Role of the TFG N-Terminus and Coiled-Coil Domain in the Transforming Activity of the Thyroid TRK-T3 Oncogene

Role of the TFG N-terminus and coiled-coil domain in the transforming activity of the thyroid TRK-T3 oncogene

Angela Greco, Lisa Fusetti, Claudia Miranda, Riccardo Villa, Simona Zanotti, Sonia Pagliardini and Marco A Pierotti

Division of Experimental Oncology A, Istituto Nazionale Tumori, Milan, Italy

The thyroid TRK-T3 oncogene results from the fusion of expression of the NTRK1 TK domain in the epithelial the tyrosine kinase (TK) domain of NTRK1 (one of the follicular cells, their cytoplasmic localization and their receptors for the Nerve Growth Factor) on chromosome constitutive, ligand independent activation (Pierotti et 1 to sequences of a novel gene, TFG, on chromosome 3. al., 1996). The dimerization domains present in the The 68 kDa TRK-T3 fusion oncoprotein displays a activating genes are represented by coiled-coil domains. constitutive tyrosine kinase activity resulting in its Such motifs consist of heptad repeats of leucine capability to transform mouse NIH3T3 cells. The TFG residues over a span of 20 ± 30 amino acids and confer portion of TRK-T3 contains a coiled-coil domain most to the protein the capability to fold into a coiled-coil likely responsible for the constitutive, ligand-independent (Lupas et al., 1991; Lupas, 1996). Computer-assisted activation of the receptor tyrosine kinase activity. We sequence analysis has shown the presence of coiled-coil have previously shown that TRK-T3 oncoprotein forms, domains in the activating portion of almost all the in vivo, complexes of three or four molecules. By mean RTK-derived oncogenes (Rodrigues and Park, 1993). of dierent experimental approaches, we show here that Such motifs, most likely, promote the self-association TRK-T3 activity depends on oligomers formation. In of the oncoproteins that triggers the constitutive trans- addition, the analysis of dierent TRK-T3 mutants autophosphorylation of the tyrosine-kinase domain, indicates that the TFG coiled-coil domain and its N- thus mimicking the receptor dimerization upon ligand terminal region are both required for the activation and binding. However, the role of coiled-coil domains in the fully transforming activity of the TRK-T3 oncopro- oncogenic activation has been documented only for the tein, although, most likely, they play a role in dierent MET (Rodrigues and Park, 1994) and the PTC1 (Tong steps of the transforming process. The deletion of the et al., 1997) oncogenes, whereas it remains inferred but coiled-coil domain abrogates the oligomers formation not proved for the other RTK-derived oncogenes, leading to a constitutive activation; the deletion of the N- including TRKs. terminal region, although not aecting phosphorylation The TRK-T3 oncogene, detected in a papillary and complexes formation, abrogates transformation, thus thyroid tumor, is activated by TFG (TRK Fused suggesting a role in cellular localization and/or interac- Gene), a novel gene on chromosome 3. TRK-T3 tion with substrata. encodes a 68 kDa cytoplasmic protein displaying a constitutive tyrosine phosphorylation and capable to Keywords: TRK oncogenes; coiled-coil domain; onco- transform NIH3T3 mouse ®broblasts (Greco et al., genic transformation 1995). The TFG gene encodes a 2.4 kb mRNA expressed in a broad variety of fetal and adult tissues. The predicted amino acid sequence indicated that TFG contains a Introduction potential coiled-coil domain that could play an important role in the ligand-independent activation of The thyroid TRK oncogenes are created by chromo- TRK-T3 oncogene. Based on the sedimentation pro®le somal rearrangements occurring in the thyroid on a sucrose density gradient, we have recently shown follicular epithelium cells and producing chimeric that the TRK-T3 oncoprotein may form, in vivo, oncogenes containing the NTRK1 tyrosine-kinase complexes of three or four molecules (Greco et al., (TK) domain fused to dierent 5' activating sequences 1995). Recently, the presence of several putative (Pierotti et al., 1996 for review). Previous studies, phosphorylation sites for PKC and CK2 has been performed in our laboratory, have shown that TRK reported in the TFG portion contained in TRK-T3 activation is achieved by the involvement of three (Mencinger et al., 1997). dierent activating sequences: TPM3, TPR and TFG. The speci®c aims of the present study are: (1) to These genes, as well as the genes activating other study in details the previously observed complexes receptor tyrosine kinase (RTK)-derived oncogenes, formation capability by mean of dierent experi- code for proteins sharing some common features: mental approaches; and (2) to precisely de®ne the constitutive expression, cytoplasmic localization, pre- role of the TFG sequences in TRK-T3 oncogenic sence of dimerization domains. Such properties are activation. conferred to the oncogenes and determine the ectopic The ability of TRK-T3 to form complexes was demonstrated by several evidences: capability to bind to a GST/TRK-T3 fusion protein; coimmunoprecipita- Correspondence: A Greco tion with a HA-tagged TRK-T3 protein; inhibition of Received 10 July 1997; revised 24 September 1997; accepted 25 phosphorylation and transforming activity by coex- September 1997 pressing the wild type TRK-T3 and a dominant- TRK-T3 oncogene structure/function analysis AGrecoet al 810 negative tyrosine-kinase defective mutant. To study the role of the TFG sequences we have constructed several TRK-T3 mutants involving the coiled-coil as well as the N-terminal region and assayed for the phosphorylation status, the transforming activity and the capability to form complexes. Our results show that TRK-T3 cDNAs carrying point mutations within the coiled-coil domain still retain the capability to form complexes (in our experimental conditions) but show a reduction of both phosphorylation and transformation; the deletion of the same region completely abolishes all the biochemical and biological activity analysed. The deletion of the amino terminal portion does not aect phosphorylation and complexes formation; however, it completely abolishes the TRK-T3 transforming activity. Our data support the model of constitutive activation triggered by a constitutive dimerization of the oncoproteins. More- over, they suggest an important role also for the regions outside the coiled-coil.

