713 O.261597 201061 s at STOM stomatin 2040 -1.O1078 O. 14297 0.261597 203016 S. at SSX2IP synovial sarcoma, X breakpoint 1171.78 -0.95396 O.143425 O.261722 2 interacting protein US 2015/0292028 A1 Oct. 15, 2015 33

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 220496 at CLEC1B C-type lectin domain family 1, S1266 -154811 0.144O6 O262175 member B 209929 S. at IKBKG inhibitor of kappa light 8517 -O.894O2 (0.145589 O.262942 polypeptide gene enhancer in B-cells, kinase gamma 37028 at PPP1R15A protein phosphatase 1, 23645 -1.05228 0.14582 0.262942 regulatory Subunit 15A 212769 at TLE3 transducin-like enhancer of 7090 -O.90676 O.14604 O.262942 split 3 (E(Sp1) homolog, Drosophila) 203581 at RAB4A RAB4A, member RAS 5867 -1.01651 0.146743 O.262942 oncogene family 213956 at CEP350 centrosomal protein 350 kDa 98.57 -0.85883 0.146813 O.262942 215382 x at TPSB2 tryptase beta 2 64499 -O.977 O.148064 O.263S47 (gene pseudogene) 201830 s at NET1 neuroepithelial cell 10276 -O.9677 O.1483O1 O.263S47 transforming 1 201693 s at EGR1 early growth response 1 1958 -1.15545 0.148318 O.263S47 215498. S. at MAP2K3 mitogen-activated protein S606 -1.08.177 0.149281 O.264O12 kinase kinase 3 204026 S. at ZWINT ZW10 interactor, kinetochore 11130 -1.12549 0.1494.13 O.264O12 protein 209170 S. at GPM6B glycoprotein M6B 2824 O.976338 0.14975 0.264O12 221211 S. at MAP3K7CL MAP3K7 C-terminal like S6911 -1.3O326 0.150281 O.264261 203045 at NINJ1 ninjurin 1 4814 -113628 0.15069 O.264293 210084 X at TPSAB1 tryptase alphabeta 1 7177 -O.997O6 0.151879 0.264649 207945 s at CSNK1D casein kinase 1, delta 1453 -0.90784 O. 152234 0.264649 204158 s at TCIRG1 T-cell, immune regulator 1, 10312 -1.17593 0.152276 O.264649 ATPase, H+ transporting, ysosomalVO subunit A3 200766 at CTSD cathepsin D 1509 -O.93104 O. 153066 0.26SO27 215819 is at RHCE Rh blood group, CcEe antigens 6006 -O.9917 O.154157 0.266.177 2034.85 at RTN1 reticulon 1 6252 -1.21235 0.1545.17 O.266.177 215240 at ITGB3 integrin, beta 3 (platelet 3690 -144118 0.156 O.267603 glycoprotein IIIa, antigen CD61) 201761 at MTHFD2 methylenetetrahydrofolate 10797 -O.98494 (0.156692 O.267603 dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 201904 S at CTDSPL CTD (carboxy-terminal 10217 -O.91323 O.156796 O.267603 domain, RNA polymerase II, polypeptideA) Small phosphatase-like 201906 S. at CTDSPL CTD (carboxy-terminal 10217 -O.94383 0.156925 0.267603 domain, RNA polymerase II, polypeptideA) Small phosphatase-like 203854 at CFI complement factor I 3426 O.8698.63 0.158526 O.268092 204925 at CTNS cystinosin, lysosomal cystine 1497 -O.97S32 0.158632 0.268092 transporter 204306 S. at CD151 CD151 molecule (Raph blood 977 -O.94181 (0.158669 O.268092 group) 206380 S. at CFP complement factor properdin 51.99 -1.1026 O.158939 O.268092 204961 S. at NCF1 neutrophil cytosolic factor 1 653361 -143048 0.15938S O.268092 2O1810 s. at SH3BP5 SH3-domain binding protein 5 94.67 -102141 0.159588. O.268092 (BTK-associated) 204.192 at CD37 CD37 molecule 951 -1.O1901 0.162409 O.270814 20208.2 s at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -O.89139 O.163106 0.271309 218009 s at PRC1 protein regulator of cytokinesis 1 9055 -1.11022 O.16572 O.274.981 218522 s at MAP1S microtubule-associated protein 1S 552O1 -0.95913 O.166988 O.27S781 214369 S at RASGRP2 RAS guanyl releasing protein 2 10235 -O.91512 0.167017 O.27S781 (calcium and DAG-regulated) 218243 at RUFY1 RUN and FYVE domain 8O230 -1.007 OS 0.168966 0.27823S containing 1 214965 at SPATA2L spermatogenesis associated 2- 124044 -O.97367 0.169324 O.27823S like 212027 at RBM2S RNA binding motif protein 25 58517 -1.0829 O.17147 0.279943 218148 at CENPT centromere protein T 8O152 -O.88627 0.171898 0.279943 203234 at UPP1 uridine phosphorylase 1 7378 -1.02931. O.172377 O.279943 200661 at CTSA cathepsin A 5476 -140173 0.172629 O.279943 US 2015/0292028 A1 Oct. 15, 2015 34

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 210793 s at NUP98 nucleoporin 98 kDa 4928 -1.O1125 0.173817 O.279943 215,464 S at TAX1BP3 Tax1 (human T-cell leukemia 3O851 -1.07322 O.174266 O.279943 virus type I) binding protein 3 204482 at CLDNS claudin 5 7122 -1.19654 (0.174447 O.279943 204.198. S. at RUNX3 runt-related transcription factor 3 864 -0.98615 0.174457 0.279943 212195 at IL6ST interleukin 6 signal transducer 3572 -O.93935 0.174626 O.279943 (gp130, oncostatin M receptor) 209304 x at GADD45B growth arrest and DNA- 4616 -O.99482 0.1749 13 O.279943 damage-inducible, beta 204079 at TPST2 tyrosylprotein sulfotransferase 2 8459 -1.11621 O.177613 O.283594 206167 s at ARHGAP6 Rho GTPase activating protein 6 395 -1.27S31 O.1782O8 O.283875 220336 s at GP6 glycoprotein VI (platelet) S12O6 -1.06098 0.183391 O-290763 214464 at CDC42BPA CDC42 binding protein kinase 8476 -O.967O1 O.186028 O.292695 alpha (DMPK-like) 213887 s at POLR2E polymerase (RNA) II (DNA S434 -0.91232 0.186513 O.292695 directed) polypeptide E, 25 kDa 216261 at ITGB3 integrin, beta 3 (platelet 3690 -1.19784 O.187072 0.292695 glycoprotein IIIa, antigen CD61) 213836 s at WIPI1 WD repeat domain, 55062 -1.OO273 0.187347 O.292695 phosphoinositide interacting 1 218032 at SNN Stannin 83O3 -1.21538 0.189158 0.293378 200931 S. at WCL Vinculin 74.14 -O.92232 O.190234 0.294037 22O110 S. at NXF3 nuclear RNA export factor 3 S6000 -0.84883 0.1941 12 O.298.064 219998 at LGALSL ectin, galactoside-binding-like 29094 -O.88669 O.19416 O.298.064 200648 s at GLUL glutamate-ammonia ligase 2752 -O.885 O.196266 O.300615 207075 at NLRP3 NLR family, pyrin domain 114548 -1.04141 0.196978 O.3OO727 containing 3 202814 S at HEXIM1 hexamethylene bis-acetamide 10614 -O.86963 O.197227 O.3OO727 inducible 1 211582 x at LST1 eukocyte specific transcript 1 794O -O.89977 O.1984O7 O.301846 57588 at SLC24A3 solute carrier family 24 57419 -0.8268 O.1992S2 O.301985 (sodium/potassium calcium exchanger), member 3 209881 s at LAT inker for activation of T cells 27040 -O.84958. O.1993.91 O.301985 213537 at HLA-DPA1 major histocompatibility 31.13 -1.OO128 0.2OO3SS O.302768 complex, class II, DP alpha 1 214084 X at NCF1C neutrophil cytosolic factor 1C 654817 -1.32671 O.2O1691 O.303721 pseudogene 2025.55 S at MYLK myosin light chain kinase 4638 -135821 O.2O1883 0.303721 222024 S at AKAP13 A kinase (PRKA) anchor 11214 -O.9453 0.2O348 O305445 protein 13 207522 s at ATP2A3 ATPase, Ca++ transporting, 489 -O.86.192 O.204597 O.3OS832 ubiquitous 202228 S. at NPTN neuroplastin 27020 -O.94477 0.204641 O305832 204396 s at GRKS G protein-coupled receptor 2869 -1.18973 0.2OSS15 O.306089 kinase 5 214073 at CTTN cortactin 2017 -14238S 0.205717 O.306089 217764 S at RAB31 RAB31, member RAS 11031 -1.28868 0.2O6889 O.3062S3 oncogene family 208792 S at CLU clusterin 1.191 -1.32868 0.207424 O.3062S3 218945 at METTL22 methyltransferase like 22 79091 -O.81822 O.207478 O.3062S3 209166 s at MAN2B1 mannosidase, alpha, class 2B, 412S -0.8723S 0.207908 O.3062S3 member 1 221856 S at FAM63A amily with sequence similarity 55793 -0.90737 0.208.242 O.3062S3 63, member A 200622 X at CALM3 calmodulin 3 (phosphorylase 808 -1.OS371 O.208.541 O.3062S3 kinase, delta) 216834 at RGS1 regulator of G-protein signaling 1 S996 -1.58O39 O.2096O3 O.3071.46 201234 at ILK integrin-linked kinase 3611 -O.893 O.210231 O.3074O1 212016 S. at PTBP1 polypyrimidine tract binding 5725 -O.82271 (0.214043 O.311628 protein 1 203196 at ABCC4 ATP-binding cassette, sub- 10257 -0.94809 O.215339 O.312842 amily C (CFTR/MRP), member 4 204838 s at MLH3 mutL homolog3 (E. coli) 27030 -117819 O.217494 O.314178 210314 X at TNFSF13 tumor necrosis factor (ligand) 8741 -0.85424 O.217651 O.314178 Superfamily, member 13 221027 s at PLA2G12A phospholipase A2, group XIIA 81579 -1.OO47 (0.2198.33 O.31622 207206 s at ALOX12 arachidonate 12-lipoxygenase 239 -12041 1 0.221481 O.316376 336 at TBXA2R hromboxane A2 receptor 6915 -0.9854 O.221852 0.316376 208924 at RNF11 ring finger protein 11 26994 -0.85227 O.222362 0.316376 US 2015/0292028 A1 Oct. 15, 2015 35

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 204440 at CD83 CD83 molecule 93O8 -0.864O6 0.222738 0.316376 216033 s at FYN FYN oncogene related to SRC, 2S34 -086181 (0.222912 O.316376 FGR, YES 207414 s at PCSK6 proprotein convertase SO46 -1246.51 0.224243 O.317072 Subtilisin?kexin type 6 202014 at PPP1R15A protein phosphatase 1, 23645 -O.9299 O.224339 O.317072 regulatory Subunit 15A 204256 at ELOVL6 ELOVL fatty acid elongase 6 79071 -O.916 O.225463 0.317997 216474 X at TPSB2 tryptase beta 2 64499 -O.84525 O.227141 0.319076 (gene pseudogene) 200696 s at GSN gelsolin 2934 -O. 94992 O.2274.66 0.319076 206632 s at APOBEC3B apolipoprotein B mRNA 9582 -10460S 0.228843 O.32O097 editing enzyme, catalytic polypeptide-like 3B 221496 s at TOB2 transducer of ERBB2, 2 10766 -O.782O4 O.231572 O.323245 219630 a. PDZK1P1 PDZK1 interacting protein 1 10158 -1.15529 O.234788 O.326336 214696 a MIR22HG MIR22 host gene (non-protein 84981 -O.82752 0.23S232 0.326336 coding) 213275 X at CTSB cathepsin B 1508 -O.98223 O.235914 O.326.614 215343 a CCDC88C coiled-coil domain containing 44O193 -O.83997 O.23881 O.328606 88C 205347 s at TMSB15A hymosin beta 15a 11013 -0.82645 0.241.173 0.329982 213093 a PRKCA protein kinase C, alpha 5578 -O.92248 0.241407 O.329982 218217 a SCPEP1 serine carboxypeptidase 1 59342 -O.82O69 O.2415 O.329982 201490 s. at PPIF peptidylprolyl isomerase F 101 OS -0.81917 O.242498 0.329982 204187 a GMPR guanosine monophosphate 2766 -0.83239 O.248436 O.336.382 reductase 217762 s at RAB31 RAB31, member RAS 11031 -1.O2S17 O.2S2O78 O.3399S4 oncogene family 204790 a SMAD7 SMAD family member 7 4092 -O.76543 O.2S3693 0.341452 2098.13 x at TARP TCRgamma alternate reading 445347 -O.8SSS4 O.2S6336 0.344324 rame protein 212636 a QKI QKI, KH domain containing, 9444 -0.79642 O.257784 O.344583 RNA binding 211429 s at SERPINA1 Serpin peptidase inhibitor, clade 5265 -1.37823 O.258343 O.344583 A (alpha-1 antiproteinase, antitrypsin), member 1 205253 at PBX1 pre-B-cell leukemia homeobox 1 5087 -O.76SSS O.258.565 0.344583 201735 s at CLCN3 chloride channel, voltage- 1182 -O.94O43 O.26OSO3 O.346484 sensitive 3 205950 S at CA1 carbonic anhydrase I 759 -O.96S83 0.262137 0.347974 201334 S. at ARHGEF12 Rho guanine nucleotide 2336S -0.77329 O.264462 0.3SO312 exchange factor (GEF) 12 210987 X at TPM1 tropomyosin 1 (alpha) 71.68 -O.82871 O.265224 0.3SO312 209806 at HIST1H2BK histone cluster 1, H2bk 85236 -O.86OSS O.266486 0.3SO312 215492 X at PTCRA pre T-cell antigen receptor 171558 -O.904 O.271153 0.35S069 alpha 205099 s at CCR1 chemokine (C-C motif) 1230 -O.80241 O.275833 0.3591.13 receptor 1 202007 at NID1 nidogen 1 4811 -O.78832 O.278249 0.361 S63 210845 S. at PLAUR plasminogen activator, 5329 -0.82653 0.280926 O.364343 urokinase receptor 218662 s at NCAPG non-SMC condensin I 641.51 -0.7380S 0.281927 0.364.942 complex, SubunitG 20945.9 s at ABAT 4-aminobutyrate 18 -O.83695 0.28286 0.3654S1 aminotransferase 2081.61 s at ABCC3 ATP-binding cassette, sub- 871.4 -0.87352 0.2834S1 O.365517 family C (CFTR/MRP), member 3 210429 at RHD Rh blood group, Dantigen 6007 -102292 O.285289 0.36S856 208791 at CLU clusterin 1.191 -1.10749 0.285331 O.36S856 36566 at CTNS cystinosin, lysosomal cystine 1497 -O.72179 0.285335 0.36S856 transporter 218711 S. at SDPR serum deprivation response 8436 -O.86687 0.28S908 O.36S897 201732 S at CLCN3 chloride channel, voltage- 1182 -0.82971 O.287865 0.36736S sensitive 3 212570 at ENDOD1 endonuclease domain 23052 -0.73257 0.289756 0.368,708 containing 1 203411 s at LMNA lamin AC 4OOO -0.7781 O.290282 0.368,708 211252 x at PTCRA pre T-cell antigen receptor 171558 -0.8545 O.291611 O.369.032 alpha US 2015/0292028 A1 Oct. 15, 2015 36

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 204908 S. at BCL3 B-cell CLL/lymphoma 3 6O2 -0.87358 0.2929O2 O.369953 218935 at EHD3 EH-domain containing 3 3O845 -0.933 63 0.293563 0.37OO97 219983 at HRASLS HRAS-like suppressor 571 10 -O.72599 0.2984O2 O.374935 220091 at SLC2A6 solute carrier family 2 11182 -O.7439 O.298,508 O.374935 (facilitated glucose transporter), member 6 212657 s at IL1RN interleukin 1 receptor 3557 -O.78633 0.3OO604 O.376172 antagonist 210240 S at CDKN2D cyclin-dependent kinase 1032 -0.73O4 (0.3O4949 O.380904 inhibitor 2D (p19, inhibits CDK4) 213338 at TMEM158 transmembrane protein 158 25907 -O.83724 O.3O8131 O.382S61 (gene pseudogene) 21855.9 s at MAFB V-maf musculoaponeurotic 9935 -1.OS359 O.308532 0.382S61 fibrosarcoma oncogene homolog B (avian) 221050 s at GTPBP2 GTP binding protein 2 S4676 -0.69663 O.3O8832 O.382S61 201131 S. at CDH1 cadherin 1, type 1, E-cadherin 999 -0.70327 O.3091 O.382S61 (epithelial) 216253 s at PARVB parvin, beta 2978O -0.854.94 O.309748 0.382663 202988 S. at RGS1 regulator of G-protein signaling 1 S996 -1.O1339 O.3126O1 O.385484 205786 s at ITGAM integrin, alpha M (complement 3684 -O.83414 O.314385 0.386979 component 3 receptor 3 Subunit) 210757 X at DAB2 Dab, mitogen-responsive 16O1 -O.74S14 0.315103 0.3871.59 phosphoprotein, homolog 2 (Drosophila) 212723 at JMJD6 jumonji domain containing 6 23210 -O.75129 O.319118 O.391.333 211743 s at PRG2 proteoglycan 2, bone marrow 5553 -0.78462 0.319656 0.391.333 (natural killer cell activator, eosinophil granule major basic protein) 222108 at AMIGO2 adhesion molecule with Ig-like 347902 -0.67947 0.320818 O.392O46 domain 2 204240 s at SMC2 structural maintenance of 10592 -O.7OOS7 O.322141 0.3929S4 chromosomes 2 217763 s at RAB31 RAB31, member RAS 11031 -O.86OO3 0.327317 O.39771S oncogene family 204467 s at SNCA Synuclein, alpha (non A4 6622 -O.70464 O.327807 O.39771S component of amyloid precursor) 216063 at HBBP1 hemoglobin, beta pseudogene 1 3044 -0.94717 O.329519 O.399.078 202581 at HSPA1A heat shock 70 kDa protein 1 A 3303 -0.98594 O.331291 O-40042 210169 at SEC14LS SEC14-like 5 (S. cerevisiae) 97.17 -0.74193 (0.33181 O40042 57082 at LDLRAP1 ow density lipoprotein 26119 -0.8255 0.333963 O.4O2301 receptor adaptor protein 1 217022 s at IGH immunoglobulin heavy locus 3492 -0.84526 0.336O16 O404055 210734 X at MAX MYC associated factor X 4149 -O.69037 0.337S78 O.405064 204099 at SMARCD3 SWI/SNF related, matrix 6604 -0.6686S O.338052 0.405064 associated, actin dependent regulator of chromatin, Subfamily d, member 3 218585 S at DTL denticleless E3 ubiquitin S1514 -O.76574 0.338678 O.4OSO98 protein ligase homolog (Drosophila) 220968 S. at TSPAN9 tetraspanin 9 10867 -0.64.905 (0.342149 0.408528 204993 at GNAZ guanine nucleotide binding 2781 -0.77214 O.343386 O.409.282 protein (G protein), alpha Z polypeptide 210992 X at FCGR2C Fc fragment of IgG, low 9103 -O.7O674 0.344O48 O4O9351 affinity IIc, receptor for (CD32) (gene pseudogene) 219412 at RAB38 RAB38, member RAS 23682 -O.70456 0.345526 O.41OOS1 oncogene family 219892 at TM6SF1 transmembrane 6 Superfamily 53346 -0.67737 0.345848 0.41OOS1 member 1 205098 at CCR1 chemokine (C-C motif) 1230 -0.67251 (0.3484O7 O.41 1654 receptor 1 206883 X at GP9 glycoprotein IX (platelet) 2815 -0.93388 O.348416 0.41 1654 204546 at KIAAOS13 KIAAO513 9764 -0.6776 O.3S4O75 0.416884 211984 at CALM1 calmodulin 1 (phosphorylase 8O1 -0.67903 0.356O16 O418443 kinase, delta) US 2015/0292028 A1 Oct. 15, 2015 37

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 212681 at EPB41L3 erythrocyte membrane protein 23136 -0.74882 0.363256 O426212 band 4.1-like 3 209586 s at PRUNE prune homolog (Drosophila) S8497 -0.71365 0.365133 0.427673 204122 at TYROBP TYRO protein tyrosine kinase 7305 -0.981 64 0.3684O9 O42992.1 binding protein 221 698 S. at CLEC7A C-type lectin domain family 7, 64,581 -O.72388 O.368957 0.429921 member A 202269 x at GBP1 guanylate binding protein 1, 2633 -O.72489 (0.374443 O.434817 interferon-inducible 37965 at PARVB parvin, beta 2978O -0.732O3 0.378,544 O.438076 206937 at SPTA1 spectrin, alpha, erythrocytic 1 6708 -0.6391 1 0.379343 O.4382S2 (elliptocytosis 2) 205863 at S100A12 S100 calcium binding protein 6283 -0.76877 O.385662 0.443766 A12 206465 at ACSBG1 acyl-CoA synthetase 23205 -0.69391 (0.386O83 0.443766 bubblegum family member 1 208.601 S. at TUBB1 tubulin, beta 1 class VI 81027 -0.7751 O.38836 0.445627 208501 at GFI1B growth factor independent 1B 8328 -0.69445 0.391,518 O448O2 transcription represser 204319 s at RGS10 regulator of G-protein signaling 10 6001 -0.66481 (0.391769 O.448O2 204115 at GNG11 guanine nucleotide binding 2791 -O.8S973 0.39661 1 0.450473 protein (G protein), gamma 11 222204 S at RRN3 RRN3 RNA polymerase I 54700 -0.6O18 O.396615 O4SO473 transcription factor homolog (S. cerevisiae) 20444.6 s at ALOX5 arachidonate 5-lipoxygenase 240 -O.88998 0.397241. O4SO473 203508 at TNFRSF1B tumor necrosis factor receptor 7133 -0.6867 O.398463 0.451 103 Superfamily, member 1B 203305 at F13A1 coagulation factor XIII, A1 2162 -0.84164 0.4O1077 O.453304 polypeptide 20843.8 s at FGR Gardner-Rasheed feline 2268 -0.62594 O.406618 O.4588O1 sarcoma viral (v-fgr) oncogene homolog 205463 s at PDGFA platelet-derived growth factor S154 -0.67628 0.408281 O.459911 alpha polypeptide 202917 s at S100A8 S100 calcium binding protein A8 6279 -12O152 (0.41 1847 O.463156 207156 a HIST1H2AG histone cluster 1, H2ag. 8969 -0.70408 O.413233 O-463944 202833 s at SERPINA1 Serpin peptidase inhibitor, clade 5265 -O.917O6 (0.413994 O.46403 A (alpha-1 antiproteinase, antitrypsin), member 1 207315 a. CD226 CD226 molecule 10666 -0.62666 0418074 O466595 204971 a CSTA cystatin A (Stefin A) 1475 -O.89766 0.4182O7 O.466595 201954 a ARPC1B actin related protein 2/3 1009S -0.64277 0.41835 0.466595 complex, Subunit 1B, 41 kDa 206254 a EGF epidermal growth factor 1950 -0.61118 O.425271 O.4727.56 204475 a MMP1 matrix metallopeptidase 1 4312 -O.79765 0.427481 0.474434 (interstitial collagenase) 205229 S. at COCH coagulation factor Chomolog, 1690 -O.S3396 O.432368 0.479072 cochlin (Limitius polyphemis) 205127 a PTGS1 prostaglandin-endoperoxide 5742 -0.54531 O.44234 O488522 synthase 1 (prostaglandin GH synthase and cyclooxygenase) 203087 s at KIF2A kinesin heavy chain member 2A 3796 -0.59853 0.443634 0.488.96S 202953 a C1QB complement component 1, q 713 -O.823O2 (0.444186 O488965 Subcomponent, B chain 218656 S at LHFP lipoma HMGIC fusion partner 10186 -O.S6539 O.445989 O.489822 214511 X at FCGR1B Fc fragment of IgG, high 2210 -O.69072 0.446411 O.489822 affinity Ib, receptor (CD64) 208406 S. at GRAP2 GRB2-related adaptor protein 2 94O2 -0.68765 0.451229 O492736 56256 at SIDT2 SID1 transmembrane family, S1092 -O.742.29 O.4S1977 O492736 member 2 209204 at LMO4 LIM domain only 4 8543 -O.S21 OS 0.4541SS O-494,314 205612 at MMRN1 multimerin 1 22915 -O.S8072 0.457SS1 O496919 206116 s at TPM1 tropomyosin 1 (alpha) 71.68 -0.6.1863 (0.458O17 O496919 204858 s at TYMP thymidine phosphorylase 1890 -0.62323 O.45998.5 0.497869 204308 s at TECPR2 tectonin beta-propeller repeat 9895 -O.S66O7 O.460363 0.497869 containing 2 204466 s at SNCA Synuclein, alpha (non A4 6622 -0.60596 0.461512 0.498.316 component of amyloid precursor) 202270 at GBP1 guanylate binding protein 1, 2633 -O.SS471 0.469SOS OSOS333 interferon-inducible US 2015/0292028 A1 Oct. 15, 2015 38

