Selection an Early Marker of Thymocyte Positive Expressed By

The Journal of Immunology

An Inhibitory Ig Superfamily Protein Expressed by Lymphocytes and APCs Is Also an Early Marker of Thymocyte Positive Selection1

Peggy Han, Olivia D. Goularte, Kevin Rufner, Beverley Wilkinson, and Jonathan Kaye2

Positive selection of developing thymocytes is associated with changes in cell function, at least in part caused by alterations in expression of cell surface proteins. Surprisingly, however, few such proteins have been identified. We have analyzed the pattern of gene expression during the early stages of murine thymocyte differentiation. These studies led to identification of a cell surface protein that is a useful marker of positive selection and is a likely regulator of mature lymphocyte and APC function. The protein is a member of the Ig superfamily and contains conserved tyrosine-based signaling motifs. The gene encoding this protein was independently isolated recently and termed B and T lymphocyte attenuator (Btla). We describe in this study anti-BTLA mAbs that demonstrate that the protein is expressed in the bone marrow and thymus on developing B and T cells, respectively. BTLA is also expressed by all mature lymphocytes, splenic macrophages, and mature, but not immature bone marrow-derived dendritic cells. Although mice deficient in BTLA do not show lymphocyte developmental defects, T cells from these animals are hyperresponsive to anti-CD3 Ab stimulation. Conversely, anti-BTLA Ab can inhibit T cell activation. These results implicate BTLA as a negative regulator of the activation and/or function of various hemopoietic cell types. The Journal of Immunology, 2004, 172: 5931Ð5939.

ctivation of lymphocytes through Ag receptors takes sion in the thymus, we show that the BTLA protein is progres- place within the context of numerous other cell surface sively up-regulated during the pre- to mature B cell transition in A proteins that can modulate the response. This has been the bone marrow (BM) and is expressed to varying degrees on a best characterized in terms of costimulatory signals needed for wide variety of hemopoietic cell types, including APC. The ex- mature lymphocyte activation, although development of lympho- pression of BTLA is further up-regulated on activated T cells and cytes also involves Ag receptor recognition to promote or inhibit down-regulated on activated B cells. We further demonstrate that continued maturation. a splice variant of BTLA (BTLAs), which is predicted to lack T cell development in the thymus involves a TCR-initiated dif- ligand binding, but maintain signaling capability, has the potential ferentiation program, characterized by changes in a number of cell to be expressed at the cell surface. Engagement of BTLA on T surface and intracellular proteins, which leads to functional and cells with specific Ab inhibits TCR-mediated activation. Mice that phenotypic maturation of the cell (reviewed in Ref. 1). Although lack the full-length form of BTLA, but maintain the splice variant, significant progress has been made in identifying the signaling have no gross defects in hemopoietic cell development. However, molecules and transcription factors involved in thymocyte differ- T cells from these mice are hyperresponsive to TCR-mediated ac- entiation, not all the proteins involved in this developmental pro- tivation. The widespread distribution of the BTLA protein coupled cess have been identified. To determine what other cell surface with regulated changes in expression and negative signaling capa- proteins might be regulated during thymocyte positive selection, bility suggest a role in regulating a wide variety of lymphocyte, we have studied the changes in gene expression associated with the and possibly APC, functions. earliest phases of this process (2). We report in this work the identification of an Ig superfamily cell surface protein that is induced Materials and Methods during the early stages of positive selection and remains expressed Animals on mature T cells. The gene encoding this protein was indepen- C57BL/6J (B6), BALB/c, BALB.K, and AND TCR-transgenic (Tg) mice dently isolated recently from mature T cells, and was designated B (4) on an H-2b or H-2b/k background were used in these studies. Rats were and T lymphocyte attenuator (Btla)3 (3). In addition to its expres- used in production of mAbs. All animals were bred at Scripps Research Institute and maintained under specific pathogen-free conditions. Experi- ments were conducted in accordance with National Institutes of Health guidelines for the care and use of animals and with an approved animal Department of Immunology, Scripps Research Institute, La Jolla, CA 92037 protocol from Scripps Research Institute Animal Care and Use Committee. Received for publication January 29, 2004. Accepted for publication March 4, 2004. Cloning of BTLA and constructs The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance Gene microarray analysis was used to identify changes in gene expression with 18 U.S.C. Section 1734 solely to indicate this fact. in isolated thymocytes activated with PMA and ionomycin, as previously 1 This work was supported by National Institutes of Health Grant AI31231 to J.K. described (2). Two spleen-derived expressed sequence tags (ESTs), AA184189 and AA177302, were highly up-regulated upon activation of 2 Address correspondence and reprint requests to Dr. Jonathan Kaye, Department of Immunology IMM-8, Scripps Research Institute, 10550 N. Torrey Pines Road, La thymocytes. These ESTs could be linked through a series of other ESTs Jolla, CA 92037. E-mail address: [email protected] identified by sequential basic local alignment search tool searches (5). The Ј 3 5 EST AA177302 was used to synthesize a downstream gene-specific Abbreviations used in this paper: BTLA, B and T lymphocyte attenuator; BTLAs, primer. A clone containing the complete coding sequence of the gene was splice variant of BTLA; BAC, bacterial artificial chromosome; BM, bone marrow; BMDC, BM-derived DC; DC, dendritic cell; EST, expressed sequence tag; ITIM, obtained by RACE (SMART RACE cDNA amplification kit; Clontech immunoreceptor tyrosine-based inhibitory motif; LN, lymph node; MAPK, mitogen- Laboratories, Palo Alto, CA) using cDNA prepared from stimulated thy- activated protein kinase; SHP, SH2-containing tyrosine phosphatase; SP, single pos- mocytes as template. The full-length human homologue of BTLA was itive; Tg, transgenic; YFP, yellow fluorescent protein. obtained from IMAGE clone 1554187.