Results

Construction and expression of TRK-T3 mutants Figure 1 Schematic representation of wild type and mutant TRK-T3 oncoproteins. The portions contributed by TFG and The structure of the wild type and mutated TRK-T3 NTRK1 are indicated. Functional domains include the coiled-coil proteins is shown in Figure 1. The TRK-T3 cDNA is (Leu), the transmembrane (TK) and the tyrosine kinase (TK) domain. The K309-Ala309 miscoding mutation present in mutant made of 592 amino acids, 193 of which are encoded by T3/DN is indicated by a triangle. The region deleted in T3/DN TFG. The coiled-coil domain spans 28 amino acids and T3/DLeu are indicated by bridging lines. The Leucine ± Valine (from Leu97 to Glu124) (Greco et al., 1995). The substitutions within the coiled-coil domain are indicated by mutant T3/DLeu lacks the coiled-coil domain of TFG; asterisks. The molecular weight of the dierent proteins is indicated on the right. The expanded region at the bottom it was constructed by PCR ampli®cation of the two shows the sequence of the coiled-coil with its corresponding TRK-T3 fragments followed by ligation at a de novo heptad frame; the core three heptads are boldfaced (Greco et al., introduced BamHI restriction site. The resulting 1995) construct lacks amino acids 98 ± 130, contains a Glu- Ser insertion due to the cloning strategy and encodes a 561 amino acids protein (MW 62 kDa). The T3/L-V phosphorylation level comparable to the wild type and T3/3L-V mutants were constructed by site-directed (Figure 2). mutagenesis by which the leucines in position d of the coiled-coil were changed to valine (see Materials and TRK-T3 self-association depends on the coiled-coil motif methods). Mutant T3/L-V carries the mutation of the leucine of the central coiled-coil heptad; in T3/3L-V all We have previously shown that TRK-T3 may form, in the three leucine residues were mutated (Figure 1). vivo, complexes of three or four molecules, based on Mutant T3/DN lacks amino acids 2 ± 90, containing the sedimentation pro®le on a sucrose density gradient putative phosphorylation sites for PKC and CK2 (Greco et al., 1995). To study more in detail this (Mencinger et al., 1997); it was constructed by PCR, feature we used several dierent approaches, based on as described in Materials and methods and encodes a in vitro binding, coimmunoprecipitation with an protein of 503 amino acids (MW 56 kDa). The TRK- epitope-tagged construct, and in vitro and in vivo T3 mutant constructs were inserted into the PRC/CMV inhibition by a dominant-negative tyrosine-kinase mammalian expression vector; transient transfection defective mutant. into COS1 cells followed by Western blot analysis with For the in vitro binding assay we constructed a NTRK1 antibodies showed that the constructs express GST/TRK-T3 fusion protein (see Materials and proteins of the expected molecular weight (Figure 2a). methods), containing the TRK-T3 oncoprotein from To detect the phosphorylation status of the mutated amino acid 23 to the carboxyl terminus fused in frame proteins, a twin blot was hybridized with the antipho- to the glutathione-S-transferase. The 92 kDa GST/ sphotyrosine antibody. The T3/DLeu, lacking the TRK-T3 fusion protein, designated as GST/T3, was coiled-coil domain, does not display a detectable puri®ed by anity chromatography on glutathione- phosphorylation (Figure 2b). With respect to the agarose (data not shown). The wild type TRK-T3 point mutants, the phosphorylation of T3/L-V is protein was then translated in vitro in the presence of comparable to that of the wild type, whereas that of [35S]methionine using plasmid pT3E19A; the speci®city T3/3L-V is slightly reduced (Figure 2). Since mutant of the translation product was demonstrated by T3/L-V resulted not dierent from the wild type from immunoprecipitation with TRK-speci®c antibody this analysis and from the NIH3T3 transformation (Figure 3a). After incubation with the GST/T3 fusion assay (see relative section) it has not been considered in protein conjugated to glutathione-sepharose beads, the other experiments. The T3/DN mutant shows a 35S-labeled TRK-T3 protein was eluted from the TRK-T3 oncogene structure/function analysis AGrecoet al 811 complex, thus reproducing in vitro the previously copies of the HA epitope; the resulting construct, observed capability to form oligomers. pHA/T3, encodes a 71 kDa protein with the HA The self-association capability was also demon- epitopes at its N-terminal, that reacts with both the strated by coimmunoprecipitation experiments using a anti-HA and the anti TRK antibodies in Western blot HA-tagged TRK-T3 protein. The TRK-T3 cDNA was analysis (Figure 4). The wild type and the HA-tagged inserted into the pcDNA/HA vector containing three TRK-T3 constructs were transiently co-transfected into

