Role of Crumbs and Bazooka in the Organization and Distribution of DE-Cadherin in Drosophila Embryo

UNIVERSITE D’AIX-MARSEILLE ECOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE / ED 62

LABORATOIRE DE LA POLARITE CELLULAIRE ET MORPHOGENESE DES EPITHELIUMS/INSTITUT DE BIOLOGIE DU DEVELOPPEMENT DE MARSEILLE (UMR 7288)

Thèse présentée pour obtenir le grade universitaire de docteur

Spécialité : Biologie du développement

Veronika AKSENOVA

Role of Crumbs and Bazooka in the organization and distribution of DE-cadherin in Drosophila embryo

Soutenue le 18/12/2017 devant le jury :

Alexandre DJIANE Rapporteur Grégoire MICHAUX Rapporteur Julien ROYET Président du jury André Le BIVIC Directeur de thèse Thomas LECUIT Invité (Co-Directeur de thèse) Résumé

Les tissus épithéliaux sont des couches de cellules adhérentes qui servent de barrières entre différents compartiments morphologiques et procurent un transport directionnel de molécules. Pour remplir leurs fonctions, ces cellules épithéliales possèdent une architecture hautement polarisée en trois domaines distincts - apical, latéral et basal. Le domaine apical fait face à l’environnement extérieur ou lumen tandis que le domaine latéral assure l’adhésion entre les cellules voisines et le domaine basal est en contact avec la membrane basale. L’action coopérative de plusieurs déterminants de la polarité gouverne l’identité et la morphogenèse spécifiques de ces domaines : 1) le cytosquelette d’actomyosine, 2) les jonctions adhérentes (AJs) basées sur la E-cadhérine et 3) les complexes de polarité conservés au cours de l’évolution. Ainsi, l’intégrité dynamique de ces acteurs donnent lieu à l’établissement et au maintien de la polarité épithéliale. Une perte de l’adhérence via la DE-cadhérine (DE-Cad) conduit à des défauts de polarité apico-basale, tandis que la localisation apicale de DE-Cad nécessite les protéines de polarité Crumbs (Crb) et Bazooka (Baz) (L’homologue de Par3 chez la mouche). Notablement, DE- Cad forme des amas qui co-localisent partiellement avec les amas de Baz, génèrent l’adhésion intercellulaire et transmettent la tension. Cependant, les mécanismes impliqués dans le contrôle de la taille, le nombre, la répartition et la dynamique des amas de DE-Cad restent peu connus. Pendant ma thèse, je me suis concentrée sur l’interaction complexe entre les AJs formées par DE-Cad, la protéine de polarité Baz et un déterminant majeur de la polarité apicale, le complexe transmembranaire Crumbs, dans l’embryon de Drosophila. En particulier, j’ai étudié le rôle de Crumbs et Baz dans la régulation de la distribution fine de DE-Cad à la membrane. J’ai montré que Crb contrôle la distribution macroscopique de DE-Cad, au moins, partiellement via Baz. En générant des mutations de Baz sur des sites régulateurs variés grâce à de la transgenèse spécifique de site et en utilisant de la microscopie en temps réel quantitative, j’ai montré que Crb agit via le domaine d’oligomérisation CR1 et le site Ser980 de Baz afin d’ajuster les niveaux de DE- Cad aux jonctions. Remarquablement, j’ai aussi révélé que le domaine d’oligomérisation de Baz est inutile à la formation d’amas Baz-DE-Cad et j’ai caractérisé la réciprocité de l’interaction DE- Cad-Baz. En conclusion, ma thèse fournit une preuve expérimentale forte d’une interaction génétique entre les protéines de polarité Crb et Baz qui est impliquée dans les niveaux et le contrôle de la distribution de DE-Cad à la membrane. Ainsi, les protéines de polarité ne jouent pas seulement leur rôle canonique requis pour l’établissement et le maintien de la polarité apico- basale mais aussi régulent la stabilité et l’intégrité des AJs pendant l’extension de la bande germinale (GBE) lors de la gastrulation de l’embryon de Drosophila.

Abstract

Epithelia are sheets of adherent cells that serve as barriers between distinct morphological compartments and provide directed transport of molecules. To fulfil their functions, epithelial cells possess a highly polarized architecture with three distinct domains – apical, lateral and basal. Apical domain faces external environment or lumen while lateral domain ensures adhesion between neighboring cells and basal domain contacts basement membrane. The cooperative action of several polarity determinants governs the proper identity and morphogenesis of these domains: 1) actomyosin cytoskeleton; 2) E-Cadherin-based adherens junctions (AJs) and 3) evolutionarily conserved polarity complexes. Thus, the dynamic integrity of these players results in the epithelial polarity establishment and maintenance. A loss of DE- cadherin (DE-Cad) adhesion leads to apico-basal polarity defects, while the apical localization of DE-Cad requires the polarity proteins Crumbs (Crb) and Bazooka (Baz) (Par3 homolog in fly). Notably, DE-Cad builds clusters that display a certain degree of colocalization with the clusters of Baz, provide intercellular adhesion and transmit tension. However, the mechanisms involved in the control of DE-Cad cluster size, number, repartition and dynamics remain poorly understood. In my thesis, I have focused on the complex interplay between DE-Cad-mediated AJs, Baz polarity protein and a major apical polarity determinant, transmembrane Crumbs complex in Drosophila embryo. In particular, I have addressed the role of Crumbs and Baz in the regulation of DE-Cad fine distribution on the membrane. I demonstrated that Crb controls DE-cad macroscopic distribution, at least, partially via Baz. By generating Baz mutants on various regulatory sites using site-specific transgenesis and quantitative live-imaging microscopy, I showed that Crb acts via CR1 oligomerization domain and Ser980 site of Baz to adjust DE-Cad levels at the junctions. Strikingly, I also revealed that Baz oligomerization domain is dispensable for Baz-DE-Cad clusters formation and characterized the reciprocity of DE-Cad-Baz crosstalk. In conclusion, my thesis provides a strong experimental evidence of a genetic interplay between polarity proteins Crb and Baz that is implicated in the DE-Cad levels and distribution control on the membrane. Hence, polarity proteins do not only play their canonical role required for the establishment and maintenance of apico-basal polarity but also regulate AJs stability and integrity during germ band elongation (GBE) in gastrulating Drosophila embryo.

Acknowledgements

First of all, I would like to thank Dr. Alexandre Djiane, Dr. Grégoire Michaux and Prof. Julien

Royet for their agreement on reading my manuscript and to be members of my PhD Jury. I look forward to receiving their constructive criticism that, I believe, would significantly enrich my work in theoretical and experimental prospects and to initiating fruitful discussions during my

Defense.

I would like to express my deep gratitude to my scientific advisors – André Le Bivic and

Thomas Lecuit. Being very different by their nature, they both contributed a lot into my personal growth from different aspects. The weekly meetings with both of them strongly developed my analytical and presentation skills, as well as conflict-solving skills sometimes. André has always been very supportive and kind to me, consistently helped to overcome tough moments during my

PhD. It was a real pleasure for me to work under André’s guidance and in the André’s lab. I would like to acknowledge Thomas for investing into my potential and inviting me to work under the

Labex Inform funding. Every meeting with Thomas was scientifically demanding and I am thankful to him for setting ambitious goals and challenging me every week. In addition, I appreciate their mutual contribution into my scientific mobility and expanding my professional network by sending me to numerous international conferences and workshops.

I would like to acknowledge André Le Bivic team members. From the very first day in the lab, they have been very supportive and helpful with me. I thank Benoit for being my teacher in

Drosophila genetics and for helping me with imaging analysis. I would like to thank Christopher

Toret for his sense of humor, for intruding me to the American culture, for educating me in general and just not letting down during tough periods. I thank Pierre Mangeol for introducing me to the world of Physics and to spend hours trying to explain me the physics laws and the coding language.

I also appreciate the support of Elsa and Magali and for sharing their knowledge of the mammalian cell culture. I would like to thank Dominique for her attentive reading of my manuscript. We spent great time doing experiments together with our collaborators in CRCM of Institut Paoli-Calmettes.

Discussions with all of them have significantly broadened my fundamental expertise in the

4 polarity proteins. In addition, I would express my deep gratitude to Stéphane Audebert, Head of

Proteomics and Mass Spectrometry platform at the CRCM, for allowing me to conduct my experiments in his lab.

I am much obliged to Pauline Salis for her constant emotional and professional support, she has been my navigator in my life in France. I appreciate Pauline for accepting me to follow her project since our first meeting and for taking me to painting classes. Thanks to Pauline, I can draw a Drosophila embryo now.

Thomas Lecuit team has been also truly supportive to me. I thank Jean-Marc Phillipe for generating Baz constructs for me and for helping me with molecular biology techniques. I also appreciate Alain Garcia de las Bayonas, Anaïs Bailles and Girish Kale for their comprehensive help and always positive attitude.

Finally, I would like to acknowledge my first scientific advisor at the Institute of

Carcinogenesis in Moscow, Natalya Gloushankova, for introducing me to the world of Cell, for sharing her knowledge on the molecular oncology and for always supporting me in my ambitious scientific plans. In addition, I would have never achieved any progress without a constant support from my family who often visited me on my long way to get a PhD degree to ensure my well-being in France. This work would have never been possible without a help of my husband Dmitry

Ilyushin who has been providing not only emotional support but, in fact, studying all these years with me. He gave me a lot of technical support and even learnt some molecular biology principals to help me in troubleshooting experimental obstacles. My expected PhD degree also belongs to him.

Table of contents

Introduction ...... 12

CHAPTER 1: Polarity Proteins ...... 14

Apical membrane complexes ...... 18

Crumbs ...... 18

Stardust and Patj ...... 19

aPKC/Par6 complex ...... 20

Par3/Bazooka ...... 22

PTEN ...... 24

Yurt and Moesin ...... 24

Basolateral complexes ...... 26

Scrib-Dlg-Lgl module in cell polarity ...... 26

Scrib-Dlg-Lgl module in cancer ...... 26

Chapter 2: Adherens Junctions ...... 28

Adherens junction organization ...... 30

E-cad clustering in AJs ...... 31

Regulation of E-cad/Catenin levels by phosphorylations ...... 33

AJs establishment in vivo: Drosophila embryo as a model ...... 34

AJs remodeling in morphogenesis ...... 36

AJs and endocytosis ...... 39

CHAPTER 3: Polarity Proteins and Adherens Junction Crosstalk in the Establishment and

Maintenance of Apico-Basal Polarity ...... 41

Apico-Basal polarity establishment ...... 43

The role of Crumbs in AJs organization ...... 46

The Baz role in AJs organization ...... 49

How polarity proteins regulate AJs organization? ...... 50

Polarity proteins and vesicle trafficking ...... 50

Polarity proteins and cytoskeleton ...... 52

CHAPTER 4: Molecular Dissection of Baz Reveals a Complex Interplay Between Crb, E-Cad and Baz ...... 55

Abstract ...... 56

Introduction ...... 57

Results ...... 59

Crb and Baz control E-Cad levels at the junctions and are required for E-Cad apical

recruitment ...... 59

Crb and Baz regulate E-Cad nanoscopic organization at the junctions ...... 61

What are the regulatory domains on Baz that might be responsible for E-Cad

regulation by Crb? ...... 62

E-Cad levels and organization in the three independent lines ...... 63

Role of E-Cad and Crumbs in Baz organization ...... 66

Discussion ...... 67

Materials and methods ...... 69

Bibliography ...... 74

Figures ...... 78

Supplementary data ...... 83

CHAPTER 5: Role of the Crumbs Proteins in Ciliogenesis, Cell Migration and Actin

Organization ...... 88

Abstract ...... 89

Introduction ...... 91

Crumbs and ciliogenesis ...... 93

Crumbs complex and cell migration ...... 95

a) Chemical cues ...... 97

b) Physical cues ...... 98

Crumbs and the actin cytoskeleton: a unifying theory...... 99

Future perspectives and concluding remarks ...... 103

Bibliography ...... 104

Figure legends ...... 115

CHAPTER 6: Discussion ...... 119

Bibliography ...... 126

List of figures

Figure 1. Graphic representation of Drosophila polarity proteins...... 16

Figure 2. Idealized scheme of Drosophila epithelial cell...... 17

Figure 3. Immunofluorescence pictures showing the localization of Crb (green) and Dlg

(magenta) in the epidermis of wild type Drosophila embryos...... 19

Figure 4. aPKC phosphorylation targets among other epithelial polarity proteins, and the functional consequences of phosphorylation. (Ulrich Tepass 2012) ...... 22

Figure 5. Domain structure of the cadherin-catenin complex components...... 30

Figure 6. E-cadherin distribution in Drosophila embryonic epithelia...... 32

Figure 7. Cellularization links embryonic cleavage to the formation of an epithelial layer.

...... 35

Figure 8. Epithelial remodeling by apical constriction, tissue bending and cell intercalation.

...... 37

Figure 9. E-cad endocytosis model in Drosophila embryo...... 40

Figure 10. Apico-Basal polarity establishment by polarity proteins and AJs during

Drosophila early embryogenesis...... 43

Figure 11. Crb and Sdt are involded in the AJs integrity regulation...... 46

Figure 12. Model of the Cdc42-Par complex function in the regulation of the apical endocytic pathway...... 52

Figure 13. Localization of DE-Cad is unaffected in bazXR11 and bazEH747 clones...... 122

Figure 14. Baz null clones do not affect DE-Cadherin organization in the wing disc...... 124

Figure 15. Baz null clones do not affect E-Cad organization...... 125

List of abbreviations

Adaptor complex 2 (AP2) Adherens junctions (AJs) Ankyrin-repeat, SH3-domain, and proline-rich-region containing protein (ASPP) Apical adherens junctions (AAJ) Apical polarity regulators (APRs) Armadillo (Arm) Atypical protein kinase C (aPKC) Basolateral polarity regulators (BLPRs) Bazooka (Baz) Cadherin-catenin complex (CCC) Cdc42-interacting protein 4 (CIP4) Coracle (Cora) Crumbs (Crb) Diacylglycerol (DAG) Diaphanous (Dia) Discs large (Dlg) Discs Lost (Dlt) Domain in receptor targeting proteins Lin-2 and Lin-7 (L27) Early endosome (EE) E-cadherin (E-cad) Echinoid (Ed) Epidermal growth factor (EGF) Evolutionary conserved region (ECR) FERM-domain binding motif (FBM) Furrow canal (FC) Hoechst (Hoe) JUN N-terminal kinase (JNK) Late endosome (LE) Lethal giant larvae (Lgl) Madin-Darby Canine Kidney cells (MDCK cells)

Mictotubules (MT) Multivesicular body (MVB) Myosin II (MyoII) Myosin V (MyoV) Neurexin IV (NrxIV) Neurotactin (Nrt) PALS1-associated tight junction protein (Patj) PDZ-domain binding motif (PBM) Phosphatase and tensin homolog (PTEN) Phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3] (PIP3) Phosphatidylinositol (4,5)-disphosphate [PtdIns(4,5)P2] (PIP2) Phosphoinositide 3-kinase (PI3K) Photoreceptor cells (PRCs) Phox and Bem1p (PB1) Plasma membrane (PM) Pleckstrin homology (PH) PSD95/Dlg1/ZO-1 domain (PDZ) Scribble (Scrib)

Spot adherens junctions (SAJs)

SRC Homology 3 (SH3) Stardust (Sdt) Wiskott-Aldrich syndrome protein (WASP)

Introduction

Epithelia are sheets of cells that serve as barriers between morphologically and physiologically distinct compartments in the body and are also responsible for the vectorial transport of molecules. To accomplish their functions, epithelial cells need to be polarized along their apico-basal axis. The plasma membrane of epithelial cells is subdivided into three distinct domains: the apical domain faces the external environment or lumen; the lateral domain is in contact with neighboring cells and the basal domain contacts with the basement membrane. The combined activities of several cellular machineries govern the proper function of these domains:

1) intrinsically polarized vesicular transport; 2) actomyosin cytoskeleton; 3) E-cadherin-based adherens junctions and 4) evolutionarily conserved polarity complexes. Thus, the dynamic integrity of all above-mentioned players results in the epithelial polarity establishment and maintenance.

One of the most appealing questions in this highly active and competitive field of epithelial cell polarity remains understanding of precise molecular pathways that cooperate to allow overall tissue polarization. Epithelial polarity has been studied since the late 1970 with the first experiments performed in mammalian cell culture and since then a marked progress has been achieved in understanding the fundamental principles of polarity regulation. Drosophila is another excellent model that has given many deep insights into apico-basal polarity functioning due its powerful genetics, advanced imaging techniques and the ease of monitoring single cells.

In my thesis, I use simple undifferentiated Drosophila embryonic ectoderm to address the question of the adherens junctions and polarity proteins crosstalk that eventually contributes to the formation of polarized epithelial sheets. The transmembrane Crumbs complex and a scaffolding protein Baz are known to act together to establish and stabilize the apico-lateral compartment, however it remains mainly unclear how they cooperate with another polarity contributor– adherens junctions (AJs) – to form apico-basal axis of cells. To advance our current

12 understanding of the mechanisms that retain Baz at the level of the AJs and to reveal how Baz positioning feedbacks on the stability of E-cad, I have analyzed the expression of Baz constructs with mutations on several regulatory sites. The overexpression of these mutants in the lateral embryonic ectoderm provided several important answers on the E-cad levels and clustering regulation and allowed to dissect a molecular pathway that involves Crumbs, Baz and E-cad and thus control stability of the AJs.

CHAPTER 1: Polarity Proteins

Many components of the protein complexes were originally identified in genetic screens performed in Drosophila melanogaster and Caenorhabditis elegans. Originally three core polarity protein complexes that are conserved among flies, worms and mammals were identified: the apical complexes – Crumbs/Sdt/Patj and Par3/Par6/aPKC, and the basolateral Dlg/Lgl/Scribble complex. Later one more apical complex comprised of lipid phosphatase PTEN (von Stein 2005) and several more basolateral polarity determinants were identified in flies including Par1 and 14-

3-3 (Par5) (Benton and St Johnston 2003; Doerflinger et al. 2003), the

Yurt/Coracle/NeurexinIV/Na1,K1-ATPase group (Laprise et al. 2009) and Rac1-Phosphoinositide

3-kinase (PI3K) (Chartier, Hardy, and Laprise 2011).

In Chapter 1, I focus on the most recent data obtained from Drosophila studies on the apical polarity determinants including Crumbs (Crb); Stardust (Sdt in Drosophila, PALS1/MPP5 in mammals); Patj (PATJ and MUPP1 in mammals); Par6; atypical protein kinase C (aPKC); the scaffolding protein Bazooka (Baz in Drosophila, PAR3 in mammals); PTEN and FERM domain- containing proteins Moesin and Yurt (see Figure 1 for protein structures) and on the basolateral polarity determinants – Dlg/Lgl/Scribble complex and Par-1 kinase. Like any other complex molecular network, epithelial polarity network represents both positive and negative feedback loops and context-dependent redundancies (see Figure 2 for a schematic epithelial polarity network).

Figure 1. Graphic representation of Drosophila polarity proteins.

Apical (a) and basolateral (b) protein domains, phosphorylation sites and functional motifs are shown. Below each phosphorylation site, the responsible kinase or phosphatase is indicated. The number in parenthesis next to each name indicates the number of predicted isoforms (number of unique polypeptides) according to FlyBase (flybase.org). (c) Shows the key for the different domains as well as the scale bar for the whole figure. EGF, epidermal growth factor; PDZ, PSD95/Dlg1/ZO-1 domain; L27, domain in receptor targeting proteins Lin-2 and Lin-7; FBM, FERM-domain binding motif; PBM, PDZ-domain binding motif; ECR, evolutionary conserved region; DAG, diacylglycerol; SH3, SRC Homology 3; PB1, Phox and Bem1p; PH, Pleckstrin homology. (Flores-Benitez and Knust 2016)

Figure 2. Idealized scheme of Drosophila epithelial cell.

The main regions of the plasma membrane of an epithelial cell are indicated on the left. Apical polarity regulators (APRs; orange) show mutually supportive interactions with the adherens junction (green). The APR Baz is enriched at the adherens junction together with the cadherin- catenin complex (CCC). The apical-basal axis of epithelial cells is generated and maintained through mutually competitive interactions between APRs and basolateral polarity regulators (BLPRs; blue) (Ulrich Tepass 2012).

Apical membrane complexes

Crumbs

Crb was the first transmembrane apical polarity protein to be identified in Drosophila genetic screens in the early 90s (U Tepass, Theres, and Knust 1990; Ulrich Tepass and Knust

1990). Crb is a master regulator of epithelial polarity due to its highly specific and strong phenotype originally described as a loss of apical membrane character in crb embryos (Andreas

Wodarz, Grawe, and Knust 1993) (Figure 3) whereas crb overexpression resulted in the apical membrane enlargement associated with the basolateral domain reduction (A Wodarz et al. 1995).

These observations were later confirmed by immunoelectron microscopy data suggesting that

Crb is not a component of adherens junctions (AJs) and is localized more apically to E-cadherin- mediated complexes in a so-called marginal zone of the apical membrane (Ulrich Tepass 1996).

Loss of crumbs, however, results in a disruption of AJs integrity (see Chapter 3 for more details).

Crb contains a large extracellular domain and a short 37 amino acid cytoplasmic tail (U

Tepass, Theres, and Knust 1990; Andreas Wodarz, Grawe, and Knust 1993). Crumbs’ functions in epithelial polarity mainly relies on its intracellular domain (Klebes and Knust 2000) containing two motives, a N-terminal PBM site that binds to PDZ-containing proteins and C-terminal FBM site that binds to FERM domain proteins (Figure 1). Whereas the function of the intracellular domain has been extensively investigated, the extracellular domain function is still poorly understood. The role for the Crb extracellular domain has been assigned mainly in photoreceptor morphogenesis, where Crb is indispensable for stalk membrane development and rhabdomere maintenance (Richard et al. 2009). Interestingly, there are several lines of evidence reassessing the classical functions of Crb and suggesting a role for its extracellular domains in engaging homophilic Crb-Crb interactions between neighboring cells in two systems - zebrafish retina

(Zou, Wang, and Wei 2012) and Drosophila salivary gland placode (Röper 2012). Homophilic interactions in cis and trans between the extracellular domains of Crb may have a potential role in cell-cell communication.

Figure 3. Immunofluorescence pictures showing the localization of Crb (green) and Dlg (magenta) in the epidermis of wild type Drosophila embryos.

Upper right panel shows the loss of polarity (noticeable by the spread of Dlg along the plasma membrane) and the loss of tissue organization in the embryonic epidermis of Drosophila embryos mutant for crb. (Flores-Benitez and Knust 2016)

Crb is expressed in many different epithelia in Drosophila performing tissue- and time- specific functions. Interestingly, some epithelia including the late embryonic ectoderm, the larval imaginal disc, the Malphigian tubules at early stages of development and tracheal cells before invagination do not require Crb expression to maintain epithelial integrity (Campbell, Knust, and

Skaer 2009; Letizia et al. 2011; Pellikka et al. 2002; Guy Tanentzapf and Tepass 2003). These data suggest a role for Crb in highly dynamic tissues undergoing drastic morphological rearrangements, where Crb could stabilize apical domain proteins and prevent basolateral protein spreading.

Stardust and Patj

Stardust has been found to be a component of the Crb complex as they act together in the same genetic pathway in Drosophila epithelia (Grawe et al. 1996; U Tepass and Knust 1993). Both

Crb and Sdt are necessary for establishing and maintaining epithelial cell integrity in the embryo

(A Bachmann et al. 2001; Hong et al. 2001; U Tepass and Knust 1993). Crb via its C-terminal ERLI motif binds the PDZ domain of Sdt and thereby serves as a hub to form a plasma membrane-

19 associated scaffold (A Bachmann et al. 2001). The L27N domain of Sdt binds to Lin-7 protein and

L27C domain recruits Patj (André Bachmann et al. 2008; Natalia A Bulgakova, Kempkens, and

Knust 2008). Therefore, Sdt, Lin7 and Patj all together interact with Crb. Sdt and crb embryos show a very similar phenotype (Figure 11) known by the loss of epithelial integrity in many epithelia (A Bachmann et al. 2001; U Tepass and Knust 1993). Sdt is also responsible for the Crb stability in most tissues, except for the boundary cells of the Drosophila hindgut where the apical localization of Crb does not require interaction with Sdt (Kumichel and Knust 2014). As sdt encodes many different isoforms that show tissue-specific expression and have an opposing effects on Crb function in photoreceptor cells (PRCs), one mechanism of Crb expression control would suggest the fine-tuned regulation of Sdt isoforms balance (Natalia A Bulgakova, Rentsch, and Knust 2010).

Patj is mainly essential for the stability of the Crb complex in Drosophila PRCs, where Patj protects PRCs against light-dependent degeneration (Richard, Grawe, and Knust 2006). In addition, Patj null mutants show Crb reduction from the apical membrane and morphological defects similar to crb phenotype in adult follicular epithelium suggesting a strong role for Patj in this tissue (Pénalva and Mirouse 2012). By contrast, Patj is dispensable for epithelial morphogenesis in the embryo since animals lacking Patj survive to pupal stages (Zhou and Hong

2012). Hence, requirements for Patj remain stronger in some epithelia than in others, with no effect on ectoderm polarity but with severe tissue disruption in ovarian epithelium. Molecular mechanisms for such discrepancy still need to be uncovered.

aPKC/Par6 complex

The evolutionary conserved Par3/Par6/aPKC complex was originally identified as a cell fate determinant during the asymmetric cell division in early C. elegans blastomere (Etemad-

Moghadam, Guo, and Kemphues 1995; Kemphues et al. 1988). In this system, the Par complex is localized to the anterior pole of the embryo and is mutually antagonizing Par1 and Par2 proteins from the posterior cortex (Nance, Munro, and Priess 2003). In Drosophila ectoderm, the adaptor

20 protein Par6 serves as a negative regulatory subunit of a serine/threonine kinase aPKC by mainly regulating its positioning rather than phosphorylation activity (reviewed in Ulrich Tepass

2012).The Par3/Par6/aPKC complex is targeted to the apical membrane and one of the major questions in the field of epithelial polarity, therefore, addresses how this complex is recruited apically and how its activity is controlled. The initial Par6/aPKC recruitment to the apical membrane domain is known to require binding to Par3 (Baz) (T. J. C. Harris and Peifer 2005).

Later, during embryogenesis, however, this link although needs to be resolved to allow Baz relocalization to the level of AJs (T. J. C. Harris and Peifer 2005; Horikoshi et al. 2009; Morais-de-

Sá, Mirouse, and St Johnston 2010). The Baz repositioning to the level of the AJs is one of the key molecular events driving epithelial polarity establishment in Drosophila (see Chapter 3 for details).

aPKC has multiple targets that contribute to epithelial cell polarity (Figure 4). As an example, aPKC phosphorylates Baz on Ser980 site that results in Baz release from the aPKC/Par6 complex (Morais-de-Sá, Mirouse, and St Johnston 2010; Walther and Pichaud 2010) and allows the Sdt-Baz complex dissociation (Krahn, Bückers, et al. 2010). Upon aPKC-mediated phosphorylation of Baz, Sdt is released and can form the Crb-Sdt complex (Krahn, Bückers, et al.