The portion of the gene encoding the external domain of the BALB/c Cell surface staining was performed, as previously described (2). In allele was cloned from spleen cells by RT-PCR. Total RNA was isolated some instances, cells were incubated with rat anti-mouse CD16/CD32 using RNeasy RNA kit (Qiagen, Valencia, CA) and oligo(dT)-primed first- (eBioscience, San Diego, CA) in PBS for 10 min at 4¡C to block FcR strand cDNA prepared with the Superscript First-Strand Synthesis System before addition of primary Abs. Stained cells were analyzed on a FACScan (Invitrogen, San Diego, CA). Primer pairs (Invitrogen) used were 5Ј-GG or FACSort, using CellQuest software (BD Biosciences, San Diego, CA). TACCATGAAGACAGTGCCTGCCATGC and 5Ј-GGATCCGCAGTC A total of 5,000Ð20,000 viable cells was analyzed, and the log fluorescence CTGCCTGGCCTCTCTTC, which add KpnI and BamHI sites to the 5Ј and is shown. 3Ј ends of the PCR product, respectively. The PCR product was TA cloned (Invitrogen) and sequenced (Scripps Research Institute Protein and Nucleic Cell activation Acid Core Facility). The sequence encoding a splice variant of BTLA was obtained from B6 spleen cells by high fidelity RT-PCR and cloning as LN T cells were enriched by negative selection using anti-B220 and anti- above, using primers 5Ј-GGAGATCTATGAAGACAGTGCCTGCCAT Ab class II MHC (Y3P) Abs and anti-rat IgG magnetic beads (Qiagen). The and 5Ј-AGATCTGCACTTCTCACACAAATGGA, which add BglII sites purity of the resultant cell population was routinely Ͼ90%. A total of 2.5 ϫ to the 5Ј and 3Ј ends. Constructs encoding fusions of yellow fluorescence 105 LN T cells was cultured a final volume of 200 ␮lin96flat-bottom protein (YFP) and BTLA were produced by high fidelity PCR using the plates previously coated with a 1:1 ratio of anti-CD3⑀ (145-2C11; eBio- constructs described above as template. Sequence-verified PCR products science) and rat IgG or anti-CD3⑀ and PK18 mAbs. Cell proliferation was were cloned in frame into the BamHI site of pEYFP-N1 expression vector measured after 48 h by pulsing with [3H]thymidine (1 ␮Ci) for the final (Clontech Laboratories). 16 h of culture. For Ag-specific responses, splenocytes were isolated from H-2b/k AND Northern analysis TCR-Tg mice, depleted of RBC by hypotonic lysis, and cultured at a den- ϫ 6 ␮ A 700-bp DNA fragment derived from the 3Ј end of a Btla cDNA including sity of 1.5 10 cells/ml in 200 l final volume with various concentra- ϳ400 bp of coding sequence was radiolabeled with [␣-32P]dCTP using a tions of pigeon cytochrome c peptide (aa 88Ð104). Cells were harvested at 71 h and analyzed by three-color FACS staining. random primer labeling kit (Roche, Basel, Switzerland). The probe was ϩ ϩ For RT-PCR analysis of Ag-activated T cells, CD4 LN T cells were hybridized to a normalized poly(A) RNA Northern blot of mouse tissues b (Origene Technologies, Rockville, MD) in ULTRAhyb hybridization purified from H-2 AND TCR-Tg mice by magnetic bead negative selec- ␣ b buffer (Ambion, Austin, TX) overnight at 42¡C and washed, according to tion using anti-B220, anti-CD8 , and anti-A class II MHC (Y3P) Abs. T ϫ 5 ϫ 6 manufacturer’s instructions. Amounts of mRNA on this blot have been cells were cultured at 2.5 10 cells/ml with 2.5 10 cells/ml irradiated previously normalized using a ␤-actin probe (Origene Technologies), but (3300 rad) B10.BR splenocytes in the presence of 100 nM pigeon cyto- the blot was also stripped and reprobed with a GAPDH housekeeping chrome c peptide. After 3 days, viable cells were isolated over Ficoll-Paque probe. Hybridization was visualized using a Storm 860 imaging system (Pharmacia Biotech, Uppsala, Sweden) and total RNA was prepared. (Molecular Dynamics, Sunnyvale, CA). In other experiments, B6 splenocytes were stimulated with Con A (2.5 ␮g/ml) or LPS (50 ␮g/ml) for 48 h and then analyzed. RT-PCR RT-PCR was performed as above. Other primer pairs used were as follows: Production of BM-derived dendritic cells (BMDC) CD4, 5Ј-CTGATGTGGAAGGCAGACAAGGATTC and 5Ј-CAGCACGC BMDC were produced, as previously described (11). Briefly, 2 ϫ 106 BM AAGCCAGAACACTGTCT; ␤-actin, 5Ј-GGCAACGAGCGGTTCCGATG cells were cultured in 10 ml of complete RPMI 1640 medium (Invitrogen) CCCTGA and 5Ј-GCCACCATGGAGCCACCGATCCACA. containing 100 U/ml GM-CSF (RDI Research Diagnostics, Flanders, NJ). Fresh medium containing 100 U/ml GM-CSF was added on day 3 of cul- Cell transfections and fluorescence microscopy ture. On days 6 and 8, half of the culture medium was removed and re- The DPK thymocyte cell line (6) was infected with recombinant retrovirus placed with fresh medium containing 60 U/ml GM-CSF. On day 10, non- encoding a BTLA-YFP fusion protein and cells selected in 2 ␮g/ml puro- adherent cells were collected, spun down, and resuspended in fresh mycin. A hybridoma generated from the D10 T cell clone (7) was trans- medium containing 100 U/ml GM-CSF with or without 1 ␮g/ml LPS (Sig- fected by electroporation with a construct encoding a BTLAs-YFP fusion ma-Aldrich). Cells were analyzed 24 h later. protein by electroporation. Stable transfectants were selected in 500 ␮g/ml G418 compound (Invitrogen). Fluorescence photomicrographs were Analysis of BTLA phosphorylation obtained using a Zeiss Axiovert (Oberkochen, Germany) inverted fluores- 7 cence microscope and a SPOT color digital camera (Diagnostic Instru- Cells (1 ϫ 10 ) were treated with 2 mM pervanadate for 5 min at room ments, Sterling Heights, MI). temperature and lysed in 1 ml of lysis buffer (PBS, 2 mM pervanadate, 1% Nonidet P-40 (v/v), 1 mM sodium fluoride, 1 mM PMSF, 2 ␮g/ml leu- Production of mAbs peptin, 2 ␮g/ml aprotinin) for 30 min on ice. Nuclei were removed by centrifugation at 2000 rpm for 10 min at 4¡C, and the supernatants were A soluble form of the BTLA protein was used to produce mAbs in rats and ␬ ␬ further clarified by centrifugation for 30 min at 14,000 rpm. Lysates were mice. Only rat mAbs PK3 (IgM ) and PK18 (IgG1 ) are used in these precleared three to four times using rat IgG-coupled agarose and immu- studies. A construct encoding a fusion of the external domain of BTLA and noprecipitated with rat IgG- or mAb-coupled agarose overnight at 4¡C. the H chain constant region of human IgG (8) was transfected into 293 Agarose beads were washed six times in lysis buffer and eluted with SDS cells. Secreted BTLA protein was purified by protein A affinity chroma- sample buffer under reducing conditions. Immunoprecipitates were ana- tography (Pierce, Rockford, IL). Abs were produced by a modification of lyzed by Western blot, as previously described (2). Blots were probed with a previously published method (9). Rats were immunized at the base of the anti-phosphotyrosine (1/1000) (clone 4G10; Upstate Biotechnology, Lake tail with an emulsion (0.2 ml) of CFA (Sigma-Aldrich, St. Louis, MO) ␬ ␮ Placid, NY), followed by HRP-conjugated goat anti-mouse -chain sec- containing recombinant protein (50 g). Two weeks after immunization, ondary Ab (1/2500; Southern Biotechnology Associates, Birmingham, medial iliac lymph node (LN) cells were harvested and fused to YB2/0 AL). Blots were stripped and reprobed sequentially with anti-green fluo- myeloma cells (10) by standard methodology. mAbs were screened by rescence protein (1/500) (Clontech Laboratories) and anti-SH2-containing differential binding to BTLA-transfected, but not parental, cells. tyrosine phosphatase 2 (SHP-2) (1/2000) (BD Biosciences) Abs and ap- Abs and cell surface staining propriate secondary Abs. The following mAbs were used in these studies (all from eBioscience, Generation of BTLA-deficient mice unless stated otherwise): PE-conjugated anti-CD4 (RM4-5), allophycocyanin-conjugated anti-CD4 (GK1.5), FITC- or allophycocyanin-conjugated PCR primers corresponding to sequences in exon 2 of the Btla gene were anti-CD8␣ (53-6.7), FITC- or allophycocyanin-conjugated anti-B220 used to screen a 129SvJ bacterial artificial chromosome (BAC) library (ES (RA3-6B2), FITC- or allophycocyanin-conjugated anti-TCR␤ (H57-597), Library Release II; Incyte Genomics, Palo Alto, CA). A cloned BAC was biotinylated anti-CD5 (53-7.3), biotinylated anti-CD69 (H1.2F3), biotin- subsequently isolated that contained exons 1 and 2 of the Btla gene. A ylated anti-CD86 (GL1), biotinylated anti-CD11b (M1/70), biotinylated rat 