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 218223 s at PLEKHO1 pleckstrin homology domain 51177 -0.63829 O.4742S3 O.SO9634 containing, family O member 1 206881 s at LILRA3 leukocyte immunoglobulin-like 11026 -0.61236 0.483816 O.S18375 receptor, subfamily A (without TM domain), member 3 22221.8 s at PILRA paired immunoglobin-like type 29992 -0.60956 O.483919 O.S18375 2 receptor alpha 213566 at RNASE6 ribonuclease, RNase A family, 6039 -O.S3861 O.485481 O.S19227 k6 221160 S at CABPS calcium binding protein 5 S6344 -O.S2004 O.487926 O.S21019 206964 at NAT8B N-acetyltransferase 8B (GCN5- S1471 -O.S2SS3 0.491589 O.S23279 related, putative, gene pseudogene) 206420 at IGSF6 immunoglobulin Superfamily, 10261 -0.58815 0.495872 O.S2701 member 6 219386 s at SLAMF8 SLAM family member 8 S6833 -0.64O79 O.SOOS74 0.531173 209949 at NCF2 neutrophil cytosolic factor 2 4688 -0.64425 O.SO1391 O.S312O7 206110 at HIST1H3H histone cluster 1, H3h 8357 -0.78197 O.SO2267 O.S31304 210660 at LILRA1 leukocyte immunoglobulin-like 11024 -O.S1819 O.S18847 O.S47986 receptor, subfamily A (with TM domain), member 1 203560 at GGEH gamma-glutamyl hydrolase 8836 -O.S3164 O.S2007S O.S48428 (conjugase, olylpolygammaglutamyl hydrolase) 214677 x at CYAT1 immunoglobulin lambda light 10O290481 -0.49954 O.S.37027 O.S64546 chain-like 211985 S at CALM1 calmodulin 1 (phosphorylase 8O1 -0.5249 O.S39781. O.S66561 kinase, delta) 200660 at S100A11 S100 calcium binding protein 6282 -O.S7564 O.S426SS O.S.68696 A11 201279 s at DAB2 Dab, mitogen-responsive 16O1 -O.47879 0.546344 O.S71676 phosphoprotein, homolog 2 (Drosophila) 203585 at ZNF185 Zinc finger protein 185 (LIM 7739 -O.S4OS O.S48693 O.S73249 domain) 203140 at BCL6 B-cell CLL/lymphoma 6 604 -0.486.32 0.5566 0.580552 202295 S at CTSH cathepsin H 1512 -O.S4O2S O.SS7399 O.S80SS2 21014.6 X at LILRB2 eukocyte immunoglobulin-like 10288 -0.42185 O.S72195 O.S93923 receptor, subfamily B (with TM and ITIM domains), member 2 212188 at KCTD12 potassium channel 1152O7 -0.40898 O.S72868 O.S93923 etramerisation domain containing 12 203973 s at CEBPD CCAAT?enhancer binding 1052 -O.SO468 O.S74596 O.S94804 protein (C/EBP), delta 204588 s at SLC7A7 Solute carrier family 7 (amino 90S6 -O.S24O1 O.S7568 O.S95O16 acid transporter light chain, y + L system), member 7 218232 a C1QA complement component 1, q 712 -0.45679 O.S784.84 O.S970O2 Subcomponent, A chain 21915.9 s at SLAMF7 SLAM family member 7 57823 -0.41122 O.S81677 O.S99384 209448 a HTATIP2 HIV-1 Tat interactive protein 2, 10553 -0.4519 O.S84526 O.6O1404 30 kDa 2084.50 a LGALS2 lectin, galactoside-binding, 3957 -0.6.1288 (0.591141 06O7288 soluble, 2 207857 a LILRA2 leukocyte immunoglobulin-like 11027 -0.38829 O.612701 O.626.584 receptor, subfamily A (with TM domain), member 2 220088 a CSAR1 complement component 5a 728 -0.41369 O.614585 0.627563 receptor 1 204912 a IL1ORA interleukin 10 receptor, alpha 3587 -0.36301 0.677S82 0.688.773 201005 a CD9 CD9 molecule 928 -0.46299 O.696997 O.707.447 205119 S at FPR1 formyl peptide receptor 1 2357 -0.34.184 O.703,731 O.713213 213831 a HLA-DQA1 major histocompatibility 3117 -0.41115 0.757.666 0.766,726 complex, class II, DQ alpha 1 205898 a CX3CR1 chemokine (C-X3-C motif) 1524 -0.2373 0.7894.41 O.797689 receptor 1 201422 a. IFI30 interferon, gamma- 10437 -O.261.45 0.793548 O.800643 inducible protein 30 US 2015/0292028 A1 Oct. 15, 2015 39

TABLE 5-continued Gene Expression in Men Patients Probe Symbol (Na32 Gene Title (Na32 Entrez Gene ID Adjusted Set ID consensus Marl3) consensus Marl3) (consensus Mar-13) Log2 (FC) P-Value p-Value 208,579 x at H2BFS H2B histone family, S4145 -0.2O818 (0.82651 O.83266 member S (pseudogene) 212192 at KCTD12 potassium channel 1152O7 -O.1977S O.8280S6 O.832977 tetramerisation domain containing 12 219505 at CECR1 cat eye syndrome S1816 -018O17 O.84.442 O.84.8178 chromosome region, candidate 1 215071 S. at HIST1H2AC histone cluster 1, 8334 -0.16128 0.864886 O.867448

TABLE 6 TABLE 6-continued Clinical Features of the Polycythemia Vera Patients Clinical Features of the Polycythemia Vera Patients Segregated by Unsupervised Hierarchical Clustering Segregated by Unsupervised Hierarchical Clustering Clinical Phenotype Aggressive Indolent p Clinical Phenotype Aggressive Indolent p Gender (MF) 4.3 4.8 Platelet count 454,000 837,000 S Age (median, years) 66 67.5 S (median, 10 L) (range) (48-74) (46-82) (range) (171,000-1,017,000) (151,000-1,480,000) Disease duration 16 6 0.040: Thrombosis (n) 4f7 112 0.037* * Palpable 7/7 612 0.034** (median, years) splenomegaly (n) (range) (7-28) (1-25) Spleen size (median, 2O 2 0.005** JAK2 v617F 100 85 S cm below costal Neutrophil margin) Allele Burden (range) (5-32) (0-14) (median, %) Splenectomy (n) 4f7 Of 12 0.007** (range) (64-100) (55-100) Chemotherapy (n) 5/7 2f12 O.O29** Hemoglobin 11.1 13.3 0.007: Transformation to 4f7 112 0.037* * (median, gmyo) acute leukemia (n) (range) (8.3-12.9) (10.7-15.9) Surviving (n) 1/7 11:12 0.001.** Leukocyte count 17,620 17,870 S (median, 10/L) Student t test (range) (10,020-171,190) (4.430-27,270) **Fisher exact probability test

TABLE 7 Annotation of the 102 Concordantly Deregulated Genes Symbol (Na32 GeneD Probe COSCSUS Gene Title (Na32 (consensus 1 Adjusted Set ID Mar13) consensus Marl3) Mar-13) Log2(FC) P-Value p-Value 2026.27 s at SERPINE1 serpin peptidase inhibitor, 5054 6684.78 O.OOSO41 0.454117 clade E (nexin, plasminogen activator inhibitor type 1), member 1 201324 at EMP1 epithelial membrane protein 1 2012 16186 O.OO771 O.454117 212667 at SPARC secreted protein, acidic, 6678 45.459 O.O14744 0.454117 cysteine-rich (osteonectin) 201438 at COL6A3 collagen, type VI, alpha 3 1293 278.559 O.O2S847 O.454117 211161 s at COL3A1 collagen, type III, alpha 1 1281 254327 O.O29648 0.454117 215076 s at COL3A1 collagen, type III, alpha 1 1281 488O17 O.O29998 0.454117 210809 S at POSTN periostin, osteoblast specific 10631 804584 O.O3S776 O.454117 factor 212464 S at FN fibronectin 1 2335 813392 O.O36784 O.454117 202404 S at COL1A2 collagen, type III, alpha 1 1281 791759 O.O37999 0.454117 2024.03 s at COL1A2 collagen, type III, alpha 1 1281 4.42683 0.042962 0.454117 211719 X at FN fibronectin 1 2335 960598 0.043407 O.454117 216442 x at FN fibronectin 1 2335 658895 O.O4716S O.454117 210495 X at FN fibronectin 1 2335 6921.78 O.O47228 O.454117 211964 at COL4A2 collagen, type IV, alpha 2 1284 O7827S O.OS3744 0.46673 202310 s. at COL1A1 collagen, type I, alpha 1 1277 496322 O.OS6008 O.46673 21738.8 s at KYNU kynureninase 8942 -1.22118 O.O726SS O-470938 217232 X at HBB hemoglobin, beta 3O43 -1.35066 0.073386 O.470938 US 2015/0292028 A1 Oct. 15, 2015 40

TABLE 7-continued Annotation of the 102 Concordantly Deregulated Genes Symbol (Na32 GeneD Probe COSCSUS Gene Title (Na32 (consensus1 Adjusted Set ID Marl3) consensus Marl3) Mar-13) Log2(FC) P-Value p-Value 205547 s at TAGLN transgelin 6876 1.27 S4O9 O.O758O3 O.470938 204848 x at HBC1 if hemoglobin, gamma A 3O47 -1.4219 O.O77286 0.470938 HBG2 211980 at COL4A1 collagen, type IV, alpha 1 1282 1.083935 0.081985 O.470938 20911.6 X at HBB hemoglobin, beta 3O43 - 147367 O.O876O2 O.470938 213515 X at HBC1 if hemoglobin, gamma A 3O47 - 1723O4 O.O89471 O.470938 HBG2 201842 s at EFEMP1 EGF containing fibulin-like 22O2 1.1531 14 O.O9001 O.470938 extracellular matrix protein 1 204897 at PTGER4 prostaglandin E receptor 4 5734 O.979697 O.O.94157 0.470938 (subtype EP4) 209183 s at C10orf10 chromosome 10 open 11067 O.631696 O.O94188 O.470938 reading frame 10 204419 X at HBC1 if hemoglobin, gamma A 3O47 - 14151 O.1OS888 OSO9076 HBG2 211696 X at HBB hemoglobin, beta 3O43 -1.18995 O112O1 O.S13618 204141 at TUBB2A tubulin, beta 2A class IIa 7280 1288228 O.115961 O.S13618 211699 X at HBA1 hemoglobin, alpha 1 3O39 -1.21697 0.122356 O.S13618 HBA2 209458 x at HBA1 hemoglobin, alpha 1 3O39 -1.38137 0.130596 O.S13618 HBA2 221760 at MAN1A1 mannosidase, alpha, class 4121 O.8560S 0.130744 O.S13618 A member 1 204018 X at HBA1 hemoglobin, alpha 1 3O39 -1.23966 0.131486 O.S13618 HBA2 213350 at RPS11 ribosomal protein S11 62OS 0.933771 O.136499 O.S15634 215772 X at SUCLG2 Succinate-CoA ligase, GDP- 88O1 -0.64738 0.145938 0.51 S634 orming, beta subunit 217414 X at HBA1 hemoglobin, alpha 1 3O39 -1.27841 O.14982S O.S15634 HBA2 205382 s at CFD complement factor D 1675 -0.8048 O.157142 O.S15634 (adipsin) 201890 at RRM2 ribonucleotide reductase M2 6241 -0.95289 0.1584.08 O.S15634 208960 s at KLF6 Kruppel-like factor 6 1316 O.S71081 0.15952 O.S15634 206157 at PTX3 pentraxin 3, long S806 0.82SO89 0.160878 O.S15634 205237 at FCN1 ficolin (collagen fibrinogen 2219 - 1.15146 0.1701.72 O.S16857 domain containing) 1 204834 at FGL2 fibrinogen-like 2 10875 -0.90858 0.17194 O.S16857 211745 X at HBA1 hemoglobin, alpha 1 3O39 -1.33S07 O.173664 O.S16857 HBA2 209803 s at PHLDA2 pleckstrin homology-like 7262 0.8791.69 O.180046 (O.S2O921 domain, family A, member 2 200629 at WARS tryptophanyl-tRNA 7453 -0.69785 0.183988 O.S2O921 synthetase 219602 s at PIEZO2 piezo-type 63895 -0.56733 0.187531 O.S2O921 mechanosensitive ion channel component 2 205848 at GAS2 growth arrest-specific 2 2620 -0.77375 0.1965.17 O.527987 210487 at DNTT deoxynucleotidyltransferase, 1791 O.622S62 O.198523 O.S27987 ermina 214414 x at HBA1 hemoglobin, alpha 1 3O39 -1.4O997 O.21SS16 O.S61241 HBA2 209374 s at GHM immunoglobulin heavy 3507 O. 614952 O.226098 O.S76781 constant nu 201110 S. at THBS1 hrombospondin 1 7057 0.617073 O2S1014 O.S8604 220377 at KIAAO125 KIAAO125 98.34 O.SS3273 0.25106 O.S8604 213524 S at GOS2 GOG1 Switch 2 SO486 -0.857O6 O.26S596 O.S86O4 204304 S at PROM1 prominin 1 8842 0.70588S O.270019 O.S8604 208961 s at KLF6 Kruppel-like factor 6 1316 O.SO248 0.272895 O.S8604 203787 at SSBP2 single-stranded DNA 23635 0.4838SS O.27435 O.S8604 binding protein 2 212952 at LOC100507328 hypothetical 1OOSO7328 O. 637258 0.276535 (O.S8604 LOC10OSO7328 209763 at CHRDL1 chordin-like 1 91851 0.393371 O.2787O6 O.S86O4 202600 s at NRIP1 nuclear receptor interacting 8204 O.S86587 0.2791.82 O.S8604 protein 209290 s. at NFIB nuclear factor IB 4781. -O.SS3O8 O.28O861 O.S8604 214041 x at RPL37A ribosomal protein L37a 6168 0.490226 O.283497 O.S8604 202237 at NNMT nicotinamide N- 4837 0.748.218 O.28S987 O.S8604 methyltransferase US 2015/0292028 A1 Oct. 15, 2015 41

TABLE 7-continued Annotation of the 102 Concordantly Deregulated Genes Symbol (Na32 GeneD Probe COSCSUS Gene Title (Na32 (consensus1 Adjusted Set ID Marl3) consensus Marl3) Mar-13) Log2(FC) P-Value p-Value 211074 at FOLR1 olate receptor 1 (adult) 2348 O.905935 0.306.067 0.617071 204872 at TLE4 transducin-like enhancer of 7091 O.422998 0.33133S O.65741 split 4 (E(Sp1) homolog, Drosophila) 217683 at HBE1 hemoglobin, epsilon 1 3O46 -0.47414 O.366576 O.687129 205933 at SETBP1 SET binding protein 1 2604O O.325978 O.36816 0.687129 204430 s at SLC2A5 solute carrier family 2 6518 O.43O164 O.378886 0.687129 (facilitated glucosef fructose transporter), member 5 2098.94 at LEPR eptin receptor 3953 -0.51789 0.379001 0.687129 221556 at CDC14B cell division cycle 14B 8SSS O-488325 O.37913S 0.687129 202870 S. at CDC20 cell division cycle 20 991 -O.SOSO4 O.379295 0.687129 204755 X at HLF hepatic leukemia factor 3131 O.315735 0.425921 O.7SOO89 209576 at GNAI1 guanine nucleotide binding 277O O.312S21 O.442731 O.7SOO89 protein (G protein), alpha inhibiting activity polypeptide 1 20403.0 s at IQCJ-SCHIP1 QCJ-SCHIP1 readthrough 1OOSOS385 0.349599 0.447391 O.7SOO89 213979 s at — O.43757 0.448237 O.7SOO89 203535 at S100A9 S100 calcium binding 6280 -0.SS271 O.46106 0.7SOO89 protein A9 216248 s at NR4A2 nuclear receptor Subfamily 4929 -0.44972 O.46SO48 0.7SOO89 4, group A, member 2 211597 s at HOPX HOP homeobox 84525 0.403732 0.466948 O.7SOO89 204622 X at NR4A2 nuclear receptor Subfamily 4929 -0.37372 0.468699 O.7SOO89 4, group A, member 2 220990 S. at MIR21 microRNA 21 4O6991 O.336172 0.469644 0.7SOO89 213668 S. at SOX4 SRY (sex determining 6659 0.449329 O.474OS6 O.7SOO89 region Y)-box 4 205984 at CRHBP corticotropin releasing 1393 0.377363 O.S18506 O.807842 hormone binding protein 209773 s at RRM2 ribonucleotide reductase M2 6241 -0.42832 0.528182 0.807842 201058 S. at MYL9 myosin, light chain 9, 10398 0.492397 O.S38149 0.807842 regulatory 201631 S. at IER3 immediate early response 3 887O 0.438819 O.S42829 O.807842 219777 at GIMAP6 GTPase, IMAP family 474344 0.266496 O.S4879 0.807842 member 6 212077 at CALD1 caldesmon 1 800 0.443992 O.S49332 O.807842 210873 X at APOBEC3A apolipoprotein B mRNA 200315 -0.3463 O.S99089 0.852599 editing enzyme, catalytic polypeptide-like 3A 201669 s at MARCKS myristoylated alanine-rich 4082 -0.26494 (0.60049 O.852599 protein kinase C Substrate 206478 at KIAAO125 KIAAO125 98.34 0.32879 0.609726 O.852599 201666 at TIMP1 TIMP metallopeptidase 7076 O.267758 0.619744 0.852599 inhibitor 1 219304 S at PDGFD platelet derived growth 8O310 0.204115 0.624045 0.852599 factor D 212531 at LCN2 lipocalin 2 3934 0.323764 O.624556 0.852599 212589 at RRAS2 related RAS viral (r-ras) 22800 -0.24O32 0.62995 O.852599 oncogene homolog 2 206698 at XK X-linked Kx blood group 7SO4 -0.27856 0.634334 0.852599 (McLeod syndrome) 209069 s at H3F3B H3 histone, family 3B 3021 O.19436 0.64152 0.853085 (H3.3B) 213593 s at TRA2A transformer 2 alpha 298.96 O.256365 0.6SO412 O.8SS806 homolog (Drosophila) 222044 at PCIF1 PDX1 C-terminal inhibiting 63935 0.1951 O.667828 O.86.1405 actor 1 201798 s at MYOF myoferlin 26SO9 O.273459 0.66845 O.86.1405 201369 s at ZFP36L2 ZFP36 ring finger protein- 678 O.230642 O.684623 O.869074 ike 2 211998 at H3F3B H3 histone, family 3B 3021 O.193469 O.6931 61 O.869074 (H3.3B) 214974 x at CXCL5 chemokine (C-X-C motif) 6374 -0.2616S O.695.259 0.869074 igand 5 200999 S at CKAP4 cytoskeleton-associated 1097O O.213798 0.708966 0.876694 protein 4 208180 s at HIST1H4H histone cluster 1, H4h 836S 0.215184 O.72SSS1 O.876694 214651 S. at HOXA9 homeobox A9 32OS 0.2O1432 O.727565 0.876,694 204563 at SELL Selectin L. 64O2 0.218847 O.72941 O.876,694 US 2015/0292028 A1 Oct. 15, 2015 42

TABLE 7-continued Annotation of the 102 Concordantly Deregulated Genes Symbol (Na32 GeneD Probe COSCSUS Gene Title (Na32 (consensus1 Adjusted Set ID Marl3) consensus Marl3) Mar-13) Log2(FC) P-Value p-Value 74694 S at RABEP2 rabaptin, RAB GTPase 79874 O.156251 0.74234 0.8796.03 binding effector protein 2 209112 at CDKN1B cyclin-dependent kinase 1027 -0.16341 0.746,336 0.8796.03 inhibitor 1B (p27, Kip1) 220416 at ATP8B4 ATPase, class I, type 8B, 798.95 O.16SO2 O.75294 O.8796.03 member 4 1405 i at CCL5 chemokine (C-C motif) 63S2 -O.25823 O.790224 0.895478 ligand 5 201195 S at SLC7A5 solute carrier family 7 8140 -0.13019 O.797734 0.895478 (amino acid transporter light chain, L system), member 5 205442 at MFAP3L microfibrillar-associated 9848 O.165446 0.798221 O.895478 protein 3-like 214911. S. at BRD2 bromodomain containing 2 6046 O.126061 O.802SS4 O.895478 203395 s at HES1 hairy and enhancer of split 328O -0.15322 O.808284 O.895478 , (Drosophila) 213757 at EIFSA eukaryotic translation 1984 O.139559 0.81OSS2 0.895478 initiation factor 5A 204655 at CCL5 chemokine (C-C motif) 63S2 -O.23378 O.816676 O.895478 igand 5 208892 s a DUSP6 dual specificity phosphatase 6 1848 O.125339 O.839353 0.91234 214805 at EIF4A1 eukaryotic translation 1973 O.O86848 0.847.057 0.912777 initiation factor 4A1 208835 S. at LUC7L3 LUC7-like 3 (S. cerevisiae) 51747 O.O.92821 O.854388 O.912807 205114 S at CCL3 if chemokine (C-C motif) 414O62 O. 116024 O.8826O7 O.934.96S CCL3L1 if igand 3-like 3 CCL3L3 219922 S at LTBP3 atent transforming growth 4054 -O.O6412 O.893898 O.936.218 actor beta binding protein 3 207815 at PF4V1 platelet factor 4 variant 1 51.97 -0.10475 O.898769 O.936218 208949 s a LGALS3 ectin, galactoside-binding, 3958 -O.06541 O.917S34 0.94.1056 soluble, 3 203394 is a HES1 hairy and enhancer of split 328O -0.06134 O.922933 0.94.1056 , (Drosophila) 204753 s a HLF hepatic leukemia factor 3131 O.037675 0.933009 O.94.1056 219410 at TMEM45A transmembrane protein 45A 55076 O.044462 0.933528 O. 941056 219403 s at HPSE heparanase 10855 -O.O1752 O.978683 0.978683

TABLE 8 Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 208949 s at LGALS3 lectin, galactoside-binding, soluble, 3 3958 -2461-16 4.71E-O7 O.OOO871 202284 S at CDKN1A cyclin-dependent kinase inhibitor 1026 -198698 2.11E-O6 OOO2134 1A (p21, Cip1) 201059 at CTTN cortactin 2017 -2.7258S 6.06E-06 O.OO2867 211458 s at GABARAPL1 GABA(A) receptor-associated 23710 -1.79927 1.03E-OS O.OO3369 protein like 1 210592 s at SAT1 spermidine?spermine N1- 6303 -122693 1.17E-O5 O.OO3384 acetyltransferase 1 201666 at TIMP1 TIMP metallopeptidase inhibitor 1 7076 -163942 2.35E-05 O.OO4281 203045 at NINJ1 ninjurin 1 4814 -1.5.136 255E-05 O.OO4462 203455 s at SAT1 spermidine?spermine N1- 6303 -1.251.84 2.78E-OS O.OO4519 acetyltransferase 1 202912 at ADM adrenomedullin 133 -1.SS85S 3.02E-OS O.OO4672 201058 s at MYL9 myosin, light chain 9, regulatory 10398 -2.74637 3.07E-OS O.OO4672 207815 at PF4V1 platelet factor 4 variant 1 51.97 -2.82239 S-35E-05 O.OOS828 1405 i at CCL5 chemokine (C-C motif) ligand 5 63S2 -3.32637 5.8SE-OS O.OO6036 214211 at FTH1 ferritin, heavy polypeptide 1 2495 -1471.29 8.74E-O5 O.OO6826 201422 at IFI30 interferon, gamma-inducible 10437 -2.1056 O.OOO104 O.OO745 protein 30 210845 s at PLAUR plasminogen activator, urokinase 5329 -148981 O.OOO116 OOO7613 receptor US 2015/0292028 A1 Oct. 15, 2015 43

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 214020 x at ITGB5 integrin, beta 5 3693 -1.08903 O.OOO121 O.OO7815 204115 at GNG11 guanine nucleotide binding protein 2791 -243614 O.OOO123 O.OO7906 (G protein), gamma 11 213524 S at GOS2 GOG1 Switch 2 SO486 -2.65615 O.OOO126 O.OO7998 201125 s at ITGB5 integrin, beta 5 3693 -167473 O.OOO134 OOO8224 209154 at TAX1BP3 Tax1 (human T-cell leukemia virus 3O851 -1.71214 O.OOO155 O.OO8862 type I) binding protein 3 201631 s at IER3 immediate early response 3 887O -2.29781. O.OOO169 O.OO9257 213988 s at SAT1 spermidine?spermine N1- 6303 -1.26095 O.OOO171 O.OO9309 acetyltransferase 1 200871 s at PSAP prosaposin S660 -1.0306 O.OOO195 O.OO9761 200661 a CTSA cathepsin A 5476 -1.96591 O.OOO218 O.O10227 204440 a CD83 CD83 molecule 93O8 -1.34989 O.OOO228 O.O1OSO3 214073 a CTTN cortactin 2017 -2.15431 O.OOO231 O.O10534 204655 a. CCL5 chemokine (C-C motif) ligand 5 63S2 -3.23424 O.OOO234 OO10534 219622 a. RAB20 RAB20, member RAS oncogene 55647 -110241 O.OOO283 0.011722 family 204546 a KIAAOS13 KIAAO513 97.64 -1.19275 O.OOO321 O.O12541 209304 x at GADD45B growth arrest and DNA-damage- 4616 -1.5.1931 O.OOO364 O.O13369 inducible, beta 203535 a. S100A9 S100 calcium binding protein A9 628O -2.4352 O.OOO37 O.O13372 21.0075 a MARCH2 membrane-associated ring finger 51257 -1.724.15 O.OOO43 O.O14432 (C3HC4) 2, E3 ubiquitin protein ligase 213716 s at SECTM1 Secreted and transmembrane 1 6398 -105168 O.OOO482 0.015364 209398 a HIST1H1C histone cluster 1, H1c 3006 -1.53845 0.000487 OO15374 214246 X at MINK1 misshapen-like kinase 1 SO488 -1.16871 O.OOO487 OO15374 204482 a CLDNS claudin 5 7122 -1626O2 O.OOO494 OO15531 206110 a HIST1H3H histone cluster 1, H3h 8357 -2.52014 O.OOO496 OO15566 200736 s at GPX1 glutathione peroxidase 1 2876 -1.14943 O.OOOSO8 OO15789 31874 at GAS2L1 growth arrest-specific 2 like 1 10634 -1.87076 O.OOOS2 O.O16031 217764 S at RAB31 RAB31, member RAS oncogene 11031 -2O1066 O.OOOS64 OO16422 family AFFX- STAT1 signal transducer and activator of 6772 -1.37938 O.OOO621 O.O16996 HUMISGF3Af transcription 1, 91 kDa M97935. MA at 212501 at CEBPB CCAAT?enhancer binding protein 1051 -1.54731 O.OOO671 O.O17573 (C/EBP), beta 212077 at CALD1 caldesmon 1 800 -2.042SS O.OOO688 O.O1782S 201108 s at THEBS1 thrombospondin 1 7.057 -2.12731 O.OOO718 O.O18258 212647 at RRAS related RAS viral (r-ras) oncogene 6237 -1.08906 O.OOO78S O.O19036 homolog 205463 s at PDGFA platelet-derived growth factor S154 -1.5857 O.OOO872 O.O2O261 alpha polypeptide 202083 s at SEC14L1 SEC14-like 1 (S. cerevisiae) 6397 -1.38339 O.OOO926 O.O2O823 221211 s at MAP3K7CL MAP3K7 C-terminal like S6911 - 190471 O.OOO937 O.O20912 22105.9 s at COTL1 coactosin-like 1 (Dictyostelium) 23406 -1.53392 O.OOO965 0.021237 201743 at CD14 CD14 molecule 929 -2.10963 O.OO106 0.022.456 218999 at TMEM140 transmembrane protein 140 55.281 -158682 0.001078 O.O22646 218032 at SNN Stannin 83O3 -1.79738 O.OO1083 0.022694 201739 at SGK1 serum glucocorticoid regulated 6446 -223217 O.OO1109 OO2284 kinase 1 203234 at UPP1 uridine phosphorylase 1 7378 -1.24O29 O.OO11SS O.O23122 215071 s at HIST1H2AC histone cluster 1, H2ac 8334 -2.0219 O.OO1169 O.O2321 202497 X at SLC2A3 solute carrier family 2 (facilitated 6515 -1.11253 O.OO1169 O.O2321 glucose transporter), member 3 20757.4 S at GADD45B growth arrest and DNA-damage- 4616 -191282 O.OO1288 O.O24289 inducible, beta AFFX- STAT1 signal transducer and activator of 6772 -1.2.2837 O.OO1313 O.O24575 HUMISGF3Af transcription 1, 91 kDa M97935 MB at 203414 at MMD monocyte to macrophage 23531 -1965O2 O.OO1341 O.O24732 differentiation-associated 204081 at NRGN neurogranin (protein kinase C 4900 -2.SS869 O.OO13S4 O.O24788 Substrate, RC3) 212242 at TUBA4A tubulin, alpha 4a 7277 -198963 O.OO1384 O.O2SOO3 211600 at PTPRO protein tyrosine phosphatase, S800 -1.25519 O.OO1385 O.O2SOO3 receptor type, O 211252 x at PTCRA pre T-cell antigen receptor alpha 171558 -120925 O.OO1454 O.O25618 210357 s at SMOX spermine oxidase S4498 -1.08.24 O.OO148 O.O25958 US 2015/0292028 A1 Oct. 15, 2015 44