a Leu cl.1 Leu cl.2 N ∆ ∆ ∆ T3wt T3/ T3/ T3/L-V Mock T3/3L-V T3wt T3wt T3/

p68 p68 p62 p56 IP α-TRK WB α-TRK

p68 p68 IP α-TRK p56 WB α-Ptyr

c Leu N ∆ ∆ T3wt T3/ T3/L-V T3/

p68 p62 p56

IP α-TRK WB α-TRK

Figure 2 Expression and tyrosine phosphorylation of wild type and mutated TRK-T3 proteins. (a and b) Cell extracts from transiently transfected COS1 cells, treated with sodium orthovanadate (Na3VO4), were immunoprecipitated (IP) with antiTRK antibodies; twin panels were immunoblotted (WB) with antiTRK (a) or antiphosphotyrosine (b) antisera. Two dierent T3/DLeu clones (cl1 e cl2) were used. (c) Cell extracts from NIH3T3 cell lines expressing the dierent TRK-T3 construct were immunoprecipitated (IP) and immunoblotted (WB) with antiTRK antibodies. TRK-T3 speci®c bands were revealed by ECL system (see Materials and methods)

a b Leu N Leu N TRK ∆ ∆ ∆ ∆ α + + GST/T3 + GST T3wt T3/3L-V T3/ T3/ T3wt T3/3L-V T3/ T3/

p68 p68 p56 p68 p62 p56

In vitro translated In vitro GST/T3 TRK-T3 protein translation binding

Figure 3 In vitro self-association assay of wild type and mutated TRK-T3 proteins. cDNA constructs inserted into the pRC/CMV vector were transcribed and translated in vitro as described in Materials and methods. (a) The product of the wild type TRK-T3 cDNA (plasmid pT3E19A) in vitro translation was immunoprecipitated with antiTRK antibodies, incubated with the sepharose- bound GST-T3 or GST protein produced in bacteria. (b) The in vitro translated proteins were electrophoresed before (left) or after (right) incubation with the sepharose-bound GST/TRK-T3 fusion protein (see Materials and methods). The molecular weights of the dierent TRK-T3 proteins are indicated TRK-T3 oncogene structure/function analysis AGrecoet al 812 a b HA/T3 T3wt T3wt