13-kb KpnI fragment derived from this BAC that contained exon 1 and a IgG2a,␬ isotype control, biotinylated hamster IgG isotype control, biotin- 5Ј portion of exon 2 was cloned into the KpnI site of pKOScrambler ylated anti-I-A(b) MHC class II (M5/114.15.2), and PE anti-CD11c (HL3; NTKV-1906 (Stratagene, La Jolla, CA). This targeting construct contains BD PharMingen, San Diego, CA). Secondary staining reagents included both positive and negative selectable markers. A BAC-derived 2.5-kb PE anti-rat IgM (G53-238; BD PharMingen) and fluorochrome-labeled KpnI-HindIII fragment that contained the 3Ј portion of exon 2 and addi- streptavidin. tional downstream sequence was then cloned into the SmaI and NotI sites The Journal of Immunology 5933 of the pKO-modified construct. The result is disruption of exon 2 by in- The residues surrounding the tyrosine at position 274 fit the con- sertion of a neor cassette into the KpnI site in reverse transcriptional ori- sensus sequence (V/I)xYxxL of an immunoreceptor tyrosine-based entation. The targeting construct was electroporated into CMTI-1 (129 S6/ inhibitory motif (ITIM) (13). The sequence surrounding tyrosine SvEv) embryonic stem cells (Specialty Media, Lavellette, NJ), and gancyclovir and G418-resistant clones were screened by PCR (primers: 299, TxYxxI, might also function in this regard, although it is also 5Ј-TGGCGCTACCGGTGGATGTGGAATG and 5Ј-TGGAGAACAAA similar to motifs in the cytoplasmic domains of CD150 family AACCGGAACTGATTGA). Southern blots were used to confirm gene tar- members that bind SLAM-associated protein and EAT-2 adaptor geting of positive clones. Chimeric mice were produced by standard means proteins (14, 15). and bred to B6 mice one generation before breeding to obtain homozygous mutant animals. Expression of a BTLA splice variant Results An alternatively spliced variant of BTLA (BTLAs) has also been Identification of an Ig superfamily cell surface protein on detected by us (Fig. 1, B and C) and others (3). The spliced tran- thymocytes script eliminates the second exon that encodes the Ig-like domain (Fig. 1B). The Btla-s transcript was detected in isolated B, CD4 T, Using gene microarray technology, we have characterized changes ϩ ϩ and CD8 T cells (Fig. 1C). To determine whether this transcript in gene expression in immature CD4 8 double-positive thymo- could produce a cell surface protein, a construct encoding a fusion cytes activated by PMA and ionomycin under conditions that elicit of BTLAs and YFP was produced. BTLAs-YFP was expressed at the differentiation of these cells (2). Normalized hybridization sig- the cell surface in transfected cells (Fig. 1D). An additional larger nals of cDNA to two spleen-derived ESTs, AA184189 and mRNA species was also detected by RT-PCR in some experiments AA177302, were increased by 9.1- and 6.6-fold, respectively, fol- (data not shown). This transcript is caused by a cryptic splice site lowing thymocyte activation. The mitogen-activated protein kinase that results in insertion of intronic sequence 5Ј to exon 3. A trans- (MAPK) signaling pathway has been shown to be obligatory for lational stop codon in this sequence precludes this transcript from positive selection (reviewed in Ref. 12). Thus, we also compared coding for a cell surface protein. gene expression in thymocytes activated in the absence or presence of the MAPK kinase inhibitor U0126. The normalized hybridization signal to both ESTs was 2.7-fold greater when cells were BTLA is induced during positive selection in the thymus and activated in the absence of U0126 than in its presence, indicating during B cell development in the BM involvement of the MAPK signaling pathway in regulating expres- To determine the expression pattern of BTLA in hemopoietic cells, sion of the gene(s) involved. These findings were confirmed by mAbs were generated by immunizing rats and mice with a recom- RT-PCR analysis of differentiating cultured thymocytes (data not binant secreted form of the protein. Both sets of mAbs gave com- shown). parable results, although rat monoclonal PK3 was found to be the EST “walking” indicated that both spleen ESTs were derived best reagent for cell surface staining and was used for FACS anal- from a single gene and the full-length gene was subsequently ysis, while PK18 was used for biochemical and functional assays. cloned. Tissue distribution of the gene was examined by Northern The specificity of PK3 and PK18 mAbs was confirmed by specific analysis and, as expected, highest levels were detected in the thy- staining of a transfected thymocyte cell line that expressed a mus, and interestingly the spleen, with lower levels found in some BTLA-YFP fusion protein (Fig. 2A). In addition, there was a cor- other tissues (Fig. 1A). Sequencing revealed that the gene encoded relation between expression of YFP and mAb staining of trans- a 306-aa protein with a single Ig-like domain, a transmembrane fected cells, further confirming the specificity of the Abs (Fig. 2A). region, and a cytoplasmic domain (Fig. 1B). This gene was re- PK3 (Fig. 2B) and PK18 (data not shown) mAb stained cells cently independently isolated by Murphy and colleagues (3) and derived from B6, but not BALB/c mice. This was found to be the has been designated Btla. result of an allelic variation in the external domain of BTLA be- The predicted BTLA protein from B6 mice (accession tween these mouse strains (Fig. 1B). The B6 allele has been des- NP_808252) has been reported to contain 305 aa, while that from ignated Btlab (encoding BTLA.2), and that found in BALB/c mice 129 strain of mice (accession AAP44002) has 306 aa, as does the Btlaa (encoding BTLA.1). B6-derived protein reported in this work (Fig. 1). The difference PK3 was used to analyze expression of BTLA during T and B lies in the presence or absence of a CAG codon that begins the cell development. In a wild-type thymus, a subset of thymocytes fourth exon (Fig. 1B). In the genomic sequence of the Btla gene, was PK3ϩ (Fig. 3A). In contrast, PK3ϩ thymocytes were absent in this codon is preceded by an additional CAG triplet. Thus, splicing TCR␣ chain-deficient mice (Fig. 3A). These animals lack single- to the acceptor AG consensus site in the first CAG codon yields an positive (SP) thymocytes due to a failure of TCR-mediated posi- mRNA that encodes the sequence -LITVS-, while splicing to the tive selection. Conversely, the majority of thymocytes in AND second CAG codon would yield the shorter translated sequence TCR-Tg mice on a positively selecting background were PK3ϩ, -LIIS-. We have observed both sequences by RT-PCR, and thus it consistent with the up-regulation of BTLA as a consequence of is possible that a single cell expresses both isoforms of the protein. positive selection. Six potential N-linked glycosylation sites are present in the pre- BTLA is expressed by a subset of double-positive thymocytes, dicted sequence (Fig. 1B), and glycosidase treatment of immuno- and is up-regulated coincident with the positive selection marker precipitated protein verified that BTLA is indeed a glycoprotein CD69 (16) (Fig. 3B). Similar results were found when TCR up- (data not shown), consistent with a previous report (3). regulation was used as a marker of positive selection (data not Database searches identified a human kidney-derived clone (ac- shown). However, unlike CD69, expression of BTLA was main- cession AI792952 and AA931122 for 5Ј and 3Ј sequencing, re- tained on all TCRϩ CD4 and CD8 SP thymocytes, with somewhat spectively) that upon sequencing was found to encode the full- higher levels on CD4 SP cells (Fig. 3B, and data not shown). length human homologue of Btla (data not shown). The predicted BTLA was not detected on precursor CD4ϪCD8Ϫ thymocytes sequence of the human protein external domain sequence is ϳ50% (Fig. 2 and data not shown). identical with its murine counterpart. In addition, both proteins Staining of BM cells for BTLA revealed that the protein was contain three tyrosines in the cytoplasmic domain that are embed- first detected at low levels in B220ϩIgMϪ cells, a subset that con- ded in conserved motifs of 8, 9, and 13 aa, respectively (Fig. 1B). tains pro- and pre-B cells. Somewhat higher expression was found 5934 AN INHIBITORY PROTEIN EXPRESSED BY LYMPHOCYTES AND APC