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 214696 at MIR22HG MIR22 host gene (non-protein 84981 -1.24889 O.OO1532 0.0264.08 coding) 201506 at TGFBI transforming growth factor, beta- 7045 -147238 O.OO1571 O.O26812 induced, 68 kDa 215464 S at TAX1BP3 Tax1 (human T-cell leukemia virus 3O851 -1.19481 O.OO1588 O.O26937 type I) binding protein 3 203585 at ZNF185 Zinc finger protein 185 (LIM 7739 -1.63846 O.OO1619 O.O273O2 domain) 214752 x at FLNA filaminA, alpha 2316 -1.19726 O.OO1669 O.O27658 216261 at ITGB3 integrin, beta 3 (platelet 3690 -142557 0.001715 O.O28O36 glycoprotein IIIa, antigen CD61) 209729 at GAS2L1 growth arrest-specific 2 like 1 10634 -1.29217 O.OO1761 O.O2833 217763 s at RAB31 RAB31, member RAS oncogene 11031 -1.57464 O.OO1927 O.O294.92 amily 201565 s at ID2 inhibitor of DNA binding 2, 3398 -2.05847 O.OO1931 O.O294.94 dominant negative helix-loop-helix protein 202499 s at SLC2A3 solute carrier family 2 (facilitated 6515 -1.76034 O.OO1995 O.O3OO69 glucose transporter), member 3 200859 X at FLNA filaminA, alpha 2316 -1.14829 O.OO1998 O.O3OO73 214054 at DOK2 docking protein 2, 56 kDa 9046 -144762 0.002111 O.O3O716 209959 at NR4A3 nuclear receptor Subfamily 4, 8013 -1.06248 0.002113 O.O3O716 group A, member 3 222043 at CLU clusterin 1.191 -1.24582 O.OO2133 O.O3O796 204057 at IRF8 interferon regulatory factor 8 3394 -1.20508 O.OO2179 0.031039 210873 X at APOBEC3A apolipoprotein B mRNA editing 20O315 -1.7692 O.OO2336 O.O32102 enzyme, catalytic polypeptide-like 3A 204794 at DUSP2 dual specificity phosphatase 2 1844 -1.692S2 O.OO2377 O.O32376 204232 at FCER1G Fc fragment of IgE, high affinity I, 22O7 -1.80094 O.OO24O9 O.O32561 receptor for; gamma polypeptide 208792 S at CLU clusterin 1.191 -1.893.67 0.002436 O.O32794 20741.4 S at PCSK6 proprotein convertase SO46 -1.66589 O.OO2S8 O.O34033 Subtilisin?kexin type 6 202295 s at CTSH cathepsin H 1512 -1477S7 O.OO26O4 O.O34228 208078 S. at SIK1 salt-inducible kinase 1 1SOO94 -138923 O.OO2612 O.O34234 204446 s at ALOX5 arachidonate 5-lipoxygenase 240 -1.78576 O.OO2664 O.O34597 205863 at S100A12 S100 calcium binding protein A12 6283 -144064 O.OO2691 O.O.34786 212531 at LCN2 lipocalin 2 3934 -1.74945 O.OO2916 0.036334 204698 at ISG20 interferon stimulated exonuclease 3669 -1.01523 O.OO3O89 O.O37S74 gene 20 kDa 213338 at TMEM158 transmembrane protein 158 25907 -1.19059 O.OO326 O.O38.684 (gene pseudogene) 215492 X at PTCRA pre T-cell antigen receptor alpha 171558 -1.15689 O.OO3318 O.O38883 204838 s a MLE3 mutL homolog3 (E. coli) 27.030 -14825 O.OO334 O.O39 336 at TBXA2R thromboxane A2 receptor 6915 -1.13899 O.OO3359 O.O39168 203140 at BCL6 B-cell CLL/lymphoma 6 604 -1.30948 0.003569 O.04.0549 220751 s a FAXDC2 fatty acid hydroxylase domain 10826 -1.36 O.003658 O.O41081 containing 2 205495 S a GNLY granulysin 10578 -1.10567 O.OO370S 0.041271 200660 at S100A11 S100 calcium binding protein A11 6282 -1.62O87 O.OO3733 O.O41423 211429 is a SERPINA1 Serpin peptidase inhibitor, clade A 5265 -19862 O.OO3781. O.O41543 (alpha-1 antiproteinase, antitrypsin), member 1 202917 s a S100A8 S100 calcium binding protein A8 6279 -2.98812 O.OO3874 0.04.1998 205114 s a CCL3L3 chemokine (C-C motif) ligand 3- 414062 -211268 O.OO3894 O.O41998 like 3 2125.09 s a MXRA7 matrix-remodeling associated 7 439921 -1.13262 O.OO3902 0.042O16 204627 s a ITGB3 integrin, beta 3 (platelet 3690 -2304O1 O.OO3953 0.042268 glycoprotein IIIa, antigen CD61) 203922 s a CYBB cytochrome b-245, beta 1536 -10925 O.OO4058 0.043079 polypeptide 208180 s a HIST1H4H histone cluster 1, H4h 836S -158615 O.OO4083 0.043.185 205237 at FCN1 ficolin (collagen fibrinogen 2219 -2.31794 O.OO4143 0.043449 domain containing) 1 204628 s a ITGB3 integrin, beta 3 (platelet 3690 -163546 O.OO42O8 (0.043687 glycoprotein IIIa, antigen CD61) 20181.0 s a SH3BP5 SH3-domain binding protein 5 94.67 -135593 O.OO4294 O.O4428S (BTK-associated) 204621 S a NR4A2 nuclear receptor Subfamily 4, 4929 -1.13205 O.OO44O7 0.044874 group A, member 2 US 2015/0292028 A1 Oct. 15, 2015 45

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 214414 X at HBA1 hemoglobin, alpha 1 3O39 -2.92562 O.OO4429 O.O44949 203305 at F13A1 coagulation factor XIII, A1 2162 -2.1758S O.OO4493 0.045292 polypeptide 2098.03 s at PHILDA2 pleckstrin homology-like domain, 7262 -1.71861 O.OO466 O.O46283 amily A, member 2 2081.61 s at ABCC3 ATP-binding cassette, sub-family 871.4 -1.2104.5 O.OO4758 0.046709 C (CFTR/MRP), member 3 2084.06 s at GRAP2 GRB2-related adaptor protein 2 94O2 -1.26529 O.OO4845 0.047046 209806 at HIST1H2BK histone cluster 1, H2bk 8.5236 -1.2.1587 0.00490S 0.04746S 217028 at CXCR4 chemokine (C-X-C motif) receptor 4 7852 -1.25222 O.OO5221 O.O4911 218454 at PLBD1 phospholipase B domain 79887 -13316 O.OOS298 0.049397 containing 1 202833 s at SERPINA1 Serpin peptidase inhibitor, clade A 5265 -1.72O53 0.005347 O.O49661 (alpha-1 antiproteinase, antitrypsin), member 1 205220 at HCAR3 hydroxycarboxylic acid receptor 3 8843 -1.11127 O.OOSS34 O.OSO489 201438 at COL6A3 collagen, type VI, alpha 3 1293 -145596 O.OOSS36 O.OSO489 221731 x at WCAN versican 1462 -2.02316 O.OOSS73 O.OSO668 201360 at CST3 cystatin C 1471 -147347 O.OOST61 O.OS1649 AFFX- STAT1 signal transducer and activator of 6772 -1.22821 O.OOST86 O.OS1736 HUMISGF3Af transcription 1, 91 kDa M97935. 5 at 204858 s at TYMP hymidine phosphorylase 1890 -1.19053 O.OOS857 O.OS2O78 205547 s at TAGLN transgelin 6876 -1.89687 O.OO62OS O.OS3812 208791 at CLU clusterin 1.191 -1.6535 0.006231 O.OS3824 209383 at DDIT3 DNA-damage-inducible transcript 3 1649 -1.19919 O.OO626 O.O53.842 217022 s at IGH immunoglobulin heavy locus 3492 -1.26043 O.OO6498 0.054967 201280 s at DAB2 Dab, mitogen-responsive 16O1 -1.3568S O.OO6817 O.OS6659 phosphoprotein, homolog 2 (Drosophila) AFFX- -1.102O7 O.OO7018 0.057621 DapX-M at 211074 at FOLR1 olate receptor 1 (adult) 2348 -2.335 O.OO7106 0.057921 221556 at CDC14B cell division cycle 14B 8555 -1.3S463 O.OO7226 O.OS8222 212723 at MD6 jumonji domain containing 6 23210 -1.10344 O.OO732S O.OS8511 211745 X at HBA1 hemoglobin, alpha 1 3O39 -2.391.9S O.OO7372 O.OS8683 204141 at TUBB2A tubulin, beta 2A class IIa 7280 -2.1393 O.OO7748 0.06O237 208,579 X at H2BFS H2B histone family, member S S4145 -14314 O.OO8655 OO63919 (pseudogene) 203973 s at CEBPD CCAAT?enhancer binding protein 1052 -1.24524 O.OO8766 0.064315 (C/EBP), delta 201170 s at BHLHE40 basic helix-loop-helix family, 8553 -1483O1 O.OO8896 OO64843 member e40 205119 s at FPR ormyl peptide receptor 1 2357 -1.27582 0.009081 0.06SSS7 204961 s at NCF neutrophil cytosolic factor 1 653361 -1.3618 O.OO9093 0.06S59 201616 s at CALD1 caldesmon 1 800 -110576 O.OO9118 OO65687 204018 x at HBA1 hemoglobin, alpha 1 3O39 -198013 O.OO9214 O.O66107 213539 at CD3D CD3d molecule, delta (CD3-TCR 915 -1.04108 O.OO9761 OO67714 complex) 202388 at RGS2 regulator of G-protein signaling 2, 5997 -146404 O.OO9794 OO6779 24 kDa 201798 s at MYOF myoferlin 26509 -151466 O.OO9894 OO68217 203708 at PDE4B phosphodiesterase 4B, cAMP- S142 -1.3848.1 O.O O.O68731 specific 214084 x at NCF1C neutrophil cytosolic factor 1C 654817 -1.3956.7 O.O104O9 O.O70394 pseudogene 209458 x at HBA1 hemoglobin, alpha 1 3O39 -2.13257 O.O108O2 O.O71832 217762 s at RAB31 RAB31, member RAS oncogene 11031 -1.34439 O.O10983 O.O72433 family 208022 s at CDC14B cell division cycle 14B 8555 -1.06029 O.O11O3S O.O72627 204790 at SMAD7 SMAD family member 7 4092 -1.18892 O.O11176 O.O72876 217414 X at HBA1 hemoglobin, alpha 1 3O39 -2.04967 O.O11779 0.07 S213 204480 s at C9orf16 chromosome 9 open reading frame 16 79095 -1.0583 O.O1178 0.075213 204908 s at BCL3 B-cell CLL/lymphoma 3 602 -1.12158 0.0118O2 O.O75244 206883 x at GP9 glycoprotein IX (platelet) 2815 -1394.92 O.O12283 0.076763 211964 at COL4A2 collagen, type IV, alpha 2 1284 -1.30407 O.O12296 O.O76763 AFFX- GAPDH glyceraldehyde-3-phosphate 2597 -1.07979 O.O12327 O.O76822 HUMGAPDHA dehydrogenase M33197 5 at US 2015/0292028 A1 Oct. 15, 2015 46

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 202887 s a DDIT4 DNA-damage-inducible transcript 4 54541 - 142927 O.O12333 O.O76822 AFFX- GAPDH glyceraldehyde-3-phosphate 2597 -1.25641 O.O1233S O.O76822 HUMGAPDHA dehydrogenase M33197 M at 204588 s a SLC7A7 Solute carrier family 7 (amino acid 90S6 -1.19903 O.O124O2 O.O77024 transporter light chain, y + L system), member 7 206655 is a GP1BB glycoprotein Ib (platelet), beta 2812 -2.09441 O.O128 O.O78521 polypeptide 221841 s a KLF4 Kruppel-like factor 4 (gut) 93.14 -1.651.98 0.012861 O.O7883S 212657 s a IL1RN interleukin 1 receptor antagonist 3SS7 - 1.14627 O.O13221 O.O8O181 204620 s a WCAN versican 1462 - 1.51568 O.O13307 O.O8O358 205442 at MFAP3L microfibrillar-associated protein 3- 9848 -1.52051 O.O13437 0.08O854 like 200665 s a SPARC Secreted protein, acidic, cysteine- 6678 - 1.75861 O.O1347 O.O8O865 rich (osteonectin) 204396 s a GRKS G protein-coupled receptor kinase 5 2869 -1.2837S O.O13822 O.O82O85 202207 at ARL4C ADP-ribosylation factor-like 4C 101.23 -1.06368 O.O14043 O.O82963 AFFX- ACTB actin, beta 60 - 1.37822 O.014382 O.O839 HSACO7. X00351. 3 at 214974 X at CXCLS chemokine (C-X-C motif) ligand 5 6374 - 1.55942 O.O14408 O.O83963 213275 X at CTSB cathepsin B 1508 -1.09109 OO14496 O.O84285 214677 x at CYAT1 immunoglobulin lambda light 10O29.0481 - 1.197O2 O.O14517 O.O84316 chain-like 21855.9 s at MAFB V-maf musculoaponeurotic 993S -1.60O23 O.O14906 O.O8566S fibrosarcoma oncogene homolog B (avian) 208.527 x at HIST1H2BE histone cluster 1, H2be 8344 -10534 O.O15738 0.08838 20231.0 s at COL1A1 collagen, type I, alpha 1 1277 - 187619 O.O16831 O.O.91891 208.601 s at TUBB1 tubulin, beta 1 class VI 81027 - 1.17222 O.O17934 0.095324 219403 s at HPSE heparanase 10855 - 1.31934 O.O18497 O.O96806 200622 X at CALM3 calmodulin 3 (phosphorylase 808 -1.04785 0.018549 O.096942 kinase, delta) 212667 at SPARC Secreted protein, acidic, cysteine- 6678 -1.34731 O.O18812 O.O97654 rich (osteonectin) 209949 at NCF2 neutrophil cytosolic factor 2 4688 -1.34905 O.O1953 O.099726 204122 at TYROBP TYRO protein tyrosine kinase 7305 - 1.58727 O.O19681 0.100052 binding protein 201811 X at SH3BP5 SH3-domain binding protein 5 9467 - 1.02097 O.O2O101 0.101165 (BTK-associated) 214469 at HIST1H2AE histone cluster 1, H2ae 3O12 -1.04742 O.O2O232 0.101492 200999 s at CKAP4 cytoskeleton-associated protein 4 10970 -1.1494 O.O2O405 O1O1743 204319 s at RGS10 regulator of G-protein signaling 10 6001 - 1.05791 O.O2O642 O.102328 37966 at PARVB parvin, beta 29780 -1.18316 O.O2O871 O.102995 AFFX- STAT1 signal transducer and activator of 6772 - 1.13562 0.02.2192 O.106109 HUMISGF3Af transcription 1, 91 kDa M97935. 3 at 208546 X at HIST1H2BEH histone cluster 1, H2bh 8345 - 1.03067 O.O224.52 0.106776 204834 at FGL2 fibrinogen-like 2 10875 - 14682 0.02277S. O.1072S6 216442 X at FN1 fibronectin 1 2335 - 190726 O.O23141 01081.66 204103 at CCL4 chemokine (C-C motif) ligand 4 6351 -1.0683 O.O2465 0.111906 221269 s at SH3BGRL3 SH3 domain binding glutamic 83442 - 1.17357 0.024677 0.111906 acid-rich protein like 3 201842 s at EFEMP1 EGF containing fibulin-like 22O2 -1. SOO62 O.O24795 0.112138 extracellular matrix protein 1 208450 at LGALS2 ectin, galactoside-binding, soluble, 2 3957 - 1.SS709 O.O2S744 0.114214 212464 S at FN1 fibronectin 1 2335 - 1.963S3 O.O2S831. O.114387 204971 at CSTA cystatin A (Stefin A) 1475 - 14559 O.O26275 0.115382 211719 x at FN1 fibronectin 1 2335 -2.20582 0.026796 O. 116477 210495 X at FN1 fibronectin 1 2335 - 190768 0.026965 0.116845 216248 s at NR4A2 nuclear receptor Subfamily 4, 4929 -1.17499 0.028.238 0.119726 group A, member 2 204912 at L1ORA interleukin 10 receptor, alpha 3587 -1.05258. O.O2903 O.121428 211699 X at HBA1 hemoglobin, alpha 1 3O39 -1600O2 O.O29162 0.121623 AFFX- ACTB actin, beta 60 -1.04373 0.029941 O.123368 HSACO7. X00351 5 at US 2015/0292028 A1 Oct. 15, 2015 47

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 218280 x at HIST2H2A A4 histone cluster 2, H2aa4 723790 -1.035 O.O29948 0.123368 215240 at TGB3 integrin, beta 3 (platelet 3690 -118589 O.O3O708. O.124841 glycoprotein IIIa, antigen CD61) 219630 at PDZK1P1 PDZK1 interacting protein 1 10158 -116143 O.O31505 O.126922 56256 at SIDT2 SID1 transmembrane family, S1092 -1.06356 0.03.192 O.127917 member 2 21414.6 s at PPBP pro-platelet basic protein 5473 -2.2804 O.O32189 0.1285O6 (chemokine (C-X-C motif) ligand 7) 217683 at HBE1 hemoglobin, epsilon 1 3O46 -1.01632 O.O3275 O.12959 202627 s at SERPINE1 Serpin peptidase inhibitor, clade E 5054 -1.24155 O.O3S257 0.134957 (nexin, plasminogen activator inhibitor type 1), member 1 218223 s at PLEKHO1 pleckstrin homology domain 51177 -1.02949 O.O3S417 O.13S21 containing, family O member 1 203394 is at HES1 hairy and enhancer of split 1, 328O -1.19137 O.O36252 0.137146 (Drosophila) 214511 X at FCGR1B Fc fragment of IgG, high affinity 2210 -1.OO332 O.O36916 0.1385 b, receptor (CD64) 211980 at COL4A1 collagen, type IV, alpha 1 1282 -1.2568 O.O37235 0.139094 215076 s at COL3A1 collagen, type III, alpha 1 1281 -143307 O.O38584 O.141774 218.723 s at RGCC regulator of cell cycle 28984 -1.3S285 0.038884 O.142295 201465 s at JUN jun proto-oncogene 3725 -1.23SS4 O.O39397 0.143388 206493 at TGA2B integrin, alpha2b (platelet 3674 -140259 O.O4O966 0.146453 glycoprotein IIb of IIb, IIIa complex, antigen CD41) 209651 at TGFB11 transforming growth factor beta 1 7041 -1.18925 O.O43241 0.1506O2 induced transcript 1 2024.03 s at COL1A2 collagen, type I, alpha 2 1278 -144055 O.O46SO3 (0.156448 213975 s at LYZ ysozyme 4069 -1.3S445 O.O46533 0.156457 202391 at BASP1 brain abundant, membrane 104.09 -1.21789 O.OSO925 0.164058 attached signal protein 1 200897 s at PALLD palladin, cytoskeletal associated 23022 -1.19733 O.OS4484 0.169794 protein 207206 s at ALOX12 arachidonate 12-lipoxygenase 239 -1.13633 O.OS4626 O.17OO45 202404 S at COL1A2 collagen, type I, alpha 2 1278 -1.711.66 O.OS6539 O.173313 2108.09 s at POSTN periostin, osteoblast specific factor 10631 -1.70047 O.OS9219 O.177986 217572 at -1.0617 O.O61496 O181515 204351 at S1 OOP S100 calcium binding protein P 6286 -110416 0.061934 0.182O39 202953 at C1QB complement component 1, q 713 -104337 O.O61996 O.1821.21 Subcomponent, B chain 36711 at MAFF V-maf musculoaponeurotic 23764 -2.0711 1 0.062874 O.183657 fibrosarcoma oncogene homolog F (avian) 214290 s. at HIST2H2A A4 histone cluster 2, H2aa4 723790 -1.00017 O.O631.96 O.184141 220496 at CLEC1B C-type lectin domain family 1, S1266 -1.261.33 O.O6812S O.192398 member B 202628 s at SERPINE1 Serpin peptidase inhibitor, clade E 5054 -1.OO38 O.O68895 O.193543 (nexin, plasminogen activator inhibitor type 1), member 1 201852 x at COL3A1 collagen, type III, alpha 1 1281 -1.06O74 OO69846 O.19499 209210 s at FERMT2 fermitin family member 2 10979 -1.18848 O.O71118. O.197 208937 s at ID1 inhibitor of DNA binding 1, 3397 -1.06464 O.O76912 0.204982 dominant negative helix-loop-helix protein 202644 S at TNFAIP3 tumor necrosis factor, alpha- 7128 -1.11193 0.077731 O.206126 induced protein 3 2025.55 S. at MYLK myosin light chain kinase 4638 -12O646 (O.O78352 0.2O6861 207808 S. at PROS1 protein S (alpha) 5627 -1.05757 0.080762 0.210O82 202237 at NNMT nicotinamide N-methyltransferase 4837 -1.16906 O.O84988 O.216541 204959 at MINDA myeloid cell nuclear differentiation 4332 -1.11553 0.09926S 0.237052 antigen 206390 x at PF4 platelet factor 4 S196 -156272 O. 105914 0.246063 207076 s at ASS1 argininosuccinate synthase 1 445 -1.01934 O. 1108O8 0.252682 206494 s at ITGA2B integrin, alpha2b (platelet 3674 -1.21162 0.118492 0.262217 glycoprotein IIb of Ilb/IIIa complex, antigen CD41) 207140 at ALPI alkaline phosphatase, intestinal 248 -1.14253 O.12301 0.267727 216834 at RGS1 regulator of G-protein signaling 1 S996 -134806 0.152O6 O3O3847 202988 s at RGS1 regulator of G-protein signaling 1 S996 -1.08916 0.188906 0.346892 213515 X at HBG1 hemoglobin, gamma A 3047 -1.06377 0.246664 O.4O788S US 2015/0292028 A1 Oct. 15, 2015 48