+T3wt +T3/3L-V +T3/∆Leu +T3wt

p71 T3/ABN5 T3/ABN6 +T3/ABN5 +T3/ABN6 +pRC/CMV T3/ABN5 T3/ABN6 +T3/ABN5 +T3/ABN6 +pRC/CMV p68 p62 p68 IP: αTRK αHA αTRK αHA αHA αTRK p68 WB: αTRK IP: αTRK Figure 4 Self-association of TRK-T3 proteins in immunoprecipitation assay. The HA-tagged TRK-T3 cDNA (plasmid pHA/ WB: αTRK αPtyr T3) was transiently transfected into COS1 cells together with the Figure 5 Dominant-negative eect of Lys309-Arg309 mutation. wild type or the mutant TRK-T3 constructs. Cell extracts were Two independent clones (pT3/ABN5 and 6) carrying the mutation immunoprecipitated (IP) with the indicated antibodies and of the ATP binding site were transfected alone or in combination immunoblotted (WB) with antiTRK antibodies. The molecular with the wild type cDNA (pT3E19A); as control the wild type weights of the dierent TRK-T3 proteins are indicated was cotransfected with the empty vector (pRC/CMV). The amounts of DNAs were: 15 mg for pT3/ABNs and pRC/CMV, 1 mg for pT3E19A. Cells extracts were immunoprecipitated (IP) with antiTRK and immunoblotted (WB) with antiTRK (a)or COS1 cells. Western blot analysis of cell extracts antiphosphotyrosine (b) antisera immunoprecipitated with anti-HA and hybridized with antiNTRK1 antibodies detected both the p68TRK-T3 and the p71HA/T3 proteins (Figure 4), thus indicating that the two proteins coimmunoprecipitate. These results provide a further evidence of TRK-T3 self- association. We also tested the eect of a dominant-negative tyrosine-kinase defective TRK-T3 mutant on the wild type TRK-T3 activity. The lysine residue of the ATP binding site (Lys309 (Greco et al., 1995), corresponding to Lys538 of the NTRK1 receptor (Martin-Zanca et al., 1989)) was changed to alanine by site-directed mutagenesis. This mutation has been shown to produce a kinase-defective receptor with a dominant-negative T3wt+pRC/CMV T3wt+T3/ABN5 eect on the wild type counterpart (Jing et al., 1992). Figure 6 Inhibition of TRK-T3 transformation by the tyrosine- Western blot analysis of the kinase-defective TRK-T3 kinase defective mutant. NIH3T3 cells were transfected as cDNA (plasmids pT3/ABN, two independent clones) described in Materials and methods. Ten nanograms of pT3E19A plasmid were cotransfected with 200 ng of pRC/CMV expressed into COS1 cells revealed that, as expected, or pT3/ABN5 plasmids. Plates were ®xed and stained after 3 the relative protein was unphosphorylated (Figure 5). weeks of selection When the mutant was coexpressed with the wild type TRK-T3 cDNA, a reduced steady-state phosphorylation level of the TRK-T3 protein was observed (Figure Table 1 TRK-T3 tyrosine kinase-defective mutant inhibits the 5), thus indicating that TRK-T3 phosphorylation biological activity of the wild type oncogene requires the formation of complexes. The biological Transformed foci Percentage 3 signi®cance of these results was determined by NIH3T3 Transfected DNA (N/mg DNA610 ) inhibition transfection/focus formation assay. Three independent T3wt+pRC/CMV 47.7 ± clones of the kinase-defective mutant were transfected T3wt+T3/ABN5 5.7 88% T3wt+T3/ABN6 16.8 65% alone or in combination with the wild type pT3E19A T3wt+T3/ABN11 13.5 72% plasmid. All the plasmid produced G418 resistant T3/ABN5 50.001 ± colonies with a comparable eciency (data not T3/ABN6 50.001 ± shown). As shown in Table 1 and Figure 6, the T3/ABN11 50.001 ± pT3E19A produced multiple foci, whereas cells HMW carrier 50.001 ± transfected with pT3/ABNs did not exhibit detectable NIH3T3 transfection assay was carried out as described in Materials levels of morphological transformation. However, and methods, using 10 ng of pT3E19A plasmid DNA together with 200 ng of pRC/CMV and pT3/ABN5DNA and 30 mg of carrier when cotransfected with the wild type cDNA, the DNA. Plates were ®xed and stained after 3 weeks of selection mutant plasmids inhibited the TRK-T3 transformation of 65 ± 88% (Table 1 and Figure 6). These results are compatible with the formation of hetero oligomers involving wild type and mutated TRK-T3 molecules T3 fusion protein conjugated to the glutathione- and thus indicate that formation of complexes is a agarose: as shown in Figure 3b, a binding activity functional requirement for TRK-T3 transforming was detected for T3/3L-V and T3/DN but not for T3/ activity. DLeu. In keeping with this result, cotransfection of T3/ To test the eect of the TFG mutations on the HA and TRK-T3 mutants followed by Western blot TRK-T3 self-association capability, all the in vivo and analysis as above described, showed that T3/3L-V but in vitro assays described above were performed with the not T3/DLeu coimmunoprecipitates with HA/T3 TRK-T3 mutants. 35S-methionine-labeled T3/3L-V (Figure 4) indicating that the complex formation and T3/DLeu proteins were incubated with the GST/ capability is retained by the point mutant but is lost TRK-T3 oncogene structure/function analysis AGrecoet al 813 by the one carrying the deletion. Taken together, the in vivo and in vitro results indicate that the TFG coiled- 2 weeks 3 weeks coil domain but not the N-terminal region is essential for the formation of TRK-T3 complexes leading to trans-autophosphorylation of the TK domain.

Both the N-terminal region and the coiled-coil domain are required for TRK-T3 transforming activity T3 wt 20 ng To determine the role of self-association in TRK-T3 oncogenic activation, we examined the transforming activity of wild type and mutant TRK-T3 cDNAs upon transfection into NIH3T3 cells. All the TRK-T3 expression plasmids produced G418-resistant colonies with comparable eciency (data not shown). With respect to the transforming eciency, the wild type and the T3/L-V mutant produced numerous foci after 2 T3/3L-V 20 ng weeks of selection; however, at the same time, the T3/ 3L-V mutant produced small-size, barely visible foci (Figure 7 and Table 2). The T3/3L-V transforming eciency, calculated from plated ®xed after 3 weeks of selection, resulted 1/6 of that of the wild type (Table 2). Thus, T3/3L-V produced foci with eciency and growth rate reduced with respect to the wild type. The transfection of T3/DLeu and T3/DN did not T3/3L-V 500 ng produce transformed foci. Moreover, individual G418- resistant colonies expressing considerable amount of the mutated proteins (Figure 2c) display a non- transformed phenotype (data not shown), ruling out the possibility that the lack of transformation could be ascribed to a low expression of the mutated TRK-T3 proteins. Thus, mutations or deletion of the coiled-coil motif as well as deletion of the N-terminal region aect T3/∆Leu 500 ng the transforming activity of TRK-T3 oncoprotein, suggesting a crucial role of these regions in the biological activity of TRK-T3.