FIGURE 1. Expression and sequence of Btla gene. A, Northern blot of poly(A)ϩ RNA from various tissues probed for expression of Btla and GAPDH genes. B, Coding sequence of B6-derived Btlab cDNA and the predicted amino acid sequence of the BTLA.2 protein. The predicted signal peptide (thin line) and transmembrane region (bold line) are underlined. The Ig-like domain is highlighted in gray, and potential N-linked glycosylation sites are indicated .Tyrosine-based motifs found in the cytoplasmic domain that are conserved in the human protein (data not shown) are indicated by a double underline .(ء) Vertical bars denote the region of the protein that is deleted from the BTLAs splice variant. The boxed CAG codon is a site of alternate splicing (see text). Residues that differ between BTLA.2 and BTLA.1 proteins are also shown. C, Left, Graphical representation of Btla splice variants. Exon boundaries and encoded protein features are indicated (L, leader; Ig, Ig-like domain; TM, transmembrane region; Y, tyrosine-based motifs). Primers used in RT-PCR are shown as arrows. Right, RT-PCR analysis of indicated cell types demonstrates expression of two predominant Btla mRNA splice variants that encode full-length BTLA and BTLAs. D, Representative ﬂuorescence photomicrographs of cells transfected with a construct encoding BTLAs-YFP fusion protein. The Journal of Immunology 5935