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 212671 s at HLA-DQA1 major histocompatibility complex, 3117 O97239 O.126891 0.272796 class II, DQ alpha 1 211734 S. at FCER1A Fc fragment of IgE, high affinity I, 2205 OO92S1 O.O78698 0.207233 receptor for; alpha polypeptide 210982 s at HLA-DRA major histocompatibility complex, 3122 194665 0.07091 O.196595 class II, DRalpha 202016 a MEST mesoderm specific transcript 4232 10616 0.05.007 O.162642 209773 s at RRM2 ribonucleotide reductase M2 6241 272153 0.049.561 0.1616O2 20294.6 s at BTBD3 BTB (POZ) domain containing 3 22903 O45621 O.O4313 O.1SO497 208894 a HLA-DRA major histocompatibility complex, 3122 34.853 O.O28179 0.119545 class II, DRalpha 213376 a ZBTB1 Zinc finger and BTB domain 22890 O88786 0.026SS2 0.116003 containing 1 206310 a SPINK2 serine peptidase inhibitor, Kazal 6691 OSS612 O.O24944 0.112515 type 2 (acrosin-trypsin inhibitor) 203817 a GUCY1B3 guanylate cyclase 1, soluble, beta 3 2983 163996 O.O24688 O. 111906 209392 a ENPP2 ectonucleotide S168 O30545 O.O23369 O.108718 pyrophosphatase/phosphodiesterase 2 216640 S at PDIA6 protein disulfide isomerase family 101.30 19128 O.O2O388 O.101.74 A member 6 212588 a PTPRC protein tyrosine phosphatase, 5788 2266O1 O.O19819 O.1OO488 receptor type, C 2098.94 a LEPR leptin receptor 3953 184929 O.O18148 0.09595 218039 a NUSAP1 nucleolar and spindle associated S12O3 1574OS O.O17634 0.094469 protein 1 213129 s at GCSEHP5 glycine cleavage system protein H 10O3291.08 .1071.4 O.O1585 O.O88615 pseudogene 5 2O1577 a NME1 NMENM23 nucleoside 4830 O34901 O.O15518 O.O877S3 diphosphate kinase 1 214741 a ZNF131 Zinc finger protein 131 7690 O72298 O.O1526S O.O86843 212498 a OO7129 O.O14477 O.O84233 200953 S at CCND2 cyclin D2 894 O83456 O.O14299 O.O83701 2O7668 x at PDIA6 protein disulfide isomerase family 101.30 O75588. O.O14187 0.083288 A member 6 208.639 X at PDIA6 protein disulfide isomerase family 101.30 14892S O.O1392S O.O82576 A member 6 212749 s at RCHY1 ring finger and CHY Zinc finger 25898 154346 0.013753 O.O81884 domain containing 1, E3 ubiquitin protein ligase 213599 at OIP5 Opa interacting protein 5 11339 O3491S O.O13279 0.080287 218477 at TMEM14A transmembrane protein 14A 28978 O380SS O.O1243 O.O77084 2091.60 at AKR1C3 aldo-keto reductase family 1, 8644 OSO868 O.O12306 0.076764 member C3 207165 at HMMR hyaluronan-mediated motility 31 61 12524 O.O12278 O.O76763 receptor (RHAMM) 200750 S at RAN RAN, member RAS oncogene S901 1961.45 O.O12173 O.O76447 amily 200853 at H2AFZ. H2A histone family, member Z 3015 133212 O.O12107 0.076162 211762 s at KPNA2 karyopherin alpha 2 (RAG cohort 3838 122517 O.O11697 O.O74903 , importin alpha 1) 202591 s at SSBP1 single-stranded DNA binding 6742 O79587 O.O11546 O.O74317 protein 1, mitochondrial 212224 at ALDH1A1 aldehyde dehydrogenase 1 family, 216 S3280S O.O112S6 O.O73O81 member A1 202157 s at CELF2 CUGBP, Elav-like family member 2 10659 34.5852 O.O11153 O.O72851 201018 at EIF1AX eukaryotic translation initiation 1964 O7069 O.O11072 O.O72653 factor 1A, X-linked 214359 is at HSP90AB1 heat shock protein 90 kDa alpha 3326 611725 O.O10493 O.O70756 (cytosolic), class B member 1 202266 at TDP2 tyrosyl-DNA phosphodiesterase 2 51567 168396 O.OO9941 OO68453 204023 at RFC4 replication factor C (activator 1) 4, S984 161476 O.OO9896 OO68217 37kDa 208852 s at CANX calnexin 821 147782 O.OO9836 OO67995 208990 s. at HNRNPH3 heterogeneous nuclear 31.89 O22691 O.OO9773 OO6773S ribonucleoprotein H3 (2H9) 201193 at IDEH1 isocitrate dehydrogenase 1 3417 1097OS O.OO967S OO67345 (NADP+), soluble 204444 at KIF11 kinesin family member 11 3832 OS2307 O.OO9568 OO6712 202899 s at SRSF3 serinefarginine-rich splicing factor 3 6428 121111 O.O09SS4 OO67103 206834 at HBD hemoglobin, delta 3O45 603183 0.009SO4 OO66927 US 2015/0292028 A1 Oct. 15, 2015 49

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 213241 at PLXNC1 plexin C1 101S4 O98497 O.OO93SS OO66441 208783 s at CD46 CD46 molecule, complement 4179 OO9037 O.OO92S3 0.066184. regulatory protein 204905 s at EEF1E1 eukaryotic translation elongation 9521 O18486 O.OO92O3 OO6606 factor 1 epsilon 1 203755 at BUB1B BUB1 mitotic checkpoint 701 ..106693 O.OO9061 OO6SSO4 serine/threonine kinase B 201462 at SCRN1 Secernin 1 98OS O89176 O.OO882S OO64512 207238 s a PTPRC protein tyrosine phosphatase, 5788 OO2292 O.OO794 OO60948 receptor type, C 202469 is a CPSF6 cleavage and polyadenylation 11052 O17757 O.OO7655 0.05992 specific factor 6, 68 kDa 21835.0 s a GMNN geminin, DNA replication inhibitor 51053 2.89682 0.007592 O.OS9577 201653 at CNIH cornichon homolog (Drosophila) 101.75 O24747 O.OO7566 O.OS9412 21075.9 s a PSMA1 proteasome (prosome, macropain) S682 O2S107 O.007S34 0.0592S Subunit, alpha type, 1 218984 at PUS7 pseudouridylate synthase 7 54.517 O92719 O.OO7372 O.OS8683 homolog (S. cerevisiae) 213541 s a ERG v-ets erythroblastosis virus E26 2O78 268671 O.OO7213 O.OS8222 oncogene homolog (avian) 214214 S a C1OBP complement component 1, q 708 O81512 O.OO6939 O.OS7298 Subcomponent binding protein 218883 s a MILF1IP MLF1 interacting protein 79682 OO2951 O.OO6546 O.OSS22 204798 at MYB v-myb myeloblastosis viral 46O2 33907 O.OO6372 O.OS4414 oncogene homolog (avian) 21471.0 s a CCNB1 cyclin B1 891 30622 O.OO6365 0.05438 2008.92 s a TRA2B transformer 2 beta homolog 6434 O59953 O.OO6225 O.OS3824 (Drosophila) 201084 s a BCLAF1 BCL2-associated transcription 9774 O42614 O.OO6038 O.O53075 factor 1 219306 a KIF15 kinesin family member 15 S6992 OOS174 O.OOS933 0.052485 209180 a RABGGTB Rab geranylgeranyltransferase, 5876 O3O791 O.OOS87 0.05217 beta subunit 201829 a NET1 neuroepithelial cell transforming 1 10276 16411 O.OOSTS9 O.OS1649 213047 x at SET SET nuclear oncogene 6418 O72575 O.OO5512 0.05039 201241 a DDX1 DEAD (Asp-Glu-Ala-Asp) box 1653 20415 O.OOSSO9 O.OSO39 helicase 1 209728 a HLA-DRB4 major histocompatibility complex, 3126 2.396871 O.OOS479 O.OSO3S3 class II, DR beta 4 201890 a RRM2 ribonucleotide reductase M2 6241 743.456 O.OOS295 O.O49397 201477 s at RRM1 ribonucleotide reductase M1 6240 259059 O.OOS293 0.049397 200728 a ACTR2 ARP2 actin-related protein 2 10097 O79756 O.OOS2SS O.O49248 homolog (yeast) 212250 a MTDH metadherin 92140 112188 O.OO5254 O.O49248 200996 a ACTR3 ARP3 actin-related protein 3 10096 167525 O.OOSO78 O.O48328 homolog (yeast) 203405 a PSMG1 proteasome (prosome, macropain) 8624 OO2781 O.OOSO39 O.O48111 assembly chaperone 1 200877 a CCT4 chaperonin containing TCP1, 10575 1341.12 O.OO4843 O.047046 subunit 4 (delta) 210438 x at TROVE2 TROVE domain family, member 2 6.738 O752S2 O.OO4643 O.O462O1 201417 a SOX4 SRY (sex determining region Y)- 6659 24O673 O.OO4S46 O.O4S582 box 4 201014 S at PAICS phosphoribosylaminoimidazole 10606 32S476 O.OO4S23 O.O4S413 carboxylase, phosphoribosylaminoimidazole Succinocarboxamide synthetase 200064 at HSP90AB1 heat shock protein 90 kDa alpha 3326 128671 O.OO4413 O.O44877 (cytosolic), class B member 1 202268 s at NAE1 NEDD8 activating enzyme E1 8883 117633 0.004311 O.O44378 subunit 1 211137 s at ATP2C1 ATPase, Ca++ transporting, type 27032 O242O7 O.OO4133 0.04339 2C, member 1 218694 at ARMCX1 armadillo repeat containing, X- S1309 24O431 O.004.091 O.O432O2 linked 1 201676 x at PSMA1 proteasome (prosome, macropain) S682 O34639 O.004O6 O.O43079 Subunit, alpha type, 1 217987 at ASNSD1 asparagine synthetase domain S4529 242982 O.OO4059 0.043079 containing 1 US 2015/0292028 A1 Oct. 15, 2015 50

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 219563 at LINCOO341 long intergenic non-protein coding 79686 115324 O.OO4OS1 O.O43O37 RNA 341 201240 S at LOC653566 signal peptidase complex subunit 2 653566 OS3758 O.OO4022 O.O42778 homolog (S. cerevisiae) pseudogene 204146 at RADS1AP1 RAD51 associated protein 1 10635 156331 O.OO4O16 O.O42729 2097.57 s at MYCN v-myc myelocytomatosis viral 4613 210293 O.OO3996 O.O42614 related oncogene, neuroblastoma derived (avian) 209.095 at DLD dihydrolipoamide dehydrogenase 1738 319642 O.OO3935 0.042191 211971 s at LRPPRC eucine-rich pentatricopeptide 101.28 113512 O.OO3889 O.O41998 repeat containing 211746 X at PSMA1 proteasome (prosome, macropain) S682 O18568 O.OO3854 O.O41914 Subunit, alpha type, 1 200052 s at LF2 interleukin enhancer binding factor 2 3608 O667 O.OO3851 O.O41914 212640 at PTPLB protein tyrosine phosphatase-like 2O1562 131425 O.OO3826 O.O41838 (proline instead of catalytic arginine), member b 200774 at FAM12OA amily with sequence similarity 120A 23196 114974 O.OO3738 O.O4145 209318 x at PLAGL1 pleiomorphic adenoma gene-like 1 5325 23893 O.OO3682 0.0412S 201180 s at GNAI3 guanine nucleotide binding protein 2773 O37392 O.OO3621 O.O4.0838 (G protein), alpha inhibiting activity polypeptide 3 215933 s at HHEX hematopoietically expressed 3O87 279779 0.003597 0.040702 homeobox 200807 s at HSPD1 heat shock 60 kDa protein 1 3329 O15247 O.OO358 0.04O641 (chaperonin) 202539 s at HMGCR 3-hydroxy-3-methylglutaryl-CoA 3156 103166 0.003517 O.O4O158 reductase 200072 s at HNRNPM heterogeneous nuclear 4670 4O2849 O.00349 O.O40O28 ribonucleoprotein M 204373 s at CEP350 centrosomal protein 350 kDa 98.57 1857O6 O.OO3481 O.O40O28 203209 at RFCS replication factor C (activator 1) 5, 5985 113492 O.OO338 O.O39333 36.5 kDa 211935 at ARL6IP1 ADP-ribosylation factor-like 6 232O4 159268 O.OO3341 O.O39 interacting protein 1 203566 s a AGL amylo-alpha-1,6-glucosidase, 4- 178 O46125 O.OO330S 0.038871 alpha-glucanotransferase 201549 X at KDMSB lysine (K)-specific demethylase 5B 10765 O65448 O.OO328S O.O38786 208029 s a LAPTM4B lysosomal protein transmembrane 55.353 2S3963 O.OO3231 O.O385O1 4 beta 218585 S a DTL denticleless E3 ubiquitin protein S1514 .350603 0.003194 O.O3822 ligase homolog (Drosophila) 212893 a ZZZ3 Zinc finger, ZZ-type containing 3 26009 O8O34 O.OO3179 0.0381.51 21544.0 s a BEX4 brain expressed, X-linked 4 56271 274266 O.OO3O8 O.O3.7537 200020 a TARDBP TAR DNA binding protein 2343S 10O346 0.002966 0.0367OS 213293 s a TRIM22 tripartite motif containing 22 10346 403817 O.00295 O.O.36579 205612 a MMRN1 multimerin 1 22915 21464 O.OO2937 O.O.36484 201930 a. MCM6 minichromosome maintenance 4175 OS1838 0.002935, O.O36484 complex component 6 20891.0 s a C1OBP complement component 1, q 708 4O182 O.OO291 O.O36295 Subcomponent binding protein 218870 a ARHGAP15 Rho GTPase activating protein 15 SS843 442188 O.OO2874 O.O36047 204236 a FLI1 Friend leukemia virus integration 1 2313 290793 O.OO2863 O.O36O16 211784 s a SRSF1 serinefarginine-rich splicing factor 1 6426 O27483 0.002853 O.O.35922 212215 a. PREPL prolyl endopeptidase-like 9581 O16567 0.002832 O.O3582 201713 s a RANBP2 RAN binding protein 2 5903 15906 0.002829 O.O35812 201589 a SMC1A structural maintenance of 8243 429.532 O.OO2826 O.O.35794 chromosomes 1A 201327 s a CCT6A chaperonin containing TCP1, 908 110939 O.OO2792 O.O.35561 subunit 6A (Zeta 1) 214949 a O96897 O.OO2708 O.O34908 213222 a. PLCB1 phospholipase C, beta 1 23236 O4S277 O.OO2634 O.O3437 (phosphoinositide-specific) 205051 S. at KIT v-kit Hardy-Zuckerman 4 feline 3815 349599 O.OO2631 O.O34353 sarcoma viral oncogene homolog 201652 a. COPS5 COP9 constitutive 10987 1331.69 O.OO2622 O.O34334 photomorphogenic homolog subunit 5 (Arabidopsis) US 2015/0292028 A1 Oct. 15, 2015 51

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 208767 s at LAPTM4B lysosomal protein transmembrane 5.5353 12S608 O.OO2597 O.O341.78 4 beta 204026 s at ZWINT ZW10 interactor, kinetochore 11130 36409 O.OO2S74 0.033989 protein 211615 s at LRPPRC leucine-rich pentatricopeptide 101.28 O77666 O.OO2S24 O.O3353 repeat containing 206332 S at IFI16 interferon, gamma-inducible 3428 O4713 O.OO2479 0.033114 protein 16 213605 s at 3O1604 O.002445 O.O32816 219054 a NPR3 natriuretic peptide receptor 4883 O795.74 O.OO2372 O.O32376 Ciguanylate cyclase C (atrionatriuretic peptide receptor C) 212867 a NCOA2 nuclear receptor coactivator 2 10499 169646 O.OO2371 O.O32376 208.828 a POLE3 polymerase (DNA directed), S4107 18931S O.002289 O.O.31795 epsilon 3, accessory subunit 204127 a RFC3 replication factor C (activator 1) 3, 5983 217624 O.OO2267 O.O31632 38 kDa 202599 s at NRIP1 nuclear receptor interacting protein 1 8204 485341 O.OO2258 O.O3152 212557 a ZNF451 Zinc finger protein 451 26036 O87217 O.OO2254 0.031489 210766 s at CSE1L CSE1 chromosome segregation 1- 1434 O38634 0.002233 0.031297 like (yeast) 211922 s at CAT catalase 847 262699 0.002221 O.O31297 205345 a. BARD1 BRCA1 associated RING domain 1 S8O O971.85 0.002218 O.O31297 201197 a AMD1 adenosylmethionine decarboxylase 1 262 1474S1 O.OO2213 O.O31264 204689 a HHE hematopoietically expressed 3O87 O69023 O.00216S O.O.30957 homeobox 201624 a DARS aspartyl-tRNA synthetase 1615 O26982 0.002159 O.O.30955 212766 s at ISG2OL2 interferon stimulated exonuclease 81875 137911 O.OO2146 O.O3O863 gene 20 kDa-like 2 201112 s at CSE1L CSE1 chromosome segregation 1- 1434 11844 O.OO2142 O.O3O838 like (yeast) 212038 s at WDAC1 voltage-dependent anion channel 1 7416 4223O3 O.OO2135 0.030796 211953 s at IPO5 importin 5 3843 242SO1 O.OO2132 O.O3O796 212612 at RCOR1 REST corepressor 1 23186 102759 O.OO2126 O.O3O796 218715 at UTP6 UTP6, small subunit (SSU) 55.813 28.737 S O.OO2119 O.O.30758 processome component, homolog (yeast) 217957 at C16orf&O chromosome 16 open reading 291. OS 23S392 O.OO2104 O.O3O707 frame 80 208.666 s at ST13 Suppression of tumorigenicity 13 6767 O6OOO2 O.OO2O6 O.O3O421 (colon carcinoma) (Hsp70 interacting protein) 201054 at HNRNPAO heterogeneous nuclear 10949 O42824 O.002053 O.O3O384 ribonucleoprotein AO 208863 s at SRSF1 serinefarginine-rich splicing factor 1 6426 1SS243 O.OO2O24 O.O3O21 221942 s at GUCY1A3 guanylate cyclase 1, soluble, alpha 3 2982 274671 O.002022 O.O3O194 203380 x at SRSFS serinefarginine-rich splicing factor 5 64.30 O94125 0.002013 O.O3O181 204439 at IFI44L interferon-induced protein 44-like 10964 .917025 O.OO2OOS O.O.301S2 202119 s at CPNE3 copine III 8895 24O924 O.OO1996 O.O3OO69 202491 s at IKBKAP inhibitor of kappa light polypeptide 85.18 162396 O.OO1995 O.O3OO69 gene enhancer in B-cells, kinase complex-associated protein 200816 s at PAFAH1B1 platelet-activating factor SO48 O410OS O.OO1981 O.O29948 acetylhydrolase 1b, regulatory subunit 1 (45 kDa) 203011 at IMPA1 inositol(myo)-1 (or 4)- 361.2 283329 O.OO1971 O.O29877 monophosphatase 1 202613 at CTPS1 CTP synthase 1 1503 114581 O.OO1955 O.O297 206937 at SPTA1 spectrin, alpha, erythrocytic 1 6708 151575 O.OO1936 O.O29531 (elliptocytosis 2) 212037 at PNN pinin, desmosome associated S411 494.883 O.OO1917 O.O29474 protein 206052 s at SLBP stem-loop binding protein 7884 O82828 O.OO1906 O.O29434 201013 s at PAICS phosphoribosylaminoimidazole 10606 121467 O.OO186 O.O29062 carboxylase, phosphoribosylaminoimidazole Succinocarboxamide synthetase 209642 at BUB1 BUB1 mitotic checkpoint 699 O34101 O.OO1808 O.O28585 serine/threonine kinase US 2015/0292028 A1 Oct. 15, 2015 52

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 210425 X at GOLGA8B golgin A8 family, member B 440270 211.96S O.OO1808 O.O28585 2098.61 s at METAP2 methionyl aminopeptidase 2 10988 173435 0.001784 O.O285 221547 at PRPF18 PRP18 pre-mRNA processing 8.559 O10609 O.OO1784 O.O285 factor 18 homolog (S. cerevisiae) 203138 at HAT1 histone acetyltransferase 1 852O 697742 0.001772 O.O28447 209630 s at FBXW2 F-box and WD repeat domain 26,190 OO777 O.OO17SS O.O28286 containing 2 201330 at RARS arginyl-tRNA synthetase 5917 O48926 0.001753 0.028265 211727 s at COX11 cytochrome c oxidase assembly 1353 104041 O.OO1747 O.O28216 homolog 11 (yeast) 212287 at SUZ12 Suppressor of Zeste 12 homolog 23512 O60589 O.OO1742 O.O28189 (Drosophila) 208802 at SRP72 signal recognition particle 72 kDa 6731 O80033 0.001713 O.O28O28 200978 at MDH1 malate dehydrogenase 1, NAD 4190 1O2S64 O.OO1677 0.027682 (soluble) 203373 at SOCS2 Suppressor of cytokine signaling 2 883S 193O44 O.OO1676 O.O27682 218263 s at ZBEDS Zinc finger, BED-type containing 5 S8486 O68226 O.OO1674 0.027682 202303 X at SMARCAS SWI/SNF related, matrix 8467 O13631 O.OO1653 O.O2757 associated, actin dependent regulator of chromatin, Subfamily a member 5 201472 at VBP1 von Hippel-Lindau binding protein 1 7411 O93136 O.OO1639 O.O27452 212825 at PAXIP1 PAX interacting (with 22976 152279 O.OO1534 0.026427 transcription-activation domain) protein 1 217993 s at MAT2B methionine adenosyltransferase II, 27430 O83589 O.OO1528 O.O2639 beta 202113 s at SNX2 Sorting nexin 2 6643 27OO36 O.OO1506 0.02616 209330 s at HNRNPD heterogeneous nuclear 31.84 161084 O.OO1504 O.O2616 ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa) 206958 s at UPF3A UPF3 regulator of nonsense 65110 374126 O.OO1456 O.O2S618 transcripts homolog A (yeast) 201478 s at DKC1 dyskeratosis congenita 1, dyskerin 1736 42O645 O.OO145 O.O2S591 210260 s at TNFAIP8 tumor necrosis factor, alpha- 2S816 O79476 O.OO1424 O.O2S305 induced protein 8 205394 a CHEK1 checkpoint kinase 1 1111 O2S967 O.OO1414 O.O2S236 208966 X at IFI16 interferon, gamma-inducible 3428 261519 O.OO1413 O.O2S236 protein 16 202227 s at BRD8 bromodomain containing 8 10902 211398 O.OO1397 O.O2S152 202983 a HLTF helicase-like transcription factor 6596 292.442 O.OO1395 O.O2S148 218966 a MYOSC myosin VC 55930 153543 O.OO1385 O.O2SOO3 208787 a MRPL3 mitochondrial ribosomal protein L3 11222 1763O4 O.OO1376 O.O2497 203427 a ASF1A ASF1 anti-silencing function 1 2S842 OS9991 O.OO1373 O.O2497 homolog A (S. cerevisiae) 201260 s at SYPL1 synaptophysin-like 1 6856 204425 O.OO1372 O.O2497 212652 s at SNX4 Sorting nexin 4 8723 OS22O1 O.OO1368 O.O24963 217850 a GNL3 guanine nucleotide binding 263S4 414O6 O.OO13S O.O24754 protein-like 3 (nucleolar) 212435 a. TRIM33 tripartite motif containing 33 51592 O36739 O.OO1348 O.O24743 210983 s at MCM7 minichromosome maintenance 4176 380913 O.OO1341 O.O24732 complex component 7 204510 a CDC7 cell division cycle 7 8317 373466 O.OO1299 O.O24412 201970 s at NASP nuclear autoantigenic sperm 4678 246,396 O.OO128 O.O242O2 protein (histone-binding) 214043 a PTPRD protein tyrosine phosphatase, 5789 2S3071 O.OO1271 O.O241S receptor type, D 209572 S at EED embryonic ectoderm development 8726 OS8266 O.OO127 O.O.2415 202890 a MAP7 microtubule-associated protein 7 9053 299804 O.OO126S O.O2408 201129 a SRSF7 serinefarginine-rich splicing factor 7 6432 119633 O.OO12S4 O.O23956 201699 a PSMC6 proteasome (prosome, macropain) 5706 SO3145 O.OO122 O.O23629 26S subunit, ATPase, 6 212266 s at SRSFS serinefarginine-rich splicing factor 5 6430 41576 O.OO1217 O.O23629 206544 x at SMARCA2 SWI/SNF related, matrix 6595 O67396 O.OO1209 OO236O1 associated, actin dependent regulator of chromatin, Subfamily a member 2 209049 s at ZMYND8 Zinc finger, MYND-type 23613 OO6778 O.OO1203 0.023.563 containing 8 US 2015/0292028 A1 Oct. 15, 2015 53