Discussion

In the present study we have analysed the capability of T3/∆N 500 ng TRK-T3 oncoprotein to form complexes and the role Figure 7 Transforming activity of wild type and mutated TRK- of TFG sequences, in particular the coiled-coil domain, T3 cDNAs. NIH3T3 cells were transfected with the indicated in this process and in cell transformation. Previously, DNA as described in Materials and methods. Duplicate plates we have reported that TRK-T3 may form, in vivo, were ®xed after 2 and 3 weeks of selection complexes of three or four molecules, based on the sedimentation pro®le on a sucrose density gradient (Greco et al., 1995). In the present paper we have reported experimental evidences strongly supporting Table 2 Eect of mutations within the coiled-coil domain on TRK- the previous observation; we have identi®ed the coiled- T3 transformation coil domain as the element conferring the oligomeriza- Foci Foci tion capability and shown that it is necessary for TRK- Transfected Dose (N/mg DNA6103) (N/mg DNA6103) T3 transforming activity. However, oligomerization per DNA (ng) 2 weeks 3 weeks se is not sucient; other mechanisms, mediated by a T3wt 10 3.8 ± region outside the coiled-coil, play a role in the full 20 4.2 18.5 oncogenic activation of TRK-T3. 100 1 6 We have expressed the TRK-T3 oncoprotein in T3/L-V 20 3.2 12.1 T3/3L-V 10 50.001 50.001 bacteria, as a GST/TRK-T3 fusion protein; by an in 20 sf 2.8 vitro assay we demonstrate its ability to bind to the 35S- 100 sf 3.4 labeled oncoprotein. Similarly, we have shown that the T3/DLeu 50 50.001 50.001 TRK-T3 oncoprotein coimmunoprecipitates with a 500 50.001 50.001 HA-epitope-tagged TRK-T3 protein. Moreover, when T3/DN 50 50.001 50.001 500 50.001 50.001 the wild type was coexpressed with a kinase-defective HMW carrier 30 000 50.001 50.001 TRK-T3 mutant, a reduction of phosphorylation level NIH3T3 transfection was performed as described in Materials and and transforming activity was observed. Altogether methods. Plates were ®xed and stained as the indicated times. these results demonstrate that TRK-T3 forms com- sf=small foci TRK-T3 oncogene structure/function analysis AGrecoet al 814 plexes in vivo. This feature is common to several fusion precise role of TFG N-terminal region requires further oncoproteins, derived from receptor and non-receptor investigations. tyrosine kinases, in which the complexes formation is The reduced transforming activity of the T3/3L-V mediated either by coiled-coil or by other dimerization mutant suggests that although the introduced muta- domains (McWhirter et al., 1993; Golub et al., 1996; tions do not disrupt coiled-coil interaction, they Carroll et al., 1996; Tong et al., 1997). The number of interfere with its stability. In this contest, it should TRK-T3 molecules involved in a complex remains to be noted that the in vitro binding and the coimmuno- be determined; the in vitro binding and the coimmu- precipitation experiments, using the wild type and the noprecipitation experiments are not informative on this mutated protein, are not suitable for pointing out a point. The data produced by the sucrose gradient dierent strength of interaction caused by the sedimentation pro®le would suggest a complex of three introduced mutations. Interestingly, the same leucine or four molecules (Greco et al., 1995). It has been to valine mutations, introduced into one of the coiled- reported that coiled-coils can form dimers, trimers and coil domains of the MET oncogene, inhibited the tetramers (Harbury et al., 1993). The coiled-coil dimerization and transforming activity (Rodrigues and domain of the BCR/ABL oncogene has been shown Park, 1993). The eect of the leucine to valine to promote tetramerization (McWhirter et al., 1993). substitutions introduced in two dierent coiled-coils Moreover, a four molecules arrangement is compatible (TPR and TFG) indicates dierent strength of with a recently proposed model for receptor tyrosine interaction related to the amino acids composition. kinase activation. Based on crystallographic studies We have previously reported that the presence of only Mohammadi et al. (1996) have proposed that receptors hydrophobic residues in position a of the TFG coiled- autophosphorylation would occur between dimers coil should increase its predicted stability of association rather than within a dimer, thus requiring the (Greco et al., 1995). occurrence of high order receptor oligomerization. In conclusion, we have demonstrated that the TRK- However, the determination of the precise number of T3 transforming potential depends on the complexes molecules involved in the TRK-T3 complex requires formation capability triggered by the coiled-coil speci®c experimental approaches and it is not domain. Several examples of oncogenic activation mandatory for the present work. mediated by oligomerization have been reported. The In order to study the role of the TFG sequences, in BCR/ABL and the TEL/ABL oncoproteins, derived particular the coiled-coil domain, in the TRK-T3 from the activation of the non-receptor-tyrosine kinase complexes formation and oncogenic activation, we by the BCR and the TEL proteins, respectively, have have constructed four mutants: the ®rst one lacks the been shown to form oligomers mediated by a coiled-coil coiled-coil domain; in the second one the leucine in domain (BCR/ABL) (McWhirter et al., 1993) and by a position d of the central heptad of the coiled-coil was helix ± loop ± helix domain (TEL/ABL) (Golub et al., mutated to valine; in the third one the three leucines in 1996) present in their relative activating