FIGURE 2. Speciﬁcity of anti-BTLA mAbs. A, A mixture of wild-type and BTLA-YFP-transfected DPK cells was stained with PK3 or PK18 mAbs. Controls included rat IgM isotype control (top left) and anti-V␣11 Ab that stains all DPK cells (bottom right). B, Spleen cells from B6 (thin line) or BALB/c (bold line) mice were stained with PK3, followed by PE anti-rat IgM, and analyzed by ﬂow cytometry. Isotype control staining is shown for B6 cells (dotted line). in B220ϩIgMhigh cells (immature B cells) with the highest level of expression in mature B cell subsets (Fig. 3C).

BTLA is expressed by mature lymphocytes The staining of CD4 and CD8 SP thymocytes with PK3 suggested that BTLA would also be expressed by T lymphocytes in periph- FIGURE 3. BTLA is up-regulated during T and B cell development. A, ␣ eral lymphoid tissue. Indeed, all T and B lymphocytes in the spleen Total thymocytes from B6, TCR chain-deficient, and AND TCR-Tg mice ϩ were stained with PK3 (bold line) or rat IgM (thin line), as in Fig. 2. B,B6 (Fig. 4A) and LN (data not shown) were PK3 . B cells express ϳ thymocytes were four-color stained with PK3, anti-CD69, anti-CD4, and 10-fold higher amounts of BTLA on the cell surface than T cells anti-CD8 Abs. Right-hand panels, Show CD4 and CD8 profiles of (Fig. 4A). As was observed in the thymus, CD4 T cells express PK3ϩCD69ϩ and PK3ϩCD69Ϫ subpopulations, as indicated. C, BM cells somewhat higher amounts of BTLA than do CD8 T cells (Fig. 4A). were three-color stained with PK3, anti-IgM, and anti-B220 Abs. The his- BTLA is also expressed by minor subsets of T cells in the spleen, togram shows PK3 staining of gated populations of pro- and pre-B cells including ␥␦ T cells (Fig. 4B) and CD25ϩCD4ϩ T cells (Fig. 4C), (1), immature B cells (2), and mature B cells (3). at comparable levels to the majority ␣␤ T cell population. In contrast, NK cells have low levels of BTLA expression (Fig. 4D). BTLA expression in B cells decreased 3- to 10-fold following class II MHCϪ/low, and CD86Ϫ, the phenotype of immature DC activation with LPS, while expression on Con A-activated CD4ϩ (Fig. 5B). Various inflammatory and other stimuli can activate DC, or CD8ϩ T cells increased ϳ10-fold (Fig. 4E). AND TCR-Tg CD4 leading to a maturation process that up-regulates expression of T cells activated by specific Ag also up-regulated BTLA, and the class II MHC and costimulatory molecules of the B7 family, and extent of up-regulation was dependent on the concentration of Ag results in increased T cell stimulatory potential. Thus, LPS treat- (Fig. 4F). Interestingly, a variable frequency (ranging from ϳ1to ment of BMDC resulted in a majority cell population that was 8%) of ex vivo CD4 T cells expressed high levels of BTLA (Fig. class II MHChigh and CD86ϩ (Fig. 5B). PK3 stained only a minor 4C). The majority of these cells were negative for activation mark- subset of unactivated BMDC, possibly correlating with the few ers CD25 and CD69 (75 and 90% CD25Ϫ and CD69Ϫ, respec- mature DC that arise spontaneously in these cultures (Fig. 5B). In tively, in Fig. 4C). However, approximately half of the BTLAhigh contrast, LPS-mediated maturation of DC was associated with dra- CD4 T cells were larger cells, as assessed by forward light scatter matic up-regulation of PK3 staining (Fig. 5B). (45% in Fig. 4C). To determine whether BTLAs was also expressed by activated BTLA is a negative regulator of T cell activation T cells, RT-PCR was performed on AND TCR-Tg T cells acti- The conserved tyrosine-containing motifs in the cytoplasmic do- vated by peptide Ag. Both full-length and spliced mRNAs were main of BTLA were considered as likely sites of phosphorylation. ϩ detected in activated CD4 T cells (Fig. 4G), and no significant To test this, cells were transfected with a construct encoding a difference in the ratio of the two isoforms was apparent when rest- BTLA-YFP fusion protein. Although BTLA was not constitutively ing and activated cells were compared (compare with Fig. 1C). phosphorylated, treatment of transfected cells with pervanadate induced tyrosine phosphorylation of the protein (Fig. 6A). ITIM mo- BTLA is expressed by APC tifs mediate negative signaling as a consequence of activation- TCRϪB220Ϫ class II MHC-positive cells in the spleen expressed induced phosphorylation and recruitment of tyrosine phosphatases, BTLA, suggesting that APC may also express this protein (Fig. 5A). including SHP-2 (17). Indeed, SHP-2 coimmunoprecipitated with Indeed, CD11bϩ macrophages were found to be uniformly PK3ϩ, BTLA in pervanadate-treated cells (Fig. 6A), consistent with the with levels of expression comparable to resting T cells (Fig. 5A). identification of an ITIM motif(s) in the BTLA cytoplasmic tail. A To determine whether DC also express BTLA, BMDC were weaker association with SHP-1 was also detected (data not prepared. The majority of cells in these preparations are CD11cϩ, shown). 5936 AN INHIBITORY PROTEIN EXPRESSED BY LYMPHOCYTES AND APC