2010) that is another essential step for epithelial polarity establishment in the Drosophila ectoderm. In addition, aPKC undergoes auto-phosphorylation and phosphorylates the FBM domain of Crb that is necessary to maintain Crb apical localization and to prevent spreading of basolateral markers towards apical domain (Sotillos et al. 2004). Moreover, aPKC can directly phosphorylate basolateral determinants Lgl and Par1 for the same reason – to prevent them from accumulating at the apical surface (Betschinger, Mechtler, and Knoblich 2003; Hurov, Watkins, and Piwnica-Worms 2004; Rolls et al. 2003).

Figure 4. aPKC phosphorylation targets among other epithelial polarity proteins, and the functional consequences of phosphorylation. (Ulrich Tepass 2012)

Par3/Bazooka

Baz was the first of the Par proteins homologs identified as a pivotal epithelial polarity regulator in Drosophila (Kuchinke, Grawe, and Knust 1998). Baz is a scaffold protein that contains an N-terminal CR1 oligomerization domain, three PDZ domains, an aPKC binding motif and a PIP- binding region (Figure 1). PDZ domains of Baz can bind the C-terminal tails of the AJs-associated transmembrane protein Echinoid (Ed), the AJs component Armadillo (Arm) (the Drosophila homolog of β-catenin) (Wei et al. 2005), the lipid phosphatase PTEN2 (von Stein 2005) and Par6

(Morais-de-Sá, Mirouse, and St Johnston 2010). Interestingly, single removal of all three PDZ domains or PIP-binding motif deletion has no detectable effect on Baz localization (Krahn,

Klopfenstein, et al. 2010), whereas double deletion of both domains together strongly disrupts plasma membrane anchoring (McKinley, Yu, and Harris 2012).

Baz is also necessary for the establishment of planar polarity of Drosophila embryonic tissue where it is enriched at dorsoventral contacts and promotes enhanced AJ formation (Simões et al. 2010). In contrast, Rho-kinase is enriched at anterior-posterior contacts where it recruits

Myo II that allows cell intercalation to occur and contributes to morphogenesis (for more details see ‘AJs remodeling in morphogenesis’ in Chapter 2).

Baz accumulation at the interface of the apical and basolateral domains is mainly enabled by an interconnected network of apical and basolateral kinases that govern mutually exclusive phosphorylation events. Thus, Baz is excluded from the apical domain by two mechanisms. First,

Baz gets phosphorylated on its Ser 980 site by aPKC that prevents their further interaction and results in Baz release from the aPKC/Par6 apical complex (Morais-de-Sá, Mirouse, and St Johnston

2010; Walther and Pichaud 2010). Phosphorylation on Ser980 site of Baz was also shown to contribute to the dissociation of Baz-Stardust complex and formation of the Crumbs-Stardust complex (Krahn, Bückers, et al. 2010). Second, as Par6 has the same PDZ-binding domain for Baz and Crumbs, Crumbs outcompetes Baz from its association with Par6 (Morais-de-Sá, Mirouse, and

St Johnston 2010; Walther and Pichaud 2010).

The basolateral exclusion of Baz is orchestrated by Par-1 kinase, which phosphorylates

Baz on Ser151 and Ser1085 conserved sites and generates the formation of 14-3-3 protein binding site (Benton and St Johnston 2003). These events block Baz oligomerization, thus preventing Baz- aPKC association (Benton and St Johnston 2003). The basolateral exclusion of Baz might also involve a recently identified Baz-centrosome pathway, where 14-3-3 protein binds Baz and mediates further protein interactions or induce conformational changes, important for Baz- microtubules association (Jiang et al. 2015).

In addition, Baz binds PIP2 (phosphatidylinositol-(4,5)-diphosphate) and PIP3

(phosphatidylinositol-(3,4,5)-trisphosphate) phosphoinositides that is crucial for Baz membrane localization (Krahn, Klopfenstein, et al. 2010). Thus, PIP2 was recently found to be necessary for

Baz apical membrane anchoring and AJ formation in the follicular epithelium (Claret et al. 2014).

On top of the above-mentioned mechanisms of Baz retention at the junctional plane, there is a recently described ASPP (Ankyrin-repeat, SH3-domain, and proline-rich-region containing protein) complex, which is involved in Baz recruitment at the level of AJs and in the maintenance of E-Cad belt integrity in Drosophila pupal eye (Zaessinger et al. 2015). However, no direct binding

23 between Baz and ASPP complex has been found in fly so far and the molecular mechanism by which ASPP anchors Baz remains poorly understood.

In the end, one of the intriguing questions that still need to be resolved remains how Baz is recruited to the plasma membrane and how it retains at the level of AJs. The mechanisms of AJs regulation by Baz are discussed in Chapter 3 and Chapter 4.

PTEN

The lipid phosphatase PTEN is a negative regulator of the PI3K pathway (Vanhaesebroeck,

Stephens, and Hawkins 2012). PI3K produces phosphatidylinositol (3,4,5)-trisphosphate [PtdIns

(3,4,5) P3] known as PIP3 that by PTEN-mediated dephosphorylation is converted into PtdIns

(4,5) P2 known as PIP2. These phospholipids are involved in many signaling cascades including cell polarity, cell growth control, cell proliferation, among other cellular processes. Drosophila embryos lacking zygotic Pten die during late embryogenesis or at early larval stages (Goberdhan et al. 1999). However, embryos derived from Pten germ-line clones lacking both maternal and zygotic Pten displayed severe abnormalities already in the freshly laid eggs and later during the cellularization stage (von Stein 2005). In addition, as discussed before, PTEN was shown to bind and to colocalize with Bazooka in the apical cortex of epithelia and neuroblasts that presumably results in a local reduction of PIP3 and subsequent local increase of PIP2 (von Stein 2005).

Likewise, PTEN could be involved in the balance of asymmetric distribution of PIP2 and PIP3 molecules that contributes to the epithelial cell polarity establishment and maintenance.

Yurt and Moesin

The predominantly basolateral FERM protein Yurt (Yrt) binds Crb during late epithelial morphogenesis, which leads to its apical recruitment (Laprise et al. 2006). Loss of Yurt results in the apical membrane expansion in embryonic ectoderm and PRCs, the phenotype very similar to

Crb gain-of-function effect, whereas crb yurt double mutants show a reduced apical membrane that is a hallmark of a classical crb phenotype (Hsu et al. 2006; Laprise et al. 2006). These two observations from Drosophila epithelia and zebrafish PCRs allow to conclude that Yrt is an

24 upstream negative regulator of Crb in apical domain establishment. In addition, aPKC-mediated phosphorylation of Yrt is essential to prevent premature apical repositioning of Yurt. Contrarily,

Yrt activity is necessary to restrict basal shift of aPKC. Therefore, Yrt and aPKC mutually antagonize each other and contribute to the segregation of morphologically distinct epithelial cells domains (Gamblin et al. 2014).

Moesin forms a complex with Crb and βheavy-Spectrin that is involved in the regulation of the apical cytoskeleton stability (Médina et al. 2002; Pellikka et al. 2002). Moesin has been reported to have a function in epithelial polarity regulation in Drosophila embryonic ectoderm and wing imaginal disc whereas functional cooperation with Crb has been only demonstrated for invaginating tracheal cells (Letizia et al. 2011).

Basolateral complexes

Scrib-Dlg-Lgl module in cell polarity

The Scrib-Dlg-Lgl complex localizes along the septate junctions in Drosophila and promotes the basal membrane identity (D Bilder, Li, and Perrimon 2000). Two distinct plasma membrane domains are established due to the mutually exclusive kinase activities: aPKC phosphorylates Lgl at the basolateral domain and Par1 phosphorylates Par3 in the apico-lateral domain (Benton and St Johnston 2003; Betschinger, Mechtler, and Knoblich 2003). Lgl is also known to bind actomyosin network via its interaction with non-muscle Myosin II heavy chain in

Drosophila embryonic cell (Strand, Raska, and Mechler 1994). Another antagonistic activity contributing into finely tuned balance between apical and basolateral domains is performed by the Crb and Scrib complexes that function in the same regulatory pathway (D Bilder and Perrimon

2000).

Scrib-Dlg-Lgl module in cancer

Basolateral proteins Scrib, Dlg and Lgl have a role in tumorigenesis and act as tumor suppressors both in Drosophila and humans. Mutations in Drosophila Scrib, Dlg and lgl result in neoplastic tumors in epithelial tissues identified by a loss of apico-basal polarity and proliferation control. Thus, loss-of-functions Scrib mutations in Drosophila eye antennal discs results in the

RAS-dependent formation of metastatic tumors. These tumors also display upregulated JUN N- terminal kinase (JNK) signaling and the hallmarks of human cancers that lack Scrib, including loss of E-cad expression, basement membrane degeneration, migration, invasion and following secondary tumors formation (Brumby and Richardson 2003; Pagliarini 2003). Lgl acts together with aPKC and Crb to balance proliferation and survival in the Drosophila developing eye and imaginal disc by adjusting activity of the Hippo tumor suppressor pathway (Grzeschik et al. 2010;

Robinson et al. 2010).

In conclusion, the knowledge about the mechanisms that orchestrate cell polarity in

Drosophila could be transformed into studies on the tumorigenesis execution pathways in

26 humans. Taken into account the polarity complexes implications in such processes as cell adhesion establishment, growth control and apoptosis, they can be utilized as potential clinical prognostic factors (reviewed in Martin-Belmonte and Perez-Moreno 2011).

Chapter 2: Adherens Junctions

AJs are a hallmark of all epithelial sheets. They establish apical adhesion between neighboring cells via homophilic interactions of single-pass transmembrane E-cad molecules. The stability and dynamics of these structures is mediated by the anchoring of E-cad molecules to actin cytoskeleton. While stable adhesion is critical for epithelial tissues stability, the controlled incredible plasticity of AJs allows numerous morphogenetic movements that contribute to the formation of tissues and organs during embryonic development. Here I focus on the organization of AJs, their establishment during Drosophila embryogenesis as well as the role of AJs remodeling in morphogenesis.

Adherens junction organization

DE-cad (shotgun gene in Drosophila) is a member of the classical cadherins family. E-cad harbors extracellular cadherin repeats with Ca2+ binding sites, which modulate homophilic interactions between cadherin molecules of two neighbor cells in the majority of multicellular organisms including Drosophila (U Tepass and Hartenstein 1994; Ulrich Tepass et al. 1996).

Recent studies have suggested that the cadherin ectodomains are sufficient to drive clustering both in vitro (Harrison et al. 2011) and in vivo (Ozaki et al. 2010). This involves strong homophilic trans interactions and weaker lateral cis interactions. The highly conserved intracellular tail of E- cad is linked to the actin cytoskeleton via binding to the -, β- and p120-catenins (Figure 5). β- catenin directly binds the intracellular tail of cadherins and recruits -catenin (Yonemura 2011) that operates at the interface with the actin through a still poorly understood mechanism.

Figure 5. Domain structure of the cadherin-catenin complex components.

(A) Schematic overview of the domain structure of a classical cadherin and its three associated catenins: β-catenin, α-catenin, and p120-ctn. (B) schematic representation of DE- cadherin in Drosophila. (Niessen, Leckband, and Yap 2011)

Interestingly, the cadherin-β-catenin--catenin-actin complex has never been precipitated so far (Yamada et al. 2005). This phenomenon can be explained by the recent data taken with the optical tweezers showing that -catenin binds F-actin only under forces (Buckley et al. 2014). One more extra bridge binding β-catenin and F-actin could be tracked via -catenin actin-binding partners, including formin, vinculin, -actinin, ZO-1, AF6/afadin and EPLIN (Abe and Takeichi 2008; Yonemura 2011).

E-cad clustering in AJs

E-cad molecules are not distributed regularly along junctions but form so-called clusters in many cell types, including both mammalian cells (Angres, Barth, and Nelson 1996; Kametani and Takeichi 2007) and invertebrate epithelia (Ulrich Tepass et al. 1996). These clusters were shown to transmit intracellular tension at cell-cell contacts (Lecuit and Yap 2015; Levayer and

Lecuit 2013; Martin et al. 2010). In Drosophila, E-cad clusters assemble at the end of cellularization, increase their density during gastrulation and persist throughout embryogenesis

(Cavey et al. 2008). At the early stages of embryogenesis, these clusters are found along the lateral membrane and at the later stages are re-localized to the apico-lateral border (Grawe et al. 1996).

E-cad clusters can be analyzed at two levels – the microscopic distribution and the nanoscopic organization. At the microscopic level, E-cad clusters are distinguished by irregular fluorescent intensity on confocal images, whereas nanoscopic clusters of E-cad are defined by the distance between single molecules and can be visualized by using super-resolution microscopy techniques (Figure 6). The E-cad molecular organization is highly important for proper adhesion functions of the AJs and, therefore, for global tissue integrity.

The size of E-cad nanoclusters has been recently described using PALM microscopy

(Truong Quang et al. 2013). This approach allows visualization of single E-cad molecules with a resolution of 30 nm. The E-cad nanoclusters analysis revealed that each cluster contains a mix of cis- and trans- pairs of E-cad (Truong Quang et al. 2013) and possesses two characteristics: the clusters do not have a distinctive size but have a limited maximum size (Truong Quang et al. 2013;

Wu, Kanchanawong, and Zaidel-Bar 2015). The mechanism controlling cluster size involves the cooperative action of fusion, fission and endocytosis events. Additional size regulation mechanism involves F-actin that forms a meshwork surrounding the clusters (Wu, Kanchanawong, and Zaidel-

Bar 2015). F-actin also controls clusters stability and dynamics: small stable actin patches with a low turnover that concentrate in E-cad clusters are responsible for their stability, whereas peripheral contractile actomyosin meshwork with a rapid turnover regulates E-cad puncta lateral displacement by a tethering mechanism (Cavey et al. 2008). Interestingly, -catenin is dispensable for the E-cad cluster stability and actin stabilization, but necessary for restricting the lateral mobility of E-cad puncta by the actin network (Cavey et al. 2008).

Figure 6. E-cadherin distribution in Drosophila embryonic epithelia.

(Left) (A) Confocal image showing the apico-lateral distribution of the endogenous E- cadherin fused to the photoconvertible protein EosFP (E-Cad::EosFP) in the ventrolateral region (stage 8). (Right) PALM images of AJs at early and late stages. The scale bar represents 5 mm. Note the formation of polydisperse clusters at late stages (red arrows). (Truong Quang et al. 2013)

To sum up, E-cad clusters directly mediate adhesion, however the mechanisms of clustering remains a subject of debate in the field. Thus, to clarify better the size control principle of E-cad distribution, in my thesis work I address the question of how E-cad organization (i.e. clusters) is regulated on a molecular level and what are the main molecular players in this process

(see Chapter 4).

Regulation of E-cad/Catenin levels by phosphorylations

Another interesting mechanism of E-cad-catenin complexes regulation includes diverse series of phosphorylation events that show cell- and time-specificity. Transgenic rescue assays in

C. elegans have shown that a conserved Ser1212 residue on cadherin promotes β-catenin binding that is highly essential for development (Choi et al. 2015). Recent Drosophila knock-in mutants however showed that none of the E-cad serine residues are specifically required for AJs formation and development in vivo (Chen et al. 2017). Probably, the overall phosphorylation potential of the conserved serine cluster of E-cad, rather than contribution of site-specific phosphorylations, enhance β-catenin binding to E-cad (Chen et al. 2017).

AJs establishment in vivo: Drosophila embryo as a model

In Drosophila embryo, AJs establishment process displays two main differences from the mammalian cells. First, Drosophila does not have a clear Nectin orthologue that functions in the recruitment of free E-cad complexes to the apposition sites like it does in cell culture, even though

Echinoid (Ed) maintain some of its Ca2+ -independent adhesive role (Wei et al. 2005). Second, there is no initial apposition of membrane between two cells and E-cad accumulation is primarily mediated by targeted traffic of E-cad/Catenin complexes during cellularization. Cellularization is a hybrid process that is alike embryonic cell division and is built on cytokinesis. The final product of cellularization is a sheet of polarized embryonic epithelium. After fertilization, the Drosophila egg undergoes 13 synchronous cycles of nuclear division in a single cytoplasm that gives rise to about 5000 nuclei localized at the cortex of the so-called syncytium (Figure 7). During mitosis, the plasma membrane invaginates between nuclei compartmentalizing 5000 nuclei into individual columnar epithelial cells. Cellularization is composed of two phases: the slow phase (0.3

µm/minute for 40 minutes) that is followed by the fast phase (0.8 µm/minute for 20 minutes), which yields more than a half of the total lateral membrane surface area (Lecuit 2004). During the fast phase, E-cad/β-Catenin complexes are first found as punctate structures along the apico- lateral border of the plasma membrane and assemble into spot adherens junctions (SAJs). At the end of cellularization SAJs form a more continuous belt and such proteins as F-actin, aPKC

(Andreas Wodarz et al. 2000), Par-3 (Kuchinke, Grawe, and Knust 1998) and Par-6 (Petronczki and Knoblich 2001) are involved in the regulation of their stability (see Chapter 3 for more details).

Figure 7. Cellularization links embryonic cleavage to the formation of an epithelial layer.

The plasma membrane (PM, green) invaginates between the nuclei (N, black) located at the cortex of the syncytial embryo shown at the onset (A) and at the end (B) of cellularization. When cellularization is completed, 5000 columnar epithelial cells are formed. The apical adherens junctions (AAJ, red in B) have assembled and ensure the cohesion of the epithelial layer. Cellularization is thus associated with the growth and polarization of the cell surface. (C,D) Confocal sections of a cellularizing embryo during slow phase (C) and at the end of fast phase (D) corresponding to the boxed areas shown in A and B. The embryos are stained with antibodies to the integral membrane protein neurotactin (Nrt, green) that marks the entire cell surface, to the junctional protein PaTJ (turquoise) that marks the membrane front called the furrow canal (FC), to the small GTPase Rab11 (red), a marker of apical recycling endosomes (see Fig. 2), and with the DNA dye Hoechst (Hoe, dark blue) to show the nuclei. Bar, 5 µm. (Lecuit 2004)

In conclusion, there are several key characteristics of AJs formation that can be underlined for different systems regardless little particularities (reviewed in Coopman and Djiane 2016):

- The AJs formation is a multi-step reversible process that allows intensive AJs remodeling

during morphogenesis.

- The mutual interplay between E-cad based AJs and actomyosin network. For example, the

transition from flexible Rac to stable Rho signaling allows formation of mature belt-like

AJs from highly mobile SAJs.

- The Rac to Rho transition is locally controlled by such scaffold proteins as Par-3/Baz and

Afadin/AF-6 (Mandai et al. 2013).

AJs remodeling in morphogenesis

Despite the need for stability, AJs also show plasticity and are highly remodeled during development and morphogenesis. AJs shrink, expand and can reversely dissociate to accommodate to the changes in cell/tissue shape and to allow local cell movements. These events depend largely on contractile forces generated by actomyosin networks. The most wide-spread morphological movement, tissue invagination, is governed by two alternative mechanisms: the apical constriction and convergence-extension by cell intercalation (Figure 8). Thus, closure of the neural tube in mouse, chick or Xenopus embryos represents a classical example of tissue invagination by apical constriction (Figure 8 b,d). Here, the neuro-epithelium bending is mediated by cortical tension at the AAJs and is activated by shroom, the protein that is implicated in Myosin

II recruitment and activation (Haigo et al. 2003; Hildebrand 2005; Hildebrand and Soriano 1999).

In Drosophila mesoderm, however, apical constriction is associated with MyoII activation in the medial apical region of the cell rather than at the junctions (Figure 8 a, c). In this system, MyoII activity depends on the apical accumulation of RhoGEF2 (Barrett, Leptin, and Settleman 1997) and the combined activity of fog (Costa, Wilson, and Wieschaus 1994), the small G protein concertina

(Gq12q13) (Parks and Wieschaus 1991), an unknown G-protein-coupled receptor, and the transmembrane protein T48, which binds to RhoGEF2 (Kölsch et al. 2007).

Importantly, positioning of AJs during morphological movements is tightly regulated by epithelial polarity proteins. Thus, Wieschaus and colleagues using dorsal folding in gastrulating

Drosophila embryo as a model showed that prior to the initiation of dorsal folds, AJs shift basally locally at the presumptive folds (Wang et al. 2012). This local basal AJs shift is powered by progressive decrease in Par-1 and is controlled by the mutual Par-1/Baz ratio that allows Par-

3/Baz gradually localize more basally and direct basal AJs repositioning (Wang et al. 2012). Later the same research group showed that Baz in this system is downregulated from junctional sites in response to Snail expression. The local Baz downregulation leads to a specific AJs decrease at the sites of the forming folds without affecting the other E-cad pools (Weng and Wieschaus 2017).

Figure 8. Epithelial remodeling by apical constriction, tissue bending and cell intercalation.

(a) Mesoderm invagination in the Drosophila embryo involves furrowing of the ventral epithelium and specific cell shape changes in apical constriction (pink) of invaginating cells (square bracket). (b) Chick embryo neurulation proceeds by bending of the neuroepithelium (square bracket). (c) Schematic representation of apical constriction (pink) in epithelial cells. (d) Schematic representation of bending associated with apical constriction of the epithelial tissue. (e) Antero- posterior elongation of the Drosophila germ band epithelium is driven by cell-cell intercalation. During intercalation, epithelial cells (marked with E-cad-GFP and then labeled in different colors) exchange neighbors within 30 min. This process depends on the irreversible change in the geometry of cell contacts, with shrinkage of type-1 junctions (red) to the type-2 configuration (yellow) and regrowth of type-3 junctions (green) (Lecuit and Lenne 2007). (f) Model for modular control of MyoII activation. Localized inputs derive from striped ectoderm (orange) and ventral mesoderm (purple) expressed transcription factors in blastoderm embryos. Mesoderm and endoderm patterning relies on Fog and possibly other ligands signaling via multiple, localized (e.g. Mist) or ubiquitous (e.g. Smog) GPCRs, which relay information to G proteins , β and γ. T48 and Tolls are single pass transmembrane proteins (Kerridge et al. 2016).

Another example of the AJs–polarity proteins cooperation during morphogenesis is represented by Drosophila tracheal system. During tracheal cells elongation, maintenance of certain E-cad/Baz levels is important for apical targeting of these proteins that requires the presence of microtubules-dependent recycling endosomes in the apical domain (Le Droguen et al.

2015). Thus, E-cad/Par-3 levels at the AJs modulate adhesion properties of the tracheal cells during morphogenesis.

Cell-cell intercalation is another prominent mechanism driving tissue elongation that requires anisotropic tension and polarized junctions remodeling. A well-studied example of cell intercalation is provided by the ventrolateral ectoderm (the germ band) of Drosophila embryo where it consists of two steps (Figure 8e). First, ‘vertical junctions’, aligned along the dorsoventral axis, shrink and, second, newly formed junctions extend along the anteroposterior axis

(Bertet, Sulak, and Lecuit 2004). This process is driven by anisotropic distribution of cortical tension (Rauzi et al. 2008), due to the local enrichment of MyoII within vertical junctions (Bertet,

Sulak, and Lecuit 2004; Zallen and Wieschaus 2004). Noteworthy, E-cad, -catenin and Par-3 form a planar polarized pattern opposite to that of MyoII, which is enriched at the shrinking junctions

(J. Todd Blankenship et al. 2006; Levayer, Pelissier-Monier, and Lecuit 2011; Zallen and

Wieschaus 2004). Lower levels of these proteins at the shrinking junctions could serve for weaker adhesion at these zones. Thus, E-cad levels are controlled by a dual mechanism that involves E- cad endocytosis upregulation at the vertical junctions (Levayer, Pelissier-Monier, and Lecuit

2011) and by the Par-3 planar polarity mediated by ROCK (Simões et al. 2010). Additionally, cell intercalation and apical constriction are driven by medial-apical MyoII pulses that power deformations (Figure 8f). These deformations are under the control of GPCR and G proteins signaling (Kerridge et al. 2016).

AJs remodeling also occurs in some other morphogenetic events. For instance, during cytokinesis, when epithelial cells undergo mitosis, newly formed AJs assemble between neighbor cells while maintaining adhesion and apico-basal polarity (Founounou, Loyer, and Le Borgne

2013; Guillot and Lecuit 2013; Herszterg et al. 2013).

Altogether, these examples illustrate how tissue morphogenesis patterns are governed by the spatial control of tension and how AJs and polarity proteins contribute to this process.

AJs and endocytosis

Cadherin endocytosis has been shown to be a major mechanism of AJs remodeling (S. M.

Troyanovsky 2009; Wirtz-Peitz and Zallen 2009). In this regards, p120-catenin is known to induce

E-cad endocytosis followed by E-cad recycling that is required for cell shape regulation and cell rearrangements in the wing disc (N. A. Bulgakova and Brown 2016). Besides, several studies suggested a role for dynamin- and clathrin-dependent endocytosis in cadherin endocytosis (Delva and Kowalczyk 2009; R. B. Troyanovsky, Sokolov, and Troyanovsky 2006). More precisely, clathrin adaptor proteins - adaptor complex 2 (AP2) (Miyashita and Ozawa 2007) and β-arrestin

(Gavard and Gutkind 2006) functions in E-cad endocytosis.

There are at least two alternative mechanisms that link cadherin endocytosis and actin polymerization. One mechanism observed in Drosophila pupal notum involves action of Rho family GTPase, Cdc42 and its effectors, Cdc42-interacting protein 4 (CIP4) and Par-6 (Georgiou et al. 2008; Leibfried et al. 2008). CIP4 and its downstream effectors, Wiskott-Aldrich syndrome protein (WASP) and ARP2/3, likely promotes branched actin nucleation at the sites of internalization, whereas Par-6 brings CIP4 to AJs and favors its binding to dynamin (Georgiou et al. 2008; Leibfried et al. 2008). Dynamin functions in the fission of clathrin-coated pins (Classen et al. 2005). Besides Par-6 contribution, there is a role for another protein involved in apico-basal polarity regulation- Cdc42. Study on more dynamic Drosophila embryonic neuroectoderm has identified a role for Cdc42 and the Par complex in apical trafficking of the Crb complex, which then affects AJ stability secondarily (K. P. Harris and Tepass 2008). However, another work on

Drosophila pigment epithelial cells suggested that Rho maintains AJ structure by inhibiting Cdc42 and Par-6 activity without affecting Crb (Warner and Longmore 2009). Therefore, the impact of

Cdc42 on E-cad endocytosis can be context-dependent and indirect.

Figure 9. E-cad endocytosis model in Drosophila embryo.

Dia and myosin II promote lateral clustering of E-cad and initiate E-cad endocytosis. Once E- cad is clustered, AP2 and clathrin are recruited to the membrane to induce endocytosis. Arp2/3 mediated actin branching and dynamin are efficient to promote vesicle scission (Levayer, Pelissier- Monier, and Lecuit 2011).

Alternative mechanism described for Drosophila embryo (Levayer, Pelissier-Monier, and

Lecuit 2011) reveals a role for the formin diaphanous (Dia) in the polymerization of unbranched actin filaments and subsequent MyoII activation (Figure 9). Dia and MyoII promote cortical recruitment of AP2 and clathrin, thereby inducing clathrin-mediated endocytosis (Levayer,

Pelissier-Monier, and Lecuit 2011).

Therefore, there are at least two different mechanisms controlling E-cad endocytosis, which involves both branched and unbranched actin polymerization. These mechanisms could also cooperate and act simultaneously for dynamic cadherin endocytosis.

CHAPTER 3: Polarity Proteins and Adherens Junction Crosstalk in the Establishment and Maintenance of

Apico-Basal Polarity

Differentiation of epithelia requires multiple systems of organization including adhesion molecules, actomyosin network, spatial organization of membrane traffic and polarity proteins.