portion. In position d were mutated; the fourth one carries the addition, the TEL helix ± loop ± helix motif promotes deletion of the 89 amino acids preceding the coiled- also the self-association and activation of the TEL/ coil. In vitro binding and coimmunoprecipitation PDGFR oncogene (Carroll et al., 1996). Furthermore, experiments indicate that the deletion of the coiled- the oncogenic potential of the MET oncogene depends coil domain abolishes the capability to form complexes, on dimerization mediated by the coiled-coil domain while the point mutations and the amino terminal within TPR (Rodrigues and Park, 1994); the mitogenic deletion do not have any detectable eect. activity of the ret/ptc2 oncogenes requires the dimeriza- The role of the N-terminus and of the coiled-coil tion domain of the RIa activating gene (Durick et al., domain on the transforming activity was investigated 1995). Recently Tong et al. (1997) have reported that by NIH3T3 transfection/focus formation assay. No dimerization, mediated by a leucine zipper motif, is transforming activity was detected for the T3/DLeu essential for the PTC1 oncogenic activity. and T3/DN mutants. The T3/L-V point mutant Thus, the complexes formation is a mechanism of displays a transforming activity comparable to that of activation common to a growing group of oncogenes the wild type, whereas the T3/3L-V mutant transforms derived from tumor-associated tyrosine kinase rearran- NIH3T3 cells with an eciency and a growth rate gements. However, the lack of transforming activity in reduced with respect to the normal counterpart. Taken the presence of phosphorylation showed by mutant together, these results indicate that both the coiled-coil lacking the N-terminus suggests that other mechan- domain and the N-terminal region play a crucial role in isms, beside complexes formation, play a role in the transforming capability of TRK-T3 oncogene, but conferring the full oncogenic potential. they are involved in dierent steps. The coiled-coil is involved in the formation of complexes; the N-terminal region could be responsible for the cellular localization Materials and methods of the oncoprotein as well as for its interaction with speci®c substrata. In this context, it is worth Cell culture and transfection mentioning that the full transforming activity of BCR/ABL requires the presence of a region contain- Mouse NIH3T3 ®broblasts and monkey COS-1 cells were ing a SH2 domain, in addition to the oligomerization maintained in Dulbecco's modi®ed Eagle's medium domain (McWhirter et al., 1993). However, the supplemented with 10% calf serum and 10% fetal calf serum, respectively. NIH3T3 cells (2.56105/10 cm plate) sequence of the TFG amino terminal region revealed were transfected by the CaPO4 method as previously the presence of PKC and PK2 phosphorylation sites described (Bongarzone et al., 1989), using 10 ± 500 ng of (Mencinger et al., 1997) but not SH2 docking sites or plasmid DNA together with 30 mg of mouse DNA. proline-rich regions. Therefore, understanding the Transformed foci were selected in DMEM containing 5% TRK-T3 oncogene structure/function analysis AGrecoet al 815 serum; G418-resistant colonies in DMEM plus 10% serum plasmid linearized with the same restriction enzymes. The and G418 antibiotic (500 mg/ml). Transformed foci and resulting plasmid (pGT3DLeu) carries the deletion of G418-resistant colonies were either ®xed or isolated for nucleotides 309 ± 408. After nucleotide sequence the deleted further studies 2 or 3 weeks after transfection. COS-1 cells TRK-T3 cDNA was excised from plasmid pGT3/DLeu by were transfected by the DEAE-dextran-chloroquine treat- ApaI/NotI digestion and inserted into the pRC/CMV vector ment (Luthman and Magnusson, 1983). Exponentially linearized with the same restriction enzymes, to produce pT3/ growing cells (106/10 cm plate) were incubated with 2 ml DLeu. of serum-free medium containing 300 ng of DEAE-dextran The T3/DN mutant was constructed by PCR ampli®cation. and 2 ± 10 mg of plasmid DNA for 30 min at 378C. After The oligonucleotides utilised were AG3046 (5'-ATCCTG- three washes with serum-free medium the cells were treated GAGTCCACCATGAATGGCCAGCCAAGACC-3', con- with 10 mM chloroquine in medium supplemented with taining nucleotides 4 ± 21 fused to nucleotides 289 ± 305 of 10% serum for 3 h. Afterwards cells were reefed with 10%- the cDNA) and AG2964 (5'-TTTTTTTTCAAGGGATAA- serum medium, incubated for 2 ± 3 days and then processed TAAA-3', nucleotides 1988 ± 2010). The ampli®ed fragment for protein extraction. was introduced into pGEMT vector, subjected to nucleotide sequence, excised by ApaI/NotI digestion and inserted into pRC/CMV expression vector carrying identical ends. The Western blot analysis resulting construct encodes a protein in which the initiation Cell lysates were prepared as described elsewhere (Borrello codon is followed by Asn 91. et al., 1994). After immunoprecipitation with the indicated To construct the GST/T3 plasmid the 2043 bp EcoRI antibody, the protein samples were electrophoresed on a fragment (from nucleotide 87 to the 3' end of the cDNA) was sodium-dodecyl-sulfate (SDS)-polyacrylamide gel, (8.5%), excised from plasmid PCRT3 and inserted into the EcoRI site transferred to nitrocellulose ®lters, and immunoblotted of the pGEX4T-2 vector, in frame with the GST protein with the indicated antisera. Immunoreactive bands were translation. visualised by using horseradish peroxidase-conjugated For the pHA/T3 expression vector the pcDNA3/HA secondary antiserum and enhanced chemiluminescence plasmid (kindly provided by Dr