FIGURE 5. Expression of BTLA by APC. A, Gated populations of TCRϪB220Ϫ spleen cells were stained with PK3 or an isotype control in combination with anti-CD11b or anti-Ab class II MHC Abs. B, BM-derived DC were prepared and stained with the indicated Abs after overnight culture in the absence or presence of LPS.

These results strongly suggest a negative signaling function for BTLA. To test this, the effect of anti-BTLA Ab on TCR-mediated T cell activation was assessed. Coimmobilized PK18 inhibited anti- CD3-mediated proliferation of T cells (Fig. 6B). PK18 reacts with

(FSC) of CD4ϩ T cells. The percentage of cells in quadrants is indicated. D, PK3 (bold line) or isotype control (thin line) staining of DX5ϩ spleen cells. E, Comparison of PK3 staining of ex vivo spleen cells (bold line) and LPS-activated (gray line, left panel) or Con A-activated (gray line, middle and right panels) cells. B220ϩ (left panel), CD4ϩ (middle panel), or CD8ϩ (right panel) cells were gated for analysis. Isotype control staining is FIGURE 4. Expression of BTLA by lymphocytes. A, Top, Total B6 spleen shown for ex vivo cells (thin line) and activated cells (dotted line) in each cells were stained with PK3 (bold line) or rat IgM (thin line), as in Fig. 2. panel. F, AND TCR-Tg spleen cells were cultured in the absence or pres- Middle, Comparison of PK3 staining of B220ϩ (bold line) and CD3ϩ (thin ence of speciﬁc peptide Ag and analyzed 3 days later. Cells were stained line) spleen cells. Bottom, Comparison of PK3 staining of CD8ϩ (bold line) with PK3 and anti-CD4 in combination with anti-CD25 or anti-CD69 Abs, and CD4ϩ (thin line) T cells. B, PK3 (bold line) or isotype control (thin line) as indicated. The staining pattern of CD4ϩ cells is shown. The percentage staining of ␥␦ TCRϩ spleen cells. C, Spleen cells were stained with PK3 and of cells in quadrants is indicated. G, AND TCR-Tg CD4ϩ T cells were anti-CD4, in combination with anti-CD25 (left dot plot) or anti-CD69 (middle activated with peptide Ag and irradiated APC for 3 days before isolation of dot plot) Abs. Analysis shows staining pattern of CD4ϩ T cells. Right-hand viable cells and preparation of cDNA. Shown is RT-PCR analysis of 5-fold dot plot, Shows two-parameter analysis of PK3 staining and forward scatter dilutions of cDNA using indicated primers. The Journal of Immunology 5937