Hence, the establishment of a unified architecture needs coordination between these systems.

Despite the early work that identified the cadherin-catenin-based adhesion as a key early landmark during Drosophila epithelial polarization steps (Drubin and Nelson 1996), more recent studies suggest that establishment of the junctions is not a founding event since formation of an apical-basal axis is possible in the absence of cell-cell contact (Baas et al. 2004). For instance, in the follicular epithelium, the absence of the AJs does not result in an immediate loss of the tissue integrity, but takes a period of several days (G. Tanentzapf et al. 2000). In addition, actin and MT- related cortical cues can act upstream of the assembly of cell-cell contacts (T. J. C. Harris and Peifer

2004, 2005). Thus, the regulatory hierarchy of these polarity determinants appears to be highly complex and remains one of the main enigma to be solved in the developmental biology field.

In Chapter 3, I discuss how the reciprocal interaction between Crb, Par3, Sdt, Scrib and AJs contribute to the establishment and maintenance of polarized Drosophila epithelia.

Apico-Basal polarity establishment

Apico-basal polarity is a basic organizing principle of epithelial cells that is mainly governed by polarity proteins with contribution of the AJs and actin cytoskeleton. Drosophila cellularization is a good illustration of a complex process regulated by reciprocal polarity proteins that are expressed at different polarizations steps and contribute altogether to the formation of polarized epithelium (Figure 10).

Figure 10. Apico-Basal polarity establishment by polarity proteins and AJs during Drosophila early embryogenesis.

Top series of diagrams shows the embryo surface (1) before cellularization and (2–4) during cellularization, and (5) the mature blastoderm or ectoderm during gastrulation. The bottom series of diagrams show close-up views of the indicated stages, illustrating the distribution of polarity proteins and the cadherin–catenin complex (Laprise and Tepass 2011 with modifications).

Baz is expressed at a very early stage and is responsible for the establishment of apico- basal polarity by recruiting aPKC, Par6 and E-cad apically (T. J. C. Harris and Peifer 2005). At the beginning of cellularization, Baz, E-cad and Dlg overlap along furrow canals and apical microvilli

(Figure 10). As cellularization proceeds, Baz recruits E-cad apically and by the end of cellularization they form apical spot junctions above the furrows (T. J. C. Harris and Peifer 2004).

However, the initial polarization cue that triggers apical segregation of Baz along the furrow canals in microtubules-dependent manner is still unknown. The Crumbs complex starts to be expressed at later stages, by the beginning of gastrulation (Figure 10) and, hence, could not be a candidate for a founding polarization determinant. Once on the apical membrane, Crb needs interaction with Sdt to prevent rapid endocytosis and loss from the membrane (U Tepass and

Knust 1993).

Mutual competition between apical and basolateral determinants eventually results in the separation of apical and lateral domains. Thus, inhibition of apical polarity proteins such as Crb leads to the reduction of apical domain at the expansion of the basal one, whereas crb gain-of- function experiments show the opposite effect – the expansion of the apical domain (A Wodarz et al. 1995). Besides, loss of the apical determinant crb phenocopies the overexpression of a basolateral cue scrib. At the same time, reduction of scrib levels suppresses crb null phenotype demonstrating, therefore, a mutual antagonism (David Bilder, Schober, and Perrimon 2003).

Another regulatory machinery that contributes to the segregation of distinct domains and apico-basal polarity establishment is orchestrated by mutual activities of apical and basolateral kinases. Apical kinase aPKC phosphorylates basolateral Lgl and Par1 to prevent their association with the apical membrane (Betschinger, Mechtler, and Knoblich 2003; Hurov, Watkins, and

Piwnica-Worms 2004), whereas Par1 phosphorylates Par3 to block basolateral anchoring of aPKC/Par6/Par3 complex (Benton and St Johnston 2003). However, the molecular cascades of these phosphorylation remain unclear.

Additionally, E-Cad-based AJs are necessary polarity landmarks. E-cad null mutants showed disrupted apico-basal polarity that led to the formation of multilayered cells during gastrulating embryo and developing follicular epithelium (David Bilder, Schober, and Perrimon

2003; R. T. Cox, Kirkpatrick, and Peifer 1996; Müller and Wieschaus 1996; Guy Tanentzapf and

Tepass 2003). These findings are further supported by data from MDCK cells, where apico-basal

44 polarity was blocked by using anti-E-cad antibodies or by e-cad expression depletion (Capaldo and Macara 2007; Gumbiner, Stevenson, and Grimaldi 1988). However, the precise AJs contribution to the polarity establishment in epithelial cells and a surrounding mechanism need to be clarified.

The role of Crumbs in AJs organization

A common feature observed from flies to mammalian cells that lack the components of the

Crb complex is a shrinkage of the apical membrane, which, in turns, triggers additional defects such as compromised adherens junction stability. The exclusive Crb apical localization just above the zonula adherens suggests a direct role for Crb in the regulation of epithelial cell architecture.

Indeed, as the early works on the Drosophila embryo in the mid-late 90s showed, lack of Crb causes impaired AJs integrity and stability (Figure 11) leading to the formation of round-up cells that finally establish a multilayer (Figure 3). At the same time, crb overexpression leads to the expansion of the apical membrane and also abolishes formation of AJs that results in the disruption of embryonic tissue integrity (Grawe et al. 1996; Ulrich Tepass 1996; A Wodarz et al.

1995).

Figure 11. Crb and Sdt are involded in the AJs integrity regulation.

(A) The ventral epidermis of a wild-type embryo at stage 12, stained for DE-Cadherin. In the ventral epidermis, DE-Cadherin is concentrated at the zonula adherens, which forms a belt-like structure around each cell. In crb (B) and sdt (C) embryos at the same stage (12), DE-Cadherin staining in the epidermis is reduced to scattered dots which are present all over the lateral plasma membrane (Grawe et al. 1996).

Later a conserved C-terminal EERLI motif of Crb intracellular domain was shown to be responsible for E-cad localization and zonula adherens formation in Drosophila embryo (Klebes and Knust 2000). These finding were further confirmed on Drosophila photoreceptor cells, where

Crb intracellular domain containing a FERM-binding site was found to be required for the positioning and integrity of the AJs (Izaddoost et al. 2002). Remarkably, apico-basal determinant

Patj was not altered upon AJs mislocalization in crb-depleted cells suggesting that Crb functioning on the AJs is independent from its role in apico-basal polarity (Izaddoost et al. 2002).

Importantly, loss of crb resembles armXP33 phenotype including round up cell and multilayered embryonic ectoderm (David Bilder, Schober, and Perrimon 2003). This observation allows to propose that Crb and AJs act in the same regulatory pathway in the coordination of epithelial polarity at the early stages of Drosophila morphogenesis. Precisely, Crb was shown to control AJs positioning via the recruitment of aPKC and Par6 at the apical cortex and the Par3 relocalization at the junctional plane in Drosophila follicular epithelium, embryo (Morais-de-Sá,

Mirouse, and St Johnston 2010) and retina (Walther and Pichaud 2010).

In addition, Crb forms a complex with Sdt which is essential for proper Baz localization at the levels of AJs (Krahn, Bückers, et al. 2010), that feedbacks on the AJs stability. During cellularization stage, Baz is bound to Sdt, and this complex is stable as long as Baz is not phosphorylated on S980 site by aPKC. Upon aPKC-mediated phosphorylation of Baz, Sdt acquires a higher binding affinity to Crb causing the dissociation of Baz-Sdt complex at the AJs and the formation of a new Crb-Sdt complex. Likewise, Crb exhibits its function in the establishment of epithelial polarity.

Crb complex is also involved in the maintenance of Baz localization at the junctions though another regulatory pathway that includes basolateral complex Scribble (David Bilder, Schober, and Perrimon 2003). Crb is recruited apically in Baz-dependent manner and antagonizes Scrib activity to maintain the apical domain whereas Scrib performs antagonistic functions on Crb to repress apical membrane identity. This functional equilibrium, at the end, contributes to a proper

AJs localization.

On top of the discussed functions, Crb is also implicated in the regulation of junctions during tissue remodeling. For example, Crb is involved in the control of tubule cells rearrangements during dynamic tissue elongation, whereas it is dispensable for the apico-basal polarity and AJs maintenance at the earlier stages of tubulogenesis (Campbell, Knust, and Skaer

2009). In this system, similar to Drosophila embryo and follicular epithelium, downregulation of

Crb leads to the loss of AJs belt and formation of multilayered epithelium. Similarly, Crb is responsible for AJs integrity maintenance during the rapid apical membrane expansion in

Drosophila rhabdomeres (Pellikka et al. 2002).

In conclusion, the mechanisms that Crb uses for the positioning and organization of AJs appear to be highly diverse, presumably, redundant, and require further investigation. In my thesis, I address this question in an attempt to fill the gaps surrounding Crb-AJs interplay in

Drosophila embryo (see Chapter 4 for details).

The Baz role in AJs organization

Many studies performed in Drosophila embryo assigned a critical role of Par3/Baz in the positioning and regulation of AJs. The experiments performed by Tony Harris and Mark Peifer on the developing embryos more than a decade ago showed that AJs assembly absolutely requires

Baz, whereas apical accumulation of Baz is not compromised upon loss of AJs (T. J. C. Harris and

Peifer 2004). In Bazm/z embryos, E-cad is accumulated basally and its apical relocalization into spot junctions is severely impaired, whereas Baz stays apically in both armm/z and shgm/z mutants (T. J.

C. Harris and Peifer 2004). These findings suggest that Baz is necessary for proper E-cad distribution along apico-basal axis and that Baz acts upstream of the AJs during apico-basal polarity establishment. Later studies from Tony Harris lab confirmed that Baz functions in repositioning of E-cad to form mature spot junctions by performing quantification on Baz, E-cad and Arm molecules numbers in the apical spot junctions. As McGill and colleagues showed, there are seven molecules of E-cad and seven molecules of Arm per one molecule of Baz and that Baz and cadherin-catenin complexes possess independent dynamics within a given junction (McGill,

McKinley, and Harris 2009). Thus, Baz and E-cad form initially independent clusters that assemble into spot junctions during later embryonic development. Therefore, the genetic hierarchy of Baz and E-cad-based AJs during polarity establishment remains controversial and unclear.

In addition, Baz together with Par1 plays a pivotal role in AJs positioning during formation of dorsal transverse folds in gastrulating Drosophila embryo. In particular, reduction of Par1 kinase activity leads to lateral positioning of AJs, whereas inhibition of Baz results in the apical positioning of AJs, and both cases cause a block of dorsal block initiation (Wang et al. 2012).

Moreover, an increase of the Baz/Par1 ratio leads to the appearance of ectopic folds (Wang et al.

2012).

The precise mechanism of how Par3 regulates AJs positioning and levels most likely involves additional polarity regulators such as apical cytoskeleton, trafficking and is yet-to-be- discovered.

How polarity proteins regulate AJs organization?

It remains unclear whether the polarity proteins are necessary only for the correct positioning of AJs or they might be also involved in the AJs organization on the membrane. For instance, single null mutants for crb and scrib demonstrated a loss of apico-basal polarity and disruption of the AJs belt (David Bilder, Schober, and Perrimon 2003). Interestingly, a double crb scrib mutant rescued apico-basal polarity defect but E-Cad belt remained impaired (David Bilder,

Schober, and Perrimon 2003) suggesting a role for polarity proteins in the organization of AJs independently from their canonical functions in the polarity establishment and maintenance.

How then the polarity proteins are able to control AJs positioning? Despite the direct link between Baz and armadillo, a component of the AJs (Wei et al. 2005), polarity proteins are implicated in the AJ stability through regulation of vesicles trafficking and apical cytoskeleton.

Polarity proteins and vesicle trafficking

There is some accumulating evidence suggesting that Crb is constantly internalized from the membrane to allow AJ stability and proper apico-basal polarity. In vivo experiments performed on Drosophila follicle cells demonstrated that basolateral exclusion of Crb is mediated by Lgl via AP2/clathrin pathway (Fletcher et al. 2012), whereas endocytic uptake of Crb in the apical domain is under the control of avalanche (the Drosophila homolog of syntaxin) and Rab5- positive endosomes (Lu and Bilder 2005). At the same time, Crb avoids lysosomal degradation by binding to the retromer that directs Crb at the early endosomes for recycling and, therefore, controls overall levels of Crb on the membrane (Pocha et al. 2011). Importantly, inhibition of retromer machinery activity results in multilayered follicular epithelium, displaying a defect in the epithelial integrity (Pocha et al. 2011).

E-cad trafficking seems to be under a primary control of Rab11-positive endosomes and to a less extent to Rab5, since a decrease in the Rab11 activity results in the dramatic disruption of embryonic ectoderm integrity that leads to the AJs fragmentation and their ultimate loss (Roeth et al. 2009). In this context, Crb is lost before the destabilization of AJs, while basolateral

50 distribution of Dlg remains unchanged (Roeth et al. 2009). Presumably, Crb might be a direct target of Rab11, with a secondary effect on E-cad and AJs, or Crb may be just more sensitive to

Rab11 pathway in the embryo. These findings were further supported by data gained from

Drosophila embryonic trachea (Shaye, Casanova, and Llimargas 2008), pupal wing disc (Classen et al. 2005) and eye disc (Tiwari and Roy 2009), where blocking Rab11 resulted in different extents of AJs abnormalities that led to impaired morphogenesis.

Another regulatory pathway controlling the apical positioning of Crb and AJs is governed by the Exo84 exocyst complex subunit homolog. Exo84 mutants display mislocalized AJs and defects in cuticle secretion that resemble crb null embryos (J. T. Blankenship, Fuller, and Zallen

2007). In agreement with the findings from Mark Pfeifer lab, loss of Crb precedes a loss of epithelial integrity upon reduction of Exo84 levels in the embryonic ectoderm. Furthermore, Crb accumulates together with AJs proteins in the Rab11-positive recycling endosomes in Exo84 mutants (J. T. Blankenship, Fuller, and Zallen 2007). Likewise, the exocyst plays a significant role in the maintenance of E-cad surface levels in the wing disc (Langevin et al. 2005).

There is also a function for aPKC/Par6/Cdc42 complex that is implicated in a local AJ stability through the control of Arp2/3-dependent endocytosis in developing Drosophila notum

(Georgiou et al. 2008). In this system, inhibition of aPKC/Par6/Cdc42 complex results in gaps in junctional E-cad, and its cytosolic accumulation in endosomes (Leibfried et al. 2008). On the other hand, Cdc42 loss-of-function in Drosophila neuroectoderm leads to the upregulated endocytosis of Crb, and as a consequence, disrupted AJs (K. P. Harris and Tepass 2008). Thus, Cdc42 contributes to the stability of dynamic AJs by regulating apical endocytosis at two levels: by preventing the endocytic uptake of apical proteins from the plasma membrane and by promoting apical proteins trafficking from early to late endosomes (Figure 12).

Interestingly, Bazooka is also involved in E-cad endocytosis. In the embryo at stage 15, Baz is associated with a mobile fraction of E-cad in microtubules-dependent manner that controls E- cad levels on the membrane and, therefore, prevents formation of multicellular rosettes (Natalia

A. Bulgakova et al. 2013). Later, Baz-E-cad complex was identified as a target of p120-mediated endocytosis that contributes to E-cad recycling (N. A. Bulgakova and Brown 2016).

Figure 12. Model of the Cdc42-Par complex function in the regulation of the apical endocytic pathway.

The Cdc42-Par complex inhibits endocytosis from the plasma membrane and also promotes progression from the early endosome (EE) to the multivesicular body/late endosome (MVB/LE) (K. P. Harris and Tepass 2008).

Polarity proteins and cytoskeleton

Stabilization of AJs by intact actomyosin network is known to be an essential step during establishment of apico-basal polarity and, thereby, polarity proteins can coordinate AJs organization through these mediators. Striking example of such interactions is performed by the aPKC-driven reorganization of microtubules (MT) in early Drosophila embryo. Minus ends of MT are bound to centrosomes from the beginning of cellularization, whereas by the end of cellularization aPKC promotes the release of MT from the centrosomes that is highly critical for proper zonula adherens establishment (T. J. C. Harris and Peifer 2007). Depletion of aPKC activity results in impaired spot junctions positioning throughout epithelial sheet and their clustering

52 along dorso-ventral axis of cells where they stay associated with centrosome-based MT (T. J. C.

Harris and Peifer 2007).

Crb forms a complex with Moesin and βheavy-spectrin that is required for the stability of the apical membrane-associated cytoskeleton (Médina et al. 2002; Pellikka et al. 2002). Later, βheavy- spectrin was identified as a regulator of proteins recycling through Rab5-positive early endosomes in Drosophila midgut (Phillips and Thomas 2006). Furthermore, Baz was found to be a localization cue for Bitesize, a moesin-binding protein, and this interaction organizes apical actin filaments which, in turn, stabilize E-cad (Pilot et al. 2006).

Crumbs also interacts with an actin-dependent motor protein Myosin V (MyoV) that is required for the stabilization of MyoV on apical membrane in Drosophila PRCs (Pocha,

Shevchenko, and Knust 2011). Upon reduction of Myo V levels, E-cad together with armadillo accumulates at the aberrant junctions flanking ectopic rhabdomeres (Li, Satoh, and Ready 2007).

Thus, altering MyoII levels leads to the AJs mislocalization during PCRs morphogenesis.

Another piece of information supporting that polarity proteins regulate AJs stability via actomyosin cytoskeleton comes from Patj, a component of the Crb complex that associates with myosin-binding subunit of Myosin phosphatase and, therefore, decreases Myosin dephosphorylation, contributing to myosin stability (Sen, Nagy-Zsvér-Vadas, and Krahn 2012).

Thereby, Patj maintains the zonula adherens stability. Remarkably, the effect of patj null allele need to be further enhanced by the presence of one copy of shotgun (DE-cad) null allele to display dramatic defect on embryonic epidermis such as mislocalization of E-Cad and Baz into cytosolic vesicles or in aggregates that ultimately lead to multilayered tissue and non-polarized distribution of basolateral cue Dlg (Sen, Nagy-Zsvér-Vadas, and Krahn 2012).

aPKC/Par6/Par3 complex is also linked to apical cytoskeleton and this link plays a critical role in the regulation of dorsal closure in Drosophila embryo. During this morphological process, the extraembryonic amnioserosa cells undergo apical constriction that is driven by pulsating contractions of actomyosin network under the control of the Par complex (David, Tishkina, and

Harris 2010). Interestingly, Par3 is responsible for the duration of actomyosin pulses and aPKC/Par6 controls the interval between pulses (David, Tishkina, and Harris 2010).

Altogether, the mechanisms that polarity complexes employ to regulate AJs levels on the membrane appear to be distinct, with tissue- and time-sensitivity. Therefore, it is highly important to explore polarity proteins and junctional trafficking in different contexts and on various models.

CHAPTER 4: Molecular Dissection of Baz Reveals a Complex Interplay Between Crb, E-Cad and Baz

Molecular dissection of Baz reveals a complex interplay between

Crb, E-Cad and Baz

Pauline Salis1,2*, Veronika Aksenova1*, Binh An Truong Quang1,3, Jean-Marc

Philippe1, Pierre-François Lenne1, Thomas Lecuit1& and André Le Bivic1&

*co-first authors

& co-last authors

1 Aix-Marseille University, CNRS UMR 7288 , Institut de Biologie du Développement de Marseille

(IBDM), Campus de Luminy case 907, 13288 Marseille cedex 9, France

2 present address: UMR CNRS 7232 OOB, Université Pierre et Marie Curie, Banyuls-sur-Mer, France

3 present address: MRC Laboratory for Molecular Cell Biology, University College London, London,

United Kingdom

Abstract

E-Cadherin and polarity complexes play an essential role in establishing and maintaining epithelial organization. A loss of E-Cadherin adhesion leads to apico-basal polarity defects while a lack of polarity complexes results not only in a compromised apico-basal polarity but also in E-

Cadherin disorganization. The relationship between these pathways still remains poorly understood. Here we have focused on the interplay between DE-Cad-mediated adherens junctions, Baz polarity protein and a major apical polarity determinant, the transmembrane

Crumbs complex in Drosophila embryo. We demonstrated that Crb controls DE-Cad nanoscopic organization during embryo Germ Band Elongation (GBE) and this regulation involves Baz. By generating Baz mutants on various regulatory sites using site-specific transgenesis and quantitative live-imaging microscopy, we showed that Crb acts via CR1 oligomerization domain and Ser980 site of Baz to adjust DE-Cad levels at the junctions. Strikingly, we revealed that E-Cad

56 regulates Baz levels at the junctions in a CR1 domain-independent way and characterized the reciprocity of DE-Cad-Baz crosstalk. Together these studies identify a novel mechanism that coordinates the dynamic link between polarity complexes and E-Cadherin during polarization of epithelia in the embryo.

Introduction

Epithelia are sheets of adherent cells that serve as barriers between distinct functional compartments and provide directed transport of molecules. To fulfil their functions, epithelia possess a highly-polarized architecture with three prominent domains – apical, lateral and basal.

Apical domain faces external environment or lumen, lateral domain adheres neighboring cells and basal domain contacts basement membrane. The cooperative action of several polarity determinants governs the proper formation of these domains: 1) actomyosin cytoskeleton; 2) E-

Cadherin-based adherens junctions (AJ) and 3) evolutionarily conserved polarity complexes.

Thus, the dynamic integrity of these players results in the epithelial polarity establishment and maintenance. Here we focus on the complex interplay between E-Cad-based adherens junctions,

Baz (Baz is Par-3 homolog in fly) polarity protein and a major apical polarity determinant, transmembrane Crumbs complex. All three components are highly important for proper tissue integrity, whereas mutations or deletions in their genes result in disrupted epithelia and compromised AJ.

It is known that E-Cadherin is not uniformly distributed along the junctions but forms distinct clusters in many cell types (Hong, Troyanovsky, and Troyanovsky 2013; Kametani and

Takeichi 2007; U Tepass and Hartenstein 1994; Yonemura et al. 2010). E-Cadherin plays a crucial role in apico-basal polarity maintenance in gastrulating embryo by building clusters that provide intercellular adhesion and transmit tension (Cavey et al. 2008; Martin, Kaschube, and Wieschaus

2009). The mechanisms involved in controlling cluster size, number, repartition and dynamics remain, however, poorly understood. E-Cad null mutants showed disrupted apico-basal polarity that led to the formation of multilayered cells during gastrulating embryo and developing

57 follicular epithelium (Bilder, Schober, and Perrimon 2003; Cox, Kirkpatrick, and Peifer 1996;

Müller and Wieschaus 1996; Tanentzapf and Tepass 2003). These findings were further supported by data from MDCK cells, where apico-basal polarity was blocked by using anti-E-Cad antibodies or by e-cad expression depletion (Capaldo and Macara 2007; Gumbiner, Stevenson, and

Grimaldi 1988). At the same time, loss of crb caused impaired AJ integrity and stability leading to the formation of round-up cells that eventually established a multilayer (Grawe et al. 1996; Ulrich

Tepass 1996; Wodarz et al. 1995). Therefore, although Crb is not a component of AJ and is localized more apically to E-Cad (Ulrich Tepass 1996), it is required for proper AJ organization.

However, the molecular basis of E-Cad organization in crb mutants still need to be investigated.

Baz is another necessary cue for the apical recruitment of E-Cad and the assembly of apical spot junctions during cellularization (Harris and Peifer 2004, 2005). Importantly, apical accumulation of Baz is not abolished upon loss of AJ (Harris and Peifer 2004), suggesting that Baz acts upstream of E-Cad, at least, during cellularization. Moreover, Baz is responsible for AJ proper positioning during formation of dorsal folds in the gastrulating embryo, since baz KD led to the basal shift of

E-Cad due to Par1 kinase activity (Wang et al. 2012). In addition, Baz was shown to control fine organization of E-Cad clusters and, thereby, overall levels of E-Cad on the membrane during Germ

Band Elongation (GBE) in gastrulating embryo (Truong Quang et al. 2013). Baz retention at the junctions is known to be highly important for proper AJ positioning and this localization is governed by interconnected network of apical and basolateral kinases. Baz is excluded from the apical domain and re-localized at the junctional plane due to aPKC kinase activity in Crb- dependent manner (Morais-de-Sá, Mirouse, and St Johnston 2010; Walther and Pichaud 2010). In addition, Crb outcompetes Baz from Baz-Sdt complex that leads to the association of a new Crb-

Sdt complex and the following release of Baz at the level of junctions (Krahn, Bückers, et al. 2010).

Basolateral exclusion of Baz is maintained by Par1 kinase that blocks Baz oligomerization, thus preventing Baz-aPKC association (Doerflinger et al. 2003). Finally, Baz forms a complex with armadillo (β-catenin homolog in fly), a component of cadherin-catenin complex (Wei et al. 2005).

Overall, structural data do not shed light on the protein function and Baz-mediated regulation of

E-Cad remains poorly understood.

To better understand how Crb and Baz control E-Cad localization and molecular organization at AJ, we tested the contribution of these polarity proteins into E-Cad cluster organization. We found that both Crb and Baz are involved in the macroscopic and nanoscopic control of E-Cad distribution on the membrane. In particular, we showed that Crb acts via CR1 oligomerization domain and Ser980 site of Baz to adjust E-Cad levels at the junctions. Strikingly, we also demonstrated that E-Cad regulates Baz levels at the junctions and Baz oligomerization domain is dispensable for such regulation.

Results

Crb and Baz control E-Cad levels at the junctions and are required for E-Cad apical recruitment

To better understand the role of Crb and Baz in the E-Cad distribution and dynamics during early embryogenesis, we measured the E-Cad levels and distribution at the end of GBE. We imaged embryos that express a construct carrying GFP tag fused to a C-terminus of E-Cad (E-

Cad::GFP) at the endogenous locus (Huang et al. 2009). The detected GFP signal was used as a read-out for the amount of E-Cad protein in the lateral ectoderm of the embryos at the end of GBE in wild type (WT) controls or following knockdown of Crb (crb KD) or Baz (baz KD) by injecting crb dsRNAi and baz dsRNAi.

We first looked at the levels of E-Cad at the level of AJ (Fig. 1E) at the end of GBE in baz

KD and crb KD (Fig. 1B, C). Interestingly, compared to control embryos, levels of E-Cad at the AJ

in crb KD decreased 2-fold whereas baz KD showed a 3.3-fold decrease (Fig. 1E). Moreover,

embryos injected with baz dsRNAi showed a highly-perturbed epithelial layer, probably due to

the lack of E-Cad at the apico-lateral junction (Fig. 1B). The baz/crb KD did not show a more

severe phenotype (Fig. 1D) than baz KD alone indicating that Baz likely acts downstream of Crb

in regulating E-Cad levels and accumulation at AJ level.

E-Cad clusters form at the end of cellularization, increase in density during gastrulation

and persist throughout embryogenesis (Cavey et al. 2008). Initially, these clusters are found

along the lateral membrane of epithelial cells at the end of cellularization and are later

redistributed to the apico-lateral border (Grawe et al. 1996). Therefore, to discriminate between

a cellular loss of E-Cad or a redistribution of E-Cad along the lateral domain in crb KD and baz KD,

we looked at the apico-basal distribution of E-Cad during GBE (Fig. 1G-J). In control embryos, as

in crb KD and baz KD at early embryogenesis (t=0), E-Cad::GFP is distributed along the whole

lateral membrane. Within 30 min E-Cad::GFP accumulates at the apico-lateral domain of control

embryos while it decreases in the lateral membrane (Fig. 1G-G’’). In contrast, in baz KD and

baz+crb KD embryos, E-Cad::GFP accumulates more uniformly along the lateral membrane after

30 min (Fig. 1H, J), while crb KD embryos show still some apico-lateral enrichment (about 50%

lower than in controls) (Fig. 1I). These data suggest that crb KD has a direct impact on E-Cad

accumulation at the AJ (apico-lateral membrane) but not on the overall quantity of E-Cad in the

cells as probed by WB (data not shown).