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 213313 at RABGAP1 RAB GTPase activating protein 1 23637 3987S3 O.OO1197 O.O235 222204 S at RRN3 RRN3 RNA polymerase I 54700 O7798 O.OO1196 O.O235 transcription factor homolog (S. cerevisiae) 203362 s at MAD2L1 MAD2 mitotic arrest deficient-like 4085 334952 O.001171 O.O2321 1 (yeast) 221264 S at TARDBP TAR DNA binding protein 2343S 148261 O.00117 O.O2321 204009 s at KRAS v-Ki-ras2 Kirsten ratsarcoma viral 3845 15051 O.OO1169 O.O2321 oncogene homolog 213416 at ITGA4 integrin, alpha 4 (antigen CD49D, 3676 S85393 0.00116 00231.83 alpha 4subunit of VLA-4 receptor) 200993 at IPO7 importin 7 10527 OS2977 O.OO1144 O.O23074 202911 at MSH6 mutS homolog 6 (E. coli) 2956 406267 O.OO114 O.O23O16 201619 at PRDX3 peroxiredoxin 3 10935 166794 O.OO1136 O.O2301 203743 s a TDG thymine-DNA glycosylase 6996 30963 O.OO113 O.O22997 212199 at MRFAP1L1 MorfA family associated protein 1- 114932 6307S7 O.OO1123 O.O22952 like 1 202164 S a CNOT8 CCR4-NOT transcription complex, 933.7 1997O4 O.OO1118 O.O22906 subunit 8 204809 at CLPX ClpX caseinolytic peptidase X 10845 O4299 O.OO1099 O.O2276 homolog (E. coli) 206542 s a SMARCA2 SWI/SNF related, matrix 6595 42069 O.OO1047 O.O22288 associated, actin dependent regulator of chromatin, Subfamily a member 2 203948 s a MPO myeloperoxidase 4353 .629289 O.OO1047 O.O22288 200927 s a RAB14 RAB14, member RAS oncogene 51552 1136O3 O.OO1045 0.022285 family 205961 s a PSIP1 PC4 and SFRS1 interacting protein 1 11168 119456 O.OO 1035, O.O22115 203139 at DAPK1 death-associated protein kinase 1 1612 135088 O.OO 1004 O.O21669 21948.5 s a PSMD10 proteasome (prosome, macropain) 5716 237831 O.OOO994 O.O21584 26S subunit, non-ATPase, 10 202169 s a AASDHPPT aminoadipate-semialdehyde 60496 491517 O.OOO983 O.O21447 dehydrogenase phosphopantetheinyl transferase 213761 a MDM1 Mdm1 nuclear protein homolog 56890 12881 O.OOO976 O.O213S (mouse) 212544 a ZNHIT3 Zinc finger, HIT-type containing 3 9326 2941.37 O.OOO971 O.O213 201368 a ZFP36L2 ZFP36 ring finger protein-like 2 678 .289879 O.OOO961 O.O21237 218882 s at WDR3 WD repeat domain 3 10885 OS9399 O.OOO955 O.O21,168 202431 s at MYC v-myc myelocytomatosis viral 4609 493528 O.OOO946 0.02101 oncogene homolog (avian) 217828 a SLTM SAFB-like, transcription modulator 79811 11835S O.OOO938 0.020912 201111 a CSE1L CSE1 chromosome segregation 1- 1434 623491 O.OOO932 O.O2O833 like (yeast) 203474 a IQGAP2 IQ motif containing GTPase 10788 614975 O.OOO922 0.020814 activating protein 2 217906 a KLHDC2 kelch domain containing 2 23588 142864 O.OOO92 O.O2O814 203531 a CUL5 cullin 5 806S O96581 O.OOO891 O.O2O435 202746 a ITM2A integral membrane protein 2A 9452 664O11 O.OOO885 O.O2O363 209421 a MSH2 mutS homolog 2, colon cancer, 4436 490121 O.OOO88 O.O2O343 nonpolyposis type 1 (E. coli) 213698 a ZMYM6NB ZMYM6 neighbor 100506144 O42591 O.OOO87 O.O2O236 218605 a TFB2M transcription factor B2, 64216 183958 O.OOO854 O.O2007 mitochondrial 201947 s at CCT2 chaperonin containing TCP1, 10576 143067 O.OOO853 O.O2007 subunit 2 (beta) 202602 s at HTATSF1 HIV-1 Tat specific factor 1 27336 187599 O.OOO849 O.O2OO15 202930 s at SUCLA2 Succinate-CoA ligase, ADP- 8803 176902 O.OOO838 O.O19818 forming, beta Subunit 201277 s at HNRNPAB heterogeneous nuclear 3182 O14906 O.OOO822 O.O19567 ribonucleoprotein A/B 208798 X at GOLGA8A golgin A8 family, member A 2301S O82102 O.OOO821 O.O19567 2024-13 s at USP1 ubiquitin specific peptidase 1 7398 360578 O.OOO8O1 O.O1926 201742 x at SRSF1 serinefarginine-rich splicing factor 1 6426 198562 0.000799 O.O1924 218014 at NUP85 nucleoporin 85 kDa 79902 18OOO4 O.OOO796 O.O19229 204240 S at SMC2 structural maintenance of 10592 4O66O1 O.OOO787 O.O1907 chromosomes 2 209337 at PSIP1 PC4 and SFRS1 interacting protein 1 11168 241851 O.OOO784 O.O19026 201273 s at SRP9 signal recognition particle 9 kDa 6,726 2O2O73 O.OOO784 O.O19026 US 2015/0292028 A1 Oct. 15, 2015 54

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adiusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 222303 at 254922 O.OOO781. O.O19002 212330 at TFDP1 transcription factor Dp-1 7027 341814 O.OOO78 O.O19002 203432 at TMPO thymopoietin 7112 O68195 O.OOO768 O.O1881 203493 s at CEP57 centrosomal protein 57 kDa 97.02 O3691 O.OOO766 O.O18788 202330 s at UNG uracil-DNA glycosylase 7374 326OO2 O.OOO761 O.O18729 209814 at ZNF330 Zinc finger protein 330 27.309 444996 O.OOO758 O.O18729 203560 at GGEH gamma-glutamyl hydrolase 8836 446967 O.OOO75 O.O18617 (conjugase, folylpolygammaglutamyl hydrolase) 209112 at CDKN1B cyclin-dependent kinase inhibitor 1027 181993 O.OOO749 O.O18617 B (p27, Kip1) 35974 at LRMP ymphoid-restricted membrane 4033 OO1783 O.OOO732 0.018537 protein 208.643 s at XRCCS X-ray repair complementing 752O O57033 O.OOO731 O.O1852S defective repair in Chinese hamster cells 5 (double-strand-break rejoining) 214651 s at HOXA9 homeobox A9 3205 466349 O.OOO687 O.O1782S 204767 s at FEN1 flap structure-specific 2237 47296 O.OOO685 O.O17799 endonuclease 1 202658 at PEX11B peroxisomal biogenesis factor 11 8799 O13624 O.OOO684 O.O17799 beta 218989 X at SLC3 OAS solute carrier family 30 (zinc 64924 O11398 O.OOO683 O.O17799 transporter), member 5 212740 at PIK3R4 phosphoinositide-3-kinase, 3O849 O16978 O.OOO678 O.O17687 regulatory Subunit 4 212378 at GART phosphoribosylglycinamide 2618 210756 O.OOO671 O.O17573 ormyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 221931 s a SEH1L SEH1-like (S. cerevisiae) 81929 151366 O.OOO671 O.O17573 201830 s a NET1 neuroepithelial cell transforming 1 10276 1933S3 O.OOO654 O.O17314 202174 s a PCM1 pericentriolar material 1 S108 19507S O.OOO641 O.O17181 202717 s a CDC16 cell division cycle 16 8881 OOO687 O.OOO632 0.017087 20472.0 s a DNAJC6 DnaJ (Hsp40) homolog, subfamily 98.29 165169 O.OOO63 O.O17071 C, member 6 2025.03 s a KIAAO101 KIAAO101 9768 410664 O.OOO627 O.O1707 212513 s a USP33 ubiquitin specific peptidase 33 23O32 3490SS O.OOO623 O.O1703 203583 at UNCSO unc-50 homolog (C. elegans) 25972 O21413 O.OOO607 O.O16773 209199 s a MEF2C myocyte enhancer factor 2C 4208 384786 O.OOO605 0.016755 203949 at MPO myeloperoxidase 4353 2.094.66 O.OOO6 O.O16728 21308.8 s a DNAJC9 DnaJ (Hsp40) homolog, subfamily 23234 16536S O.OOO6 O.O16728 C, member 9 201873 s a ABCE1 ATP-binding cassette, sub-family 6059 123959 O.OOOS98 0.016728 E (OABP), member 1 201518 at CBX1 chromobox homolog 1 10951 1182S3 O.OOOS91 O.O16699 221771 s a MPHOSPH8 M-phase phosphoprotein 8 54.737 OO3732 O.OOOS88 O.O16642 218236 s a PRKD3 protein kinase D3 23683 O39419 O.OOOS8 O.O16542 218979 at RMI1 RMI1, RecQ mediated genome 80010 O12559 O.OOOS77 O.O16542 instability 1, homolog (S. cerevisiae) 201532 at PSMA3 proteasome (prosome, macropain) S684 4.45319 O.OOOS7S O.O16531 Subunit, alpha type, 3 212653 s at EHBP1 EH domain binding protein 1 23301 O3273S O.OOOS 66 O.O16422 210338 s at HSPA8 heat shock 70 kDa protein 8 3312 S74514 O.OOOS64 O.O16422 218642 s at CHCHD7 coiled-coil-helix-coiled-coil-helix 79145 O29917 O.OOOS61 O.O16422 domain containing 7 221970 s at NOL11 nucleolar protein 11 25926 OS4307 O.OOOS6 O.O16422 202741 at PRKACB protein kinase, cAMP-dependent, 5567 O48386 O.OOOSS7 O.O16422 catalytic, beta 209905 at HOXA9 homeobox A9 3205 .24736 O.OOOSS4 O.O16422 202589 at TYMS hymidylate synthetase 7298 65426 O.OOOS48 O.O1628 200071 at SMNDC1 Survival motor neuron domain 10285 O34914 O.OOO544 OO16265 containing 1 201303 at EIF4A3 eukaryotic translation initiation 9775 17097 O.OOOS39 O.O162O6 actor 4A3 205632 s at PIPSK1B phosphatidylinositol-4-phosphate 8395 175229 O.OOOS33 O.O16113 5-kinase, type I, beta US 2015/0292028 A1 Oct. 15, 2015 55

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adiusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 21538.0 s at GGCT gamma-glutamylcyclotransferase 79017 1898.41 O.OOOS31 O.O16099 203765 at GCA grancalcin, EF-hand calcium 2S801 O460O3 O.OOOS3 O.O16099 binding protein 220865 s at PDSS1 prenyl (decaprenyl) diphosphate 23590 O7448S O.OOOS25 O.O16054 synthase, Subunit 1 202446 s at PLSCR1 phospholipid scramblase 1 5359 327281 O.OOOS24 O.O16OS 200970 S. at SERP1 stress-associated endoplasmic 27230 O75633 O.OOOS12 OO15879 reticulum protein 1 216920 S at TARP TCRgamma alternate reading 445347 4851S6 O.OOO48S OO15374 rame protein 212693 a MDN1 MDN1, midasin homolog (yeast) 23195 O87SO1 O.OOO484 OO15374 213359 a HNRNPD heterogeneous nuclear 31.84 O9076 O.OOO478 O.O15321 ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa) 206102 a GINS1 GINS complex subunit 1 (Psf1 9837 S7510S 0.000474 OO15221 homolog) 202950 a CRYZ crystallin, Zeta (quinone reductase) 1429 315997 O.OOO472 OO15221 202395 a NSF N-ethylmaleimide-sensitive factor 490S O21689 0.000471 OO15221 220615 s at FAR2 atty acyl CoA reductase 2 55711 OSO613 O.OOO469 O.O15212 211700 s at TRO trophinin 7216 O68948 O.OOO46S OO15212 206095 S. at SRSF10 serinefarginine-rich splicing factor 10 10772 179453 O.OOO464 OO15212 208.694 a PRKDC protein kinase, DNA-activated, 5591 O97773 0.000458 OO15075 catalytic polypeptide 214141 X at SRSF7 serinefarginine-rich splicing factor 7 6432 .331333 O.OOO439 O.O14608 203517 a MTX2 metaxin 2 10651 225852 O.OOO439 O.O14608 205857 a SLC18A2 solute carrier family 18 (vesicular 6571 O6SO76 O.OOO431 O.O14432 monoamine), member 2 203856 a WRK1 vaccinia related kinase 1 7443 237886 O.OOO43 O.O14432 203372 s at SOCS2 Suppressor of cytokine signaling 2 883S O9312 O.OOO42 O.014308 221652 s at ASUN asunder, spermatogenesis regulator 55726 363988 O.OOO412 OO14181 212690 a DDHD2 DDHD domain containing 2 23259 2363.77 O.OOO412 O.O14181 208808 s at HMGB2 high mobility group box 2 3148 445O21 O.OOO4O2 OO14069 212896 a SKIV2L2 Superkiller viralicidic activity 2- 23517 O982S3 O.OOO395 O.O1390S like 2 (S. cerevisiae) 221622 S at TMEM126B transmembrane protein 126B 55863 103945 O.OOO394 O.O13871 2183.03 X at KRCC1 lysine-rich coiled-coil 1 51315 OS4683 O.OOO393 O.O13857 201479 a DKC1 dyskeratosis congenita 1, dyskerin 1736 261576 O.OOO39 O.O13806 203156 a AKAP11 A kinase (PRKA) anchor protein 11 11215 181561 O.OOO384 O.O13683 201756 a RPA2 replication protein A2, 32 kDa 6118 O3971S O.OOO379 O.O13533 209903 s at ATR ataxiatelangiectasia and Rad3 545 O74716 O.OOO376 O.O13488 related 206976 s at HSPH1 heat shock 105 kDa 110 kDa protein 1 10808 2S4331 O.OOO376 O.O13488 219454 a EGFL6 EGF-like-domain, multiple 6 25975 3O877 O.OOO367 O.O13369 211144 X at TARP TCRgamma alternate reading 445347 365.625 O.OOO366 O.O13369 rame protein 205133 s at HSPE1 heat shock 10 kDa protein 1 3336 O81382 O.OOO36S O.O13369 (chaperonin 10) 202429 s at PPP3CA protein phosphatase 3, catalytic 5530 OS6462 O.OOO363 O.O13369 Subunit, alpha isozyme 210038 a PRKCQ protein kinase C, theta 5588 O46788 O.OOO358 O.O13295 205668 a LY75 ymphocyte antigen 75 406S O75449 O.OOO3S7 O.O13295 201515 s at TSN translin 7247 3O897 O.OOO349 O.O1317 221825 a. ANGEL2 angelhomolog 2 (Drosophila) 90806 O10739 O.OOO347 O.O13115 212168 a RBM12 RNA binding motif protein 12 10137 209363 O.OOO346 O.O13115 201555 a. MCM3 minichromosome maintenance 4172 OS7831 O.OOO343 O.O13089 complex component 3 208766 s at HNRNPR heterogeneous nuclear 10236 O4567 O.OOO341 O.O13032 ribonucleoprotein R 213294 a EIF2AK2 eukaryotic translation initiation S610 224,521 O.OOO339 O.O12995 actor 2-alpha kinase 2 217956 S at ENOPEH1 enolase-phosphatase 1 S8478 13057 O.OOO325 O.O12646 212211 a ANKRD17 ankyrin repeat domain 17 26057 O6166 O.OOO321 OO12541 218396 a VPS13C vacuolar protein sorting 13 54832 169643 O.OOO315 O.O12391 homolog C (S. cerevisiae) 202020 S at LANCL1 Lanc lantibiotic synthetase 10314 265915 O.OOO314 O.O12374 component C-like 1 (bacterial) 213304 a FAM179B amily with sequence similarity 23116 O5681 O.OOO311 O.O1229 79, member B US 2015/0292028 A1 Oct. 15, 2015 56

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adiusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 214093 s at FUBP1 ar upstream element (FUSE) 888O 19343 O.OOO311 O.O1229 binding protein 1 221761 at ADSS adenyloSuccinate synthase 159 O10834 O.OOO3O8 O.O12252 201386 s at DHX15 DEAH (Asp-Glu-Ala-His) box 1665 6SO845 O.OOO306 0.012244 polypeptide 15 221505 at ANP32E acidic (leucine-rich) nuclear 81611 183054 O.OOO3O3 O.O12139 phosphoprotein 32 family, member E 218127 at NFYB nuclear transcription factorY., beta 48O1 104339 O.OOO29 O.O11904 219303 at RNF219 ring finger protein 219 79596 119496 O.OOO279 0.01.1636 218133 s at NIF3L1 NIF3 NGG1 interacting factor 3- 60491 192936 O.OOO269 O.O11358 ike 1 (S. cerevisiae) 203428 s at ASF1A ASF1 anti-silencing function 1 2S842 128273 O.OOO268 0.011351 homolog A (S. cerevisiae) 219037 a RRP15 ribosomal RNA processing 15 S1018 OS7006 O.OOO267 0.011351 homolog (S. cerevisiae) 218889 a NOC3L nucleolar complex associated 3 64318. 366O19 O.OOO262 0.011306 homolog (S. cerevisiae) 201413 a HSD17B4 hydroxysteroid (17-beta) 3295 14O766 O.OOO2SS O.O11131 dehydrogenase 4 212526 a SPG20 spastic paraplegia 20 (Troyer 23111 O26783 O.OOO2S1 O.O1101 syndrome) 208021 s at RFC1 replication factor C (activator 1) 1, 5981 O39 138 O.OOO2S O.010974 145 kDa 213253 a SMC2 structural maintenance of 10592 O34612 O.OOO246 OO10839 chromosomes 2 218713 a NARG2 NMDA receptor regulated 2 79664 O1OO22 O.OOO244 OO10824 209092 s at GLOD4 glyoxalase domain containing 4 51031 45226S O.OOO233 O.O10534 208.634 S. at MACF1 microtubule-actin crosslinking 234.99 OS3724 O.OOO229 O.O1OSO3 factor 1 202854 a HPRT1 hypoxanthine 3251 377438 O.OOO227 O.O10458 phosphoribosyltransferase 1 202345 s at FABP5 fatty acid binding protein 5 2171 412774 O.OOO223 O.O10332 (psoriasis-associated) 217832 a SYNCRIP synaptotagmin binding, 104.92 449861 O.OOO222 O.O1 O305 cytoplasmic RNA interacting protein 220742 s a NGLY1 N-glycanase 1 55768 OSS086 O.OOO22 O.O10287 20231.8 s a SENP6 SUMO1/sentrin specific peptidase 26OS4 O218O2 O.OOO214 O.O1O126 6 202892 at CDC23 cell division cycle 23 8697 142138 0.000212 OO1O103 201964 at SETX Senataxin 23O64 25.3372 O.OOO211 O.O101.03 20905.6 s a CDCSL cell division cycle 5-like 988 214199 O.OOO2O8 O.O10O28 214047 s a MBD4 methyl-CpG binding domain 893O O11612 O.OOO2O8 O.O10O28 protein 4 201603 at PPP1R12A protein phosphatase 1, regulatory 4659 O89584 O.OOO2O4 O.OO993 subunit 12A 208716 s a TMCO1 transmembrane and coiled-coil S4499 113356 O.OOO2O2 O.OO9867 domains 1 218710 at TTC27 etratricopeptide repeat domain 27 55622 O90229 O.OOO2O1 O.OO9867 216221 S a PUM2 pumilio homolog 2 (Drosophila) 23369 1OSS18 O.OOO2O1 O.OO9867 202107 s a MCM2 minichromosome maintenance 4171 SO6995 O.OOO2O1 O.OO9867 complex component 2 214453 s a IFI44 interferon-induced protein 44 10561 .7190OS O.OOO2 O.OO9867 208775 at XPO1 exportin 1 (CRM1 homolog, yeast) 7514 473631 O.OOO198 O.OO9851 211929 at HNRNPA3 heterogeneous nuclear 220988 2S7569 O.OOO198 O.OO9839 ribonucleoprotein A3 2124.06 s a PCMTD2 protein-L-isoaspartate (D- 55.251 452466 O.OOO196 O.OO9776 aspartate) O-methyltransferase domain containing 2 204354 at POT1 protection of telomeres 1 25913 126965 O.OOO194 O.OO9746 218323 at RHOT1 ras homolog family member T1 55.288 OO782S O.OOO186 O.OO9582 200994 at IPO7 importin 7 10527 OO1576 O.OOO186 O.OO9582 201773 at ADNP activity-dependent neuroprotector 23394 38.8566 0.000183 O.OO9532 homeobox 202060 at CTR9 Ctr9, Paf1/RNA polymerase II 9646 453,326 O.OOO18 O.OO945 complex component, homolog (S. cerevisiae) 209218 at SQLE squalene epoxidase 6713 758.399 O.OOO177 O.OO9364 209580 S. at MBD4 methyl-CpG binding domain 893O 1605.08 O.OOO174 O.OO9336 protein 4 US 2015/0292028 A1 Oct. 15, 2015 57

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 202633 a TOPBP1 opoisomerase (DNA) II binding 11073 197566 O.OOO173 O.OO9336 protein 1 213106 a ATP8A1 ATPase, aminophospholipid 10396 20933 O.OOO168 OOO9246 transporter (APLT), class I, type 8A, member 1 212058 a U2SURP U2 SnRNP-associated SURP 23350 3988.97 O.OOO168 O.OO9246 domain containing 212408 a TOR1AIP1 orsin A interacting protein 1 26092 153349 O.OOO163 O.OO9063 203067 a PDHX pyruvate dehydrogenase complex, 8OSO O24437 O.OOO16 O.OO9007 component X 202184 S at NUP133 nucleoporin 133 kDa 55746 163427 O.OOO156 O.OO8893 204749 a NAP1L3 nucleosome assembly protein 1- 4675 756,608 O.OOO149 O.OO8702 ike 3 212621 a TMEM194A transmembrane protein 194A 23.306 11723S O.OOO148 O.OO8702 200723 s at CAPRIN1 cell cycle associated protein 1 4O76 36073S O.OOO14S O.OO8669 219008 a C2OrfA3 chromosome 2 open reading frame 43 60526 160627 O.OOO144 O.OO8657 202220 a KIAAO907 KIAAO907 22889 S427OS O.OOO144 O.OO8657 211987 a TOP2B opoisomerase (DNA) II beta 7155 O23919 O.OOO143 O.OO8633 80 kDa 202441 a ERLIN1 ER lipid raft associated 1 10613 221226 O.OOO141 O.OO8533 218171 a VPS4B vacuolar protein sorting 4 homolog 95.25 O99892 O.OOO138 O.OO84O2 B (S. cerevisiae) 20997.4 S at BUB3 BUB3 mitotic checkpoint protein 91.84 1771.94 O.OOO136 O.OO8296 219412 a RAB38 RAB38, member RAS oncogene 23682 455958 O.OOO133 O.OO8144 amily 205474 a CRLF3 cytokine receptor-like factor 3 51379 O12784 O.OOO132 OOO8144 222201 S. at CASP8AP2 caspase 8 associated protein 2 9994 164562 O.OOO13 O.OO8097 208838 a CAND1 cullin-associated and neddylation- 55832 O71114 O.OOO128 O.OO7998 dissociated 1 204521 a FAM216A family with sequence similarity 299.02 272748 O.OOO124 O.OO7921 216, member A 213506 a F2RL1 coagulation factor II (thrombin) 21SO 465.639 O.OOO123 O.OO7906 receptor-like 1 214988 s at SON SON DNA binding protein 6651 293714 O.OOO12 O.OO78O3 21800S a ZNF22 Zinc finger protein 22 7570 363822 O.OOO117 O.OO7673 202798 a SEC24B SEC24 family, member B 10427 2173.71 O.OOO115 O.OO7613 (S. cerevisiae) 203519 s at UPF2 UPF2 regulator of nonsense 26019 .021857 O.OOO114 O.OO7613 transcripts homolog (yeast) 213227 a PGRMC2 progesterone receptor membrane 104.24 O88092 O.OOO114 O.OO7613 component 2 212918 a RECQL RecQ protein-like (DNA helicase 5965 204724 O.OOO111 O.OO7613 Q1-like) 218842 a. RPAP3 RNA polymerase II associated 796.57 OO7012 O.OOO109 OOO7613 protein 3 218370 s at S1OOPBP S100P binding protein 64766 O40583 O.OOO107 O.OO76O1 209043 a PAPSS1 3'-phosphoadenosine 5'- 9061 .266585 O.OOO106 0.007558 phosphosulfate synthase 1 213374 x at HIBCEH 3-hydroxyisobutyryl-CoA 26275 372S7 O.OOO104 O.OO745 hydrolase 201202 a PCNA proliferating cell nuclear antigen S111 874S41 O.OOO1 O2 O.OO739 208925 a. CLDND1 claudin domain containing 1 S6650 O3S219 O.OOO101 O.OO7343 208986 a TCF12 transcription factor 12 6938 13518, 9.8OE-05 O.OO719 202706 s at UMPS uridine monophosphate synthetase 7372 .021819 9.71E-OS O.OO7147 222209 s at TMEM13S transmembrane protein 135 6SO84 .139737 9.39E-05 O.OO7017 202956 a ARFGEF1 ADP-ribosylation factor guanine 10565 O48.197 9.2SE-OS O.OO6996 nucleotide-exchange factor 1 (brefeldin A-inhibited) 208877 a PAK2 p21 protein (Cdc42/Rac)-activated SO62 O95691 9.02E-OS O.OO6891 kinase 2 212454 x at HNRPDL heterogeneous nuclear 998.7 O12227 8.99E-05 O.OO6891 ribonucleoprotein D-like 201832 s at USO1 USO1 vesicle transport factor 8615 196724 8.58E-OS O.OO6807 218104 at TEX10 estis expressed 10 S4881 O63963 8.48E-OS O.OO6794 209585 S at MINPP1 multiple inositol-polyphosphate 9562 S483 8.34E-OS O.OO6749 phosphatase 1 204160 s at ENPP4 ectonucleotide 22875 O23317 8.1SE-OS O.OO6724 pyrophosphatase/phosphodiesterase 4 (putative) US 2015/0292028 A1 Oct. 15, 2015 58