the BTLA.2, but not BTLA.1 protein. PK18 had no effect on activation of BALB/c (BTLA.1) T cells, thereby demonstrating the specificity of the Ab-mediated inhibition (Fig. 6B). In this exper- iment, equal concentrations of anti-CD3 and PK18 Abs were used to coat plates. Interestingly, the inhibition of T cell activation was particularly pronounced at higher concentrations of Ab, perhaps reflecting the threshold of negative signaling that is necessary to overcome a productive response. Alternatively, this pattern of inhibition could be due to differences in the affinity of anti-CD3 and PK18 Abs for their respective ligands. Because engagement of BTLA inhibited T cell activation, one would predict that loss of BTLA would result in an enhanced response. To address this, mice deficient in BTLA were produced. Exon 2, which encodes the Ig-like domain, was targeted for disruption (Fig. 6C). Spleen cells from homozygous mutant animals (BTLAϪ/Ϫ) failed to express full-length Btla mRNA (Fig. 6D). The anti-BTLA Abs described in this work also fail to bind homozygous mutant cells (data not shown). However, because these Abs are not able to recognize the 129 strain allele of BTLA, this result only confirms that mutant mice are homozygous for the 129 Btla locus. In contrast to loss of full-length Btla mRNA, the Btla-s transcript, which splices out exon 2, was still present in homozygous mutant cells (Fig. 6D). Both B and T cells develop normally in BTLAϪ/Ϫ mice, and no abnormalities in peripheral lymphoid organ cell subpopulations were detected in these mutant animals (data not shown). However, BTLAϪ/Ϫ T cells were hyperresponsive to TCR-mediated activation (Fig. 6E), as predicted from the ability of anti-BTLA Abs to inhibit T cell activation.

Discussion Our analysis of changes in gene expression in differentiating cultured thymocytes has led to the identification of an inhibitory member of the Ig superfamily of cell surface proteins that is up- regulated in the early stages of thymocyte positive selection. The gene for this protein was independently isolated recently and has been designated Btla (3). We describe in this study mAbs that recognize BTLA and allow a more complete picture of the expression pattern of this cell surface protein. Our data demonstrate that BTLA can be added to a very short list of useful markers of positive selection. The coincident expression of CD69 and BTLA may reflect the involvement of MAPK signaling in up-regulation of both these proteins (18). One intrigu- ing possibility is that the varying degrees of expression of BTLA in CD4 and CD8 thymocytes reflect differences in the strength of the MAPK signal that is thought to be important in the development of these lineages (reviewed in Ref. 12). Despite the early expression of BTLA during positive selection in the thymus, there is no gross abnormality in T cell (or B cell) development in BTLA- deficient animals. Whether this reflects compensatory mecha- nisms, more subtle defects in development, or a lack of function