Next, we tested the effect of the double baz/crb KD on E-Cad levels at the AJ. The double

KD showed a similar phenotype as a single baz KD action on E-cad organization – the E-Cad levels were 2.9-fold decreased in comparison with the control injection (Fig. 1E). The double baz/crb KD resulted in a significant reduction of E-Cad levels at the junctions leading to even more severe embryonic tissue collapse than in a single baz KD background (Fig. 1D). The Ecad::GFP redistribution dynamics along the apico-basal axis in the double baz/crb KD showed that more E-

Cad clusters remain at the lateral membrane throughout GBE (Fig. 1J-J’’). Overall, these results suggest that Baz and Crb act together to control the redistribution of E-Cad clusters from the lateral membrane to the apico-lateral border.

Crb and Baz regulate E-Cad nanoscopic organization at the junctions

As we observed a more irregular pattern of E-Cad::GFP fluorescence in baz KD or crb KD than in control AJ (Fig. 1B,C), we decided to investigate further the organization of E-Cad in the absence of Crb and/or Baz at the end of GBE. To investigate the precise role of Crb in E-Cad organization at the junctions and compare these results with already published data on Baz role in E-Cad clustering, we analyzed the nanoscopic organization of E-Cad upon crb KD in the same conditions as it has been done for baz KD (Truong Quang et al. 2013). It was previously shown by photo-activation localized microscopy (PALM) that RNAi-mediated reduction of Baz yielded in a significant reduction of E-Cad at the junction and resulted in a strong decrease of E-Cad clustering independent of its effect on E-Cad surface density (Truong Quang et al. 2013).

To resolve the organization of E-Cad at the nanoscopic level and to characterize E-Cad nanoscopic organization in crb KD we thus used PALM that allows a more quantitative description of E-Cad molecular distribution in AJ with a resolution of 30 nm (Truong Quang et al. 2013). This quantitative distribution is based on single molecule detection and localization of E-Cad at AJ.

Clusters are defined based on a proximity criteria of E-Cad molecules: when the distance between two E-Cad molecules is smaller than the PALM resolution (i.e 30nm), we assign them to the same cluster. PALM analysis of embryos at the T=+30 min after the end of cellularization confirmed that

E-Cad forms clusters along cell-cell junctions in both crb KD and control embryos (Fig. 2A-D).

In crb KD embryos, the junctional surface density of E-Cad decreases about 50% from 160

± 70 down to 90 ± 40 molecules/µm² when compared to the control (n = 559 junctions in 19 embryos; 453 junctions in 8 embryos, respectively) (Fig. 2E). This is in agreement with our previous observation of a two-fold reduction of E-Cad at the AJ in crb KD in a comparison with control based on the fluorescent intensity of E-Cad::GFP (Fig 1E). Moreover, this decrease in E-

Cad density is associated with a 30% decrease in the density of E-Cad clusters in crb KD compared to the control (from 18± 5 to 12 ± 5 clusters/µm²) (Fig. 2F). This is consistent with the fact that crb KD has a direct impact on E-Cad accumulation at the AJ (apico-lateral membrane) but not on the overall quantity of E-Cad in the cells.

Next we assessed whether Crb controls the quantity of E-Cad molecules in clusters, a parameter which we call cluster size (Truong Quang et al. 2013). The size distribution of E-Cad clusters at AJ is poly-dispersed ranging from E-Cad monomers to clusters of about a hundred molecules and the cluster size distribution can be approximated by a power-law with exponential cut-off Cn= A nα exp(-n/n*) with a slope α, an amplitude A, and a cutoff n* (Fig. 2I-K). Together, this size distribution of E-Cad clusters shows that the processes underlying the formation of E-

Cad clusters do not favor the production of a particular size. Importantly, E-Cad clustering depends strongly on the junctional surface density of E-Cad such that for a given amount of E-Cad at the surface one can predict the distribution of E-Cad cluster size (Truong Quang et al. 2013).

For the rest of the study, we thus compared cluster distribution for an equal given E-Cad density in the junctions of both control and crb KD embryos. In crb KD, E-Cad cluster size distribution is also poly-dispersed (Fig.2H) though it is strongly affected compared to controls and the parameters of the power law describing the distribution are different. There is an increase in the proportion of small and large clusters (corresponding respectively to the amplitude A and the cutoff n*) but there is a corresponding decrease in the proportion of clusters of intermediate size

(corresponding to the slope parameter α) compared to the control (Fig. 2G, H, quantifications in

Fig. 2I, J, K). Crb is thus required for E-Cad cluster size regulation and number. To summarize, Crb controls the size of E-Cad clusters (i.e. the number of molecules per cluster).

What are the regulatory domains on Baz that might be responsible for E-Cad regulation by Crb?

Next, we addressed the molecular mechanisms underlying E-Cad clustering and levels at the cell junctions. To test if Crb and Baz are involved in the same molecular pathway to regulate

E-Cad levels and organization, we generated mutations on some of Baz regulatory sites which could potentially rescue crb phenotype on E-Cad. To this end, we created new fly lines: a non- phosphorytable (BazS980A), a phospho-mimetic (BazS980E), a line lacking the CR1 oligomerization domain in the N-terminus site of Baz (BazΔCR1) and a wild type Baz (BazWT)

62 under spaghetti squash (sqh) promoter control and fused to mKate2 tag. The sqh>Baz::mKate2 lines were generated using site-specific transgenesis at the baz locus that allows comparable expression of the transgenes. In order to quantitatively describe the distribution of E-Cad along

AJs, Ecad::GFP transgene (Huang et al. 2009) was introduced into sqh>Baz::mKate2 lines. In addition, to better evaluate the intrinsic contribution or behavior of Baz::mKate2, endogenous levels of Baz were down-regulated by injecting dsRNA homologous to the baz 3’UTR, which was not present in the Baz transgenes (the depletion of Baz is shown in Fig. S1 and movies S1, S2). This approach allowed us to strongly reduce the contribution of endogenous Baz pool and thus to prevent the formation of hybrid oligomers since Baz is able to self-oligomerize (Benton and St.

Johnston 2003; McKinley, Yu, and Harris 2012).

E-Cad levels and organization in the three independent lines

First, we analyzed the expression of the sqh>Baz WT::mKate2 construct at the ventro-

lateral embryonic ectoderm of the live embryos at the end of GBE. This construct shows complete

functionality by full rescue of baz KD phenotype on E-Cad upon its overexpression (Fig. S2 and

movies S3, S4, S5). To characterize the organization of E-Cad along the junction, we introduced a

second parameter for the quantification i.e. heterogeneity. Heterogeneity is measured as the

standard deviation of E-Cad::GFP normalized intensity along a given junction. Thus, if a protein

tends to form big clusters at cell contacts, heterogeneity increases.

Interestingly, we detected slightly higher mean fluorescent intensity of

sqh>BazWT::mKate2 in endogenous baz-/- background in comparison with water control

injection, which had no effect on Ecad levels at the AJ (Figure S3C, D). This increase of

sqh>BazWT::mKate2 levels upon depletion of endogenous Baz is likely due to a competition

between the Baz isoforms that is relieved upon endogenous Baz depletion. E-Сad heterogeneity

was, however, slightly increased upon reduction of endogenous Baz levels (Fig. S3F). Then we

looked at the sqh>BazΔCR1::mKate2 transgene expression. This line is lacking 83 amino acids

sequence on the N-terminus site, which encodes the CR1 domain responsible to build Baz-Baz

63 oligomers (Feng et al. 2007). Sqh> BazΔCR1::mKate2 still remains associated with the junctions and shows Baz ΔCR1::mKate2 significant enrichment along the junctions in comparison with sqh>BazWT line (2.5 times higher mean fluorescent intensity in BazΔCR1 vs BazWT) (Fig. 3B, C, quantification in Fig. S4A). However, the junctional levels of BazΔCR1 are 1.3-fold decreased upon reduction of endogenous Baz pool (Fig. 3G, quantification in Fig. S4A) suggesting that there is still some association between sqh>BazΔCR1 and endogenous Baz that contributes to the overall levels of BazΔCR1 at the AJ likely by stabilizing it there. Interestingly, lowering BazΔCR1 levels at the AJ (after baz 3’UTR dsRNAi injection) leads to the increase of E-Cad heterogeneity

(quantification Fig. 3K). This observation could suggest that lower amount of Baz along the junction leads to more irregular distribution of the Baz protein on the membrane and consequently causes more uneven spreading of Baz-E-Cad clusters. Strikingly, E-Cad levels are not modified in these conditions (Fig. 3J). Next, we analyzed the expression of a phospho-mimetic

(BazS980E) and a phospho-dead (BazS980A) mutants. As opposed to BazΔCR1, we did not see any difference in BazS980E levels between the presence or lack of endogenous copy of Baz (Fig.

3D,H, quantification in Fig. S4A). E-Cad heterogeneity, however, shows 1.4-fold increase after a reduction of endogenous Baz as for BazΔCR1 (Fig. 3K). Interestingly, E-Cad levels at the AJ also remain unchanged (Fig. 3J). The analysis of non-phosphorylatable BazS980A mutant expression in the lateral embryonic ectoderm at the end of GBE was quite problematic due to the very punctate BazS980A expression at the AJ and the change of its cellular distribution profile in baz

KD background (Fig. 3E, I). In fact, it resulted in an almost complete loss of the protein on the plasma membrane that made the quantification analysis at AJ technically impossible (Fig. 3I). We hypothesized that the strongly perturbed behavior of this mutant can be explained by its instability at AJ in the absence of endogenous Baz as it was previously studied on the overexpressed transgene in a WT background (Morais-de-Sá, Mirouse, and St Johnston 2010).

Despite almost complete loss of BazS980A and lack of endogenous Baz contribution, E-Cad levels and heterogeneity do not seem to be affected (Fig. 3I’, quantification in Fig. 3K) suggesting that stable expression of Baz at AJ is not a prerequisite for E-Cad accumulation.

Then, in order to identify Crb function in this molecular pathway, we depleted Crb together with endogenous Baz to study the consequence on Baz::mKate2 mutants and E-Cad levels and heterogeneity. Endo baz + crb KD in BazWT::mKate2 embryos exhibited a 1.6-fold E-Cad level reduction when compared to controls (Fig. 4A’, quantification in Fig.4E) in agreement with our previous experiments in the presence of endogenous Baz (Fig. 1C, quantification in Fig.1E).

BazWT::mKate2 levels were not affected by endo baz + crb KD (Fig.4A, quantification in Fig. S4A), while E-Cad heterogeneity increased significantly (1.3-fold) (Fig. 4A’, quantification in Fig. 4F).

Taken together, these data indicate that in BazWT::mKate2 embryos, endo baz + crb KD induces the same loss of E-Cad and increase in E-Cad heterogeneity at AJ as in control embryos. We next performed endo baz + crb KD in BazΔCR1 background and analyzed the levels and the heterogeneity of E-Cad. BazΔCR1 levels at the junction are not changed upon endo baz + crb KD in comparison with the control (endo baz KD) (quantification in Fig. S4A). More strikingly, E-Cad levels in this case are comparable to E-Cad levels in Baz WT background with Crb (334 a.u. and

362 a.u., respectively) (Fig. 4B’, quantification in Fig. 4E). Thus, loss of Crb does not result in the

50% E-Cad level drop in BazΔCR1 as it was found for endo baz + crb KD in Baz WT. These data strongly suggest that crb KD phenotype on E-Cad levels is rescued by BazΔCR1 expression and, therefore, the CR1 domain of Baz might regulate E-Cad levels at the AJ. E-cad heterogeneity, however still shows a significant increase comparable to the one observed in the same conditions with BazWT::mKate2 (quantification in Fig. 4F). This observation indicates that Crb regulates E-

Cad levels and heterogeneity at the AJ by two parallel mechanisms.

We next asked whether loss of Crb could also act on E-Cad clustering via Ser980 phosphorylation on Baz. Endo baz + crb KD had no effect on the BazS980E levels at the AJ (Fig. 4C, quantification in Fig. S4A). E-Cad levels are not altered by endo baz + crb KD in BazS980E mutant similar to BazΔCR1 mutant as opposed to BazWT::mKate2 (Fig. 4C’ in comparison with Fig. 4A’, quantification in Fig. 4E). These data suggest that crb KD phenotype on E-Cad levels is rescued by

BazS980E expression in endo baz +crb KD background and, therefore, the aPKC-mediated phosphorylation of Baz might be involved in the E-Cad levels regulation mechanism by Crb. E-Cad

65 heterogeneity in BazS980E endo baz + crb KD is still significantly higher than in the Baz KD alone

(quantification in Fig. 4F) further suggesting that Crb controls E-Cad levels and heterogeneity by two different mechanisms.

Loss of crb and endogenous Baz yielded in a severe effect on BazS980A expression that

left hardly detectable traces (Fig. 4D). E-Cad is also strongly perturbed and only some remnants

can be seen at the AJ level as the tissue integrity is significantly compromised (Fig. 4D’). These

data indicate that in the absence of Baz phosphorylation on S980 loss of Crb results in an even

stronger E-Cad phenotype than in a Baz WT background.

Role of E-Cad and Crumbs in Baz organization

Crb is involved in the regulation of E-Cad levels and clustering via Baz, although, as we have shown, Crb does not control Baz levels at the AJ. So, we decided to check whether E-Cad can affect Baz levels. To address this issue, we performed e-cad KD (shotgun dsRNAi), as for all previous experiments mixed with endo baz dsRNAi probe, on Baz WT::mKate2 line. Remarkably, complete loss of E-Cad from the junctions does not lead to the loss of BazWT from AJ but instead

BazWT::mKate2 showed 1.8 times increased levels in comparison with the control injection (Fig.

5B in comparison with Fig. 5A, quantification in Fig. 5E). Then we asked whether CR1 domain of

Baz is involved in Baz accumulation at AJ upon depletion of E-Cad and endogenous Baz.

Interestingly, BazΔCR::mKate2 remains on the membrane upon endo baz +e-cad KD (Fig. 5D).

Under these conditions, BazΔCR1::mKate2 performs significant 1.8-fold increase of the fluorescent intensity similar to the Baz WT::mKate2 (Fig. 5D, quantification in Fig. 5E). Thus, E-

Cad is involved in the control of Baz levels at the AJ, while Crb is not, suggesting the reciprocity of

E-Cad-Baz regulatory link. How E-Cad governs Baz levels at the plasma membrane remains an open question, though.

Discussion

Altogether, the analysis of three independent Baz mutants gave a series of important

answers regarding the molecular regulation of Baz and E-Cad proteins on the membrane. First,

none of the Baz mutants demonstrated an effect on the E-Cad levels at the AJ, meaning that none

of the tested regulatory sites on Baz is solely involved in the regulation of E-Cad levels. Second,

we have identified that CR1 domain and S980 site are employed by Crb to adjust E-Cad levels at

the junctions since they both showed E-Cad levels rescue in crb KD conditions. However, the

expression of the mutants on these regulatory sites demonstrated only partial rescue of E-Cad

heterogeneity. These observations could be explained by two potential mechanisms – either

there is another, not yet characterized site on the Baz protein that is responsible for the Crb-

mediated regulation of E-Cad heterogeneity, or, more probably, Crb regulates E-Cad

heterogeneity independently from the E-Cad levels, for example, via actin. Another question that

remains unsolved is the mechanism of the E-Cad levels adjustment – how E-Cad could be removed

from the junctions? One possibility could be the difference of its distribution along the apico-

basal axis, however we did not observe any modification in the E-Cad apico-basal polarity across

the mutants, except for the BazS980A (Fig. S5). Therefore, there must be another way to remove

E-Cad molecules from the membrane and E-Cad endocytosis would be a first candidate for this

role.

Baz oligomerization domain has been shown to be essential but not sufficient for apical membrane localization of Baz since the mutant lacking CR1 domain (83 aa on the N-term) was found in the cytosol in the Drosophila follicular epithelium (Benton and St. Johnston 2003). The same results were obtained using the MDCK cell line (Feng et al. 2007). However, in our study on

Drosophila embryonic ectoderm, BazΔCR1 (83 aa on the N-term) did not display any membrane- to-cytosol transfer, which is in line with the previous report on the GFP-tagged Baz oligomerization mutant lacking 317 aa on its N-terminal site that still remained associated with the junctions in the embryonic epidermis at stage 12 (Krahn, Klopfenstein, et al. 2010). In the

Wodarz group study, BazΔCR1 colocalized with E-Cad at the AJ in the embryonic epidermis,

67 whereas localization of BazΔCR1 in the follicular epithelium depended on the level of its overexpression. Thus, at low levels, BazΔCR1 stayed at the AJ, meanwhile high levels of the protein resulted in a diffusive distribution of BazΔCR1 in the cytosol similar to the St Johnston group report (Krahn, Klopfenstein, et al. 2010). Therefore, the levels of the Baz expression seem to affect its subcellular localization that is why in our study we used spaghetti squash promoter that gives milder overexpression level and, presumably, more relevant expression levels in comparison with the UAS/Gal4 system that results in high overexpression levels. Moreover, Baz oligomerization domain might need another regulatory site on the Baz protein to perform its membrane-binding function as single removal of CR1 domain does not affect a subcellular distribution of Baz.

The same explanation could be also applied onto BazS980A mutant expression that in our hands did not result in the accumulation of prominent bar-shaped clusters on the membrane, which were previously reported by St Johnston group for the embryonic ectoderm (Morais-de-Sá,

Mirouse, and St Johnston 2010). Like for the BazΔCR1, such an aberrant phenotype could be a consequence of too high transgene overexpression level, which we bypassed by using a weaker promoter than UAS/Gal4, squash.

All together these data point at a complex role of Baz in the regulation of E-Cad levels and organization at AJs since removal of the CR1 domain or the hyperphosphorylation of the Baz aPKC phosphorylation site can rescue Crb depletion effects on E-Cad levels at AJs. These two mutations may have a common role in modifying Baz folding and thus interaction with E- -catenin binding. In turn this change in conformation might prevent E-Cad endocytosis and turn-over in the absence of Crb. How Crb acts on Baz to regulate E-Cad endocytosis is still unclear and further studies will be necessary to unravel this mechanism.

Materials and methods

Fly strains and Genetics

Transgenes for fluorescent microscopy

E-Cad::GFPki, is a knock in line generated by homologous recombination (Huang et al.

2009)..Baz∷GFP is a gene trap with GFP inserted into the first intron of the baz locus (McGill,

McKinley, and Harris 2009). SqhPa-Baz::mKate2 expression vectors were generated using a

SqhPa-sqh::mCherry modified vector (kind gift from A. Martin, (Martin, Kaschube, and Wieschaus

2009). a pCasper vector containing a sqh (MyoII RLC) minimal promoter. A PhiC31 attB was inserted downstream the white gene into AfeI restriction site. ORF of sqh::mCherry was replaced by a Baz-RA ORF tagged C-terminally by mKate2 (Shcherbo et al. 2009) with a GSAGSAAGSGEF flexible aa linker in between. WT construct contains the full baz-RA ORF (1-1464). In DCR1, aa 2-

84 were deleted (KVT---PDP). Phospho-null 980A (aPKC P° site) contains a S980A mutation (AGC-

> gcc). Phoshomimetic 890E contains a S980E mutation (AGC-> gag). All recombinant expression vectors were verified by sequence (Genewiz) and were sent to BestGene Inc for PhiC31 site specific mediated insertion into attP2 (3L, 68A4) or attP40 (2L, 25C7) landing sites. FASTA sequences of these vectors and cloning strategies are available on request.

Transgenic flies for PALM imaging

Flies expressed Ecad::EosFP under the promoter of spaghetti-squash (sqh) (Truong Quang et al. 2013).

Null mutants lines

crb 11A22 null mutant line is a gift from E. Knust

RNA interference

dsRNA probes were made by PCR amplification of genomic DNA with a pair of primers containing the sequence of the T7 promoter (TAATACGACTCACTATAGGGAGACCAC) followed by

23 nucleotides specific of the genes to target. PCR products were subsequently used as a template for the in vitro RNA synthesis with T7 polymerase using Ribomax (Promega) or MEGAscript

(Ambion) kits. The dsRNA probes were purified, precipitated, washed and re-suspended in DEPC

69 treated water, quantified by OD, checked on agarose gel and diluted for injection at standard concentrations (5 µM) in DEPC treated water.

The amplified sequences were as follows: shg/e-cad nucleotides 2164-2697 of transcript

NM057374, genebank

We used the following primers (underlined sequences correspond to the T7 promoter):

Shg2T7-F: T7seq GAGTCTCTTTGATAATGGCGAGC

Shg2T7-R: T7seq GGTTTCCATCGTTCTGGTGAATC

We generated two dsRNAi probes targeted against baz at the locus using the following primers: 3’UTR baz1, 506 nucleotides between -8 and + 497 from ATG of transcript CG5055-RA

(NM_001347807.1 genebank):

Baz1-T7-F: T7seq AGTACGAAATGAAGGTCACCGTC

Baz1-T7-R: T7seq TTTGTTACTGCCCTCTGCCTTCA

The template sequences: 3’UTR baz2, 481 nucleotides (743-1224 nucleotides) of transcript CG5055-RA (NM_001347807.1 genebank):

Baz2-T7-F: T7seq GTCATCAGCTAAAGGAACAGCTG

Baz2-T7-R: T7seq CCATTGATCTCCAAGATGCGATC

We generated by PCR two dsRNA probes directed against crb using the following primers.

The underlined sequence is T7 promoter. The sequence not underlined corresponds to the template sequence: Crb1, 491 nucleotides are between +18179 and +18670 from ATG

TAATACGACTCACTATAGGGCGCAAGAGTACTGCAACCCAC and T7--7385-R1:

TAATACGACTCACTATAGGGACAATACATTTGATGGGCTTCCT. Crb2, 514 nucleotides are between

-415 and +99 from ATG: T7-Crumbs-6917-F1: T7-Crumbs-153-F2: TAATACGACTCACTATAGGG

CGCACCTCTCTTTTAAGCCAAGTCT and T7-Crumbs-626-R2:

TAATACGACTCACTATAGGGTTCTACTG ATGCCGCCACTGTTG.

Live imaging

Embryos were prepared as described in (Cavey et al. 2008) and imaged in the ventral ectoderm from the beginning of cephalic furrow during 45 min. Live imaging of all embryos was performed with a spinning disc microscope using an oil 100X objective.

PALM imaging experiment and data analysis

Drosophila embryos were collected at 30min after the beginning of the germ band elongation and were fixed in 3.6% PFA (Prolabo) in PBS and Heptane for 20 minutes. Embryos were manually peeled from the glass-like vitellus membrane and transferred onto a 25 mm glass coverslip (No 1.5, Neuvitro) pre-coated with fiducial nanogold particles. Embryos were embedded in mounting medium (Aqua-poly mount) and sandwiched by adding another 12 mm top glass coverslip (No 1.0, Neuvitro).

Super-resolution imaging was done using custom-built PALM microscopy (Betzig et al.

2006) with three lasers: 405 nm for photo-conversion (50 mW, Coherent), 488 nm (50 mW,

Coherent) and 561 nm (Oxxius, 200 mW). High NA oil-immersion objective lens (100x/1.45 Oil,

αPlan-FLUAR, Zeiss) was used to collected fluorescence from single molecules and imaged onto a high sensitive camera (EMCCD iXon+ 897, Andor). Additional 1.6X tube lens yields a total magnification of 160X. A cylindrical lens with 7.5 m focal length was introduced into the light path to improve the axial localization using astigmatism (Huang, Zhou et al. 2009).

A ROI of 256x256 pixels in fixed Drosophila embryo was selected in either bright field or with 488 laser before being imaged with high power 561 nm laser (3-4 kW/cm2). Number of photo-activated molecules was kept constant by gradually increasing the intensity of the 405 nm laser (0-2 W/cm2). The background was reduced by using tilted illumination (Tokunaga, Imamoto et al. 2008) and by alternating activation and imaging laser using fire output of the camera as a trigger (Truong Quang and Lenne 2015). Exposure time was 100ms as an optimum for both high

SN and fast acquisition. Every 500 frames, the objective was lowered down 300-500 nm from the

AJ plane to take image of fiducial nanogold particles deposited on the coverslip. The acquisition lasted until full loss of fluorescence in the red channel and took in total 15-20k frames. Lateral and

71 axial localization precision were estimated by Thompson formula (Thompson, Larson et al. 2002) or by standard deviation of localizing single 555nm Alexa dyes multiple times, respectively.

Single molecules were detected and localized by custom-script in Matlab based on MTT algorithm (Sergé et al. 2008). PALM images were reconstructed from localized coordinates convoluted with the localization precision. The mechanical drift of the sample was estimated and compensated by tracking fiducial markers. Cluster were identified as described in (Truong Quang et al. 2013) by grouping molecules in within a distance of 2 folds of the localization precision.

Nearby clusters that were falsely attributed into one were separated by a mean-shift clustering algorithm (Comaniciu and Meer 1999) that identified local maximum of the underlying density function.

Cluster length

Cluster length was estimated by projecting detected cluster's coordinates onto the segmented junction and calculating the standard deviation of the 1D coordinates. The cluster length L was approximated as 6-folds of the standard deviation.

Cluster density

The cluster density was estimated as the ratio of the cluster size N and the cluster cross surface S = Π/4*L2.

Statistics

All the p-values are calculated using student test: p<0.001 highly significantly different; p>0.05, not significantly different.

Image analysis and quantification

E-Cad::GFP and sqh>Baz::mKate2 mean intensity quantifications were performed on time lapse live images from the beginning of cephalic furrow invagination (t=0) during 30 min.

Heterogeneity of E-Cad::GFP and sqh>Baz::mKate2

E-Cad::GFP and sqh>Baz::mKate2 heterogeneity quantifications were performed on time lapse images from -1.5µm from the apical surface at t+30 min after cephalic furrow invagination.

Heterogeneity of each junction was obtained by:

1. Determining all pixel intensity along the junction: Ip

2. Determining the mean intensity of the junction: Im

3. Normalizing (NI= Ip-Im)/Im

4. Calculate the standard deviation of NI of the junction

Bibliography

Benton, Richard, and Daniel St. Johnston. 2003. “A Conserved Oligomerization Domain in

Drosophila Bazooka/PAR-3 Is Important for Apical Localization and Epithelial Polarity.”

Current Biology 13(15): 1330–34.

Betzig, Eric, George H Patterson, R. Sougrat, O Wolf Lindwasser, Scott Olenych, Juan S Bonifacino,

Michael W Davidson, Jennifer Lippincott-Schwartz, and Harald F Hess. 2006. “Imaging

Intracellular Fluorescent Proteins at Nanometer Resolution.” Science 313(5793): 1642–45.

Bilder, David, Markus Schober, and Norbert Perrimon. 2003. “Integrated Activity of PDZ Protein

Complexes Regulates Epithelial Polarity.” Nature cell biology 5(1): 53–58.