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 201872 s at ABCE1 ATP-binding cassette, sub-family 6059 OS63O2 7.77E-OS O.OO6497 E (OABP), member 1 203608 at ALDHSA1 aldehyde dehydrogenase 5 family, 7915 S67849 7.76E-OS O.OO6497 member A1 201177 s at UBA2 ubiquitin-like modifier activating 10054 O11771 7.72E-OS O.OO6497 enzyme 2 201663 s at SMC4 structural maintenance of 10051 397O17 7.58E-OS O.OO6462 chromosomes 4 206478 at KIAAO125 KIAAO125 98.34 .699586 7.39E-05 O.OO6369 209259 s at SMC3 structural maintenance of 9126 S36331 7.36E-OS O.OO6369 chromosomes 3 201491 at AHSA1 AHA1, activator of heat shock 10598 O17409 7.09E-05 O.OO6348 90 kDa protein ATPase homolog 1 (yeast) 200050 at ZNF146 Zinc finger protein 146 7705 112747 6.82E-OS O.OO6137 212798 s at ANKMY2 ankyrin repeat and MYND domain 57037 .282009 6.82E-OS O.OO6137 containing 2 200597 at EIF3A eukaryotic translation initiation 8661 15333 6.58E-OS O.OO6137 factor 3, subunit A 220416 at ATP8B4 ATPase, class I, type 8B, member 4 798.95 3.19886 6.56E-OS O.OO6137 218352 at RCBTB1 regulator of chromosome 55213 4O1043 6.56E-OS O.OO6137 condensation (RCC1) and BTB (POZ) domain containing protein 1 208954 s at LARP4B La ribonucleoprotein domain 23185 O3S21S 6.5SE-OS O.OO6137 family, member 4B 200754 x at SRSF2 serinefarginine-rich splicing factor 2 6427 189498 6.53E-OS O.OO6137 213094 at GPR126 G protein-coupled receptor 126 57211 723615 6.36E-OS O.OO6137 201726 at ELAVL1 ELAV (embryonic lethal, 1994 21 OO67 6.33E-OS O.OO6137 abnormal vision, Drosophila)-like 1 (Huantigen R) 202797 at SACM1L, SAC1 suppressor of actin 22908 O68996 6.19E-05 O.OO6092 mutations 1-like (yeast) 218932 at ZNHIT6 Zinc finger, HIT-type containing 6 S468O S33903 6.11E-OS O.OO6036 205909 at POLE2 polymerase (DNA directed), 5427 13581 6.1 OE-05 O.OO6036 epsilon 2, accessory subunit 201493 s at PUM2 pumilio homolog 2 (Drosophila) 23369 O4SO91 6.09E-05 O.OO6036 203605 at SRPS4 signal recognition particle 54 kDa 6729 336SO1 6.O8E-OS O.OO6036 213737 X at GOLGA8H golgin A8 family, member H 728498 276,782 S.98E-OS O.OO6036 205848 at GAS2 growth arrest-specific 2 262O .882946 S-69E-05 O.OOS965 207483 s at CAND1 cullin-associated and neddylation- 55832 101.083 S.6OE-05 O.OOS911 dissociated 1 219497 s at BCL11A B-cell CLL/lymphoma 11A (zinc 53335 OS1534 S.48E-OS O.OOS86 finger protein) 201664 at SMC4 structural maintenance of 10051 810802 S-39E-05 O.OOS828 chromosomes 4 209362 at MED21 mediator complex subunit 21 9412 3S1739 S-36E-OS O.OOS828 201458 s at BUB3 BUB3 mitotic checkpoint protein 91.84 194O27 S.3OE-05 O.OOS828 2038.04 s at LUCTL3 LUC7-like 3 (S. cerevisiae) 51747 117694 S.28E-OS O.OOS828 206316 s at KNTC1 kinetochore associated 1 9735 132251 S.1 OE-05 O.OOS79 20403.0 s at IQCJ- IQCJ-SCHIP1 readthrough 100505385 123787 S.O4E-OS O.OOS746 SCHIP1 218437 s at LZTFL1 leucine Zipper transcription factor- 54585 226372 4.98E-OS O.OOS732 like 1 2025.02 at ACADM acyl-CoA dehydrogenase, C-4 to 34 O24159 4.94E-OS O.OOS732 C-12 straight chain 204256 at ELOVL6 ELOVL fatty acid elongase 6 79071 S33869 4.93E-OS O.OOS732 215165 X at UMPS uridine monophosphate synthetase 7372 104322 4.89E-05 O.OOS732 217814 at CCDC47 coiled-coil domain containing 47 57003 43O862 4.63E-OS O.OOS622 212944 at SLC5A3 solute carrier family 5 6526 422266 4.48E-05 OOOS619 (sodium/myo-inositol cotransporter), member 3 2088.61 s at ATRX alpha thalassemiamental S46 174112 4-47E-OS O.OOS619 retardation syndrome X-linked 208848 at ADHS alcohol dehydrogenase 5 (class 128 3SOO61 4.32E-OS O.OOSS87 III), chi polypeptide 2098.13 x at TARP TCRgamma alternate reading 445347 675539 4.27E-OS O.OOSSS6 frame protein 13 213005 s at KANK1 KN motif and ankyrin repeat 23 189 42O28S 2.37E-OS O.OO4281 domains 1 US 2015/0292028 A1 Oct. 15, 2015 59

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 201086 X at SON SON DNA binding protein 6651 3O3827 2.37E-OS O.OO4281 205885 s at ITGA4 integrin, alpha 4 (antigen CD49D, 3676 152728 2.32E-OS O.OO4281 alpha 4subunit of VLA-4 receptor) 218957 s at PAAF1 proteasomal ATPase-associated 80227 O82321 2.32E-OS O.OO4281 factor 1 2094.09 a GRB10 growth factor receptor-bound 2887 411903 2.31E-05 OOO4281 protein 10 218428 s at REV1 REV1, polymerase (DNA directed) 51455 O14141 23 OE-05 OOO4281 212982 a ZDHHC17 Zinc finger, DHHC-type containing 17 23390 24448 2.23E-05 OOO4281 206854 S at MAP3K7 mitogen-activated protein kinase 6885 362632 2.14E-05 OOO4215 kinase kinase 7 213164 a SLC5A3 solute carrier family 5 6526 12656 2.14E-05 OOO4215 (sodium/myo-inositol cotransporter), member 3 209662 a CETN3 centrin, EF-hand protein, 3 1070 780447 2.13E-OS O.OO4215 213092 X at DNAJC9 DnaJ (Hsp40) homolog, subfamily 23234 281922 2.11E-05 OOO4215 C, member 9 219130 a. TRMT13 tRNA methyltransferase 13 54482 OS4729 2.09E-05 O.OO4215 homolog (S. cerevisiae) 218096 a AGPATS 1-acylglycerol-3-phosphate O- 55326 O46,759 2.OSE-OS O.OO4215 acyltransferase 5 200783 s at STMN1 stathmin 1 3925 O21197 199E-05 O.OO41.83 202763 a CASP3 caspase 3, apoptosis-related 836 113632 1.97E-OS O.OO4167 cysteine peptidase 206874 S at SLK STE20-like kinase 97.48 SO8576 1.9SE-OS O.OO4.162 215806 x at TARP TCRgamma alternate reading 445347 6996O1 94E-05 O.OO4.162 frame protein 218139 s at APSM1 adaptor-related protein complex 5, 55745 .213838 1.93E-OS O.OO4.162 mu 1 subunit 212731 at ANKRD46 ankyrin repeat domain 46 157567 139853 1.87E-OS O.OO4117 217317 s at HERC2P2 hect domain and RLD 2 40O322 O63595 1.62E-OS O.OO3764 pseudogene 2 212176 at PNISR PNN-interacting serinefarginine- 25957 O103 .62E-OS O.OO3764 rich protein 218313 s at GALNT7 UDP-N-acetyl-alpha-D- S1809 SO7414 1.62E-OS O.OO3764 galactosamine:polypeptide N acetylgalactosaminyltransferase 7 (GalNAc-T7) 219083 at SHQ1 SHQ1, H/ACA ribonucleoprotein SS164 675814 1.53E-OS O.OO3721 assembly factor 203302 at DCK deoxycytidine kinase 1633 .276653 1.43E-OS O.OO3616 218515 at PAXBP1 PAX3 and PAX7 binding protein 1 94104 243.818 143E-05 OOO3616 213391 at DPY19L4 dpy-19-like 4 (C. elegans) 28.6148 187053 1.29E-05 O.OO3444 202907 s at NBN nibrin 4683 588244 1.26E-05 OOO3444 217886 at EPS15 epidermal growth factor receptor 2060 345925 23E-05 O.OO3411 pathway substrate 15 218622 at NUP37 nucleoporin 37 kDa 79023 261215 1.22E-05 OOO3411 208654 S at CD164 CD164 molecule, sialomucin 8763 456204 121E-05 OOO3411 219035 s at RNF34 ring finger protein 34, E3 ubiquitin 801.96 187459 11 SE-OS O.OO3369 protein ligase 22004.4 x at LUCTL3 LUC7-like 3 (S. cerevisiae) 51747 199028 1.15E-05 O.OO3369 218768 a NUP107 nucleoporin 107 kDa 57122 457543 1.14E-OS O.OO3369 2084.05 s at CD164 CD164 molecule, sialomucin 8763 103873 1.11E-OS O.OO3369 212675 s at CEP68 centrosomal protein 68 kDa 23177 33608 11E-OS O.OO3369 209200 a MEF2C myocyte enhancer factor 2C 4208 964319 1OE-05 O.OO3369 209476 a TMX1 thioredoxin-related transmembrane 81542 209672 1.07E-OS O.OO3369 protein 1 212474 a AVLS) AVL9 homolog (S. cerevisiase) 2308O 1284O1 9.17E-O6 OOO3236 203306 s at SLC3SA1 solute carrier family 35 (CMP- 10559 184632 9.1OE-06 OOO3236 sialic acid transporter), member A1 219405 a. TRIM68 tripartite motif containing 68 55128 O92848 8.27E-O6 O.OO3067 217954 s at PHF3 PHD finger protein 3 23469 O96771 8.OOE-06 O.OO3O17 2014.48 a TLA1 TIA1 cytotoxic granule-associated 7072 3648.27 7.61E-O6 O.OO2919 RNA binding protein 20291.8 s at MOB4 MOB family member 4, phocein 2S843 281577 7.6OE-06 O.OO2919 201503 a G3BP1 GTPase activating protein (SH3 101.46 400871 7.4OE-06 O.OO2919 domain) binding protein 1 221606 s at HMGNS high mobility group nucleosome 79366 O41186 7.16E-O6 OOO2919 binding domain 5 US 2015/0292028 A1 Oct. 15, 2015 60

TABLE 8-continued Genes Differently Regulated in the Indolent Group as Compared to the Controls Symbol Entrez (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus Adjusted ProbesetID Marl3) Mar13) Mar-13) Log2(FC) P-Value P-Value 212179 a PNISR PNN-interacting serinefarginine- 25957 659487 7.06E-O6 O.OO2919 rich protein 207943 X at PLAGL1 pleiomorphic adenoma gene-like 1 5325 O2225 6.8OE-06 OOO2919 219002 a FASTKD1 FAST kinase domains 1 796.75 139996 6.78E-O6 O.OO2919 219649 a ALG6 ALG6, alpha-1,3- 29929 3.187OS 6.36E-O6 O.OO2919 glucosyltransferase 218593 a RBM28 RNA binding motif protein 28 551.31 O95331 6.OOE-06 O.OO2867 218152 a HMG20A high mobility group 20 A 10363 329726 S.S2E-06 0.002834 218108 a UBR7 ubiquitin protein ligase E3 55148 468044 4.88E-O6 OOO2649 component n-recognin 7 (putative) 212959 s a GNPTAB N-acetylglucosamine-1-phosphate 79158 108946 4.43E-O6 OOO2528 transferase, alpha and beta Subunits 213653 a METTL3 methyltransferase like 3 56339 13S123 4.23E-O6 O.OO2S28 201218 a CTBP2 C-terminal binding protein 2 1488 622964 4.OOE-06 OOO2528 202520 s a MILE1 mutL homolog 1, colon cancer, 4292 112927 3.95E-06 O.OO2S28 nonpolyposis type 2 (E. coli) 209.022 a. STAG2 stromal antigen 2 10735 14.9995 3.82E-O6 O.OO2S28 218343 s a GTF3C3 general transcription factor IIIC, 9330 144191 3.71E-O6 OOO2528 polypeptide 3, 102 kDa 219960 S a UCHLS ubiquitin carboxyl-terminal 51377 108112 364E-O6 OOO2528 hydrolase L5 209175 at SEC23IP SEC23 interacting protein 11196 2SS797 3.63E-O6 O.OO2S28 218170 at SOC1 isochorismatase domain containing 1 51015 243O4 3.49E-06 OOO2528 209265 s a METTL3 methyltransferase like 3 56339 227.046 3.29E-06 O.OO2S28 222127 s a EXOC1 exocyst complex component 1 55763 394408 2.86E-O6 OOO2528 207002 s a PLAGL1 pleiomorphic adenoma gene-like 1 5325 171723 249E-06 O.OO2309 204168 at MGST2 microsomal glutathione S- 4258 O37395 1.79E-06 O.OO1991 transferase 2 205609 at ANGPT1 angiopoietin 1 284 S47029 1.71E-O6 O.OO1991 209537 at EXTL2 exostosin-like glycosyltransferase 2 2135 O5732 7.39E-07 O.OO1096 209748 at SPAST spastin 6683 O96487 6.6OE-07 O.OO1049 218397 at EANCL Fanconi anemia, complementation 55120 .8897S7 4.53E-O7 O.OOO871 group L. 210621 s at RASA1 RAS p21 protein activator 5921 39113 3.67E-O7 O.OOO871 (GTPase activating protein) 1 201687 s at APIS apoptosis inhibitor 5 8539 OSS434 1.84E-O7 O.OOO682 212828 at SYNJ2 synaptoanin 2 8871 111098. 184E-O7 OOOO682 209007 s at C1orf63 chromosome 1 open reading frame 63 57035 O46263 8.11E-08 OOOO6O1 218361 at GOLPH3L golgi phosphoprotein 3-like SS2O4 174O16 S.59E-08 OOOO6O1 219913 s at CRNKL1 crooked neck pre-mRNA splicing S1340 4684O7 217E-08 OOOO482 factor-like 1 (Drosophila)

TABLE 9 Genes Differently Regulated in the Aggressive Group as Compared to the Controls

Entrez Symbol (Na32 GeneD COSCSUS (consensus Adjusted Probeset ID Marl3) Gene Title (Na32 consensus Marl3) Mar-13) Log2 (FC) P-Value P-Value 209763 at CHRDL1 chordin-like 1 91.851 -1.17606 5.21E-09 6.67E-OS 210487 at DNTT deoxynucleotidyltransferase, terminal 1791 -191383 6.OOE-09 6.67E-OS 205933 at SETBP1 SET binding protein 1 26040 -1.1773 1.S1E-08 O.OOO112 202723 s at FOXO1 forkhead box O1 2308 -1102O1 4 34E-O6 O.O24108 201324 at EMP1 epithelial membrane protein 1 2012 -1.73635 6.04E-O6 O.O268O2 201325 S. at EMP1 epithelial membrane protein 1 2012 -1.00997 1.48E-OS O.O2992S 209398 at HIST1H1C histone cluster 1, H1c 3006 -2.26773 3.33E-OS 0.061697 212827 at IGHM immunoglobulin heavy constant mu 3507 -162695 O.OOO114 0.134692 206385 S at ANK3 ankyrin 3, node of Ranvier (ankyrin G) 288 -1.01371 O.OOO117 O.134692 209183 s at C10orf10 chromosome 10 open reading frame 10 11067 -1.07496 O.OOO131 O.1390S6 20937.4 S at IGHM immunoglobulin heavy constant mu 3507 -1.78678 O.OOO238 0.212O2 204430 s at SLC2A5 solute carrier family 2 (facilitated 6518 -1.13053 O.OOO26 O.213741 glucosef fructose transporter), member 5 200872 at S100A10 S100 calcium binding protein A10 6281 -147658 O.OOO279 0.215629 209069 s at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.18661 O.OOO318 O.221129 US 2015/0292028 A1 Oct. 15, 2015 61

TABLE 9-continued Genes Differently Regulated in the Aggressive Group as Compared to the Controls

Entrez Symbol (Na32 GeneD COSCSUS (consensus Adjusted Probeset ID Marl3) Gene Title (Na32 consensus Marl3) Mar-13) Log2 (FC) P-Value P-Value 210592 S at SAT1 spermidine?spermine N1- 63O3 -1.08O3S O.OOO376 O.227751 acetyltransferase 1 207111 at EMR1 egf-like module containing, mucin-like, 2015 -1.08619 O.OOO4O1 O.227751 hormone receptor-like 1 204304 S at PROM1 prominin 1 8842 - 182999 O.OOO42 (0.227751 205984 at CRHBP corticotropin releasing hormone binding 1393 -1.68SS9 O.OOO482 0.239161 protein 218280 x at HIST2H2A A4 histone cluster 2, H2aa4 723790 -2.047SS O.OOO661 O.271413 211997 X at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.22595 O.OOO753 0.293.064 211998 at H3F3B H3 histone, family 3B (H3.3B) 3021 -1.37161 O.OO1101 O.376554 214290 s. at HIST2H2A A4 histone cluster 2, H2aa4 723790 -2.1OO63 O.OO1825 0.399.532 202888. S. at ANPEP alanyl (membrane) aminopeptidase 290 -1.09.433 O.OO1827 0.399.532 210785 s at THEMIS2 thymocyte selection associated family 9473 -1.4O909 O.OO1958 0.412534 member 2 2054.02 X at PRSS2 protease, serine, 2 (trypsin 2) S645 - 1.OS383 O.OO2OO1 O.412534 220990 S. at MIR21 microRNA 21 4O6991 -11666.2, O.OO2O23 O.412534 201369 S at ZFP36L2 ZFP36 ring finger protein-like 2 678 - 142932 O.OO2729 O4SO281 207571 x at THEMIS2 thymocyte selection associated family 9473 -1.3478 O.OO28 O4SO 281 member 2 212543 a AIM1 absent in melanoma 1 2O2 -1.12719 O.OO2817 O4SO 281 204698 a SG20 interferon stimulated exonuclease gene 3669 -1.19993 O.OO2841 O.45O281 20 kDa 204872 a TLE4 transducin-like enhancer of split 4 7091 -1.08661 O.OO4743 O.S16178 (E(sp1) homolog, Drosophila) 211597 s at HOPX HOP homeobox 84525 - 1.35699 O.OO4787 O.S16178 220377 a KIAAO125 KIAAO125 9834 -1.1578S O.OO4957 O.S16178 20270.8 s at HIST2H2BE histone cluster 2, H2be 8349 -1.73994 O.OOSO1 O.S16178 222258 s at SH3BP4 SH3-domain binding protein 4 23677 -1.25738 O.OO6817 O.S49162 202748 a GBP2 guanylate binding protein 2, interferon- 2634 -147788 O.OO7224 O.SS7788 inducible 222067 x at HIST1H2BD histone cluster 1, H2bd 3017 - 1.3732 O.OO7682 0.562835 204805 s at H1FX H1 histone family, member X 8971 -1.45O2S O.O12357 O.S87079 214472 a. HIST1H2AD histone cluster 1, H2ad 3013 -1.33457 O.O16968 O.609599 215071 S. at HIST1H2AC histone cluster 1, H2ac 8334 - 159794 O.O2O339 O.6316O1 204057 a RF8 interferon regulatory factor 8 3394 -101328 O.O21285 O.6316O1 221760 a MAN1A1 mannosidase, alpha, class 1A, member 1 4121 -1.18372 O.02233 0.632753 208490 x at HIST1H2BF histone cluster 1, H2bf 8343 - 1.14111 O.O27318 O.639S45 221556 a CDC14B cell division cycle 14B 8555 - 126289 O.028048 0.64494 210387 a HIST1H2BG histone cluster 1, H2bg 83.39 -1.14146 (O.O2951 O.65.1733 201416 a SOX4 SRY (sex determining region Y)-box 4 6659 -1.05187 O.O32258 0.65293 208579 x at H2BFS H2B histone family, member S S4145 - 1.30549 O.O3SSS1 O.658.786 (pseudogene) 208.527 x at HIST1H2BE histone cluster 1, H2be 8344 -105374 O.O.35992 O.658.786 203708 a PDE4B phosphodiesterase 4B, cAMP-specific S142 -1.26501 O.O39076 O.662929 212488 a COLSA1 collagen, type V, alpha 1 1289 -1.O1422 O.O41826 O.666611 203140 a BCL6 B-cell CLL/lymphoma 6 604 -1.OO963 0.04395 O.666724 208546 X at HIST1H2BH histone cluster 1, H2bh 8345 - 1.02623 O.O48771 0.677SO6 214455 a. HIST1H2BC histone cluster 1, H2bc 8347 - 1.16847 O.OS1456 0.68O853 218999 a TMEM140 transmembrane protein 140 SS281 - 1.01862 O.OS3069 O.682.752 208018 S at HCK hemopoietic cell kinase 3OSS -1.13981 O.OS449 O.6841.83 204897 a PTGER4 prostaglandin E receptor 4 (Subtype 5734 -1.13843 O.OS8834 O.692792 EP4) 201565 s at D2 inhibitor of DNA binding 2, dominant 3398 - 1.33S13 O.O6594 O.694O22 negative helix-loop-helix protein 212587 s at PTPRC protein tyrosine phosphatase, receptor S788 -1.101.26 O.O80672 0.719636 type, C 200897 s at PALLD palladin, cytoskeletal associated protein 23022 -1.2408S O.O85951 O.722.194 208891 at DUSP6 dual specificity phosphatase 6 1848 -1.07107 0.098612 O.73O122 202391 at BASP1 brain abundant, membrane attached 10409 -11892 O.O99272 0.73O445 signal protein 1 201743 at CD14 CD14 molecule 929 -1.11579 0.106127 0.731069 221841 s at KLF4 Kruppel-like factor 4 (gut) 93.14 -1.2O574 0.106845 0.731355 206110 at HIST1H3H histone cluster 1, H3h 8357 - 1.19698 0.116318 O.738259 213975 s at LYZ ysozyme 4O69 -1.22513 O.117821 O.7386.67 218.723 s at RGCC regulator of cell cycle 28984 -1.017SS O.173123 O.764957 202917 s at S100A8 S100 calcium binding protein A8 6279 -101114 O.365.329 O.843.162 209774 x at CXCL2 chemokine (C-X-C motif) ligand 2 2920 127083 0.184971 O.77OSO4 20648.8 s at CD36 CD36 molecule (thrombospondin 948 O62242 O.179158 0.767834 receptor) US 2015/0292028 A1 Oct. 15, 2015 62

TABLE 9-continued Genes Differently Regulated in the Aggressive Group as Compared to the Controls

Entrez Symbol (Na32 GeneD COSCSUS (consensus Adjusted Probeset ID Marl3) Gene Title (Na32 consensus Marl3) Mar-13) Log2 (FC) P-Value P-Value 206049 at SELP Selectin P (granule membrane protein 6403 O27O39 O.142209 0.749649 40 kDa, antigen CD62) 202581 at HSPA1A heat shock 70 kDa protein 1A 3303 O7338 0.141805 O.749649 212671 s a HLA-DQA1 major histocompatibility complex, class 3117 256994. O.134567 0.747232 I, DQ alpha 1 207808 s at PROS1 protein S (alpha) 5627 O763O2 O.125868 0.743.062 204419 X at HBC1 hemoglobin, gamma A 3047 66637 S O.091429 O.723.603 204848 x at HBC1 hemoglobin, gamma A 3047 S65419 O.O86123 O.722.194 209839 at DNM3 dynamin 3 26OS2 13O837 O.O7S473 0.711904 21738.8 s at KYNU kynureninase 8942 468314 O.069766 0.703289 214710 S. at CCNB1 cyclin B1 891 O19442 O.OS7837 O.692792 202729 s a LTBP1 atent transforming growth factor beta 4052 2O54S4 O.OS 6.194 O.689409 binding protein 1 205950 s at CA1 carbonic anhydrase I 759 154113 O.OSS27 O.686498 201014 S a PAICS phosphoribosylaminoimidazole 10606 OO1269 O.OS46SS O.6841.83 carboxylase, phosphoribosylaminoimidazole Succinocarboxamide synthetase 215813 s a PTGS1 prostaglandin-endoperoxide synthase 1 5742 O93699 O.O54246 0.6841.83 (prostaglandin GH synthase and cyclooxygenase) 216063 at HBBP1 hemoglobin, beta pseudogene 1 3044 2373O4 O.OS1626 O.68O853 209290 s. at NFIB nuclear factor IB 4781 O89323 O.O47583 0.675495 212224 at ALDH1A1 aldehyde dehydrogenase 1 family, 216 36S131 O.O47481 0.675495 member A1 207165 at HMMR hyaluronan-mediated motility receptor 31 61 O3S4S1 O.O4372 O666724 (RHAMM) 2O7668 X at PDIA6 protein disulfide isomerase family A, 101.30 O1888 O.O42673 O.666611 member 6 208.639 X at PDIA6 protein disulfide isomerase family A, 101.30 O87019 O.O4232 O666611 member 6 201202 at PCNA proliferating cell nuclear antigen S111 O2S175 0.040518 O.664974 202705 at CCNB2 cyclin B2 91.33 OOO457 O.O37459 0.658.786 202870 S. at CDC20 cell division cycle 20 991 3394.89 O.O.36577 0.658.786 217232 X at HBB hemoglobin, beta 3O43 819046 O.O34587 0.658.786 218009 s at PRC1 protein regulator of cytokinesis 1 9055 31 6131 O.O32297 0.65293 213515 x at HBC1 hemoglobin, gamma A 3047 2.417287 0.029879 0.65.1733 218350 S at GMNN geminin, DNA replication inhibitor 51053 197599 O.O2966 O.65.1733 209728 at HLA-DRB4 major histocompatibility complex, class 3126 2.147596 O.O281.76 O.6459SS I, DR beta 4 204023 at RFC4 replication factor C (activator 1) 4, S984 .139793 O.O27395 O.640611 37 kDa 203755 at BUB1B BUB1 mitotic checkpoint 701 O78.262 0.026537 0.639024 serine/threonine kinase B 202760 s at AKAP2 A kinase (PRKA) anchor protein 2 11217 132676 O.O23696 O.635.738 201477 s at RRM1 ribonucleotide reductase M1 6240 170464 O.O2268 O.635.738 218039 at NUSAP1 nucleolar and spindle associated protein 1 S12O3 2.96022 O.O22485 0.634539 209773 s at RRM2 ribonucleotide reductase M2 6241 767338 0.021614 O.6316O1 206632 S at APOBEC3B apolipoprotein B mRNA editing 9582 217919 O.O21271 0.6316O1 enzyme, catalytic polypeptide-like 3B 201563 at SORD Sorbitol dehydrogenase 6652 OO3384 O.O21071 0.6316O1 211696 x at HBB hemoglobin, beta 3O43 96.08O3 O.O2O716 0.6316O1 201490 s. at PPIF peptidylprolyl isomerase F 101OS O68584 O.O2OOS O.62633 209969 s at STAT1 signal transducer and activator of 6772 O334.33 O.O18323 O.612297 transcription 1, 91 kDa 202112 at VWF von Willebrand factor 7450 O652S2 O.O17O67 0.6101.94 211005 at LAT linker for activation of T cells 27040 44.1264 O.O16468 O605865 206102 at GINS1 GINS complex subunit 1 (Psf1 9837 19856 O.O14854. O.S95174 homolog) 206698 at XK X-linked Kx blood group (McLeod 7504 4.73769 O.O14747 O.S95174 syndrome) 201761 at MTHFD2 methylenetetrahydrofolate 10797 176486 O.O1448 O.S95174 dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 202589 at TYMS thymidylate synthetase 7298 284.352 O.O14339 O.S94132 203362 s at MAD2L1 MAD2 mitotic arrest deficient-like 1 4085 12377 O.O14136 0.591776 (yeast) 204146 at RADS1AP1 RAD51 associated protein 1 10635 138009 O.O13242 O.S87079 202814 S at HEXIM1 hexamethylene bis-acetamide inducible 1 10614 O18846 O.O11855 OS87079 US 2015/0292028 A1 Oct. 15, 2015 63