JC Reed), carrying three (Amersham). HA epitopes was used. The construction included several The polyclonal NTRK1-speci®c antibody has been steps, as follows. A 5'-end fragment was produced by PCR previously described (Borrello et al., 1994); the anti-HA ampli®cation using oligonucleotides AG4212 (5'-ATTAT- monoclonal antibody was kindly provided by Dr K Helin; GGATCCCGGGGAACGGACAGTTGGA - 3', nucleotides the monoclonal antiphosphotyrosine antibody was purchased 21 ± 35 of the cDNA preceded by a tail containing BamHI from Upstate Biotechnology Incorporated. and SmaI restriction sites) and AG3056 (5'-TAATAGGATC- CAAGGGGTCTTGGCTGGCC-3', nucleotides 291 ± 309). The ampli®ed 313 bp fragment was inserted into the Plasmid construction pGEMT plasmid vector to produce plasmid pG5'313 that was sequenced to verify the absence of any mutation The construction of the pT3E19A, containing the full- introduced by the Taq polymerase. Plasmid pG5'313 was length TRK-T3 cDNA inserted into the pRC/CMV then digested with PstI and EcoRI, cutting in the insert and expression vector, has been previously reported (Greco et in the vector sequences, respectively. This digestion produces al., 1995). All the point mutants were constructed by site- a linear vector containing the ®rst 100 nucleotide of the directed mutagenesis using an in vitro oligonucleotide ampli®ed fragment that was isolated. After blunting the PstI mutagenesis system (Altered Sites in vitro Mutagenesis end with Klenow DNA polymerase, the linear plasmid was System, Promega). To construct mutant T3/L-V the ligated with the 2043 bp EcoRI/XbaI blunt TRK-T3 Leucine in position 112 was changed to Valine using the fragment isolated from the PRC T3 expression plasmid. oligonucleotide AG3970 (5'-ATTTCGAACTTCTATCA- The resulting pGT3/NT plasmid contains a TRK-T3 cDNA 3'). Mutant T3/3L-V was constructed from T3/L-V using lacking the ATG starting codon that was isolated by simultaneously oligonucleotides AG3969 (5'-TCGACGGA- digesting with SmaI and XhoI and ligated to the pcDNA3/ CATATTTCA-3') and AG3971 (5'-CTATCCAATACAC- HA vector carrying EcoRI/blunt and XhoI ends. The GATTCAC-3') carrying the mutations of Leucines 105 and resulting pHA/T3 plasmid contains the TRK-T3 sequences 119, respectively. The T3/ABN mutant was constructed fused in frame with the HA translation and encodes a protein using nucleotide AG4572 (5'-CTTCTTCAGTGCCGCGA- of predicted molecular weight 71 kDa. CAGCCACCAGC-3', oligonucleotides 1020 ± 1047) carrying the mutation of the ATP binding site Lysine 309 to Alanine. Mutant clones were identi®ed by PCR followed DNA sequencing by allele-speci®c oligonucleotide (ASO) hybridization. Clones positive by these analyses were subjected to Nucleotide sequence was determined by the dideoxy chain nucleotide sequence; selected clones were transferred into terminator method (Sanger and Nicklen, 1977) using the the PRC/CMV expression vector. sequenase kit (US Biochemical). The T3/DLeu mutant was constructed by PCR amplifica- tion followed by DNA ligation. The 5' moiety was ampli®ed In vitro translation using oligonucleotides AG3055 (5'-ATCCTGGAGTCCAC- CATG-3', nucleotide 4 ± 21 of the cDNA) and AG3056 (5'- The TRK-T3 wild type and mutated cDNAs cloned into TAATAGGATCCAAGGGGTCTTGGCTGGCC-3', nucleo- pGEM3 or pRC/CMV vectors were subjected to in vitro tides 292 ± 309 followed by a tail carrying the BamHI transcription-translation using the TNT coupled reticulo- restriction site). The 3' moiety was ampli®ed using cyte lysate system (Promega), according to the manufac- oligonucleotide AG3057 (5'-ATTATGGATCCCCTTCCAC- turer's speci®cation. The proteins were labeled with 35S- CAATATT-3', nucleotides 409 ± 423 preceded by a tail methionine; reactions were performed in a volume of 50 ml, including the BamHI restriction site) and nucleotide using 1 mg of plasmid DNA as template. AG2964 (5'-TTTTTTTTCAAGGGATAATAAA-3', nucleotides 1988 ± 2010). The ampli®ed fragments were cloned into Expression and puri®cation of GST/T3 fusion protein the pGEMT vector to produce the pGT3/5' and pGT3/3' plasmids, respectively and subjected to nucleotide sequence. Escherichia coli BL21 strain was transformed with the The 5' fragment was excised from plasmid pGT3/5' by pGEX-2T and the pGST/T3 plasmids. An overnight BamHI/NotI digestion and was inserted into the pGT3/3' culture of these bacteria was diluted 1 : 10 with fresh LB TRK-T3 oncogene structure/function analysis AGrecoet al 816 medium plus ampicillin and grown at 378C until OD41. sion protein was incubated with 25 mlofin vitro translated Induction was performed by adding isopropylthiogalacto- TRK-T3 proteins in 100 mlofPLCLBat48C for 2 h. The side (IPTG) to 0.06 mM and incubating at 308Cfor2h. complexes were washed 3 ± 4 times with HNTG (20 mM The induced bacteria were pelleted, washed once with 1/5 HEPES, 150 mM NaCl, 10% glycerol, 0.1% Triton X-100). volume of STE (10 mM Tris,pH8,150mM NaCl, 1 mM The bound proteins were eluted from the complexes by EDTA) and resuspended in an equal volume of STE boiling in Laemly buer (Laemmli, 1970) and resolved on containing 100 mg/ml of lysozime. After incubation on ice 8.5% polyacrylamide gel. After ®xing in 30% methanol, for 15 min, DTT (5 mM) and Sarkosyl (1.5%) were added. 7% acetic acid the gel was treated with 1 M salicyclic acid, The cells were lysate by sonication. The lysates were sodium salt for 30 min and dried. Autoradiography was centrifuged at 15 000 g for 5 min. The supernatant was performed after overnight exposure to Hyper®lm. utilized for gel analysis, immunoprecipitation or in vitro binding assay.