Capaldo, Christopher T, and Ian G Macara. 2007. “Depletion of E-Cadherin Disrupts Establishment

but Not Maintenance of Cell Junctions in Madin-Darby Canine Kidney Epithelial Cells.” Mol

Biol Cell 18(1): 189–200.

Cavey, Matthieu, Matteo Rauzi, Pierre-François Lenne, and Thomas Lecuit. 2008. “A Two-Tiered

Mechanism for Stabilization and Immobilization of E-Cadherin.” Nature 453(7196): 751–56.

Comaniciu, Dorin, and P. Meer. 1999. “Mean Shift Analysis and Applications.” Proceedings of the

Seventh IEEE International Conference on Computer Vision 2(2): 1197–1203 vol.2.

Cox, Rachel T., Catherine Kirkpatrick, and Mark Peifer. 1996. “Armadillo Is Required for Adherens

Junction Assembly, Cell Polarity, and Morphogenesis during Drosophila Embryogenesis.”

Journal of Cell Biology 134(1): 133–48.

Doerflinger, Hélène, Richard Benton, Joshua M Shulman, and Daniel St Johnston. 2003. “The Role

of PAR-1 in Regulating the Polarised Microtubule Cytoskeleton in the Drosophila Follicular

Epithelium.” Development 130(17): 3965–75.

Feng, Wei, Hao Wu, Ling-Nga Chan, and Mingjie Zhang. 2007. “The Par-3 NTD Adopts a PB1-like

Structure Required for Par-3 Oligomerization and Membrane Localization.” The EMBO

Journal.

Grawe, F, A Wodarz, B Lee, E Knust, and H Skaer. 1996. “The Drosophila Genes Crumbs and

Stardust Are Involved in the Biogenesis of Adherens Junctions.” Development 122(3): 951–

59.

Gumbiner, B., B. Stevenson, and A. Grimaldi. 1988. “The Role of the Cell Adhesion Molecule

Uvomorulin in the Formation and Maintenance of the Epithelial Junctional Complex.” Journal

of Cell Biology 107(4): 1575–87.

Harris, Tony J C, and Mark Peifer. 2004. “Adherens Junction-Dependent and -Independent Steps

in the Establishment of Epithelial Cell Polarity in Drosophila.” Journal of Cell Biology 167(1):

135–47.

Harris, Tony J C, and Mark Peifer. 2005. “The Positioning and Segregation of Apical Cues during

Epithelial Polarity Establishment in Drosophila.” Journal of Cell Biology 170(5): 813–23.

Hong, Soonjin, Regina B. Troyanovsky, and Sergey M. Troyanovsky. 2013. “Binding to F-Actin

Guides Cadherin Cluster Assembly, Stability, and Movement.” Journal of Cell Biology 201(1):

131–43.

Huang, Juan, Wenke Zhou, Wei Dong, Annie M Watson, and Yang Hong. 2009. “From the Cover:

Directed, Efficient, and Versatile Modifications of the Drosophila Genome by Genomic

Engineering.” PNAS 106(20): 8284–89.

Kametani, Yoshiko, and Masatoshi Takeichi. 2007. “Basal-to-Apical Cadherin Flow at Cell

Junctions.” Nature cell biology 9(1): 92–98.

Krahn, Michael P., Johanna Bückers, Lars Kastrup, and Andreas Wodarz. 2010. “Formation of a

Bazooka-Stardust Complex Is Essential for Plasma Membrane Polarity in Epithelia.” Journal

of Cell Biology 190(5): 751–60.

Krahn, Michael P., Dieter R. Klopfenstein, Nannette Fischer, and Andreas Wodarz. 2010.

“Membrane Targeting of Bazooka/PAR-3 Is Mediated by Direct Binding to Phosphoinositide

Lipids.” Current Biology 20(7): 636–42.

Martin, Adam C., Matthias Kaschube, and Eric F. Wieschaus. 2009. “Pulsed Contractions of an

Actin–myosin Network Drive Apical Constriction.” Nature 457(7228): 495–99.

McGill, Melanie A., R. F Andrew McKinley, and Tony J C Harris. 2009. “Independent Cadherin-

Catenin and Bazooka Clusters Interact to Assemble Adherens Junctions.” Journal of Cell

Biology 185(5): 787–96.

McKinley, R. F. a., C. G. Yu, and T. J. C. Harris. 2012. “Assembly of Bazooka Polarity Landmarks

through a Multifaceted Membrane-Association Mechanism.” Journal of Cell Science 125(5):

1177–90.

Morais-de-Sá, Eurico, Vincent Mirouse, and Daniel St Johnston. 2010. “aPKC Phosphorylation of

Bazooka Defines the Apical/Lateral Border in Drosophila Epithelial Cells.” Cell 141(3): 509–

23.

Müller, H. a J, and Eric Wieschaus. 1996. “Armadillo, Bazooka, and Stardust Are Critical for Early

Stages in Formation of the Zonula Adherens and Maintenance of the Polarized Blastoderm

Epithelium in Drosophila.” Journal of Cell Biology 134(1): 149–63.

Sergé, Arnauld, Nicolas Bertaux, Hervé Rigneault, and Didier Marguet. 2008. “Dynamic Multiple-

Target Tracing to Probe Spatiotemporal Cartography of Cell Membranes.” Nature Methods

5(8): 687–94.

Shcherbo, Dmitry, Christopher S. Murphy, Galina V. Ermakova, Elena A. Solovieva, Tatiana V.

Chepurnykh, Aleksandr S. Shcheglov, Vladislav V. Verkhusha, Vladimir Z. Pletnev, Kristin L.

Hazelwood, Patrick M. Roche, Sergey Lukyanov, Andrey G. Zaraisky, Michael W. Davidson,

and Dmitriy M. Chudakov. 2009. “Far-Red Fluorescent Tags for Protein Imaging in Living

Tissues.” Biochemical Journal 418(3): 567–74.

Tanentzapf, Guy, and Ulrich Tepass. 2003. “Interactions between the Crumbs, Lethal Giant Larvae

and Bazooka Pathways in Epithelial Polarization.” Nature cell biology 5(1): 46–52.

Tepass, U, and V Hartenstein. 1994. “The Development of Cellular Junctions in the Drosophila

Embryo.” Developmental biology 161(2): 563–96.

Tepass, Ulrich. 1996. “Crumbs, a Component of the Apical Membrane, Is Required for Zonula

Adherens Formation in Primary Epithelia of Drosophila.” Developmental Biology 177(1):

217–25.

Truong Quang, Binh An, Madhav Mani, Olga Markova, Thomas Lecuit, and Pierre François Lenne.

2013. “Principles of E-Cadherin Supramolecular Organization in Vivo.” Current Biology

23(22): 2197–2207.

Walther, Rhian F., and Franck Pichaud. 2010. “Crumbs/DaPKC-Dependent Apical Exclusion of

Bazooka Promotes Photoreceptor Polarity Remodeling.” Current Biology 20(12): 1065–74.

Wang, Yu-Chiun, Zia Khan, Matthias Kaschube, and Eric F. Wieschaus. 2012. “Differential

Positioning of Adherens Junctions Is Associated with Initiation of Epithelial Folding.” Nature

484(7394): 390–93.

Wei, Shu Yi, Luis M. Escudero, Fengwei Yu, Li Hsun Chang, Li Ying Chen, Yu Huei Ho, Chiao Ming

Lin, Chin Shun Chou, William Chia, Juan Modolell, and Jui Chou Hsu. 2005. “Echinoid Is a

Component of Adherens Junctions That Cooperates with DE-Cadherin to Mediate Cell

Adhesion.” Developmental Cell 8(4): 493–504.

Wodarz, A, U Hinz, M Engelbert, and E Knust. 1995. “Expression of Crumbs Confers Apical

Character on Plasma Membrane Domains of Ectodermal Epithelia of Drosophila.” Cell 82(1):

67–76.

Yonemura, Shigenobu, Yuko Wada, Toshiyuki Watanabe, Akira Nagafuchi, and Mai Shibata. 2010.

“α-Catenin as a Tension Transducer That Induces Adherens Junction Development.” Nature

Cell Biology 12(6): 533–42.

Figures

Supplementary data

CHAPTER 5: Role of the Crumbs Proteins in Ciliogenesis, Cell Migration and Actin Organization

ROLE OF THE CRUMBS PROTEINS IN CILIOGENESIS, CELL MIGRATION AND ACTIN

ORGANIZATION

Elsa Bazellières1, Veronika Aksenova1, Magali Barthélémy-Requin1, Dominique Massey-

Harroche1 and André Le Bivic1*

1 : Aix-Marseille University, CNRS, IBDM, Case 907, 13288 Marseille, Cedex 09, France

*: corresponding author

Correspondence to: [email protected]

Key words: polarity complexes; cell polarity; cell migration; cytoskeleton

Abstract

Epithelial cell organization relies on a set of proteins that interact in an intricate way and which are called polarity complexes. These complexes are involved in the determination of the apico-basal axis and in the positioning and stability of the cell-cell junctions called adherens junctions at the apico-lateral border in invertebrates. Among the polarity complexes, two are present in the apical side of epithelial cells. These are the Par complex including aPKC, PAR3 and

PAR6 and the Crumbs complex including, CRUMBS, PALS1 and PATJ/MUPP1. These two complexes interact directly and in addition to their already well described functions, they play a role in other cellular processes such as ciliogenesis and polarized cell migration. In this review, we will focus on these aspects that involve the apical Crumbs polarity complex and its relation

89 with the cortical actin cytoskeleton which might provide a more comprehensive hypothesis to explain the many facets of Crumbs cell and tissue properties.

Abbreviations:

AJ, adherens junction; TJ, tight junction; aPKC, atypical protein kinase C; CRB, crumbs; DLG, discs large; ECM, extracellular matrix; FERM, 4.1 ezrin radixin moesin; LGL, lethal giant larvae;

MAGUK, membrane-associated guanylate kinase; MUPP1, multi PDZ domain protein; Ome, oko meduzy; PALS, proteins associated with Lin seven; PAR, partition defective; PATJ, PALS1- associated tight junction protein; PDZ, PSD-95, discs large, ZO-1; SCRIB, scribble; Sdt, stardust;

SH3, Src homology domain 3;.

☆ D. melanogaster and C. elegans gene and protein names are written in minuscule whereas vertebrate GENE and PROTEIN names are in capital letters. All gene names are in italic.

Introduction

Cell polarity is a general feature of living cells, from bacteria to eukaryotes. Overall cell polarity is linked to the necessity to move, to divide or to function directionally. Multicellularity has however introduced an additional level of organization as cell polarity and movements have to be coordinated at the level of the tissue 1. This is particularly true for metazoans since morphogenetic events such as gastrulation that are essential for morphogenesis, involve coordinated cell movements and coupling of cell forces while keeping the homeostasis of the developing organism 2. To achieve these complex morphogenetic events, metazoans have developed a new tissue organization with epithelial layers that are made of a single sheet of polarized adherent cells. In epithelia, each cell has a polarity which is integrated in a higher order of polarized organization of the tissue. Several years of research have led to define cell polarity in epithelial cells within two axes: The Planar Cell Polarity (PCP) and the Apico-Basal Polarity (ABP).

PCP coordinates in the plane of the epithelium the asymmetric distribution of several cell features, such as actomyosin cytoskeleton organization or cilia positioning, necessary for movement, feeding or sensing (for review see 3). This polarity relies on a set of proteins called the

PCP core complex made of several transmembrane proteins (Flamingo, van Gogh …) and adapters such as Prickle or Disheveled (for review see 4).

The other polarity system is the one that defines the ABP within cells. ABP is based on the formation of a free cell surface in contact with the external medium (the apical side), cell-cell contacts in the lateral domain and a basal side that lies most often on a basement membrane, opposite the apical side. The apical side is separated from the lateral domain by a set of specialized cell-cell junctions, which preserve the organism homeostasis (for review see 5). The integrity of the cell layers, in vertebrates, is mediated by the physical coupling of the cells through different sets of junctions, namely tight junctions, adherens junctions, and desmosomes 6. Apical and basolateral membranes are characterized by the presence of protein and lipid markers such as channels, transporters or enzymes linked to the function of these membranes. While these proteins or lipids are usually strongly associated to a specific polarized domain most of them do

91 not play an instrumental role in the establishment or maintenance of a polarized epithelium. Only a set of few proteins or lipids has been identified to play a role in establishing and/or maintaining epithelial ABP and organization 7, 8. The first set of genes was discovered using the Caenorabditis elegans model and genetic screens that identified Par proteins (for partitioning defective) including the Par3/Par6/aPKC (atypical protein kinase C) apical complex and the lateral

Par1/Par4 complex 9 , 10. For the polarity to be established, the Par6/Par3/aPKC and Par1 mutually exclude each other through antagonistic phosphorylation. This will actively drive the segregation of the Par polarity protein into their respective apical and basolateral domains (review in details

11). Once the polarity established, these complexes regulate the actin cytoskeleton and the endocytosis providing thus a mean to maintain distinct apico-basal cortical and membrane subdomains 12. Another complex involved in ABP is the lateral Scribble complex identified in flies

13 and made of Scribble, Discs large (Dlg) and Lethal giant larvae (Lgl) (for review see 14). This complex is involved in vesicular trafficking and cell proliferation (for review see 15).

In addition to these cortical or cytoplasmic complexes, a membrane anchored complex is formed by Crumbs, an apical transmembrane protein 16, stardust (PALS1 ,Protein Associated to

Lin Seven, in mammals), an adaptor of the MAGUK (Membrane Associated GUanylate Kinase) family 17, 18 and Patj (PALS1-Associated TJ protein), containing multi PDZ (PSD-95, Discs large, ZO-

1) domains 19, 20. This was the first core Crumbs complex identified and later it was shown in vertebrate that CRUMBS itself can bind directly to PAR6 21 and that in Drosophila aPKC phosphorylates Crumbs cytoplasmic tail 22 suggesting that they might form another complex together. Moreover, it was shown that Stardust/PALS1, PATJ and Par6 also interact 23 blurring the distinction between two distinct Crumbs complexes. The core Crumbs complex is involved in the regulation of the cortical actin cytoskeleton 24, the stabilization of AJs 25, vesicular trafficking 26 and cell proliferation 27, 28. For a more detailed description and functional analysis of the Crumbs complexes we suggest several recent reviews 26, 29. In this review, we will focus on the role of the

Crumbs complex in less explored functions or in fast moving aspects of its cell biology.

Crumbs and ciliogenesis

Cilia are extensions of the apical surface of most quiescent and differentiated cells (for review 30). In most cases, primary ciliogenesis begins by the gathering of small vesicles originated from the Golgi apparatus that reach the activated mother centriole using a polarized endosomal trafficking 31. Fusion of these vesicles produces a membranous cap called the ciliary vesicle at the distal tip of centriole. From this distal tip, microtubules grow in a polarized manner under the cap that jointly increases due to the addition of membrane. This nascent axoneme is therefore inserted in a double membrane which fuses with the apical plasma membrane during the emergence of the cilium. In epithelial cells, however, cilia grow directly by extension of the apical membrane around the axoneme (for review see 32). Like all organelles, the cilium is maintained by polarized vesicular traffic within the cell and along the axonemal microtubule network, with the specific molecular intraflagellar transport machinery 33.

Crumbs proteins and the polarity Par complex that specify apical identity have been involved in epithelial ciliogenesis (figure 1). The first Crumbs involved in ciliogenesis was CRB3 and in mammals, the CRB3 gene codes by alternative splicing for two isoforms: CRB3A with the canonical COOH-terminal ERLI motif and CRB3B with a COOH-terminal CLPI motif. These two isoforms are localized in cilia of MDCK cells (Madin Darby Canine Kidney cells) and are involved in its formation 34, 35. This is also the case for the polarity Par complex (PAR6, PAR3 and aPKC) which co-localizes to the primary cilium in the same cells and it has been proposed that CRB3A and the Par complex interact in the cilium 35. Previously, we have identified an interaction between CRB3A and PAR6α via the PDZ binding domain (ERLI) of CRB3A and the PDZ domain of

PAR6α 21 thus providing a direct link between these two complexes involved in ciliogenesis. While

CRB3A is involved in the initiation of ciliogenesis, PAR3 (linked to KIF3A/kinesin2/microtubules) seems to participate to the anterograde vesicular transport for the elongation of primary cilia 36 suggesting that CRB3A is required for the delivery of the Par complex to the cilium and acts upstream of it. It is interesting to mention that PAR6ɣ is also present at the centrosome suggesting that it could act earlier in ciliogenesis than proposed by organizing the pericentriolar domain 37.

CRB3B (also called CRB3-CLPI) does not interact with the Par complex but its targeting to the cilium is mediated by importin β-1, a nuclear import protein, that is essential for cytokinesis but also for ciliogenesis 34. Despite the fact that CRB3A or B have been involved in ciliogenesis a decade ago the molecular mechanisms at work remain unclear. In addition to be involved in primary ciliogenesis, CRB3 is necessary for the multiciliated airway cell differentiation 38 but a direct role of the Crumbs proteins in multiciliogenesis has not been demonstrated yet. It must be however noted that CRB2B (one of the CRB2 proteins in zebrafish) accumulates at the basis of the ciliary tuft in pronephric cells and that CRB2B knock-down induced a strong reduction in cilium length indicating that it plays a role in the formation or maintenance of cilia in multiciliated cells 39.

Some cells possess cilia with specialized sensory functions and it is the case for retina photoreceptors which bear inner and outer segments on their apical side (figure 1). This specialized cilium is in constant renewal throughout life while photoreceptors are not renewable.

Several studies from flies to man have shown that Crumbs proteins are essential for proper photoreceptor morphogenesis and survival 40-42 and are involved in the building of this specialized structure both in the zebrafish and in mammals. In zebrafish, CRB2A is expressed in the inner segments of all types of photoreceptors and in the apical domain of Müller cells whereas CRB2B

(also called Oko meduzy or Ome) 39 is mainly expressed in the inner segments of green, red and blue cones 43. CRB2A is involved in the regulation of the inner segment size as over-expression of full-length protein induced an increase in its size 44. In human and mouse photoreceptors, CRB1 and 2 are localized to the inner segments in addition to the cell-cell junctions (for review see 45).

It is of particular interest that CRB2 is accumulated in vesicles in the striated ciliary rootlets at the tip of the inner segments suggesting that CRB2 could play a role in transporting material to the connecting cilium 41. CRB3A is also found in the vicinity of the connecting cilium of human photoreceptors 46, 47 indicating that it might also have a conserved role between the primary cilium and the connecting cilium. Both CRB1 and CRB2 when mutated induced retina pathologies with photoreceptor degeneration 48 but the mechanism behind this degeneration is not known. One hypothesis could be that the lack of either CRB1 or CRB2 might impair transport of essential

94 components towards the outer segment through the connecting cilium. In Drosophila melanogaster, transport of rhodopsin is based on Myosin V that is in turn stabilized by Crumbs 49.

It must be noted that in mouse photoreceptor inner segments Myosin V is also detected but its function in photoreceptors has not been addressed 50. Thus, more work is necessary to understand the molecular role of Crumbs proteins in ciliogenesis and photoreceptor morphogenesis and survival.

Crumbs complex and cell migration

Cell migration is an important process that occurs in several events during either development, adulthood or pathological conditions. Cells can migrate as single units or collectively. Collective cell migration is an efficient process as a cluster of cells move in the same direction with a similar speed, compare to isolated cells that undergo a less persistent migration with frequent changes in their direction. In all these situations, polarity proteins are essential, as they will dictate how the cells will migrate. The level of expression together with the localization of the Par and Crumbs complexes strongly correlate with epithelial cell behavior, and with the balance between a static differentiated epithelium and a loosely connected/collectively migrating cells. The expression and localization of the polarity protein PATJ, PALS1 (both members of the

Crumbs complex) and PAR6, PAR3, aPKC confer the migration property of the cells as their accumulation at the leading edge will result in a polarized/directed and persistent migration whereas their mislocalization will give rise to a random migration (for review see 51-54). Even though several studies have demonstrated an implication for PATJ, PALS1 in cell migration, the role of CRUMBS during both single and collective cell migration still needs to be clearly demonstrated. However, CRUMBS is a transmembrane protein that can recruit the cytoplasmic proteins PAR6 and PALS1 at the cell membrane allowing the formation of the different polarity complexes. One can then speculate that CRUMBS could be involved in the recruitment of the different proteins at the leading edge of migrating cells. This localization is essential for the initial breaking of symmetry that leads to cell polarization. The temporal regulation also needs to be

95 elucidated but it has been proposed that PATJ can recruit PAR3 and aPKC at the wound edge 53, where it can be activated by Cdc42, thereby initiating downstream events such as stabilization of microtubules or integrins 55-57. We have recently identified a new interactor of PAR6α, HOOK2, a microtubule binding protein 58. In this study, we have unveiled a new function of HOOK2 in maintaining PAR6α at the centrosome level, resulting in an efficient and polarized migration of the epithelial sheet. From all these different studies, it seems to be important to look at the role of the polarity complexes not only at the level of the leading edge, but also elsewhere in the cells, as they are involved in the stabilization of the polarized organization of the cells.

During the so-called Epithelial to Mesenchymal Transition (EMT), it has been described in several models, in vivo and in vitro, that the polarity complexes Crumbs and Par are perturbed within their localization or expression. In these contexts, the polarity complexes play different roles. Historically, it has been admitted that CRUMBS could act as a tumor suppressor, as its expression is frequently lost in advanced tumors 59-63. However, recent work show that the loss of different isoforms of CRUMBS, namely CRB3 and CRB2 can induce or prevent the EMT to occur, respectively. For instance, loss of CRB3 expression in non-tumorigenic human mammary epithelial cells increases cell invasion, activates the transcription factor Snail and promotes cell scattering 63. In contrast, during mouse gastrulation the loss of CRB2 expression prevents the disassembly of AJs leading to defect in cell ingression 64. In both cases, the consequence is an impairment of the dynamical remodeling of the cell-cell adhesions, which could lead to a weakening of cell-cell adhesion in the CRB3 depletion or to a strengthening of cell-cell adhesion in the CRB2 depletion, resulting in an existing but perturbed cell migration.

In contrast to the Crumbs complex, in cancer cells, proteins of the Par complex are overexpressed or mislocalized and then potentially could act as oncoproteins 65, 66. Interestingly, the overexpression of any member of the Par complex also leads to an impairment of TJs integrity and apico-basal polarity, which could mechanically also result in the weakening of cell-cell adhesion. Recently, this idea has been challenged by a bioinformatic study, where it has been demonstrated that CRB1, CRB2 or PAR6γ gene expressions are downregulated in several cancers,

96 whereas, in the same cancer types, CRB3, PAR6α and PAR6β are upregulated 67. By expanding the analysis to all the members of the polarity complexes, it was concluded that polarity complexes play an important role in tumor progression, although the specific effects on depletion or upregulation are cancer type dependent.

All the studies done so far have clearly established a link between the behavior of migrating cells and the polarity complexes Crumbs and Par. However, the key events and factors that trigger the correct level expression or localization of the Crumbs and Par complexes are still unclear. So far, it has been described that during migration, by responding to different cues such as chemical (soluble factors, composition of the matrix) or physical (pulling forces, release in tension), epithelial cells can move persistently in a given direction correlating with the accumulation of the polarity complexes Crumbs and Par at the leading edge (for review see 51, 52).

The potential impact of chemical or physical cues on polarity protein expression or localization is discussed in the next sections.”

a) Chemical cues

During cancer progression, it has been shown that the growth factor TGFβ can dictate and enhance the occurrence of EMT through its effect on polarity proteins, such as phosphorylation of

PAR6 68 or the downregulation of PAR3 and CRB3 69, 70. Indeed, TGFβ associates and phosphorylates PAR6β, resulting in TJs dissolution 68 and in the formation of the PAR6β/aPKC complex at the leading edge 71. In the later study, it was further shown the importance of such a localization for the formation of the PAR6β/aPKC complex that connects to the microtubule system and directs cell migration. The effect of TGFβ will thus impact the tension at the cell-cell interface by weakening the adhesions and by stabilizing microtubules. This will allow the occurrence of pulling force that reorient the microtubule network resulting in a persistent migration 72, 73.

The matrix composition is also important. Deregulation of the extracellular matrix (ECM) environment can disrupt ABP and promote collective cell migration. This occur via changes in the

97 expression of matrix metalloproteinases, integrins, and ECM proteins (review in76) that correlate with changes in expression and/or localization of polarity proteins. When epithelial cell acquire a migrating phenotype, the Par complex is re-localized at the anterior/basal domain of the epithelial migrating cells, whereas CRUMBS expression is decreased but how this is triggered by the matrix is still unclear. Some evidences clearly point out a link between matrix composition and polarity complexes. As an example, in pancreatic carcinoma cells, collagen I and integrin expression are increased leading to AJs disruption and nuclear translocation of β-catenin77. This nuclear translocation of β-catenin by activating the transcription factor Snail has been shown to impact and remove the junctional localization of PAR3 and aPKC without affecting their expression. It was further showed that Snail activation repress CRB3 expression whereas PALS1 and PATJ expression were only reduced 69, 78. In that context, it is tempting to speculate that the remaining

PAR3, aPKC, PALS1 and PATJ could be relocalized to the leading edge allowing efficient cell migration.”

b) Physical cues

Interestingly, increasing evidences have shown that the microenvironment can influence tissue polarity and promote collective cell migration. Notably, the change in ECM composition is known to influence the rigidity of the matrix. During cancer progression, an increase in matrix rigidity has been extensively shown in several models 75. This increase in rigidity has been demonstrated to disrupt tissue polarity and promote collective cell invasion, a process called durotaxis 75, 79, 80. During durotaxis, cells migrate persistently toward the stiffer matrix, and acquired a spread and polarized shape that is associated with a high Rac, RhoA, ROCK and Cdc42 activity 81-83. Even if the link with the polarity complexes is not clearly established, PAR6 is a known interactor of Cdc42 and CRB3. It is tempting to speculate that the rigidity will impact the localization of these complexes toward the leading edge. Furthermore, an increase in rigidity has been described to modulate gene expression and cytoskeletal architecture favoring the EMT 75.

This EMT strongly correlated with changes in expression or loss of functional activity of the cell

98 polarity complexes Crumbs and PAR6, reinforcing the functional link between rigidity and polarity complexes 59-61, 67.

During migration, the formation of a free edge can also be thought as a release of lateral tension together with the weakening of the cell-cell junction 84, 85. This process has been described to happen in vivo when the gut suffers mild injuries 86. During this process, epithelial cells from the intestine acquire a migrating phenotype, and proteins, such as villin, relocalize from the apical membrane toward the leading edge 86. In this context, it would useful to understand how the

Crumbs and Par complexes behave and if the release in tension is sufficient to drive a change in localization of the polarity proteins. Interestingly, Merlin has been described to be sensitive to tension. A change in tension at the cell-cell interface, when the migrating cells are pulling on the cell behind, has been shown to remove Merlin from the cell-cell junction, allowing the generation of a Rac gradient needed for the formation of the lamellipodia 87. However, the link with the polarity complex CRUMBS/PATJ/PALS1 is not clear in this study, even if some other studies suggest an indirect link between CRUMBS and Merlin through either PAR3 88 or Expanded 89, 90.

Nowadays, the interplay between the nanotechnologies (tuning of the matrix), the physics

(measuring and applying forces) and the biology give the opportunity to tackle all the remaining questions, and to go further in the understanding of the implication of polarity protein during cell migration.