TABLE 9-continued Genes Differently Regulated in the Aggressive Group as Compared to the Controls

Entrez Symbol (Na32 GeneD COSCSUS (consensus Adjusted Probeset ID Marl3) Gene Title (Na32 consensus Marl3) Mar-13) Log2 (FC) P-Value P-Value 211953 S at IPO5 importin 5 3843 1663 O.O10926 O.S87079 212589 at RRAS2 related RAS viral (r-ras) oncogene 22800 248922 O.O10896 O.S87079 homolog 2 201897 s at CKS1B CDC28 protein kinase regulatory 1163 237742 O.O10699 O.S87079 subunit 1B 201829 at NET1 neuroepithelial cell transforming 1 10276 249.173 O.O10403 O.S8573 212459 X at SUCLG2 Succinate-CoA ligase, GDP-forming, 88O1 16554 O.OO9868 0.58573 beta subunit 201930 at MCM6 minichromosome maintenance complex 4175 O46236 O.OO9628 O.S82356 component 6 20911.6 X at HBB hemoglobin, beta 3O43 2.529691 O.OO8816 O.S68066 218585 S at DTL denticleless E3 ubiquitin protein ligase S1514 376897 O.OO8767 O.S68066 homolog (Drosophila) 206937 at SPTA1 spectrin, alpha, erythrocytic 1 6708 11407S O.OO8321 O.S66O14 (elliptocytosis 2) 218883 s at MILF1IP MLF1 interacting protein 79682 136.186 O.OO8.177 O.S66O14 215772 X at SUCLG2 Succinate-CoA ligase, GDP-forming, 88O1 175819 O.OO8054 O.S66O14 beta subunit 21308.8 s at DNAJC9 DnaJ (Hsp40) homolog, subfamily C, 23234 OOO79 O.OO7957 0.565.327 member 9 206145 at RHAG Rh-associated glycoprotein 600S 393541 O.OO6392 O.S47427 204695 at CDC25A cell division cycle 25A 993 O84134 O.OO6299 O.S47427 204240 S at SMC2 structural maintenance of chromosomes 2 10592 294656 O.OOS936 O.S4O991 202107 s at MCM2 minichromosome maintenance complex 4171 2222S2 O.OOST61 O.S36001 component 2 222204 S at RRN3 RRN3 RNA polymerase I transcription 54700 O42118 O.OOS/29 O.S36001 actor homolog (S. cerevisiae) 203560 a GGEH gamma-glutamyl hydrolase (conjugase, 8836 340214 O.OOS47 O.S26.569 olylpolygammaglutamyl hydrolase) 202613 a CTPS1 CTP synthase 1 1503 14984 O.OOS331 O.S26.569 208955 a. DUT deoxyuridine triphosphatase 1854 O3421 0.005157 0.523702 212282 a TMEM97 transmembrane protein 97 27346 O11374 O.OO4822 O.S16178 219412 a RAB38 RAB38, member RAS oncogene family 23682 1687O2 O.OO47S3 O.S16178 2025.03 s at KIAA0101 KIAAO101 9768 3.09.228 O.OO471 O.S16178 204767 s at FEN1 flap structure-specific endonuclease 1 2237 381621 O.OO4647 O.S16178 205394 a CHEK1 checkpoint kinase 1 1111 O45411 O.OO4442 OS 16178 2014.89 a PPIF peptidylprolyl isomerase F 101 OS 11818S O.OO4062 OSO74S4 201890 a RRM2 ribonucleotide reductase M2 6241 2.141038. O.OO366 O.476O1 219306 a KIF15 kinesin family member 15 S6992 266139 O.OO3389 0.461859 211144 x at TARP TCRgamma alternate reading frame 445347 26OOO2 O.OO328S 0456931 protein 206834 a HBD hemoglobin, delta 3O4S 2.1722O2 O.OO3266 O.456931 203476 a TPBG trophoblast glycoprotein 71.62 13238S O.OO2991 O4SO281 212281. S. at TMEM97 transmembrane protein 97 27346 28O2 O.OO287S O4SO281 206067 s at WT1 Wilms tumor 1 7490 247746 0.002812 O4SO281 208.694 a PRKDC protein kinase, DNA-activated, catalytic 5591 O67872 O.OO2S44 0.438543 polypeptide 206118 a STAT4 signal transducer and activator of 6775 O12186 O.OO2SO6 0.438543 transcription 4 216920 S. at TARP TCRgamma alternate reading frame 445347 474096 O.OO22S2 0.428O68 Ocil 202949 s at FHL2 our and a half LIM domains 2 2274 107316 O.OO2224 0.428O68 222201 S. at CASP8AP2 caspase 8 associated protein 2 9994 OS4149 O.OO1764 O.399.532 204026 S. at ZWINT ZW10 interactor, kinetochore protein 11130 .72O113 O.OO1341 0.397293 2098.94 at LEPR eptin receptor 3953 2.O15714 O.OO1141 0.380525 213092 x at DNAJC9 DnaJ (Hsp40) homolog, subfamily C, 23234 O90583 O.OOO823 O.3102O6 member 9 219454 at EGFL6 EGF-like-domain, multiple 6 25975 4SS89 O.OOO616 O2S8418 213262 at SACS spastic ataxia of Charlevoix-Saguenay 26278 O42232 O.OOOS9 O2S2396 (sacsin) 204256 at ELOVL6 ELOVL fatty acid elongase 6 79071 448618 O.OOOSS9 O2S2191 215806 x at TARP TCRgamma alternate reading frame 445347 S34041 O.OOO427 O.227751 Ocil 2098.13 x at TARP TCRgamma alternate reading frame 445347 66S423 O.OOO291 0215629 Ocil 201830 S. at NET1 neuroepithelial cell transforming 1 10276 S301S2 O.OOO2S1 O.213741 219615 S. at KCNKS potassium channel, Subfamily K, 864.5 O4543 O.OOO225 O.212O2 member 5 219602 s at PIEZO2 piezo-type mechanosensitive ion 63895 504577 7.5OE-05 O.117928 channel component 2 US 2015/0292028 A1 Oct. 15, 2015 64

TABLE 9-continued Genes Differently Regulated in the Aggressive Group as Compared to the Controls

Entrez Symbol (Na32 GeneD COSCSUS (consensus Adjusted Probeset ID Marl3) Gene Title (Na32 consensus Marl3) Mar-13) Log2 (FC) P-Value P-Value

219000 s at DSCC1 defective in sister chromatid cohesion 1 79075 1.08.1581 4.67E-OS O.O79813 homolog (S. cerevisiae) 205848 at GAS2 growth arrest-specific 2 262O 2492596 111E-OS O.02744

TABLE 10 Gene Expression in the Aggressive Group of the Core 102 Genes Symbol (Na32 GeneD COSCSS Gene Title (Na32 consensus (NCBI Adjusted Probeset ID Marl3) Mar13) Mar) Log2 (FC) P-Value p-Value 209763 at CHRDL1 chordin-like 1 91851 1760592 S.21E-09 6.67E-OS 210487 at DNTT deoxynucleotidyltransferase, 1791 913834.18 6.OOE-09 6.67E-OS terminal 205933 at SETBP1 SET binding protein 1 26040 17729694 151E-08 201324 at EMP1 epithelial membrane protein 1 2012 73634604 6.04E-O6 209183 s a C10orf10 chromosome 10 open reading 11067 O7496461 O.OOO131314 frame 10 209374 s a GHM immunoglobulin heavy constant 3507 78677828 O.2120204 204430 s a SLC2AS solute carrier family 2 6518 13053427 O.OOO259511 O.2137408 (facilitated glucose/fructose transporter), member 5 209069 s a H3 histone, family 3B (H3.3B) 3021 1866O722 O.OOO3182 O.221129 219777 a GTPase, IMAP family member 6 474344 O.96412142 0.000351.795 0.2277507 204304 is a prominin 1 8842 82998841 O.OOO419599 0.2277507 205984 a corticotropin releasing hormone 1393 68558627 O.OOO481558 O.2391606 binding protein 211998 a H3 histone, family 3B (H3.3B) 3021 37160868 O.376S544 220990 s a microRNA 21 4O6991 1666179 O.412S343 201369 s a ZFP36 ring finger protein-like 2 678 42931862 O.4SO2813 204872 a transducin-like enhancer of split 7091 O866.1045 0.5161776 4 (E(Sp1) homolog, Drosophila) 211597 s a HOP homeobox 84S25 35699251 O.OO4786898 0.5161776 220377 a KIAAO125 98.34 1578.4914 O.OO4956965 0.5161776 219304 is a platelet derived growth factor D 8O310 O.940599.13 O.OOS103212 O.S229734 208960 S a Kruppel-like factor 6 1316 O.94664.654 O.010221625 0.5857297 203787 a single-stranded DNA binding 2363S O.792294.96 O.O13428932 0.5870789 protein 2 204755 X at hepatic leukemia factor 3131 O.O1393.6253 O.S8994.67 209576 a guanine nucleotide binding 2770 O.O15529376 O.6O15332 protein (G protein), alpha inhibiting activity polypeptide 1 204753 s at hepatic leukemia factor 3131 O.70807109 O.021022S62 O.6316009 221760 a mannosidase, alpha, class 1A, 4121 1.1837.1513 O.O22329984 O.6327526 member 1 206478 a KIAAO125 98.34 O.99597623 0.02539777 O.6372958 221556 a cell division cycle 14B 8555 1.26288843 O.0280478.25 O.6449399 214805 a eukaryotic translation initiation 1973 0.67982725 O.O2807.0099 O.6449399 actor 4A1 220416 a ATPase, class I, type 8B, 798.95 0.73256572 O.031829237 member 4 208835 S. at LUC7-like 3 (S. cerevisiae) 51747 O90441159 O. 666611 20403.0 s at QCJ-SCHIP1 readthrough 100505385 O.S7342 O. 666611 204897 a prostaglandin E receptor 4 5734 1.13842542 O.6927923 (subtype EP4) 208949 s at LGALS3 ectin, galactoside-binding, 3958 O.7883.4036 0.075957894 O.7119044 soluble, 3 208961 s at Kruppel-like factor 6 1316 O.794OO193 O.O78101.123 O.7129149 209112 at cyclin-dependent kinase 1027 O.S7998.283 O. 119332543 O.7386668 inhibitor 1B (p27, Kip1) 204563 at SELL Selectin L. 6402 O.97868544 O.12O606528 0.7393127 214651 s at HOXA9 homeobox A9 3205 O.S6640825 O.211940371 O.7838234 208892 s at DUSP6 dual specificity phosphatase 6 1848 O.8SO96752 O.2356O7663 O.7928467 213524 S at GOS2 GOG1 Switch 2 SO486 O.82SO1945 O.239.215682 O.7948.695 US 2015/0292028 A1 Oct. 15, 2015 65

TABLE 10-continued Gene Expression in the Aggressive Group of the Core 102 Genes Symbol (Na32 GeneD COSCSS Gene Title (Na32 consensus (NCBI Adjusted Probeset ID Marl3) Mar13) Mar) Log2 (FC) P-Value p-Value 203535 at S100A9 S100 calcium binding protein 6280 -0.80627992 O.254346668 O.8015736 A9 213668 s at SOX4 SRY (sex determining region 6659 -0.82323589 0.260556623 O.802741 Y)-box 4 222044 at PCIF1 PDX1 C-terminal inhibiting 63935 -0.49806168 0.282S60332 0.8109941 factor 1 213593 s at TRA2A transformer 2 alpha homolog 298.96 -0.60971572 O.34436S936 O.8383.152 (Drosophila) 214041 x at RPL37A ribosomal protein L37a 6168 -0.396.53673 0.4O744.4152 0.8568.069 205442 at MFAP3L microfibrillar-associated protein 9848 -0.51285589 0.449796.577 0.872S199 3-like 214974 X at CXCL5 chemokine (C-X-C motif) ligand 6374 -0.41826978 O.SS1543,186 0.9009074 5 213979 s at — -O.35065846 O.S99848748 0.9149341 214911. S. at BRD2 bromodomain containing 2 6046 -0.27608523 O.61174O131 O.9174215 211074 a FOLR1 olate receptor 1 (adult) 2348 -0.451.12625 0.632OOO886 O.9246948 208180 S. at HIST1H4H histone cluster 1, H4h 8365 -0.277854.4 O.639.5281.85 0.92S74O6 207815 a. PF4V1 platelet factor 4 variant 1 S197 -0.30911148 0.6519791 SS O.9286903 205547 s at TAGLN transgelin 6876 -0.28O88743 O.708O17145 0.9439304 205237 a FCN1 icolin (collagen fibrinogen 2219 -0.32136788 O.711.156716 0.94.4669 domain containing) 1 219922 S at LTBP3 atent transforming growth factor 4054 -0.1806O244 O.72388,1126 0.94.84945 beta binding protein 3 204141 a TUBB2A tubulin, beta 2A class IIa 7280 -0.295.34658 0.73S081.772 0.9498889 212952 a LOC100507328 hypothetical LOC100507328 10OSO7328 -0.22415499 0.7439S4O62 0.9528O39 209803 s at PHLDA2 pleckstrin homology-like 7262 -0.19751659 0.7623S3226 O.95683.SS domain, family A, member 2 204834 a FGL2 fibrinogen-like 2 10875 -0.208O3456 0.771 O180O8 0.9582727 213350 a RPS11 ribosomal protein S11 62OS -0.21 SSS457 0.7729238O8 O.9589509 211964 a COL4A2 collagen, type IV, alpha 2 1284 -0.15879898 0.78O84214 O.9613311 205114 s at CCL3L3 chemokine (C-C motif) ligand 3- 414O62 -0.2051.934S O.793565216 0.9626063 ike 3 20231.0 s at COL1A1 collagen, type I, alpha 1 1277 -0.22272495 0.796823974 0.9633788 217683 a HBE1 hemoglobin, epsilon 1 3O46 -0.12978731 O.80694.8287 0.964.919 201842 s at EFEMP1 EGF containing fibulin-like 22O2 -0.17SOO966 0.813572867 0.9663992 extracellular matrix protein 1 201631 S. at IER3 immediate early response 3 8870 -0.126629O7 O.8364323O8 O.9684535 201798 s at MYOF myoferlin 26509 -0.129871.94 O.83931 6831 O.96923.11 1405 i at CCL5 chemokine (C-C motif) ligand 5 63S2 -0.16353O2S O.84O439597 0.969S199 201058 S. at MYL9 myosin, light chain 9, regulatory 10398 -0.11665284 O.854796O69 O.973 1863 215076 s at COL3A1 collagen, type III, alpha 1 1281 -0.11954993 0.87741 01 08 0.9785103 2024.03 s at COL1A2 collagen, type I, alpha 2 1278 -0.11102.SS3 O.891268.391 O.9806744 210809 S at POSTN periostin, osteoblast specific 10631 -0.1111146 0.9129117OS 0.9851423 factor 212531 at LCN2 lipocalin 2 3934 -0.02914052 0.962852347 O.9923439 210873 x at APOBEC3A apolipoprotein B mRNA editing 200315 -0.025341.14 O.967184O16 O.994OO37 enzyme, catalytic polypeptide like 3A 211980 at COL4A1 collagen, type IV, alpha 1 1282 -0.01874.739 O.97782O792 0.9959916 201438 at COL6A3 collagen, type VI, alpha 3 1293 O.OO97O3779 0.986.3171 O.997O689 74694 S at RABEP2 rabaptin, RAB GTPase binding 79874 O.O11843173 0.981583585 0.996.1445 effector protein 2 211719 x at FN1 fibronectin 233S O.O37210894 O.973 177363 0.995OO96 202404 S at COL1A2 collagen, type I, alpha 2 1278 O.O34227062 O.972988883 0.995OO96 204655 at CCL5 chemokine (C-C motif) ligand 5 63S2 0.038628831 O.96S309914 O.993SOO3 216442 x at FN1 fibronectin 2335 0.054191701 0.953.55946 0.99.12349 210495 X at FN1 fibronectin 233S O.OS8226728 O.951SSO365 0.991O374 212464 S at FN1 fibronectin 2335 0.081392657 0.933.688332 0.988994 211161 s at COL3A1 collagen, type III, alpha 1 1281 O.OS61468.34 0.93OSOO411 0.9881951 212667 at SPARC Secreted protein, acidic, 6678 O.OS8151732 O.92681 0399 O.9875364 cysteine-rich (osteonectin) 202627 s at SERPINE1 Serpin peptidase inhibitor, clade SOS4 O.13O82S837 O.842575178 O.9702264 E (nexin, plasminogen activator inhibitor type 1), member 1 213757 at EIFSA eukaryotic translation initiation 1984 O.1383.14467 0.836269539 O.9684535 factor 5A 202600 S. at NRIP1 nuclear receptor interacting 8204 0.1466 67606 0.81125437 0.966O204 protein 1 202237 at NNMT nicotinamide N- 4837 0.3571371960.643404225 O.9262OSS methyltransferase US 2015/0292028 A1 Oct. 15, 2015 66

TABLE 10-continued Gene Expression in the Aggressive Group of the Core 102 Genes Symbol (Na32 GeneD COSCSS Gene Title (Na32 consensus (NCBI Adjusted Probeset ID Marl3) Mar13) Mar) Log2 (FC) P-Value p-Value 201666 at TIMP1 TIMP metallopeptidase inhibitor 1 7076 O.178832267 0.632222OS1 O.9248966 204018 X at HBA1 hemoglobin, alpha 1 3O39 O.SO3353692 O.S447S2592 O.898.6814 200999 s at CKAP4 cytoskeleton-associated protein 4 10970 O.335798499 O.S41539SS6 0.8965721 204622 X at NR4A2 nuclear receptor Subfamily 4, 4929 O.334447219 O497538.974 O.8848.345 group A, member 2 203394 S at HES1 hairy and enhancer of split 1, 328O O.443814733 0.487186309 O.8828.267 (Drosophila) 206157 at PTX3 pentraxin 3, long S806 O4.94269798 0.426649316 O.86388O2 205382 s at CF complement factor D (adipsin) 1675 0.493713983 0.395763648 0.8528093 217414 X at HBA1 hemoglobin, alpha 1 3O39 O.79268O859 O.3771-15905 0.8469171 211745 x at HBA1 hemoglobin, alpha 1 3O39 O.872403284 0.371311295 0.8441546 214414 X at HBA1 hemoglobin, alpha 1 3O39 O.997898457 0.369791 698 0.8441546 211699 X at HBA1 hemoglobin, alpha 1 3O39 O.74O693292 O.368 184583 0.84.4099 209458 x at HBA1 hemoglobin, alpha 1 3O39 O.8SO433299 O.356237193 0.8404624 212077 at CALD1 caldesmon 1 800 O.S8832O285 0.348578SO2 0.8401911 216248 s at NR4A2 nuclear receptor Subfamily 4, 4929 O.S.70789SO3 0.342393968 O.8375489 group A, member 2 219403 s at HPSE heparanase 10855 O.691038.194 O.269546864 O.8062958 201110 s. at THBS1 hrombospondin 1 7.057 O.6704O1219 O2S1133297 O.8008466 203395 S at HES1 hairy and enhancer of split 1, 328O O.85070808 O.193692 0.7743035 (Drosophila) 200629 at WARS tryptophanyl-tRNA synthetase 7453 0.666O4SS16 0.186OO6457 0.7721508 201669 S at MARCKS myristoylated alanine-rich 4082 O.7S956860S 0.13272O593 0.7472316 protein kinase C substrate 201195 S at SLC7A5 Solute carrier family 7 (amino 8140 O.824741527 O.116329142 0.7382591 acid transporter light chain, L. system), member 5 204419 X at HBC1 hemoglobin, gamma A 3O47 666375.122 O.0914290S 0.7236.03 204848 x at HBC1 hemoglobin, gamma A 3O47 S65419124 O.O86123226 O.7221941 219410 at TMEM45A transmembrane protein 45A 55076 O.99.127647S O.O82130669 O.7221941 21738.8 s at KYNU kynureninase 8942 468313974 O.06976.6007 O.7032894 209290 s. at NFIB nuclear factor IB 4781 O893.23355 O.O4758335 0.6754948 202870 S. at CDC20 cell division cycle 20 991 .339488946 O.O.36576735 0.658.786 217232 x at HBB hemoglobin, beta 3O43 819045943 O.O3458682 0.658.786 213515 X at HBC1 hemoglobin, gamma A 3O47 2.417286959 O.O29878S97 0.65.1733 209773 s at RRM2 ribonucleotide reductase M2 6241 767337745 0.021613828 O.6316009 211696 X at HBB hemoglobin, beta 3O43 96.0802898 O.O2O71.5624 O.6316009 206698 at XK X-linked Kx blood group 7504 4.73769082 O.O14746SS O.S951742 (McLeod syndrome) 212589 at RRAS2 related RAS viral (r-ras) 22800 24892.1748 O.O10895S73 O.S870789 oncogene homolog 2 20911.6 X at HBB hemoglobin, beta 3O43 2.529691.269 O.OO8815809 O.S680662 215772 X at SUCLG2 Succinate-CoA ligase, GDP- 88O1 175819449 O.OO8OS4348 O.S66O139 forming, beta Subunit 201890 at RRM2 ribonucleotide reductase M2 6241 2.141037934 O.OO3660296 O.476OO98 2098.94 at LEPR leptin receptor 3953 2.O15713837 O.OO114085 0.3805249 219602 s at PIEZO2 piezo-type mechanosensitive ion 63.895 504577032 7.5OE-05 0.1179278 channel component 2 205848 at GAS2 growth arrest-specific 2 262O 2.492.5957.62 111E-OS 0.0274403

TABLE 11 Gene Expression in the Indolent Group of the Core 102 Genes Symbol (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus1 Adjusted Probeset ID Marl3) Mar13) Mar-13) Log2 (FC) P-Value p-Value 208949 s at LGALS3 lectin, galactoside-binding, 3958 -2.4611SSO8 4.71E-07 O.OOO8705 soluble, 3 201666 at TIMP1 TIMP metallopeptidase inhibitor 1 7076 -1.63941887 2.35E-05 O.OO42807 201058 S. at MYL9 myosin, light chain 9, regulatory 10398 -2.74636917 3.07E-OS O.OO46717 207815 at PF4V1 platelet factor 4 variant 1 51.97 -2.82238801 S.3SE-OS O.OOS8277 1405 i at CCL5 chemokine (C-C motif) ligand 5 63S2 -3.32636522 S.8SE-OS O.OO60359 213524 s at GOS2 GOG1 Switch 2 SO486 -2.65614662 O.OOO1262 O.OO7998 201631 S. at IER3 immediate early response 3 887O -2.29780898 O.OOO169 O.OO9257 204655 at CCL5 chemokine (C-C motif) ligand 5 63S2 -3.23424391 O.OOO2336 O.O1 OS336 203535 at S100A9 S100 calcium binding protein A9 628O -2.4351969 O.OOO3703 O.O133722 US 2015/0292028 A1 Oct. 15, 2015 67