In vitro binding assay Acknowledgements The GST/T3 fusion protein extracted from 5 ml of bacteria We thank Anna Grassi and Cristina Mazzadi for secretar- culture was incubated with glutathione-sepharose (Phar- ial work, Mario Azzini and Maria Teresa Radice for macia) for 30 min. After centrifugation the complexes were technical assistance, Dr K Helin for providing the anti-HA washed three times with lysis buer (STE, 5 mM DTT, antibody, Dr JC Reed for the gift of pcDNAHA plasmid. 1.5% sarkosyl) and once with PLCLB (50 mM HEPES (pH This work was supported by grants from Italian Associa- 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, tion for Cancer Research (AIRC), Special Project ACRO

1.5 mM MgCl2,1mMEGDTA, 100 mM Na4P2O7,100mM of the Italian National Research Council (CNR) and the NaF). The glutathione-sepharose-conjugated GST/T3 fu- Italian Ministry of Health.

References

Bongarzone I, Pierotti MA, Monzini N, Mondellini P, Lupas A, Van Dyke M and Stock J. (1991). Science, 252, Manenti G, Donghi R, Pilotti S, Grieco M, Santoro M, 1162 ± 1164. Fusco A, Vecchio G and Della Porta G. (1989). Oncogene, Lupas A. (1996). TIBS, 21, 375 ± 382 4, 1457 ± 1462. Luthman H and Magnusson G. (1983). Nucl. Acids Res., 11, Borrello MG, Pelicci G, Arighi E, De Filippis L, Greco A, 1295 ± 1308. Bongarzone I, Rizzetti MG, Pelicci PG and Pierotti MA. Martin-Zanca D, Oskam R, Mitra G, Copeland T and (1994). Oncogene, 9, 1661 ± 1668. Barbacid M. (1989). Mol. Cell. Biol., 9, 24 ± 33. Carroll M, Tomasson MH, Barker GF, Golub TR and McWhirter JR, Galasso DL and Wang JY. (1993). Mol. Cell. Gilliland DG. (1996). Proc. Natl. Acad. Sci. USA, 93, Biol., 13, 7587 ± 7595. 14845 ± 14850. Mencinger M, Panagopoulos I, Andreasson P, Lassen C, Durick K, Yao VJ, Borrello MG, Bongarzone I, Pierotti MA Mitelman F and Aman P. (1997). Oncogene, 41, 327 ± 331. and Taylor SS. (1995). J. Biol. Chem., 270, 24642 ± 24645. Mohammadi M, Schlessinger J and Hubbard SR. (1996). Golub TR, Goga A, Barker GF, Afar DE, McLaughlin J, Cell, 86, 577 ± 587. Bohlander SK, Rowley JD, Witte ON and Gilliland DG. Pierotti MA, Bongarzone I, Borrello MG, Greco A, Pilotti S (1996). Mol. Cell. Biol., 16, 4107 ± 4116. and Sozzi G. (1996). Genes Chrom. Cancer, 16, 1 ± 14. Greco A, Mariani C, Miranda C, Lupas A, Pagliardini S, Rodrigues GA and Park M. (1993). Curr. Opin. Genet. Dev., Pomati M and Pierotti MA. (1995). Mol. Cell. Biol., 15, 13, No.11, 6711 ± 6722. 6118 ± 6127. Rodrigues GA and Park M. (1994). Curr. Opin. Genet. Dev., Harbury PB, Zhang T, Kim PS and Alber T. (1993). Science, 4, 15 ± 24. 262, 1401 ± 1407. Sanger F and Nicklen SC. (1977). Proc. Natl. Acad. Sci. Jing S, Tapley P and Barbacid M. (1992). Neuron, 9, 1067 ± USA, 74, 5463 ± 5467. 1079. Tong Q, Xing S and Jhiang SM. (1997). J. Biol. Chem., 272, Laemmli UK. (1970). Nature, 227, 680 ± 685. 9043 ± 9047.