Crumbs and the actin cytoskeleton: a unifying theory

So far, the function of Crumbs complex has been compartmentalized to different processes, namely the formation and maintenance of epithelial junctions, cell proliferation, ciliogenesis, and migration (for review see 26). However, all these processes require changes in cell shape (figure 2) which are intrinsically linked to a specific organization and turnover of the actin cytoskeleton. When epithelial tissue polarity switches from an apico-basal (non-migratory state, formation and maintenance of junctions and cilia) to an anterior-posterior (migratory state) polarity, epithelial cells need to change their architecture. By doing so, the cells adapt to potential

99 changes in the surrounding environment as observed during cancer progression or differentiation

75, 91. Many years of research, and in particular the last decades have revealed an increase number of proteins that link CRB2 and CRB3 to several actin binding proteins. The proteins involved can interact with the FERM or the PDZ-binding domains of CRUMBS directly or indirectly through different partners. The final result of all these interactions can lead to a protein platform anchored to the cell membrane by CRUMBS. Here we will review the interactions between CRUMBS proteins and actin-binding proteins.

Several years ago, our group has identified in flies an interaction between Crumbs and

Moesin/β-heavy-Spectrin demonstrating for the first time a crucial role for Crumbs in the stabilization of actin cytoskeleton 24. Since then, this interaction has been shown to regulate the apical constriction and cellular movement allowing the formation of the tracheal tube, or dorsal closure 92-94.

In mammalian systems, CRB2 or CRB3 can interact with the actin cytoskeleton, through interactors such as E-cadherin 95, Moesin 24, Ezrin 96, Arp2/3, Eps8 97 or EHM2 98 but also through a co-regulation between these polarity complexes and the small GTPases, Rho, Rac and Cdc42.

Recent studies have demonstrated that cells depleted for CRB3 possess truncated actin microfilaments with a decrease expression levels of formin1 97, and leads to membrane blebbing that is associated to a detachment of the actin cortex from the membrane 99, 100. Based on all these studies, it is clear that at least CRB3 and CRB2 can regulate the actin dynamics in different manners. It can either allow the formation of branched actin by recruiting Arp2/3 and activates actin nucleation through Rac1 and Cdc42 regulation or the formation of actin bundles by recruiting Eps8 and promotes actomyosin contraction by regulating Rho activation through

EHM2. Even though the spatiotemporal regulation of all these proteins with CRUMBS is still unclear few studies have adressed this point. So far it has been demonstrated that Cdc42 is important for the correct localization of Crumbs 101 and for its interaction with Par6 102, allowing the establishment of the apical domain. The correct localization of activated Rac and Cdc42 is also important for the formation and stabilisation of AJs and TJs 103-105.

100

During migration, these local activations induce cytoskeletal rearrangements and rapid actin polymerization that lead to the formation of membrane protrusions and promote engagement of integrins with the extracellular matrix 106. aPKC, a component of the PAR6 complex, is a downstream effector of activated Cdc42, and has been shown to be localized at the cell front by PATJ, a component of the Crumbs polarity complex 53. When localized at the cell front, aPKC will promote actin assembly by reinforcing different pathway such as the Tiam1-Rac1 signalling pathway 107. In contrast to Rac and Cdc42, Rho is localized at the rear of the cell where it allows actomyosin contraction that helps the translocation of the cell body during cell migration.

During migration, CRB2 has also been shown to play an important role in the localization of the contractile actomyosin network, allowing the extrusion of cells during mesodermal invagination 64.

Taken together, all these studies strongly suggest that polarity proteins may control cell shape and dynamics by significantly contributing to the localization and activation of different small GTPases both at the apical and front ends of cells (e.g. Cdc42, Rac1) as well as at their basal and rear ends (e.g. Rho). Interestingly, these different small GTPases are involved in the formation and stability of specific actin filamentous structures, such as mesh-like actin and actin bundles networks. These actin networks will either produce pushing or pulling forces allowing epithelial cells to tune their shape. In cuboidal and columnar epithelia, actin mesh-like networks have been shown to be essential to preserve and maintain the stability of AJs, and TJs through the regulation of endocytosis 108. Furthermore, the apical localization of actin bundles has been proposed to be responsible for the contraction of the apical domain leading to columnar and tall cells 109, 110. In flat and migrating cells, the mesh-like network allows the formation of lamellipodia at the cell front for efficient cell migration. There, actin bundles are localized at focal adhesions at the cell- substrate interface 106, 111 or at AJs at the cell-cell interface 112 where they operate to reinforce adhesion sites 113, 114. Interestingly, actin dynamics result in the generation of forces that are intrinsically linked to mechanotransduction signalling, leading to important switches in cell behavior 114, 115. When cells generate high forces, the mechanosensitive proteins YAP and Merlin

101 lose their apical and junctional localization allowing the cells to switch from being differentiated/ciliated toward a more migrating phenotype 87, 114, 116, 117. YAP is phosphorylated upon the activation of the Hippo pathway, resulting in the cytoplamic localization of YAP. In

Drosophila, Crumbs regulates the Hippo pathway through its interaction with Expanded 90, 118.

Recently, studies done in mammalian system have revealed that CRB3 interacts with phosphorylated YAP and Kibra 38 or indirectly with Merlin 88-90, allowing the differentiation of multiciliated cells and the formation of normal 3D acini in MCF10A 119. The loss of CRB3 has been associated with defects in cell differentiation and the formation of acini with multiple lumen, the degradation of Kibra by the proteasome and the nuclear localization of YAP. This localization of

YAP induces the transcription of several factors involved in cell migration. YAP is a well-known mechanosensitive protein that is affected by cell-cell adhesion, and cell-substrate forces but also substrate rigidity. If cells are plated on top of a stiff substrate, the forces are increased at the cell- substrate interphase and thus transmitted to the cell-cell adhesions. In this high force condition, it is tempting to speculate that the CRB3/YAP and the CRB3/Merlin bonds are also mechanosensitive and could be released upon an increase in forces, resulting in YAP translocation to the nucleus and Merlin accumulation in the cytoplasm.”

From all these recent studies, it is clear that CRUMBS is not only involved in the establishment and maintenance of ABP, but has a much broader function. The different CRUMBS isoforms emerge as essential players in the dynamics of actin remodeling by interacting with many actin binding partners. Due to the fact that the different partners bind to the same cytoplasmic domain of CRUMBS, spatiotemporal regulation of these interactions must occur and much remains to be learned about how these multifaceted interactions direct tissue homeostasis and morphogenesis.

102

Future perspectives and concluding remarks

In this review, we have focused on less characterized functions of the CRUMBS family of proteins, showing that they might have a broader and more general function than expected. More dynamical studies are still needed to fully understand how polarity complexes work in an orchestrated, organized and finely regulated manner. Studies done so far in vertebrates are limited in terms of spatio-temporal regulation of the interaction between CRUMBS and its multiple partners, making the picture complex and yet incomplete. In order to fully understand the function of the different CRUMBS polarity complexes, the visualization and characterization of their spatio-temporal interactions are mandatory. Using the CRISPR-CAS9 technology combined with optogenetic tools to spatially and temporally control these interactions will help to finely described how and when the different partners interact. Furthermore, nano-technologies and biophysical tools will allow to pinpoint the global mechanical impact of the Crumbs complex on cellular forces and how the external constraints affect the regulation of the Crumbs complex together with its specific interactome. In addition to these basic cellular functions there are now evidences that all CRUMBS proteins are important players in some human pathologies but so far very little information has been provided on the mechanisms involved given the complexity of working directly on tissue organization and physiology in human. The next challenge will be to use human derived mini-organs expressing some mutated forms of CRUMBS genes.

103

Bibliography

1. Julicher, F. & Eaton, S. Emergence of tissue shape changes from collective cell behaviours. Seminars in cell & developmental biology 67, 103-112 (2017).

2. Davidson, L.A. No strings attached: new insights into epithelial morphogenesis.

BMC biology 10, 105 (2012).

3. Gray, R.S., Roszko, I. & Solnica-Krezel, L. Planar cell polarity: coordinating morphogenetic cell behaviors with embryonic polarity. Developmental cell 21, 120-133 (2011).

4. Seifert, J.R. & Mlodzik, M. Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nature reviews. Genetics 8, 126-138 (2007).

5. Rodriguez-Boulan, E. & Nelson, W.J. Morphogenesis of the polarized epithelial cell phenotype. Science 245, 718-725 (1989).

6. Jonusaite, S., Donini, A. & Kelly, S.P. Occluding junctions of invertebrate epithelia.

Journal of comparative physiology. B, Biochemical, systemic, and environmental physiology 186, 17-

43 (2016).

7. Le Bivic, A. Evolution and cell physiology. 4. Why invent yet another protein complex to build junctions in epithelial cells? American journal of physiology. Cell physiology 305,

C1193-1201 (2013).

8. Assemat, E., Bazellieres, E., Pallesi-Pocachard, E., Le Bivic, A. & Massey-Harroche,

D. Polarity complex proteins. Biochimica et biophysica acta 1778, 614-630 (2008).

9. Kemphues, K.J., Priess, J.R., Morton, D.G. & Cheng, N.S. Identification of genes required for cytoplasmic localization in early C. elegans embryos. Cell 52, 311-320 (1988).

10. Goldstein, B. & Macara, I.G. The PAR proteins: fundamental players in animal cell polarization. Developmental cell 13, 609-622 (2007).

11. McCaffrey, L.M. & Macara, I.G. Signaling pathways in cell polarity. Cold Spring

Harbor perspectives in biology 4 (2012).

104

12. Motegi, F. & Seydoux, G. The PAR network: redundancy and robustness in a symmetry-breaking system. Philosophical transactions of the Royal Society of London. Series B,

Biological sciences 368, 20130010 (2013).

13. Bilder, D., Li, M. & Perrimon, N. Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289, 113-116 (2000).

14. Yamanaka, T. & Ohno, S. Role of Lgl/Dlg/Scribble in the regulation of epithelial junction, polarity and growth. Frontiers in bioscience : a journal and virtual library 13, 6693-6707

(2008).

15. Humbert, P.O. et al. Control of tumourigenesis by the Scribble/Dlg/Lgl polarity module. Oncogene 27, 6888-6907 (2008).

16. Tepass, U., Theres, C. & Knust, E. crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell 61,

787-799 (1990).

17. Bachmann, A., Schneider, M., Theilenberg, E., Grawe, F. & Knust, E. Drosophila

Stardust is a partner of Crumbs in the control of epithelial cell polarity. Nature 414, 638-643

(2001).

18. Hong, Y., Stronach, B., Perrimon, N., Jan, L.Y. & Jan, Y.N. Drosophila Stardust interacts with Crumbs to control polarity of epithelia but not neuroblasts. Nature 414, 634-638

(2001).

19. Lemmers, C. et al. hINADl/PATJ, a homolog of discs lost, interacts with crumbs and localizes to tight junctions in human epithelial cells. The Journal of biological chemistry 277,

25408-25415 (2002).

20. Bhat, M.A. et al. Discs Lost, a novel multi-PDZ domain protein, establishes and maintains epithelial polarity. Cell 96, 833-845 (1999).

21. Lemmers, C. et al. CRB3 binds directly to Par6 and regulates the morphogenesis of the tight junctions in mammalian epithelial cells. Molecular biology of the cell 15, 1324-1333

(2004).

105

22. Sotillos, S., Diaz-Meco, M.T., Caminero, E., Moscat, J. & Campuzano, S. DaPKC- dependent phosphorylation of Crumbs is required for epithelial cell polarity in Drosophila. The

Journal of cell biology 166, 549-557 (2004).

23. Hurd, T.W., Gao, L., Roh, M.H., Macara, I.G. & Margolis, B. Direct interaction of two polarity complexes implicated in epithelial tight junction assembly. Nature cell biology 5, 137-142

(2003).

24. Medina, E. et al. Crumbs interacts with moesin and beta(Heavy)-spectrin in the apical membrane skeleton of Drosophila. The Journal of cell biology 158, 941-951 (2002).

25. Tepass, U. Crumbs, a component of the apical membrane, is required for zonula adherens formation in primary epithelia of Drosophila. Developmental biology 177, 217-225

(1996).

26. Pocha, S.M. & Knust, E. Complexities of Crumbs function and regulation in tissue morphogenesis. Current biology : CB 23, R289-293 (2013).

27. Richardson, E.C. & Pichaud, F. Crumbs is required to achieve proper organ size control during Drosophila head development. Development 137, 641-650 (2010).

28. Grzeschik, N.A., Parsons, L.M., Allott, M.L., Harvey, K.F. & Richardson, H.E. Lgl, aPKC, and Crumbs regulate the Salvador/Warts/Hippo pathway through two distinct mechanisms.

Current biology : CB 20, 573-581 (2010).

29. Slavotinek, A.M. The Family of Crumbs Genes and Human Disease. Molecular syndromology 7, 274-281 (2016).

30. Walz, G. Role of primary cilia in non-dividing and post-mitotic cells. Cell and tissue research 369, 11-25 (2017).

31. Sanchez, I. & Dynlacht, B.D. Cilium assembly and disassembly. Nature cell biology

18, 711-717 (2016).

32. Bernabe-Rubio, M. & Alonso, M.A. Routes and machinery of primary cilium biogenesis. Cellular and molecular life sciences : CMLS (2017).

106

33. Lechtreck, K.F., Van De Weghe, J.C., Harris, J.A. & Liu, P. Protein transport in growing and steady-state cilia. Traffic 18, 277-286 (2017).

34. Fan, S. et al. A novel Crumbs3 isoform regulates cell division and ciliogenesis via importin beta interactions. The Journal of cell biology 178, 387-398 (2007).

35. Fan, S. et al. Polarity proteins control ciliogenesis via kinesin motor interactions.

Current biology : CB 14, 1451-1461 (2004).

36. Sfakianos, J. et al. Par3 functions in the biogenesis of the primary cilium in polarized epithelial cells. The Journal of cell biology 179, 1133-1140 (2007).

37. Kodani, A., Tonthat, V., Wu, B. & Sutterlin, C. Par6 alpha interacts with the dynactin subunit p150 Glued and is a critical regulator of centrosomal protein recruitment. Molecular biology of the cell 21, 3376-3385 (2010).

38. Szymaniak, A.D., Mahoney, J.E., Cardoso, W.V. & Varelas, X. Crumbs3-Mediated

Polarity Directs Airway Epithelial Cell Fate through the Hippo Pathway Effector Yap.

Developmental cell 34, 283-296 (2015).

39. Omori, Y. & Malicki, J. oko meduzy and related crumbs genes are determinants of apical cell features in the vertebrate embryo. Current biology : CB 16, 945-957 (2006).

40. Hwa, J.J. & Clandinin, T.R. Apical-basal polarity proteins are required cell-type specifically to direct photoreceptor morphogenesis. Current biology : CB 22, 2319-2324 (2012).

41. Pellissier, L.P. et al. Gene therapy into photoreceptors and Muller glial cells restores retinal structure and function in CRB1 retinitis pigmentosa mouse models. Human molecular genetics 24, 3104-3118 (2015).

42. Alves, C.H. et al. Targeted ablation of Crb2 in photoreceptor cells induces retinitis pigmentosa. Human molecular genetics 23, 3384-3401 (2014).

43. Zou, J., Wang, X. & Wei, X. Crb apical polarity proteins maintain zebrafish retinal cone mosaics via intercellular binding of their extracellular domains. Developmental cell 22, 1261-

1274 (2012).

107

44. Hsu, Y.C. & Jensen, A.M. Multiple domains in the Crumbs Homolog 2a (Crb2a) protein are required for regulating rod photoreceptor size. BMC cell biology 11, 60 (2010).

45. Quinn, P.M., Pellissier, L.P. & Wijnholds, J. The CRB1 Complex: Following the Trail of Crumbs to a Feasible Gene Therapy Strategy. Frontiers in neuroscience 11, 175 (2017).

46. Pellissier, L.P. et al. Specific tools for targeting and expression in Muller glial cells.

Molecular therapy. Methods & clinical development 1, 14009 (2014).

47. Pellissier, L.P. et al. CRB2 acts as a modifying factor of CRB1-related retinal dystrophies in mice. Human molecular genetics 23, 3759-3771 (2014).

48. Pellissier, L.P. et al. Targeted ablation of CRB1 and CRB2 in retinal progenitor cells mimics Leber congenital amaurosis. PLoS genetics 9, e1003976 (2013).

49. Pocha, S.M., Shevchenko, A. & Knust, E. Crumbs regulates rhodopsin transport by interacting with and stabilizing myosin V. The Journal of cell biology 195, 827-838 (2011).

50. Schlamp, C.L. & Williams, D.S. Myosin V in the retina: localization in the rod photoreceptor synapse. Experimental eye research 63, 613-619 (1996).

51. Etienne-Manneville, S. Polarity proteins in migration and invasion. Oncogene 27,

6970-6980 (2008).

52. Nelson, W.J. Remodeling epithelial cell organization: transitions between front- rear and apical-basal polarity. Cold Spring Harbor perspectives in biology 1, a000513 (2009).

53. Shin, K., Wang, Q. & Margolis, B. PATJ regulates directional migration of mammalian epithelial cells. EMBO reports 8, 158-164 (2007).

54. Assemat, E. et al. The multi-PDZ domain protein-1 (MUPP-1) expression regulates cellular levels of the PALS-1/PATJ polarity complex. Experimental cell research 319, 2514-2525

(2013).

55. Etienne-Manneville, S. & Hall, A. Cell polarity: Par6, aPKC and cytoskeletal crosstalk. Current opinion in cell biology 15, 67-72 (2003).

56. Pegtel, D.M. et al. The Par-Tiam1 complex controls persistent migration by stabilizing microtubule-dependent front-rear polarity. Current biology : CB 17, 1623-1634 (2007).

108

57. Nishimura, T. & Kaibuchi, K. Numb controls integrin endocytosis for directional cell migration with aPKC and PAR-3. Developmental cell 13, 15-28 (2007).

58. Pallesi-Pocachard, E. et al. Hook2, a microtubule-binding protein, interacts with

Par6alpha and controls centrosome orientation during polarized cell migration. Scientific reports

6, 33259 (2016).

59. Boussioutas, A. et al. Distinctive patterns of gene expression in premalignant gastric mucosa and gastric cancer. Cancer research 63, 2569-2577 (2003).

60. Laprise, P. Emerging role for epithelial polarity proteins of the Crumbs family as potential tumor suppressors. J Biomed Biotechnol 2011, 868217 (2011).

61. Pearson, H.B. et al. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia. J Clin Invest 121, 4257-4267 (2011).

62. Karp, C.M. et al. Role of the polarity determinant crumbs in suppressing mammalian epithelial tumor progression. Cancer research 68, 4105-4115 (2008).

63. Li, P. et al. CRB3 downregulation confers breast cancer stem cell traits through

TAZ/beta-catenin. Oncogenesis 6, e322 (2017).

64. Ramkumar, N. et al. Crumbs2 promotes cell ingression during the epithelial-to- mesenchymal transition at gastrulation. Nature cell biology 18, 1281-1291 (2016).

65. Aranda, V. et al. Par6-aPKC uncouples ErbB2 induced disruption of polarized epithelial organization from proliferation control. Nature cell biology 8, 1235-1245 (2006).

66. Murray, N.R., Kalari, K.R. & Fields, A.P. Protein kinase Ciota expression and oncogenic signaling mechanisms in cancer. J Cell Physiol 226, 879-887 (2011).

67. Lin, W.H., Asmann, Y.W. & Anastasiadis, P.Z. Expression of polarity genes in human cancer. Cancer informatics 14, 15-28 (2015).

68. Ozdamar, B. et al. Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell plasticity. Science 307, 1603-1609 (2005).

109

69. Whiteman, E.L., Liu, C.J., Fearon, E.R. & Margolis, B. The transcription factor snail represses Crumbs3 expression and disrupts apico-basal polarity complexes. Oncogene 27, 3875-

3879 (2008).

70. Wang, X. et al. Downregulation of Par-3 expression and disruption of Par complex integrity by TGF-beta during the process of epithelial to mesenchymal transition in rat proximal epithelial cells. Biochimica et biophysica acta 1782, 51-59 (2008).

71. Mu, Y., Zang, G., Engstrom, U., Busch, C. & Landstrom, M. TGFbeta-induced phosphorylation of Par6 promotes migration and invasion in prostate cancer cells. British journal of cancer 112, 1223-1231 (2015).

72. Letort, G., Nedelec, F., Blanchoin, L. & Thery, M. Centrosome centering and decentering by microtubule network rearrangement. Molecular biology of the cell 27, 2833-2843

(2016).

73. Rasmussen, J.P., Reddy, S.S. & Priess, J.R. Laminin is required to orient epithelial polarity in the C. elegans pharynx. Development 139, 2050-2060 (2012).

74. Akhtar, N. & Streuli, C.H. An integrin-ILK-microtubule network orients cell polarity and lumen formation in glandular epithelium. Nature cell biology 15, 17-27 (2013).

75. Weaver, V.M. & Roskelley, C.D. Extracellular matrix: the central regulator of cell and tissue homeostasis. Trends Cell Biol 7, 40-42 (1997).

76. Lamouille, S., Xu, J. & Derynck, R. Molecular mechanisms of epithelial- mesenchymal transition. Nature reviews. Molecular cell biology 15, 178-196 (2014).

77. Koenig, A., Mueller, C., Hasel, C., Adler, G. & Menke, A. Collagen type I induces disruption of E-cadherin-mediated cell-cell contacts and promotes proliferation of pancreatic carcinoma cells. Cancer research 66, 4662-4671 (2006).

78. Aigner, K. et al. The transcription factor ZEB1 (deltaEF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene 26, 6979-6988

(2007).

110

79. Chaudhuri, O. et al. Extracellular matrix stiffness and composition jointly regulate the induction of malignant phenotypes in mammary epithelium. Nat Mater 13, 970-978 (2014).

80. Paszek, M.J. et al. Tensional homeostasis and the malignant phenotype. Cancer Cell

8, 241-254 (2005).

81. Giannone, G. et al. Periodic lamellipodial contractions correlate with rearward actin waves. Cell 116, 431-443 (2004).

82. Lee, K. et al. Matrix compliance regulates Rac1b localization, NADPH oxidase assembly, and epithelial-mesenchymal transition. Molecular biology of the cell 23, 4097-4108

(2012).

83. Wormer, D.B., Davis, K.A., Henderson, J.H. & Turner, C.E. The focal adhesion- localized CdGAP regulates matrix rigidity sensing and durotaxis. PloS one 9, e91815 (2014).

84. Raucher, D. & Sheetz, M.P. Cell spreading and lamellipodial extension rate is regulated by membrane tension. The Journal of cell biology 148, 127-136 (2000).

85. Dai, J. & Sheetz, M.P. Membrane tether formation from blebbing cells. Biophysical journal 77, 3363-3370 (1999).

86. Ubelmann, F. et al. Enterocyte loss of polarity and gut wound healing rely upon the

F-actin-severing function of villin. Proceedings of the National Academy of Sciences of the United

States of America 110, E1380-1389 (2013).

87. Das, T. et al. A molecular mechanotransduction pathway regulates collective migration of epithelial cells. Nature cell biology 17, 276-287 (2015).

88. Gladden, A.B., Hebert, A.M., Schneeberger, E.E. & McClatchey, A.I. The NF2 tumor suppressor, Merlin, regulates epidermal development through the establishment of a junctional polarity complex. Developmental cell 19, 727-739 (2010).

89. Hamaratoglu, F. et al. The tumour-suppressor genes NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. Nature cell biology 8, 27-36

(2006).

111

90. Ling, C. et al. The apical transmembrane protein Crumbs functions as a tumor suppressor that regulates Hippo signaling by binding to Expanded. Proceedings of the National

Academy of Sciences of the United States of America 107, 10532-10537 (2010).

91. Yeung, T. et al. Effects of substrate stiffness on cell morphology, cytoskeletal structure, and adhesion. Cell Motil Cytoskeleton 60, 24-34 (2005).

92. Letizia, A., Sotillos, S., Campuzano, S. & Llimargas, M. Regulated Crb accumulation controls apical constriction and invagination in Drosophila tracheal cells. Journal of cell science

124, 240-251 (2011).

93. Klose, S., Flores-Benitez, D., Riedel, F. & Knust, E. Fosmid-based structure-function analysis reveals functionally distinct domains in the cytoplasmic domain of Drosophila crumbs.

G3 3, 153-165 (2013).

94. Flores-Benitez, D. & Knust, E. Crumbs is an essential regulator of cytoskeletal dynamics and cell-cell adhesion during dorsal closure in Drosophila. eLife 4 (2015).

95. Straight, S.W. et al. Loss of PALS1 expression leads to tight junction and polarity defects. Molecular biology of the cell 15, 1981-1990 (2004).

96. Tilston-Lunel, A.M. et al. Crumbs 3b promotes tight junctions in an ezrin- dependent manner in mammalian cells. Journal of molecular cell biology (2016).

97. Gao, Y., Lui, W.Y., Lee, W.M. & Cheng, C.Y. Polarity protein Crumbs homolog-3

(CRB3) regulates ectoplasmic specialization dynamics through its action on F-actin organization in Sertoli cells. Scientific reports 6, 28589 (2016).

98. Loie, E., Charrier, L.E., Sollier, K., Masson, J.Y. & Laprise, P. CRB3A Controls the

Morphology and Cohesion of Cancer Cells through Ehm2/p114RhoGEF-Dependent Signaling.

Molecular and cellular biology 35, 3423-3435 (2015).

99. Whiteman, E.L. et al. Crumbs3 is essential for proper epithelial development and viability. Molecular and cellular biology 34, 43-56 (2014).

100. Charras, G.T., Hu, C.K., Coughlin, M. & Mitchison, T.J. Reassembly of contractile actin cortex in cell blebs. The Journal of cell biology 175, 477-490 (2006).

112

101. Harris, K.P. & Tepass, U. Cdc42 and Par proteins stabilize dynamic adherens junctions in the Drosophila neuroectoderm through regulation of apical endocytosis. The Journal of cell biology 183, 1129-1143 (2008).

102. Whitney, D.S. et al. Binding of Crumbs to the Par-6 CRIB-PDZ Module Is Regulated by Cdc42. Biochemistry 55, 1455-1461 (2016).

103. Chen, X. & Macara, I.G. Par-3 controls tight junction assembly through the Rac exchange factor Tiam1. Nature cell biology 7, 262-269 (2005).

104. Georgiou, M. & Baum, B. Polarity proteins and Rho GTPases cooperate to spatially organise epithelial actin-based protrusions. Journal of cell science 123, 1089-1098 (2010).

105. Mack, N.A. et al. beta2-syntrophin and Par-3 promote an apicobasal Rac activity gradient at cell-cell junctions by differentially regulating Tiam1 activity. Nature cell biology 14,

1169-1180 (2012).

106. Pollard, T.D. & Cooper, J.A. Actin, a central player in cell shape and movement.

Science 326, 1208-1212 (2009).

107. Nakayama, M. et al. Rho-kinase phosphorylates PAR-3 and disrupts PAR complex formation. Developmental cell 14, 205-215 (2008).

108. Georgiou, M., Marinari, E., Burden, J. & Baum, B. Cdc42, Par6, and aPKC regulate

Arp2/3-mediated endocytosis to control local adherens junction stability. Current biology : CB 18,

1631-1638 (2008).

109. Hannezo, E., Prost, J. & Joanny, J.F. Theory of epithelial sheet morphology in three dimensions. Proceedings of the National Academy of Sciences of the United States of America 111,

27-32 (2014).