TABLE 1 1-continued Gene Expression in the Indolent Group of the Core 102 Genes Symbol (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus1 Adjusted Probeset ID Marl3) Mar13) Mar-13) Log2 (FC) P-Value p-Value 212077 at CALD1 caldesmon 1 800 -2.042SS108 O.OOO6877 O.O178246 210873 X at APOBEC3A apolipoprotein B mRNA editing 20O315 -1.7692O321 O.OO23357 0.032102 enzyme, catalytic polypeptide ike 3A 212531 at LCN2 ipocalin 2 3934 -1.7494.4593 O.OO29164 O.036333S 205114 S at CCL3L3 chemokine (C-C motif) ligand 3- 414062 -2.11268.057 O.OO38941 0.04.19976 ike 3 208180 S. at HIST1H4H histone cluster 1, H4h 836S -158614736 OOO40832 0.0431848 205237 at FCN1 icolin (collagen fibrinogen 2219 -2.31794,481 O.OO41427 0.0434.495 domain containing) 1 214414 X at HBA1 hemoglobin, alpha 1 3O39 -2.92561932 O.OO44286 0.0449487 209803 s at PHLDA2 pleckstrin homology-like 7262 -1.71861 O99 O.OO46599 0.0462831 domain, family A, member 2 201438 at COL6A3 collagen, type VI, alpha 3 1293 -145596,175 O.OOSS357 O.OSO4893 205547 s at TAGLN transgelin 6876 -1.896868O3 O.OO62O53 O.OS38116 211074 at FOLR1 olate receptor 1 (adult) 2348 -2.33SOO441 O.OO71061 O.OS 79213 221556 at CDC14B cell division cycle 14B 8555 -1.3S462909 OOO72261 O.OS82223 211745 X at HBA hemoglobin, alpha 1 3O39 -2.39194906 O.OO73721 O.OS86827 204141 at TUBB2A tubulin, beta 2A class IIa 7280 -2.139296.18 O.OO77476 O.O602366 204018 X at HBA hemoglobin, alpha 1 3O39 -198O13O3 O.OO92138 0.0661068 201798 s at MYOF myoferlin 26509 -1.5.1465891 O.OO9894 O.O682173 209458 x at HBA hemoglobin, alpha 1 3O39 -2.132S74OS O.O108O16 0.071832 217414 X at HBA hemoglobin, alpha 1 3O39 -2.0496731 O.O117787 0.07 S212S 211964 at COL4A2 collagen, type IV, alpha 2 1284 -1.3O4O6638 O.O122956 O.O767626 205442 at MFAP3L microfibrillar-associated protein 9848 -1.52OSOSS9 O.O134371 0.08O8545 3-like 214974 X at CXCL5 chemokine (C-X-C motif) ligand 6374 -1.55942048 O.O144O79 0.083963 5 20231.0 s at COL1A1 collagen, type I, alpha 1 1277 -1.87618778 O.O168309 0.0918907 219403 s at HPSE heparanase 10855 -1.319342O6 OO184966 0.0968.056 212667 at SPARC Secreted protein, acidic, cysteine- 6678 -1.34731184 O.O1881.23 O.O976.538 rich (osteonectin) 200999 S at CKAP4 cytoskeleton-associated protein 4 10970 -1.14939507 O.O2O4052 0.1017426 204834 at FGL2 fibrinogen-like 2 10875 -14681964.8 O.O227746 0.1072SSS 216442 x at FN1 fibronectin 1 2335 - 190725545 O.O23141 0.1081658 201842 s at EFEMP1 EGF containing fibulin-like 22O2 -1. SOO62O86 O.O247947 0.1121383 extracellular matrix protein 1 212464 S at FN1 fibronectin 1 2335 -1.963S2838 O.O2S8307 0.1143867 211719 x at FN1 fibronectin 1 2335 -2.20581999 O.O267964 O. 1164775 210495 X at FN1 fibronectin 1 2335 - 19076.8224 0.026965 0.1168453 216248 s at NR4A2 nuclear receptor Subfamily 4, 4929 -1.174987.47 O.O28.2382 0.11972S7 group A, member 2 211699 X at HBA1 hemoglobin, alpha 1 3O39 -1.6OOO1534 O.O291616 0.1216234 217683 at HBE1 hemoglobin, epsilon 1 3O46 -1.01631722 O.O327SO1 O.1295902 2026.27 s at SERPINE1 Serpin peptidase inhibitor, clade 5054 -1.241552 O.O352569 O.1349566 E (nexin, plasminogen activator inhibitor type 1), member 1 203394 S at HES1 hairy and enhancer of split 1, 328O -1.1913737 O.O362S17 O.1371.457 (Drosophila) 211980 at COL4A1 collagen, type IV, alpha 1 1282 -1.2S68O3S4 O.O372348 0.139094 204622 X at NR4A2 nuclear receptor Subfamily 4, 4929 -O.91 0729S4 O.O37958 0.1405444 group A, member 2 215076 s at COL3A1 collagen, type III, alpha 1 1281 -1433072OS O.O385845 0.1417739 2024.03 s at COL1A2 collagen, type I, alpha 2 1278 -144054881 O.O465026 0.1564,484 202404 S at COL1A2 collagen, type I, alpha 2 1278 -1.71166248 0.0565387 0.173313S 210809 s at POSTN periostin, osteoblast specific 10631 -1.7OO47318 O.OS921.92 0.1779858 factor 200629 at WARS tryptophanyl-tRNA synthetase 7453 -O.814O73O3 OO632647 0.1842488 205382 s at CFD complement factor D (adipsin) 1675 -0.93430533 OO674121 O.1911642 211161 s at COL3A1 collagen, type III, alpha 1 1281 -O.97790719 O.O849171 O.216434 202237 at NNMT nicotinamide N- 4837 -1.1690S976 O.O849883 0.216541 methyltransferase 206157 at PTX3 pentraxin 3, long S806 -O-8886965 O.1017166 0.24O1657 222044 at PCIF1 PDX1 C-terminal inhibiting 63935 -O.S901O446 0.1405898 0.2902372 factor 1 203395 S at HES1 hairy and enhancer of split 1, 328O -O.828S67SS O-1406431 O.29O2934 (Drosophila) 214041 x at RPL37A ribosomal protein L37a 6168 -O49636O26 O.2288,142 0.389.2891 213668 S. at SOX4 SRY (sex determining region Y)- 6659 -O.74126SO3 O.236,6512 0.397241 box 4 US 2015/0292028 A1 Oct. 15, 2015 68

TABLE 1 1-continued Gene Expression in the Indolent Group of the Core 102 Genes Symbol (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus1 Adjusted Probeset ID Marl3) Mar13) Mar-13) Log2 (FC) P-Value p-Value 214911. S. at BRD2 bromodomain containing 2 6046 -0.SSS89849 0.237402 0.398O366 213515 X at HBC1 hemoglobin, gamma A 3O47 -1.06377 O.2466641 (0.4O7885 204419 x at HBC1 hemoglobin, gamma A 3O47 -0.908371 O.2734.668 04340414 208892 s at DUSP6 dual specificity phosphatase 6 1848 -0.62624686 O3054404 O.4659019 201669 S at MARCKS myristoylated alanine-rich 4082 -0.4343098 O3O841 1 0.4689854 protein kinase C Substrate 201324 at EMP1 epithelial membrane protein 1 2012 -0.26518451 0.3157697 O.47 6429 204848 x at HBC1 hemoglobin, gamma A 3O47 -0.73774161 O.3338994 O.49393O4 213350 at RPS11 ribosomal protein S11 62OS -0.59851.213 O.352S386 O.S113994 213593 s at TRA2A transformer 2 alpha homolog 298.96 - O.S1180921 O.35298.63 O.S117818 (Drosophila) 20937.4 S at IGHM immunoglobulin heavy constant 3S07 -0.31785029 O.38OO608 O.S367239

213979 s at — -0.4O184672 0.4828663 O.626.2323 201110 s. at THBS1 thrombospondin 1 7057 -0.32862948 O.S.0663 0.645676 212952 at LOC100507328 hypothetical LOC100507328 10OSO7328 -0.3705879 0.5288.342 0.6639313 213757 at EIFSA eukaryotic translation initiation 1984 -0.30685777 O.S926473 0.71SS269 factor 5A 201195 s at SLC7A5 Solute carrier family 7 (amino 8140 -0.21795SSS O.6192996 O.7368622 acid transporter light chain, L. system), member 5 217232 X at HBB hemoglobin, beta 3O43 -0.28O378O2 O.6901SS O.790SOS7 206698 at XK X-linked Kx blood group 7SO4 -0.153S4275 0.7519213 0.8333529 (McLeod syndrome) 20911.6 X at HBB hemoglobin, beta 3O43 -0.22O11194 O.7745612 O.8490507 208960 s at KLF6 Kruppel-like factor 6 1316 -0.0669692 0.81983O8 O.8804886 211696 X at HBB hemoglobin, beta 3O43 -0.11853666 0.8626478 O.9090874 212589 a RRAS2 related RAS viral (r-ras) 22800 -0.03O39679 0.9381282 0.9597619 oncogene homolog 2 74694 s at RABEP2 rabaptin, RAB GTPase binding 79874 -O.O2974959 O.9459227 0.965SO37 effector protein 2 205933 a SETBP1 SET binding protein 1 26040 -O.OOSS7713 O.9639004 O.976948 219410 a TMEM45A transmembrane protein 45A SSOf6 -0.013OO971 O.978O245 0.9864563 209183 s a C10orf10 chromosome 10 open reading 11067 O.OS3999237 0.792.4264 O.8612892 rame 10 21738.8 s at KYNU kynureninase 8942 0.22O147884 O.7422951 0.82651.51 204872 a TLE4 transducin-like enhancer of split 709 O. 119923227 O.6919854 0.7913794 4 (E(Sp1) homolog, Drosophila) 209290 s. at NFIB nuclear factor IB 478 O.17944.1546 O.691.2758 0.79.09339 209069 s at H3F3B H3 histone, family 3B (H3.3B) 3O2 O.O998.461.14 O.6841093 0.7862131 209763 a CHRDL1 chordin-like 1 91.85 O.OSO2S4159 0.6660676 O.7731SO2 208961 s at KLF6 Kruppel-like factor 6 1316 0.2O3610948 O.S862653 0.7103285 219922 s a LTBP3 atent transforming growth factor 4054 0.265731289 O.S441646 0.676381 beta binding protein 3 210487 a DNTT deoxynucleotidyltransferase, 179 O.159844.182 0.4049727 O.SS88841 erminal 202600 S. at NRIP1 nuclear receptor interacting 8204 0.470263901 O.374O44 0.531.0937 protein 1 211998 a H3F3B H3 histone, family 3B (H3.3B) 3O2 O.3O3O14616 0.3488911 O.S.083632 219304 is a PDGFD platelet derived growth factor D 8O310 0.277S96346 0.298783 0.4593O71 204897 a PTGER4 prostaglandin E receptor 4 5734 0.607994.686 0.2274529 O.387SO45 (subtype EP4) 202870 s at CDC20 cell division cycle 20 99 O.762O09765 0.1538922 O.306O777 220990 S. at MIR21 microRNA 21 4O699 O43.5464726 0.1444477 O.29491.63 220377 a KIAAO125 KIAAO125 98.34 0.4872O3922 0.1414233 0.2913494 215772 x at SUCLG2 Succinate-CoA ligase, GDP- 880 O.S4O170913 0.134O248 0.282O2S3 orming, beta Subunit 204563 a SELL Selectin L. 64O2 0.910468161 O.O926084 O.22778.75 211597 s at HOPX HOP homeobox 84525 0.686080974 O.O787633 0.2O73318 205984 a CRHBP corticotropin releasing hormone 1393 0.679S6433 O.O697279 0.1948OO1 binding protein 20883.5 s at LUC7L3 LUC7-like 3 (S. cerevisiae) S1747 O.690777363 OO6766OS O.1915926 221760 a MAN1A1 mannosidase, alpha, class 1A, 4121 O.824262339 O.OS82629 O.1763O29 member 1 201369 s at ZFP36L2 ZFP36 ring finger protein-like 2 678 O.748937.338 0.0520224 0.1657888 209773 s at RRM2 ribonucleotide reductase M2 6241 1.272153164 O.O4956O7 O.1616O2S 204304 S at PROM1 prominin 1 8842 0.92S426909 O.O2374.82 0.10952.13 2098.94 at LEPR leptin receptor 3953 1.1849291.39 O.O181485 0.0959498 203787 at SSBP2 single-stranded DNA binding 23635 0.7581,1153 O.OO63777 O.OS44303 protein 2 US 2015/0292028 A1 Oct. 15, 2015 69

TABLE 1 1-continued Gene Expression in the Indolent Group of the Core 102 Genes Symbol (Na32 GeneD COSCSUS Gene Title (Na32 consensus (consensus1 Adjusted Probeset ID Marl3) Mar13) Mar-13) Log2 (FC) P-Value p-Value 201890 at RRM2 ribonucleotide reductase M2 6241 1.743455889 O.OOS2954 O.0493966 219602 s at PIEZO2 piezo-type mechanosensitive ion 63895 O.94901436S O.OO17907 O.O28SOO1 channel component 2 204755 X at HLF hepatic leukemia factor 3131 O.69286O181 O.OO17806 0.028SOO1 204753 S at HLF hepatic leukemia factor 3131 O.867266686 O.OO16SSS O.O27S765 209576 a GNAI1 guanine nucleotide binding 277O 0.736228442 O.OO15849 O.O2692S4 protein (G protein), alpha inhibiting activity polypeptide 1 214805 a EIF4A1 eukaryotic translation initiation 1973 0.894OS2441 O.OO1431 O.O2S337 factor 4A1 209112 a CDKN1B cyclin-dependent kinase inhibitor 1027 1.181992974 O.OOO7491 O.O186168 1B (p27, Kip1) 214651 S. at HOXA9 homeobox A9 32OS 1.46634.8689 O.OOO6873 O.O178246 219777 a GIMAP6 GTPase, IMAP family member 6 474344 0.787293816 O.OOOS6S O.O16422 204430 s at SLC2A5 solute carrier family 2 (facilitated 6518 O. 91694O276 O.OOO4539 O.O149986 glucosef fructose transporter), member 5 206478 a KIAAO125 KIAAO125 98.34 1.69958,581.6 7.39E-OS O.OO63689 220416 a ATP8B4 ATPase, class I, type 8B, 7989S 1.319886477 6.56E-OS O.OO61373 member 4 205848 a GAS2 growth arrest-specific 2 262O 1882.945739 S-69E-0S 0.005964.8 20403.0 s at IQCJ-SCHIP1 IQCJ-SCHIP1 readthrough 10OSOS38S 1.123786747 S.O4E-OS O.OOST459

TABLE 12 TABLE 12-continued Regulation of 16 PV Core Genes in Chronic Phase CML Regulation of 16 PV Core Genes in Chronic Phase CML CML Chronic Phase CMLBlast Phase Up Regulated Genes Up Regulated Genes HES1 LGALS3 NRIP1 HBA2 RRAS2 SOX4 HBB GAS2 HBG1 HES1 COL1A1 EMP1 RRM2 SSBP2 TABLE 13 THSB1 LUCTL3 TIMP1 GIMAP6 MARCKS eIFSA 10 Gene Screen Probability Score: 30 Test PV Cohort XK SETBP1 CDC2O Aggressive (5-6/6) Indolent (O-46) P MYOF N = 8 N = 22 value LEPR CCL5 Gender (MVF) 1/7 11.11 S ER3 Median Age in Years 62 (46-76) 65 (43-79) S K (range) LGALS3 9. eIFSA % JAK2 V617F (range) 94 (52-100) 81 (44-100) S HOXA9 Leukocyte count 31 14.5 S Thrombosis 6.8 5,22 O.O14 Down Regulated Genes Down Regulated Genes Hemoglobin 10.9 13.1 O.OO6 Median Disease Duration 15.5 7 O.O11 SCHIP1 IGHM in years (range) HLF SELL y 9. PROM1 EFEMP1 Platelet count 3O8 666 <0.019 MAN1A1 HBA1 Palpable splenomegaly 8.8 9,22 O.OO9 CRHBP FCN1 Spleen size 14 3.5 O.O33 KIAA1025 LCN2 Chemotherapy 7/8 7/22 O.O12 DNTT CKAP4 Median Probability Score 5.0 (5-6) 2.5 (0-4) <0.001 GHM S100A9 (range) SELL APOBEC3A 9. FGL2 FGL2 Median Clinical Score 3.0 (2-4) O (O-3) <0.001 NR4A2 IER3 (range) CDC14B GOS2 US 2015/0292028 A1 Oct. 15, 2015 70

TABL E 14 Ten Gene Screening Panel Gene SEQ Target Symbol Gene Name Context Sequence ID No. Exons

PCNA proliferating AAAGAGGAGGAAGCTGTTACCATAG 1. 5 cell nuclear antigen

TSN translin GCCAGTGAACTGTCGAGGCTGTCTG 2 5

CDKN1A cyclin-dependent GCAGACCAGCATGACAGATTTCTAC 3 2 kinase inhibitor 1A (p21, Cip1)

MYL9 myosin, light TGGCCTCGCTGGGTTTCATCCATGA 4. 2 chain 9, regulatory

IFI3 O interferon, CTGCCAGTTGTACCAGGGCAAGAAG 5 7 gamma-inducible protein 3 O

CTSA cathepsin. A CAGAAGATGGAGGTGCAGCGCCGGC 6 14

SMC4 structural AAAAGAAGGAAGAATTGTATTTGCA 7 21 maintenance of chromosomes 4

CTTN cortactin CTACCAGGCTGCGGGCGATGATGAG 8 16

SON SON DNA CAAACATTTTCTCTTTAGGGTATTG 9 12 binding protein

TIA1 TIA1 cytotoxic CCCGTGCAACAGCAGAATCAAATTG O 10 granule - a sociated RNA binding protein

ACTB Beta actin 1. (Endogenous control)

TABLE 1.5 TABLE 15-continued Ten Gene Screening Panel NCBI Gene Accession Nos. Ten Gene Screening Panel NCBI Gene Accession Nos. Gene Symbol NCBIGene Accession Nos. Gene Symbol NCBIGene Accession Nos. PCNA NM 002592, NM 182649 SMC4 TSN NM OO4622 NM 001002800, NM 005496 CDKN1A NM 000389, NM 001220777, NM_001220778, CTTN NM 001184740, NM O05231, NM 138565 NM O78467 SON NM 138927 MYL9 NM 181526 TLA1 NM 022037, NM 022173 IFI30 NM OO6332 ACTB NM 001101 CTSA NM 000308, NM OO1127695, NM 001167594

TABL E 16 Gene Expression Assay Reagents

Primer-Probe SEQ Gene Symbol Assay ID Context Symbol ID No. Part Number

PCNA HsO0952870 g1 AAAGAGGAGGAAGCTGTTACCATAG 11 433 1182

TSN HsOO172824 mill GCCAGTGAACTGTCGAGGCTGTCTG 12 433 1182

CDKN1A HsOo355782 ml. GCAGACCAGCATGACAGATTTCTAC 13 433 1182

MYL9 HsOo382913 ml TGGCCTCGCTGGGTTTCATCCATGA 14 433 1182

IFI3 O Hs00908857 g1 CTGCCAGTTGTACCAGGGCAAGAAG 15 435.1372 US 2015/0292028 A1 Oct. 15, 2015 71

TABLE 16 - continued Gene Expression Assay Reagents

Primer-Probe SEQ Gene Symbol Assay ID Context Symbol ID No. Part Number

CTSA Hs 01563956 g1 CAGAAGATGGAGGTGCAGCGCCGGC 16 435.1372

SMC4 Hs00909708 g1 AAAAGAAGGAAGAATTGTATTTGCA 17 435.1372

CTTN Hs 01124227 ml CTACCAGGCTGCGGGCGATGATGAG 18 435.1372

SON HsO1066142 g1 CAAACATTTTCTCTTTAGGGTATTG 19 435.1372 TIA1 Hs 01046922 mill CCCGTGCAACAGCAGAATCAAATTG 2O 435.1372 ACTB NAA NAA 43.33.762F

TABLE 17 TABLE 18-continued Algorithm for PV Patient Stratification 10 Gene Screening Data from Indolent PV Patients - Ten Gene Screening Panel 10 Clin For the following gene level comparisons: UPIN Diagnosis DxDur Gscore Score If TRUE (and >2 fold difference) score 1 1529 PV 2.5 3 O If FALSE (or <2 fold difference) score O 1542 PV 3 O A score of>4 out of 6 indicates an aggressive form of PV 1542 PV 2 O PCNA > IFI30 1552 PV 2 O TSN > CTSA 1552 PV 1 O SMC4 - CDKN1A 1574 PV 13 2 3 PCNA > CTTNSON > 1574 PV 2 2 O CTTN 1578 PV 7 4 O TIA1 > MYL9 1585 PV 1.5 2 O 1591 PV 3 3 1 1599 PV 8 1 O 1635 PV 1.5 2 O TABLE 18 1127 PV 11 3 O Average 2.651,163 O.906977 - OGene Screenins Data from Indolent FV Patients Median 3 1 Mann-Whitney U Statistic p < 0.001 p<0.001 10 Clin compared to PVAggressive UPIN Diagnosis DxDur Gscore Score

124 PV 3 2 124 PV 21 1 O 136 PV 1 2 TABLE 19 183 PV 4 3 O 199 PVMF 8 4 2 10 Gene Screening Data from Aggressive PV Patients 294 PV 8 2 326 PV 7 4 3 10 Clin 351 PV 6 2 O UPIN Diagnosis DxDur Gscore Score 355 PV O 2 2 398 PV 6 3 113 PVMF 19 5 5 470 PV 26 O 3 173 PVMF 28 5 4 495 PV 6 2 O 2O6 PVMFAAML 18 6 6 S64 PV 1 4 249 PV 18 5 3 645 PV 1 2 671 PVMF 24 5 2 914 PV O 3 68O PVMF 12 5 3 1045 PV 9 2 1113 PVMF 7 5 5 1073 PV 8 4 1113 PVMF 12 5 5 1092 PV 7 2 1235 PV 9 5 2 1125 PV 27 4 3 1253 PV 4 5 2 1.191 PV 10 4 1463 PVMF 39 5 3 1267 PV 4 2 O 1545 PV 11 5 1 1308 PV 10 4 1596 PVMF 13 5 1 1370 PV 4 1 2 1639 PV 4 6 3 1418 PV 7 4 2 999 PVMF 11 6 3 1428 PV 1 3 O 682 PVMFSM 2O 5 3 1428 PV 4 4 Mean 5.1875 3.1875 1433 PV 3 4 O Median 5 3 1438 PV 3 4 2 Mann-Whitney U Statistic p < 0.001 p<0.001 1439 PV 3 3 compared to PV Indolent 1459 PV 4 3 2 US 2015/0292028 A1 Oct. 15, 2015 72

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 2O

<210s, SEQ ID NO 1 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for proliferating cell nuclear antigen <4 OOs, SEQUENCE: 1 aaagaggagg aagctgttac Catag 25

<210s, SEQ ID NO 2 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for translin

<4 OOs, SEQUENCE: 2 gccagtgaac titcgaggct gtctg 25

<210s, SEQ ID NO 3 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for cyclin-dependent kinase inhibitor 1A <4 OOs, SEQUENCE: 3 gcagaccago atgacagatt totac 25

<210s, SEQ ID NO 4 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for myosin, light chain 9 <4 OOs, SEQUENCE: 4 tggcct cqct gggittt catc catga 25

<210s, SEQ ID NO 5 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for interferon, gamma-inducible protein 3O

<4 OOs, SEQUENCE: 5 Ctgc.cagttg taccagggca agaag 25

<210s, SEQ ID NO 6 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Probe of cortactin

<4 OOs, SEQUENCE: 6 Cagalagatgg aggtgcagcg cc.ggc 25 US 2015/0292028 A1 Oct. 15, 2015 73

- Continued

<210s, SEQ ID NO 7 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for structural maintenance of chromosomes 4.

<4 OO > SEQUENCE: 7 aaaagaagga agaattgt at ttgca 25

<210s, SEQ ID NO 8 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Probe for cortactin

<4 OOs, SEQUENCE: 8 Ctaccaggct gcgggcgatg atgag 25

<210s, SEQ ID NO 9 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for SON DNA binding protein

<4 OOs, SEQUENCE: 9 caaacatttit ct ctittaggg tattg 25

<210s, SEQ ID NO 10 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Probe for TIA1 cytotoxic granule-associated RNA binding protein

<4 OOs, SEQUENCE: 10 cc.cgtgcaac agcagaatca aattg 25

<210s, SEQ ID NO 11 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 11 aaagaggagg aagctgttac Catag 25

<210s, SEQ ID NO 12 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 12 gccagtgaac titcgaggct gtctg 25

<210s, SEQ ID NO 13 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 13

US 2015/0292028 A1 Oct. 15, 2015

1. A method for predicting the likelihood of an indolent 11. The method of claim 1, wherein the expression prod form of Polycythemia Vera (PV) transforming to an aggres ucts of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, sive form of PV in a subject, the method comprising: SON, TIA1, and MYL9 are measured by determining protein (a) measuring the gene products of PCNA, IFI30, TSN, expression levels. CTSA, SMC4, CDKN1A, CTTN, SON, TIA1, and 12. The method of claim 1, wherein the biological sample MYL9 in a biological sample comprising blood cells comprises peripheral blood or bone marrow. obtained from the subject; 13. The method of claim 1, wherein the indolent form of (b) making the following comparisons of the gene product PV is characterized by at least one of symptom selected from levels measured in (a) and recording a score of 1 for a the group consisting of increased production of red cells, true result and a score of 0 for a false result: increased production of white cells, increased production of PCNA-IFI30; TSN>CTSA; SMC4DCDKN1A: platelets, itching, gouty arthritis peptic ulcer disease, PCNA>CTTN; SONDCTTN; TIA1>MYL9; enlarged liver or spleen, elevated hemoglobin levels, and low (c) adding the scores together to obtain an added score and erythropoietin levels in the subject. calculating a ratio of the added score/6 to calculate a 14. The method of claim 1, wherein the aggressive form of total score; and PV is characterized by at least one symptom selected from the (d) predicting based on the total score calculated in (c) the group consisting of thrombosis, heart attack, stroke, Budd likelihood of the indolent form of PV in the subject to Chiari syndrome, myelofibrosis and acute leukemia (AML) transform to an aggressive form of PV. in the subject. 2. The method of claim 1, whereina total score of 5/6 or 6/6 15. The method of claim 1, wherein the method displays a predicts that the indolent form of PV in a subject is likely to sensitivity of at least 80% and a specificity of at least 90%. transform to an aggressive form of PV in the subject. 16. The method of claim 1, further comprising informing 3. The method of claim 1, whereina total score of less than the subject or a treating physician of the likelihood of the 5/6 predicts that the indolent form of PV in a subject is not indolent form of Polycythemia Vera (PV) transforming to an likely to transform to an aggressive form of PV in the subject. aggressive form of PV in the subject. 4. The method of claim 1, wherein the blood cells are white 17. The method of claim 1, wherein the method is used to blood cells. determine if a subject should undergo further therapy for PV. 5. The method of claim 1, wherein the blood cells are 18. The method of claim 17, further comprising treating the CD34+ cells. patient with further therapy for PV. 6. The method of claim 1, wherein the subject is mamma 19. The method of claim 18, wherein the therapy is selected lian. from the group consisting of bone marrow transplantation, 7. The method of claim 6, wherein the subject is human. pegylated interferon, chemotherapy, and ruXolitinib. 8. The method of claim 1, wherein the expression products 20. A diagnostic kit for determining whether an indolent of PCNA, IFI30, TSN, CTSA, SMC4, CDKN1A, CTTN, form of PV in a subject is likely to transform to an aggressive SON, TIA1, and MYL9 are measured by determining mRNA form of PV, the kit comprising a means for measuring the expression levels. gene product levels of PCNA, IFI30, TSN, CTSA, SMC4, 9. The method of claim 8, wherein the mRNA expression CDKN1A, CTTN, SON, TIA1, and MYL9 and a set of levels are measured by using reverse transcription PCR (RT instructions comprising an algorithm for predicting if the PCR). indolent form of PV in the subject is likely to transform to an 10. The method of claim 9, wherein the reverse transcrip aggressive form of PV. tion PCR (RT-PCR) is followed by real-time PCR (Q-PCR). k k k k k