110. Martin, A.C., Kaschube, M. & Wieschaus, E.F. Pulsed contractions of an actin-myosin network drive apical constriction. Nature 457, 495-499 (2009).

111. de Rooij, J., Kerstens, A., Danuser, G., Schwartz, M.A. & Waterman-Storer, C.M.

Integrin-dependent actomyosin contraction regulates epithelial cell scattering. The Journal of cell biology 171, 153-164 (2005).

113

112. Huveneers, S. & de Rooij, J. Mechanosensitive systems at the cadherin-F-actin interface. Journal of cell science 126, 403-413 (2013).

113. Elosegui-Artola, A. et al. Rigidity sensing and adaptation through regulation of integrin types. Nat Mater 13, 631-637 (2014).

114. Elosegui-Artola, A. et al. Mechanical regulation of a molecular clutch defines force transmission and transduction in response to matrix rigidity. Nature cell biology 18, 540-548

(2016).

115. Das, A., Fischer, R.S., Pan, D. & Waterman, C.M. YAP Nuclear Localization in the

Absence of Cell-Cell Contact Is Mediated by a Filamentous Actin-dependent, Myosin II- and

Phospho-YAP-independent Pathway during Extracellular Matrix Mechanosensing. The Journal of biological chemistry 291, 6096-6110 (2016).

116. Elbediwy, A., Vincent-Mistiaen, Z.I. & Thompson, B.J. YAP and TAZ in epithelial stem cells: A sensor for cell polarity, mechanical forces and tissue damage. BioEssays : news and reviews in molecular, cellular and developmental biology 38, 644-653 (2016).

117. Cooper, J. & Giancotti, F.G. Molecular insights into NF2/Merlin tumor suppressor function. FEBS letters 588, 2743-2752 (2014).

118. Robinson, B.S., Huang, J., Hong, Y. & Moberg, K.H. Crumbs regulates

Salvador/Warts/Hippo signaling in Drosophila via the FERM-domain protein Expanded. Current biology : CB 20, 582-590 (2010).

119. Mao, X. et al. CRB3 regulates contact inhibition by activating the Hippo pathway in mammary epithelial cells. Cell death & disease 8, e2546 (2017).

114

Acknowledgments and funding sources:

We thank Chris Toret for critical reading of this manuscript. The Le Bivic group is an

“Equipe labellisée 2008 de La Ligue Nationale contre le Cancer” and is supported by the labex

INFORM (grant ANR-11-LABX-0054), the ANR grant Ghearact (14-CE13-0013), CNRS and Aix-

Marseille University. EB was supported by « La Ligue Nationale contre le Cancer »

Figure legends

Figure 1: CRUMBS and ciliogenesis. The localization of the different CRUMBS and their binding partners are represented in the different types of cilia. On the left a photoreceptor with a connecting cilium is shown, in the middle a cell with a primary cilium and on the right a multiciliated cell. In all cases, CRUMBS proteins are localized at the level of the junctions, Sub-

Apical Region (SAR) of the photoreceptor and tight junctions of the other cells. CRUMBS proteins function to organize the apical membrane and underlying cytoskeleton (green) and have also been shown to be involved in polarized vesicular trafficking in the photoreceptor (from the SAR to the connecting cilium) and in the primary cilia

Figure 2: CRUMBS and actin organization during apico basal differentiation and cell migration. The localization of the CRUMBS complex is affected by external cues such as matrix

different signaling pathways, such as activation of Cdc42 that will allow the dynamics of the TJs and will impact the activity of the actin binding partner that bind to CRUMBS. All these interactions will allow the reorganization of the actin cytoskeleton and its contraction thanks to the localized activity of Rho, generating apical forces needed for the cell to acquire their columnar shape. Another protein platform formed by CRUMBS is the one constituted of phosphorylated

Merlin and phosphorylated Yap. In this configuration, these proteins are inactive allowing cell differentiation. On stiff substrate, the Crumbs complex is localized at the leading edge together with Par complex, Rac and Cdc42, allowing the formation of the lamellipodia. The Par complex is

115 also localized at the centrosome where it interacts with Hook2, a microtubule binding protein.

The generation of basal and junctional forces impacts the localization of YAP and Merlin, which are translocated to the nucleus and remove from the front edge of the pulled cells respectively.

These mechano-translocation and mechano-delocalization result in the activation of YAP and merlin that will result in the expression of gene needed for the migration and in the activation of

Rac at the leading edge. How CRUMBS proteins behave during migration is still unclear and we propose two scenarios, one where CRUMBS is also relocalized to the leading edge and one where the forces break the bond between CRUMBS/merlin and CRUMBS/YAP.

116

Figure 1

117

Figure 2

118

CHAPTER 6: Discussion

119

Although the pivotal role of E-cad-mediated adherens junctions is to establish intercellular adhesion, they also participate in the maintenance of polarization axis in epithelial cell sheets by segregating apical and basolateral membrane domains. To establish epithelial polarity, AJs are involved in a complex interplay with numerous feedback loops with acto-myosin cytoskeleton regulators and polarity proteins, mainly represented by Baz. In order to shed more light on the interactions between these polarity cues, during my PhD I investigated the role of Baz and Crb polarity proteins in the E-cad organization and distribution on the membrane. I have characterized the clustering principles of E-Cad and Baz proteins that contribute to the AJ stability on the membrane.

Despite the progress reached in understanding the basis of clustering, there are still many questions to be resolved. For instance, we are still far from deciphering how clustering of the proteins feedbacks on their local recruitment or coupling to the actomyosin cytoskeleton.

Moreover, we do not know if and how clustering results in the modification(s) of biochemical status of the proteins and how it reflects on their stability. In these regards, a more global question remains to be addressed is how proteins and polarity proteins in particular utilize stability mechanisms to establish boundaries between distinct compartments within the cell and how the crosstalk between different polarity determinants contributes to the overall cell polarization.

Current model based on my experiments and already published data suggest that Crb controls E- cad levels at the junctions via Baz oligomerization domain and involves Baz phosphorylation by aPKC. On top of that, Crumbs regulates Baz and E-cad heterogeneity, i.e. their distribution on the membrane by, most probably, another mechanism independent from the levels control. E-cad, in its turn, controls Baz levels and, surprisingly, not via Baz CR1 oligomerization domain, or, at least, not solely via CR1.

Taken together, I have identified a reciprocity of Baz and E-Cad regulatory link. In the future, it would be important to dissect a molecular mechanism surrounding Crb-Baz-E-cad interplay and to reveal how these proteins interact with actin cytoskeleton to adjust protein levels

120 and distribution pattern on the membrane. E-cad is also involved in the Baz internalization from the membrane since E-cad KD results in the significant upregulation of Baz. At the same time, Baz is reciprocally involved in the E-cad levels adjustment mechanism under Crb control. Thus, E-cad and Baz could be implicated in the same trafficking pathway as it was shown in the wing disc, where E-cad and Baz form a complex that is a target for p120-mediated endocytosis followed by

E-cad recycling (N. A. Bulgakova and Brown 2016). Crb has also been showed to be involved in E- cad trafficking via Rab11-positive endosomes (Roeth et al. 2009) and Exo84 exocyst complex subunit homolog (J. T. Blankenship, Fuller, and Zallen 2007) in the embryo. In addition, stabilization of E-cad on the membrane could be regulated by Crb and Baz via their interactions with apical actin belt. As we know, Crb forms a complex with Moesin and βheavy-spectrin and Baz is a localization cue for Bitesize, a moesin-binding protein that mediate a proper actin organization, which in turn stabilizes E-cadherin. Therefore, the characterization of the mechanism that polarity proteins utilize to modify cytoskeletal dynamics would provide an essential blueprint for our understanding of how polarity proteins fulfil their functions to modify certain protein levels and organization in different contexts.

Context specificity is an important feature of many polarity proteins. Thus, Baz is known to be required for proper E-cad positioning in the embryonic ectoderm (Morais-de-Sá, Mirouse, and St Johnston 2010), retina photoreceptor cells (Walther and Pichaud 2010) and follicular epithelium (Franz and Riechmann 2010). However, Baz functions in the follicular epithelium are a subject of debate. In the recent study on the follicular epithelium, the authors used bazxi106 allele which was considered as a null allele since it contains a stop codon resulting in a deletion of more than two thirds of the Baz protein (Krahn, Klopfenstein, et al. 2010). Remarkably, later bazxi106

(also known as baz4) was shown to express truncated Baz protein fragments in the follicular epithelium and carry additional mutations that possibly increase the baz loss-of-function effect in this tissue (Shahab et al. 2015). In addition, St Johnston group tested rescue capacities of non- phosphorylatable Baz S980A and phosphomimetic Baz S980E mutants in the follicular epithelium

121 and in the embryo using the same baz4 allele (Morais-de-Sá, Mirouse, and St Johnston 2010) that gives ground for potential speculations surrounding the conclusions drawn from these results.

Contrarily, a recent analysis reassessed the role of Baz in the follicular epithelium using new baz null alleles devoid of additional mutations and did not show E-cad positioning defect in bazEH747 and bazXR11 clones (Figure 13).

Figure 13. Localization of DE-Cad is unaffected in bazXR11 and bazEH747 clones.

Ovarian follicles in which bazXR11 (A and A’’) and bazEH747 (B and B’’) mutant cells are induced by hs-Flp mediated recombination and marked by loss of His-GFP. White boxes indicate regions shown in A’’ and B”. Scale bar = 20µm for A and B, 5µM for A” and B”. (Shahab et al. 2015)

Interestingly, bazEH747 m/z mutants, despite the lack of their effect on E-Cad positioning in the follicular epithelium, failed to establish apico-basal polarity during cellularization (Shahab et al. 2015). Thus, it is tempting to conclude that Baz is highly important for the polarity establishment during cellularization phase and becomes dispensable for polarity maintenance in the mature follicular epithelium.

Intrigued by the Baz tissue and developmental context specificity, I decided to address the the role of Baz in the Drosophila wing disc. To tackle this question, I have generated the bazxi106

122 mutant clones in the Drosophila pupal wing disc and, remarkably, did not manage to report any E-

Cad disorganization (Figure 14C). Although, the Baz functioning in this system is not widely studied, few research works conducted on the developing Drosophila wing epithelium did not assign a role for Baz in the apico-basal polarity foundation for this model, consistently with my data. Thus, bazxi106 clones in the wing imaginal discs did not show any defects in apico-basal polarity as revealed by the proper apical localization of aPKC and zonula adherens marker

(Wasserscheid, Thomas, and Knust 2007). Similarly, baz gain-of-functions experiments did not alter apical localization of aPKC (Wasserscheid, Thomas, and Knust 2007). More recent data further support that Baz is dispensable for apico-basal polarity in the wing epithelium since bazxi106 clones do not display any E-Cad organization discrepancies (Bardet et al. 2013) (Figure

15).

Overall, my results together with already published data allow to infer an auxiliary role of

Baz in the polarization of the wing disc. Presumably, Baz functions redundantly with other protein(s) in the wing that still need to be characterized.

123

Figure 14. Baz null clones do not affect DE-Cadherin organization in the wing disc.

Confocal images (A-C) of the fixed imaginal wing discs at the 17h after pupa formation (APF) representing wt tissue and bazxi106 clones. Bazxi106 clones were generated with Ubx-FLP FRT9_2 recombination system. Clones were identified by the absence of cytoplasmic GFP signal (A) and by Baz staining (B). The boundaries between wt tissue and bazxi106 clones are outlined in red. (A) Merged image of cytoplasmic GFP labeling wt tissue in green, Baz in red and DE-Cad in blue. (B) Baz staining shows the area of the clone lacking Baz. (C) DE-Cad staining displays uniform distribution of DE-Cad in both, wt tissue and bazxi106 clones.

124

Figure 15. Baz null clones do not affect E-Cad organization.

Confocal images (X-X'') of bazxi106 mutant clones within wt tissue. Clones were identified by the absence of cytoplasmic GFP (not shown) and of Baz staining (green in X, gray in X') are shown by a white outline. Cell apical contours were labeled by E-cad staining (red in X, gray in X'').(Bardet et al. 2013)

In conclusion, Baz has well-established roles in cellularizing embryo (David Bilder,

Schober, and Perrimon 2003; T. J. C. Harris and Peifer 2004; Müller and Wieschaus 1996; Guy

Tanentzapf and Tepass 2003), during zygotic embryonic development (David Bilder, Schober, and

Perrimon 2003; K. P. Harris and Tepass 2008; Müller and Wieschaus 1996; Guy Tanentzapf and

Tepass 2003), in embryonic neuroblasts (Atwood et al. 2007; Schober, Schaefer, and Knoblich

1999; A Wodarz et al. 1999) and oocyte polarity (Becalska and Gavis 2010; D. Cox et al. 2001; H.

Doerflinger et al. 2010; Huynh et al. 2001). In all these backgrounds, Baz employs various molecular pathways to orchestrate epithelial cell polarity and the requirement for the key players is highly dependent of the developmental context and cell type. Hence, the characterization and the structuring of the Baz molecular partners in different genetic/cellular/physiological remains a pressing challenge in the field that would significantly improve our understanding of the polarity protein fundamental functions.

125

Bibliography

Abe, Kentaro, and Masatoshi Takeichi. 2008. “EPLIN Mediates Linkage of the Cadherin

Catenin Complex to F-Actin and Stabilizes the Circumferential Actin Belt.” PNAS

105(1): 13–19.

Angres, Brigitte, Angela Barth, and W. James Nelson. 1996. “Mechanism for Transition

from Initial to Stable Cell-Cell Adhesion: Kinetic Analysis of E-Cadherin-Mediated

Adhesion Using a Quantitative Adhesion Assay.” Journal of Cell Biology 134(2): 549–

57.

Atwood, S. X., C. Chabu, R. R. Penkert, C. Q. Doe, and K. E. Prehoda. 2007. “Cdc42 Acts

Downstream of Bazooka to Regulate Neuroblast Polarity through Par-6 aPKC.”

Journal of Cell Science 120(18): 3200–3206.

Baas, a F, J Kuipers, N N van der Wel, E Batlle, H K Koerten, P J Peters, and H C Clevers.

2004. “Complete Polarization of Sibgle Intestinal Epithelial Cells upon Activation of

LKB1 by STRAD.” Cell 116: 457–66.

Bachmann, A, M Schneider, E Theilenberg, F Grawe, and E Knust. 2001. “Drosophila

Stardust Is a Partner of Crumbs in the Control of Epithelial Cell Polarity.” Nature

414(6864): 638–43.

Bachmann, André, Ferdi Grawe, Kevin Johnson, and Elisabeth Knust. 2008. “Drosophila

Lin-7 Is a Component of the Crumbs Complex in Epithelia and Photoreceptor Cells

and Prevents Light-Induced Retinal Degeneration.” European Journal of Cell Biology

87(3): 123–36.

Bardet, Pierre Luc, Boris Guirao, Camille Paoletti, Fanny Serman, Valentine Léopold, Floris

Bosveld, Yûki Goya, Vincent Mirouse, François Graner, and Yohanns Bellaïche. 2013.

126

“PTEN Controls Junction Lengthening and Stability during Cell Rearrangement in

Epithelial Tissue.” Developmental Cell 25(5): 534–46.

Barrett, Kathy, Maria Leptin, and Jeffrey Settleman. 1997. “The Rho GTPase and a Putative

RhoGEF Mediate a Signaling Pathway for the Cell Shape Changes in Drosophila

Gastrulation.” Cell 91(7): 905–15.

Becalska, Agata N., and Elizabeth R. Gavis. 2010. “Bazooka Regulates Microtubule

Organization and Spatial Restriction of Germ Plasm Assembly in the Drosophila

Oocyte.” Developmental Biology 340(2): 528–38.

Benton, Richard, and Daniel St Johnston. 2003. “Drosophila PAR-1 and 14-3-3 Inhibit

Bazooka/PAR-3 to Establish Complementary Cortical Domains in Polarized Cells.”

Cell 115(6): 691–704.

Bertet, Claire, Lawrence Sulak, and Thomas Lecuit. 2004. “Myosin-Dependent Junction

Remodelling Controls Planar Cell Intercalation and Axis Elongation.” Nature

429(6992): 667–71.

Betschinger, Jörg, Karl Mechtler, and JA Juergen A Knoblich. 2003. “The Par Complex

Directs Asymmetric Cell Division by Phosphorylating the Cytoskeletal Protein Lgl.”

Nature 422(March): 326–30.

Bilder, D, M Li, and N Perrimon. 2000. “Cooperative Regulation of Cell Polarity and Growth

by Drosophila Tumor Suppressors.” Science 289(July): 113–16.

Bilder, D, and N Perrimon. 2000. “Localization of Apical Epithelial Determinants by the

Basolateral PDZ Protein Scribble.” Nature 403(6770): 676–80.

Bilder, David, Markus Schober, and Norbert Perrimon. 2003. “Integrated Activity of PDZ

Protein Complexes Regulates Epithelial Polarity.” Nature cell biology 5(1): 53–58.

Blankenship, J. T., M. T. Fuller, and J. A. Zallen. 2007. “The Drosophila Homolog of the

Exo84 Exocyst Subunit Promotes Apical Epithelial Identity.” Journal of Cell Science

127

120(17): 3099–3110.

Blankenship, J. Todd, Stephanie T. Backovic, Justina S S.P. Sanny, Ori Weitz, and Jennifer

A. Zallen. 2006. “Multicellular Rosette Formation Links Planar Cell Polarity to Tissue

Morphogenesis.” Developmental Cell 11(4): 459–70.

Brumby, Anthony M., and Helena E. Richardson. 2003. “Scribble Mutants Cooperate with

Oncogenic Ras or Notch to Cause Neoplastic Overgrowth in Drosophila.” EMBO

Journal 22(21): 5769–79.

Buckley, Craig D, Jiongyi Tan, Karen L Anderson, Dorit Hanein, Niels Volkmann, William I

Weis, W James Nelson, and Alexander R Dunn. 2014. “Cell Adhesion. The Minimal

Cadherin-Catenin Complex Binds to Actin Filaments under Force.” Science

346(6209): 1254211.

Bulgakova, N. A., and N. H. Brown. 2016. “Drosophila p120catenin Is Critical for

Endocytosis of the Dynamic E-Cadherin-Bazooka Complex.” Journal of Cell Science

129: 477–82.

Bulgakova, Natalia A., Ilya Grigoriev, Alpha S. Yap, Anna Akhmanova, and Nicholas H.

Brown. 2013. “Dynamic Microtubules Produce an Asymmetric E-Cadherin-Bazooka

Complex to Maintain Segment Boundaries.” Journal of Cell Biology 201(6): 887–901.

Bulgakova, Natalia A, Ozlem Kempkens, and Elisabeth Knust. 2008. “Multiple Domains of

Stardust Differentially Mediate Localisation of the Crumbs-Stardust Complex during

Photoreceptor Development in Drosophila.” Journal of cell science 121(Pt 12): 2018–

26.

Bulgakova, Natalia A, Michaela Rentsch, and Elisabeth Knust. 2010. “Antagonistic

Functions of Two Stardust Isoforms in Drosophila Photoreceptor Cells.” Molecular

biology of the cell 21(22): 3915–25.

Campbell, Kyra, Elisabeth Knust, and Helen Skaer. 2009. “Crumbs Stabilises Epithelial

128

Polarity during Tissue Remodelling.” Journal of cell science 122(Pt 15): 2604–12.

Capaldo, Christopher T, and Ian G Macara. 2007. “Depletion of E-Cadherin Disrupts

Establishment but Not Maintenance of Cell Junctions in Madin-Darby Canine Kidney

Epithelial Cells.” Mol Biol Cell 18(1): 189–200.

Cavey, Matthieu, Matteo Rauzi, Pierre-François Lenne, and Thomas Lecuit. 2008. “A Two-

Tiered Mechanism for Stabilization and Immobilization of E-Cadherin.” Nature

453(7196): 751–56.

Chartier, François J.-M., Émilie J.-L. Hardy, and Patrick Laprise. 2011. “Crumbs Controls

Epithelial Integrity by Inhibiting Rac1 and PI3K.” Journal of Cell Science 124(20):

3393–98.

Chen, Yi-Jiun, Juan Huang, Lynn Huang, Erin Austin, and Yang Hong. 2017.

“Phosphorylation Potential of Drosophila E-Cadherin Intracellular Domain Is

Essential for Development and Adherens Junction Biosynthetic Dynamics

Regulation.” Development 144(7): 1242–48.

Choi, Hee Jung, Timothy Loveless, Allison M. Lynch, Injin Bang, Jeff Hardin, and William I.

Weis. 2015. “A Conserved Phosphorylation Switch Controls the Interaction between

Cadherin and Beta-Catenin in Vitro and in Vivo.” Developmental Cell 33(1): 82–94.

Claret, Sandra, Julie Jouette, Béatrice Benoit, Kevin Legent, and Antoine Guichet. 2014.

“PI(4,5)P2 Produced by the PI4P5K SKTL Controls Apical Size by Tethering PAR-3 in

Drosophila Epithelial Cells.” Current Biology 24(10): 1071–79.

Classen, Anne Kathrin, Kurt I. Anderson, Eric Marois, and Suzanne Eaton. 2005.

“Hexagonal Packing of Drosophila Wing Epithelial Cells by the Planar Cell Polarity

Pathway.” Developmental Cell 9(6): 805–17.

Coopman, Peter, and Alexandre Djiane. 2016. “Adherens Junction and E-Cadherin

Complex Regulation by Epithelial Polarity.” Cellular and Molecular Life Sciences

129

73(18): 3535–53.

Costa, Michael, Ellen T. Wilson, and Eric Wieschaus. 1994. “A Putative Cell Signal Encoded

by the Folded Gastrulation Gene Coordinates Cell Shape Changes during Drosophila

Gastrulation.” Cell 76(6): 1075–89.

Cox, D, S Seyfried, L Jan, and Y Jan. 2001. “Bazooka and Atypical Protein Kinase C Are

Required to Regulate Oocyte Differentiation in the Drosophila Ovary.” PNAS 98(25):

14475–80.

Cox, Rachel T., Catherine Kirkpatrick, and Mark Peifer. 1996. “Armadillo Is Required for

Adherens Junction Assembly, Cell Polarity, and Morphogenesis during Drosophila

Embryogenesis.” Journal of Cell Biology 134(1): 133–48.

David, D. J. V., A. Tishkina, and T. J. C. Harris. 2010. “The PAR Complex Regulates Pulsed

Actomyosin Contractions during Amnioserosa Apical Constriction in Drosophila.”

Development 137(10): 1645–55.

Delva, Emmanuella, and Andrew P. Kowalczyk. 2009. “Regulation of Cadherin

Trafficking.” Traffic 10(3): 259–67.

Doerflinger, H., N. Vogt, I. L. Torres, V. Mirouse, I. Koch, C. Nusslein-Volhard, and D. St

Johnston. 2010. “Bazooka Is Required for Polarisation of the Drosophila Anterior-

Posterior Axis.” Development 137(10): 1765–73.

Doerflinger, Hélène, Richard Benton, Joshua M Shulman, and Daniel St Johnston. 2003.

“The Role of PAR-1 in Regulating the Polarised Microtubule Cytoskeleton in the

Drosophila Follicular Epithelium.” Development 130(17): 3965–75.

Le Droguen, P.-M., S. Claret, A. Guichet, and V. Brodu. 2015. “Microtubule-Dependent

Apical Restriction of Recycling Endosomes Sustains Adherens Junctions during

Morphogenesis of the Drosophila Tracheal System.” Development 142(2): 363–74.

Drubin, David G., and W. James Nelson. 1996. “Origins of Cell Polarity.” Cell 84(3): 335–44.

130

Etemad-Moghadam, Bijan, Su Guo, and Kenneth J. Kemphues. 1995. “Asymmetrically

Distributed PAR-3 Protein Contributes to Cell Polarity and Spindle Alignment in Early

C. Elegans Embryos.” Cell 83(5): 743–52.

Fletcher, Georgina C., Eliana P. Lucas, Ruth Brain, Alexander Tournier, and Barry J.

Thompson. 2012. “Positive Feedback and Mutual Antagonism Combine to Polarize

Crumbs in the Drosophila Follicle Cell Epithelium.” Current Biology 22(12): 1116–22.

Flores-Benitez, David, and Elisabeth Knust. 2016. “Dynamics of Epithelial Cell Polarity in

Drosophila: How to Regulate the Regulators?” Current Opinion in Cell Biology 42: 13–

21.

Founounou, Nabila, Nicolas Loyer, and Roland Le Borgne. 2013. “Septins Regulate the

Contractility of the Actomyosin Ring to Enable Adherens Junction Remodeling during

Cytokinesis of Epithelial Cells.” Developmental Cell 24(3): 242–55.

Franz, Andre, and Veit Riechmann. 2010. “Stepwise Polarisation of the Drosophila

Follicular Epithelium.” Developmental Biology 338(2): 136–47.

Gamblin, Clémence L., Émilie J L Hardy, François J M Chartier, Nicolas Bisson, and Patrick

Laprise. 2014. “A Bidirectional Antagonism between aPKC and Yurt Regulates

Epithelial Cell Polarity.” Journal of Cell Biology 204(4): 487–95.

Gavard, J, and J S Gutkind. 2006. “VEGF Controls Endothelial-Cell Permeability by

Promoting the Beta-Arrestin-Dependent Endocytosis of VE-Cadherin.” Nature cell

biology 8(11): 1223–34.

Georgiou, Marios, Eliana Marinari, Jemima Burden, and Buzz Baum. 2008. “Cdc42, Par6,

and aPKC Regulate Arp2/3-Mediated Endocytosis to Control Local Adherens Junction

Stability.” Current Biology 18(21): 1631–38.

Goberdhan, D. C I, Nuria Paricio, Emma C. Goodman, Marek Mlodzik, and Clive Wilson.

1999. “Drosophila Tumor Suppressor PTEN Controls Cell Size and Number by

131

Antagonizing the Chico/PI3-Kinase Signaling Pathway.” Genes and Development

13(24): 3244–58.

Grawe, F, A Wodarz, B Lee, E Knust, and H Skaer. 1996. “The Drosophila Genes Crumbs

and Stardust Are Involved in the Biogenesis of Adherens Junctions.” Development

122(3): 951–59.

Grzeschik, Nicola A., Linda M. Parsons, Melinda L. Allott, Kieran F. Harvey, and Helena E.

Richardson. 2010. “Lgl, aPKC, and Crumbs Regulate the Salvador/Warts/Hippo

Pathway through Two Distinct Mechanisms.” Current Biology 20(7): 573–81.

Guillot, Charlène, and Thomas Lecuit. 2013. “Adhesion Disengagement Uncouples

Intrinsic and Extrinsic Forces to Drive Cytokinesis in Epithelial Tissues.”

Developmental Cell 24(3): 227–41.

Gumbiner, B., B. Stevenson, and A. Grimaldi. 1988. “The Role of the Cell Adhesion Molecule

Uvomorulin in the Formation and Maintenance of the Epithelial Junctional Complex.”

Journal of Cell Biology 107(4): 1575–87.

Haigo, Saori L., Jeffrey D. Hildebrand, Richard M. Harland, and John B. Wallingford. 2003.

“Shroom Induces Apical Constriction and Is Required for Hingepoint Formation

during Neural Tube Closure.” Current Biology 13(24): 2125–37.

Harris, Kathryn P., and Ulrich Tepass. 2008. “Cdc42 and Par Proteins Stabilize Dynamic

Adherens Junctions in the Drosophila Neuroectoderm through Regulation of Apical

Endocytosis.” Journal of Cell Biology 183(6): 1129–43.

Harris, Tony J C, and Mark Peifer. 2004. “Adherens Junction-Dependent and -Independent

Steps in the Establishment of Epithelial Cell Polarity in Drosophila.” Journal of Cell

Biology 167(1): 135–47.

Harris, Tony J C, and Mark Peifer. 2005. “The Positioning and Segregation of Apical Cues

during Epithelial Polarity Establishment in Drosophila.” Journal of Cell Biology

132

170(5): 813–23.

Harris, Tony J C, and Mark Peifer. 2007. “aPKC Controls Microtubule Organization to

Balance Adherens Junction Symmetry and Planar Polarity during Development.”

Developmental Cell 12(5): 727–38.

Harrison, Oliver J., Xiangshu Jin, Soonjin Hong, Fabiana Bahna, Goran Ahlsen, Julia Brasch,

Yinghao Wu, Jeremie Vendome, Klara Felsovalyi, Cheri M. Hampton, Regina B.

Troyanovsky, Avinoam Ben-Shaul, Joachim Frank, Sergey M. Troyanovsky, Lawrence

Shapiro, and Barry Honig. 2011. “The Extracellular Architecture of Adherens

Junctions Revealed by Crystal Structures of Type I Cadherins.” Structure 19(2): 244–

56.

Herszterg, Sophie, Andrea Leibfried, Floris Bosveld, Charlotte Martin, and Yohanns

Bellaiche. 2013. “Interplay between the Dividing Cell and Its Neighbors Regulates

Adherens Junction Formation during Cytokinesis in Epithelial Tissue.”

Developmental Cell 24(3): 256–70.

Hildebrand, Jeffrey D. 2005. “Shroom Regulates Epithelial Cell Shape via the Apical

Positioning of an Actomyosin Network.” Journal of cell science 118(Pt 22): 5191–

5203.

Hildebrand, Jeffrey D, and Philippe Soriano. 1999. “Shroom, a PDZ Domain–containing

Actin-Binding Protein, Is Required for Neural Tube Morphogenesis in Mice.” Cell

99(5): 485–97.

Hong, Y, B Stronach, N Perrimon, L Y Jan, and Y N Jan. 2001. “Drosophila Stardust Interacts

with Crumbs to Control Polarity of Epithelia but Not Neuroblasts.” Nature

414(6864): 634–38.

Horikoshi, Yosuke, Atsushi Suzuki, Tomoyuki Yamanaka, Kazunori Sasaki, Keiko Mizuno,

Hajime Sawada, Shigenobu Yonemura, and Shigeo Ohno. 2009. “Interaction between

133

PAR-3 and the aPKC-PAR-6 Complex Is Indispensable for Apical Domain

Development of Epithelial Cells.” Journal of cell science 122(Pt 10): 1595–1606.

Hsu, Ya-Chu, John J Willoughby, Arne K Christensen, and Abbie M Jensen. 2006. “Mosaic

Eyes Is a Novel Component of the Crumbs Complex and Negatively Regulates

Photoreceptor Apical Size.” Development 133(24): 4849–59.

Hurov, Jonathan B., Janis L. Watkins, and Helen Piwnica-Worms. 2004. “Atypical PKC

Phosphorylates PAR-1 Kinases to Regulate Localization and Activity.” Current Biology

14(8): 736–41.

Huynh, Jean René, Mark Petronczki, Juergen A. Knoblich, and Daniel St Johnston. 2001.

“Bazooka and PAR-6 Are Required with PAR-1 for the Maintenance of Oocyte Fate in

Drosophila.” Current Biology 11(11): 901–6.

Izaddoost, Shayan, Sang-Chul Nam, Manzoor A. Bhat, Hugo J. Bellen, and Kwang-Wook

Choi. 2002. “Drosophila Crumbs Is a Positional Cue in Photoreceptor Adherens

Junctions and Rhabdomeres.” Nature 416(6877): 178–83.

Jiang, Tao, R.F. Andrew McKinley, Melanie A. McGill, Stephane Angers, and Tony J.C. Harris.

2015. “A Par-1-Par-3-Centrosome Cell Polarity Pathway and Its Tuning for Isotropic

Cell Adhesion.” Current Biology 25(20): 2701–8.

Kametani, Yoshiko, and Masatoshi Takeichi. 2007. “Basal-to-Apical Cadherin Flow at Cell

Junctions.” Nature cell biology 9(1): 92–98.

Kemphues, Kenneth J., James R. Priess, Diane G. Morton, and Niansheng Cheng. 1988.

“Identification of Genes Required for Cytoplasmic Localization in Early C. Elegans

Embryos.” Cell 52(3): 311–20.

Kerridge, Stephen, Akankshi Munjal, Jean-Marc Philippe, Ankita Jha, Alain Garcia de las

Bayonas, Andrew J. Saurin, and Thomas Lecuit. 2016. “Modular Activation of Rho1 by

GPCR Signalling Imparts Polarized Myosin II Activation during Morphogenesis.”

134

Nature Cell Biology 18(3): 261–70.

Klebes, A, and E Knust. 2000. “A Conserved Motif in Crumbs Is Required for E-Cadherin

Localisation and Zonula Adherens Formation in Drosophila.” Current Biology 10(2):

76–85.

Kölsch, Verena, Thomas Seher, Gregorio J Fernandez-Ballester, Luis Serrano, and Maria

Leptin. 2007. “Control of Drosophila Gastrulation by Apical Localization of Adherens

Junctions and RhoGEF2.” Science 315(5810): 384–86.

Krahn, Michael P., Johanna Bückers, Lars Kastrup, and Andreas Wodarz. 2010. “Formation

of a Bazooka-Stardust Complex Is Essential for Plasma Membrane Polarity in

Epithelia.” Journal of Cell Biology 190(5): 751–60.

Krahn, Michael P., Dieter R. Klopfenstein, Nannette Fischer, and Andreas Wodarz. 2010.

“Membrane Targeting of Bazooka/PAR-3 Is Mediated by Direct Binding to

Phosphoinositide Lipids.” Current Biology 20(7): 636–42.

Kuchinke, U, F Grawe, and E Knust. 1998. “Control of Spindle Orientation in Drosophila by

the Par-3-Related PDZ-Domain Protein Bazooka.” Current Biology 8(25): 1357–65.

Kumichel, Alexandra, and Elisabeth Knust. 2014. “Apical Localisation of Crumbs in the

Boundary Cells of the Drosophila Hindgut Is Independent of Its Canonical Interaction

Partner Stardust.” PLoS ONE 9(4): 1–10.

Langevin, Johanna, Matthew J. Morgan, Carine Rossé, Victor Racine, Jean Baptiste Sibarita,

Sandra Aresta, Mala Murthy, Thomas Schwarz, Jacques Camonis, and Yohanns

Bellaïche. 2005. “Drosophila Exocyst Components sec5, sec6, and Sec15 Regulate DE-

Cadherin Trafficking from Recycling Endosomes to the Plasma Membrane.”

Developmental Cell 9(3): 365–76.

Laprise, Patrick, Slobodan Beronja, Nancy F. Silva-Gagliardi, Milena Pellikka, Abbie M.

Jensen, C. Jane McGlade, and Ulrich Tepass. 2006. “The FERM Protein Yurt Is a

135

Negative Regulatory Component of the Crumbs Complex That Controls Epithelial

Polarity and Apical Membrane Size.” Developmental Cell 11(3): 363–74.

Laprise, Patrick, Kimberly M Lau, Kathryn P Harris, Nancy F Silva-Gagliardi, Sarah M Paul,

Slobodan Beronja, Greg J Beitel, C Jane McGlade, and Ulrich Tepass. 2009. “Yurt,

Coracle, Neurexin IV and the Na+,K+-ATPase Form a Novel Group of Epithelial

Polarity Proteins.” Nature 459(7250): 1141–45.

Laprise, Patrick, and Ulrich Tepass. 2011. “Novel Insights into Epithelial Polarity Proteins

in Drosophila.” Trends in Cell Biology 21(7): 401–8.

Lecuit, Thomas. 2004. “Junctions and Vesicular Trafficking during Drosophila

Cellularization.” Journal of cell science 117(Pt 16): 3427–33.

Lecuit, Thomas, and Pierre-François Lenne. 2007. “Cell Surface Mechanics and the Control

of Cell Shape, Tissue Patterns and Morphogenesis.” Nature reviews. Molecular cell

biology 8(8): 633–44.

Lecuit, Thomas, and Alpha S Yap. 2015. “E-Cadherin Junctions as Active Mechanical

Integrators in Tissue Dynamics.” Nature cell biology 17(5): 533–39.

Leibfried, Andrea, Robert Fricke, Matthew J. Morgan, Sven Bogdan, and Yohanns Bellaiche.

2008. “Drosophila Cip4 and WASp Define a Branch of the Cdc42-Par6-aPKC Pathway

Regulating E-Cadherin Endocytosis.” Current Biology 18(21): 1639–48.

Letizia, Annalisa, Sol Sotillos, Sonsoles Campuzano, and Marta Llimargas. 2011.

“Regulated Crb Accumulation Controls Apical Constriction and Invagination in

Drosophila Tracheal Cells.” Journal of cell science 124(Pt 2): 240–51.

Levayer, Romain, and Thomas Lecuit. 2013. “Oscillation and Polarity of E-Cadherin

Asymmetries Control Actomyosin Flow Patterns during Morphogenesis.”

Developmental Cell 26(2): 162–75.

Levayer, Romain, Anne Pelissier-Monier, and Thomas Lecuit. 2011. “Spatial Regulation of

136

Dia and Myosin-II by RhoGEF2 Controls Initiation of E-Cadherin Endocytosis during

Epithelial Morphogenesis.” Nature cell biology 13(5): 529–40.

Li, Bingbing X., Akiko K. Satoh, and Donald F. Ready. 2007. “Myosin V, Rab11, and dRip11

Direct Apical Secretion and Cellular Morphogenesis in Developing Drosophila

Photoreceptors.” Journal of Cell Biology 177(4): 659–69.

Lu, Han, and David Bilder. 2005. “Endocytic Control of Epithelial Polarity and Proliferation

in Drosophila.” Nature Cell Biology 7(12): 1232–39.

Mandai, Kenji, Yoshiyuki Rikitake, Yohei Shimono, and Yoshimi Takai. 2013. “Afadin/AF-

6 and Canoe: Roles in Cell Adhesion and beyond.” Progress in Molecular Biology and

Translational Science 116: 433–54.

Martin-Belmonte, Fernando, and Mirna Perez-Moreno. 2011. “Epithelial Cell Polarity,

Stem Cells and Cancer.” Nature Reviews Cancer 12(1): 23–38.

Martin, Adam C., Michael Gelbart, Rodrigo Fernandez-Gonzalez, Matthias Kaschube, and

Eric F. Wieschaus. 2010. “Integration of Contractile Forces during Tissue

Invagination.” Journal of Cell Biology 188(5): 735–49.

McGill, Melanie a., R. F Andrew McKinley, and Tony J C Harris. 2009. “Independent

Cadherin-Catenin and Bazooka Clusters Interact to Assemble Adherens Junctions.”

Journal of Cell Biology 185(5): 787–96.

McKinley, R. F. a., C. G. Yu, and T. J. C. Harris. 2012. “Assembly of Bazooka Polarity

Landmarks through a Multifaceted Membrane-Association Mechanism.” Journal of

Cell Science 125(5): 1177–90.

Médina, Emmanuelle, Janice Williams, Elizabeth Klipfell, Daniela Zarnescu, Graham

Thomas, and André Le Bivic. 2002. “Crumbs Interacts with Moesin and βHeavy-

Spectrin in the Apical Membrane Skeleton of Drosophila.” Journal of Cell Biology

158(5): 941–51.

137

Miyashita, Yayoi, and Masayuki Ozawa. 2007. “Increased Internalization of p120-

Uncoupled E-Cadherin and a Requirement for a Dileucine Motif in the Cytoplasmic

Domain for Endocytosis of the Protein.” Journal of Biological Chemistry 282(15):

11540–48.

Morais-de-Sá, Eurico, Vincent Mirouse, and Daniel St Johnston. 2010. “aPKC

Phosphorylation of Bazooka Defines the Apical/Lateral Border in Drosophila

Epithelial Cells.” Cell 141(3): 509–23.

Müller, H. a J, and Eric Wieschaus. 1996. “Armadillo, Bazooka, and Stardust Are Critical for

Early Stages in Formation of the Zonula Adherens and Maintenance of the Polarized

Blastoderm Epithelium in Drosophila.” Journal of Cell Biology 134(1): 149–63.

Nance, Jeremy, Edwin M Munro, and James R Priess. 2003. “C . Elegans PAR-3 and PAR-6

Are Required for Apicobasal Asymmetries Associated with Cell Adhesion and

Gastrulation.” Development 130(issue 22): 5339–50.

Niessen, Carien M, Deborah Leckband, and Alpha S Yap. 2011. “Tissue Organization by

Cadherin Adhesion Molecules: Dynamic Molecular and Cellular Mechanisms of

Morphogenetic Regulation.” Physiological reviews 91(2): 691–731.

Ozaki, Chisa, Shuichi Obata, Hiroaki Yamanaka, Sachiko Tominaga, and Shintaro T. Suzuki.

2010. “The Extracellular Domains of E- and N-Cadherin Determine the Scattered

Punctate Localization in Epithelial Cells and the Cytoplasmic Domains Modulate the

Localization.” Journal of Biochemistry 147(3): 415–25.

Pagliarini, Raymond A. 2003. “A Genetic Screen in Drosophila for Metastatic Behavior.”

Science 302(5648): 1227–31.

Parks, Suki, and Eric Wieschaus. 1991. “The Drosophila Gastrulation Gene Concertina

Encodes a G Alpha-like Protein.” Cell 64(2): 447–58.

Pellikka, Milena, Guy Tanentzapf, Madalena Pinto, Christian Smith, C Jane McGlade,

138

Donald F Ready, and Ulrich Tepass. 2002. “Crumbs, the Drosophila Homologue of

Human CRB1/RP12, Is Essential for Photoreceptor Morphogenesis.” Nature

416(6877): 143–49.

Pénalva, Clothilde, and Vincent Mirouse. 2012. “Tissue-Specific Function of Patj in

Regulating the Crumbs Complex and Epithelial Polarity.” Development 139(24):

4549–54.

Petronczki, Mark, and Juergen A Knoblich. 2001. “DmPAR-6 Directs Epithelial Polarity and

Asymmetric Cell Division of Neuroblasts in Drosophila.” Nature cell biology 3(1): 43–

49.

Phillips, Matthew D, and Graham H Thomas. 2006. “Brush Border Spectrin Is Required for

Early Endosome Recycling in Drosophila.” Journal of cell science 119(Pt 7): 1361–70.

Pilot, Fanny, Jean-Marc Philippe, Céline Lemmers, and Thomas Lecuit. 2006. “Spatial

Control of Actin Organization at Adherens Junctions by a Synaptotagmin-like Protein

Btsz.” Nature 442(7102): 580–84.

Pocha, Shirin Meher, Anna Shevchenko, and Elisabeth Knust. 2011. “Crumbs Regulates

Rhodopsin Transport by Interacting with and Stabilizing Myosin V.” Journal of Cell

Biology 195(5): 827–38.

Pocha, Shirin Meher, Thomas Wassmer, Christian Niehage, Bernard Hoflack, and Elisabeth

Knust. 2011. “Retromer Controls Epithelial Cell Polarity by Trafficking the Apical

Determinant Crumbs.” Current Biology 21(13): 1111–17.

Rauzi, Matteo, Pascale Verant, Thomas Lecuit, and Pierre-François Lenne. 2008. “Nature

and Anisotropy of Cortical Forces Orienting Drosophila Tissue Morphogenesis.”

Nature cell biology 10(12): 1401–10.

Richard, Mélisande, Ferdi Grawe, and Elisabeth Knust. 2006. “DPATJ Plays a Role in

Retinal Morphogenesis and Protects against Light-Dependent Degeneration of

139

Photoreceptor Cells in the Drosophila Eye.” Developmental Dynamics 235(4): 895–

907.

Richard, Mélisande, Nadine Muschalik, Ferdi Grawe, Susann Özüyaman, and Elisabeth

Knust. 2009. “A Role for the Extracellular Domain of Crumbs in Morphogenesis of

Drosophila Photoreceptor Cells.” European Journal of Cell Biology 88(12): 765–77.

Robinson, Brian S., Juang Huang, Yang Hong, and Kenneth H. Moberg. 2010. “Crumbs

Regulates Salvador/Warts/Hippo Signaling in Drosophila via the FERM-Domain

Protein Expanded.” Current Biology 20(7): 582–90.

Roeth, Jeremiah F., Jessica K. Sawyer, Daniel A. Wilner, and Mark Peifer. 2009. “Rab11

Helps Maintain Apical Crumbs and Adherens Junctions in the Drosophila Embryonic

Ectoderm.” PLoS ONE 4(10).

Rolls, Melissa M., Roger Albertson, Hsin Pei Shih, Cheng Yu Lee, and Chris Q. Doe. 2003.

“Drosophila aPKC Regulates Cell Polarity and Cell Proliferation in Neuroblasts and

Epithelia.” Journal of Cell Biology 163(5): 1089–98.

Röper, Katja. 2012. “Anisotropy of Crumbs and aPKC Drives Myosin Cable Assembly

during Tube Formation.” Developmental Cell 23(5): 939–53.

Schober, M, M Schaefer, and J a Knoblich. 1999. “Bazooka Recruits Inscuteable to Orient

Asymmetric Cell Divisions in Drosophila Neuroblasts.” Nature 402(6761): 548–51.

Sen, Arnab, Zsanett Nagy-Zsvér-Vadas, and Michael P. Krahn. 2012. “Drosophila PATJ

Supports Adherens Junction Stability by Modulating Myosin Light Chain Activity.”

Journal of Cell Biology 199(4): 685–98.

Shahab, J., M. D. Tiwari, M. Honemann-Capito, M. P. Krahn, and A. Wodarz. 2015.

“Bazooka/PAR3 Is Dispensable for Polarity in Drosophila Follicular Epithelial Cells.”

Biology Open 4(4): 528–41.

Shaye, Daniel D., Jordi Casanova, and Marta Llimargas. 2008. “Modulation of Intracellular

140

Trafficking Regulates Cell Intercalation in the Drosophila Trachea.” Nature Cell

Biology 10(8): 964–70.

Simões, Sérgio De Matos, J. Todd Blankenship, Ori Weitz, Dene L. Farrell, Masako Tamada,

Rodrigo Fernandez-Gonzalez, and Jennifer Zallen. 2010. “Rho-Kinase Directs

bazooka/Par-3 Planar Polarity during Drosophila Axis Elongation.” Developmental

Cell 19(3): 377–88.

Sotillos, Sol, María Teresa Díaz-Meco, Eva Caminero, Jorge Moscat, and Sonsoles

Campuzano. 2004. “DaPKC-Dependent Phosphorylation of Crumbs Is Required for

Epithelial Cell Polarity in Drosophila.” Journal of Cell Biology 166(4): 549–57. von Stein, W. 2005. “Direct Association of Bazooka/PAR-3 with the Lipid Phosphatase

PTEN Reveals a Link between the PAR/aPKC Complex and Phosphoinositide

Signaling.” Development 132(7): 1675–86.

Strand, Dennis, Ivan Raska, and Bernard M. Mechler. 1994. “The Drosophila lethal(2)giant

Larvae Tumor Suppressor Protein Is a Component of the Cytoskeleton.” Journal of

Cell Biology 127(5): 1345–60.

Tanentzapf, G., C. Smith, J. McGlade, and U. Tepass. 2000. “Apical, Lateral, and Basal

Polarization Cues Contribute to the Development of the Follicular Epithelium during

Drosophila Oogenesis.” Journal of Cell Biology 151(4): 891–904.

Tanentzapf, Guy, and Ulrich Tepass. 2003. “Interactions between the Crumbs, Lethal Giant

Larvae and Bazooka Pathways in Epithelial Polarization.” Nature cell biology 5(1):

46–52.

Tepass, U, and V Hartenstein. 1994. “The Development of Cellular Junctions in the

Drosophila Embryo.” Developmental biology 161(2): 563–96.

Tepass, U, and E Knust. 1993. “Crumbs and Stardust Act in a Genetic Pathway That

Controls the Organization of Epithelia in Drosophila Melanogaster.” Developmental

141

biology 159(1): 311–26.

Tepass, U, C Theres, and E Knust. 1990. “Crumbs Encodes an EGF-like Protein Expressed

on Apical Membranes of Drosophila Epithelial Cells and Required for Organization of

Epithelia.” Cell 61(5): 787–99.

Tepass, Ulrich. 1996. “Crumbs, a Component of the Apical Membrane, Is Required for

Zonula Adherens Formation in Primary Epithelia of Drosophila.” Developmental

Biology 177(1): 217–25.

Tepass, Ulrich. 2012. “Epithelial Cells: Regulation of Polarity, Junctions, Morphogenesis,

Cell Growth, and Survival.” Annual Review of Cell and Developmental Biology 28(1):

655–85.

Tepass, Ulrich, Eileen Gruszynski-DeFeo, Thomas A. Haag, Lili Omatyar, Tibor Török, and

Volker Hartenstein. 1996. “Shotgun Encodes Drosophila E-Cadherin and Is

Preferentially Required during Cell Rearrangement in the Neurectoderm and Other

Morphogenetically Active Epithelia.” Genes and Development 10(6): 672–85.

Tepass, Ulrich, and Elisabeth Knust. 1990. “Phenotypic and Developmental Analysis of

Mutations at the Crumbs Locus, a Gene Required for the Development of Epithelia in

Drosophila Melanogaster.” Roux’s Archives of Developmental Biology 199(4 (1990)):

189–206.

Tiwari, Anand K., and Jagat K. Roy. 2009. “Mutation in Rab11 Results in Abnormal

Organization of Ommatidial Cells and Activation of JNK Signaling in the Drosophila

Eye.” European Journal of Cell Biology 88(8): 445–60.

Troyanovsky, Regina B, Eugene P Sokolov, and Sergey M Troyanovsky. 2006. “Endocytosis

of Cadherin from Intracellular Junctions Is the Driving Force for Cadherin Adhesive

Dimer Disassembly.” Molecular biology of the cell 17(8): 3484–93.

Troyanovsky, Sergey M. 2009. “Regulation of Cadherin-Based Epithelial Cell Adhesion by

142

Endocytosis.” Frontiers in Bioscience (S1): 61–67.

Truong Quang, Binh An, Madhav Mani, Olga Markova, Thomas Lecuit, and Pierre François

Lenne. 2013. “Principles of E-Cadherin Supramolecular Organization in Vivo.”

Current Biology 23(22): 2197–2207.

Vanhaesebroeck, Bart, Len Stephens, and Phillip Hawkins. 2012. “PI3K Signalling: The

Path to Discovery and Understanding.” Nature reviews. Molecular cell biology 13(3):

195–203.

Walther, Rhian F., and Franck Pichaud. 2010. “Crumbs/DaPKC-Dependent Apical

Exclusion of Bazooka Promotes Photoreceptor Polarity Remodeling.” Current Biology

20(12): 1065–74.

Wang, Yu-Chiun, Zia Khan, Matthias Kaschube, and Eric F. Wieschaus. 2012. “Differential

Positioning of Adherens Junctions Is Associated with Initiation of Epithelial Folding.”

Nature 484(7394): 390–93.

Warner, Stephen J., and Gregory D. Longmore. 2009. “Distinct Functions for Rho1 in

Maintaining Adherens Junctions and Apical Tension in Remodeling Epithelia.”

Journal of Cell Biology 185(6): 1111–25.

Wasserscheid, Isabel, Ulrich Thomas, and Elisabeth Knust. 2007. “Isoform-Specific

Interaction of Flamingo/starry Night with Excess Bazooka Affects Planar Cell Polarity

in the Drosophila Wing.” Developmental Dynamics 236(4): 1064–71.

Wei, Shu Yi, Luis M. Escudero, Fengwei Yu, Li Hsun Chang, Li Ying Chen, Yu Huei Ho, Chiao

Ming Lin, Chin Shun Chou, William Chia, Juan Modolell, and Jui Chou Hsu. 2005.

“Echinoid Is a Component of Adherens Junctions That Cooperates with DE-Cadherin

to Mediate Cell Adhesion.” Developmental Cell 8(4): 493–504.

Weng, Mo, and Eric Wieschaus. 2017. “Polarity Protein Par3/Bazooka Follows Myosin-

Dependent Junction Repositioning.” Developmental Biology 422(2): 125–34.

143

Wirtz-Peitz, Frederik, and Jennifer A. Zallen. 2009. “Junctional Trafficking and Epithelial

Morphogenesis.” Current Opinion in Genetics and Development 19(4): 350–56.

Wodarz, A, U Hinz, M Engelbert, and E Knust. 1995. “Expression of Crumbs Confers Apical

Character on Plasma Membrane Domains of Ectodermal Epithelia of Drosophila.” Cell

82(1): 67–76.

Wodarz, A, A Ramrath, U Kuchinke, and E Knust. 1999. “Bazooka Provides an Apical Cue

for Inscuteable Localization in Drosophila Neuroblasts.” Nature 402(6761): 544–47.

Wodarz, Andreas, Ferdi Grawe, and Elisabeth Knust. 1993. “CRUMBS Is Involved in the

Control of Apical Protein Targeting during Drosophila Epithelial Development.”

Mechanisms of Development 44(2–3): 175–87.

Wodarz, Andreas, Andreas Ramrath, Alexandra Grimm, and Elisabeth Knust. 2000.

“Drosophila Atypical Protein Kinase C Associates with Bazooka and Controls Polarity

of Epithelia and Neuroblasts.” Journal of Cell Biology 150(6): 1361–74.

Wu, Yao, Pakorn Kanchanawong, and Ronen Zaidel-Bar. 2015. “Actin-Delimited Adhesion-

Independent Clustering of E-Cadherin Forms the Nanoscale Building Blocks of

Adherens Junctions.” Developmental Cell 32(2): 139–54.

Yamada, Soichiro, Sabine Pokutta, Frauke Drees, William I. Weis, and W. James Nelson.

2005. “Deconstructing the Cadherin-Catenin-Actin Complex.” Cell 123(5): 889–901.

Yonemura, Shigenobu. 2011. “Cadherin-Actin Interactions at Adherens Junctions.”

Current Opinion in Cell Biology 23(5): 515–22.

Zaessinger, S., Y. Zhou, S. J. Bray, N. Tapon, and A. Djiane. 2015. “Drosophila MAGI Interacts

with RASSF8 to Regulate E-Cadherin-Based Adherens Junctions in the Developing

Eye.” Development 142(6): 1102–12.

Zallen, Jennifer A., and Eric Wieschaus. 2004. “Patterned Gene Expression Directs Bipolar

Planar Polarity in Drosophila.” Developmental Cell 6(3): 343–55.

144

Zhou, W., and Y. Hong. 2012. “Drosophila Patj Plays a Supporting Role in Apical-Basal

Polarity but Is Essential for Viability.” Development 139(16): 2891–96.

Zou, Jian, Xiaolei Wang, and Xiangyun Wei. 2012. “Crb Apical Polarity Proteins Maintain

Zebrafish Retinal Cone Mosaics via Intercellular Binding of Their Extracellular

Domains.” Developmental Cell 22(6): 1261–74.

145