96-well plates coated with mixtures of anti-CD3 and rat Ig (open symbols) or anti-CD3 and PK18 (filled symbols). Data are expressed as the mean [3H]TdR incorporation of triplicate cultures (ϮSD) minus cpm incorporation of cultures of T cells alone (Ͻ1500 cpm). C, Btla targeting construct. D, RT-PCR analysis of Btla gene expression in spleen cells from normal mice (wild type) or wild type (ϩ/ϩ), heterozygous mutant (Ϯ), or ho- FIGURE 6. BTLA is an inhibitor of T cell activation. A, Western blot mozygous mutant (Ϫ/Ϫ) littermates. E, Anti-CD3 proliferative response of analysis of PK18 or rat Ig control immunoprecipitates from BTLA-YFP-ex- LN T cells from wild-type (squares) or homozygous mutant (triangles) pressing cells, probed sequentially with anti-phosphotyrosine, anti-YFP, and littermates. Data are expressed as the mean [3H]TdR incorporation of trip- anti-SHP-2. Where indicated, cells were treated with pervanadate before lysis. licate cultures (ϮSD) minus cpm incorporation of cultures of T cells alone B, LN T cells were purified from B10.BR and BALB.K mice and cultured in (Ͻ750 cpm). 5938 AN INHIBITORY PROTEIN EXPRESSED BY LYMPHOCYTES AND APC for this cell surface protein in the thymus remains to be deter- resting T cells express BTLA is also consistent with the ability of mined. In contrast, mice lacking programmed death 1, another T Abs to BTLA to inhibit T cell activation in a short-term assay. The cell inhibitory receptor with proposed functional and structural difference between our results and those reported previously is similarity to BTLA (3), exhibit alterations in T cell development, likely to be the result of low sensitivity of detection of gene ex- including enhanced negative selection and generation of TCRϩ pression and the lack of reagents to assess protein expression in the CD4ϪCD8Ϫ T cells in a TCR-Tg model system (19). latter study. Expression of BTLA also marks B cell developmental progres- A number of isoforms of the BTLA protein exist, as a result of sion, first appearing in pre-B cells. The progressive increase in cell both allelic variation and alternative splicing. Duplication of a surface expression during B cell development may reflect contin- CAG sequence at the 5Ј end of exon 4 causes differential splicing, ued signaling during this process, a change in expression of the resulting in two isoforms of the protein that differ in length by a transcriptional regulators that control BTLA gene expression, single amino acid and have a minor difference in sequence. This and/or changes in protein sorting or internalization. sequence change is in a region of the protein between the Ig-like BTLA is also widely expressed on peripheral mature lympho- domain and the transmembrane region. Whether these protein iso- cytes, including B, ␣␤ T, ␥␦ T, and CD25ϩCD4ϩ T cells. The forms have any functional significance remains to be determined. latter cell population contains regulatory T cells (reviewed in Ref. We also show in this work that the more radical splice variant 20), and thus BTLA has the potential to impact their function as BTLAs, which eliminates the Ig-like domain, has the potential to well. In contrast, NK cells express little BTLA. NK cells have be expressed at the cell surface. The Btla-s transcript is expressed ITIM-containing inhibitory receptors that bind class I MHC and by B and T cells, and we have not observed any gross alteration of prevent cytolysis of normal healthy tissue (reviewed in Ref. 21). It the ratio of full-length to Btla-s transcripts in activated T cells. The is possible that expression of BTLA on NK cells would otherwise loss of this external domain of BTLA would be predicted to elim- interfere with the careful balance of negative and positive signal- inate ligand binding, but could maintain some signaling function of ing that is critical for preventing indiscriminant killing of normal the protein. The position of the coding sequence in the human gene cells by these cytolytic cells. in relation to consensus splice sites would also allow exon 1 to be BTLA is more highly expressed on the cell surface of B cells spliced in frame with exon 3 (data not shown). It remains to be than T cells. There is up-regulation of the protein on the cell sur- determined whether the BTLAs variant protein is functional in face upon activation of T cells and down-regulation upon activa- cells, but it is possible that it could act as an endogenous inhibitor tion of B cells. The extent of BTLA up-regulation on TCR-Tg of BTLA function in some circumstances by sequestering intra- CD4ϩ T cells was more sensitive to the concentration of Ag than cellular signaling partners. was up-regulation of CD69 or CD25. Thus, ϳ90% of activated T In contrast to previously reported BTLA-deficient mice (3), the cells were BTLAhigh and CD69ϩ or CD25ϩ at high Ag concen- BTLAϪ/Ϫ mice described in this work have the potential to ex- tration, while ϳ50% of activated T cells had this phenotype at press the BTLA protein (Fig. 6C). Nevertheless, loss of full-length lower concentrations of Ag (Fig. 4F). The extent of up-regulation BTLA is sufficient to cause enhanced T cell activation. This sug- of expression of this negative regulator on T cells may therefore be gests that the external domain of BTLA is likely to be critical for proportional to the initial activating signal and may suggest a role the ability of the protein to act as a coinhibitory receptor (25) for the protein in dampening responses. during TCR-mediated activation. Interestingly, we also detected a low and variable frequency of BALB/c and B6 mice express different alleles of Btla (Btlaa and BTLAhigh CD4ϩ T cells in LN and spleen. Based on an increased Btlab encoding BTLA.1 and BTLA.2, respectively) that differ in cell size compared with the bulk population of T cells, BTLAhigh the external domain coding region. The predicted sequence of the cells may include in vivo recently activated cells that have down- human BTLA external domain described in this work differs from regulated other activation markers. Alternatively, these cells could that reported previously (3) by 3 aa in the external domain (data represent memory cells or a distinct functional subset of T cells. not shown). Thus, it is possible that there are also allelic variations BTLA is also expressed by APC, including splenic macrophages in humans. The ability of the PK3 and PK18 mAbs to distinguish and BMDC. Interestingly, mature, but not immature BMDC ex- BTLA.1 and BTLA.2 suggests that some of the amino acid dif- press BTLA. These data indicate that DC maturation is not only ferences in these proteins are solvent exposed and could impact associated with changes that increase the potency of the DC as a T ligand as well as Ab binding. cell activator, but also leads to changes in cell surface proteins with Our data using anti-BTLA Abs and BTLA-deficient mice indi- the potential for negative signaling. DC express other ITIM-con- cate that BTLA is a negative regulator of TCR-mediated T cell taining proteins, including lectin-like and Ig superfamily proteins activation. This function is most likely mediated at least in part by (22Ð24). The Ig-superfamily inhibitory receptor, FDF03 (also recruitment of tyrosine phosphatases to phosphorylated ITIM mo- known as paired Ig-like receptor ␣), was similarly shown to be tif(s) in the cytoplasmic tail. Increased cell surface expression of highly expressed by mature DC following activation. However, BTLA protein following T cell activation could enhance avidity unlike BTLA, this protein was also expressed by populations of for ligand, potentially tipping the balance of positive and negative immature DC (24). In contrast, the ITIM containing lectin-like signaling. A similar effect may account for the particular potency protein CLECSF6 is down-regulated upon DC maturation (23). of higher concentrations of anti-BTLA Ab in inhibiting T cell re- This suggests that the particular complement of inhibitory recep- sponses in culture. tors expressed by DC is altered upon maturation. The change in Interestingly, the Btla gene is located between gene loci for cell surface signaling receptors may coordinate with changes in the CD200 (Mox2) and its receptor CD200R (Mox2r), on chromo- microenvironment, including changes in expression of appropriate somes 16 and 3 in mice and humans, respectively. Like BTLA, ligands, as DC migrate from tissue to lymphoid organ. both CD200 and its receptor are Ig superfamily members, and a It was reported previously that the Btla gene was expressed by number of CD200R protein isoforms are produced by alternate B cells and activated T cells, but not naive T cells (3). In addition, splicing (26). There is conservation of tyrosine-based motifs in the Btla mRNA was not detected in macrophages or thymocytes in human and mouse CD200R cytoplasmic domains that mediate sig- that study. Our data clearly demonstrate that BTLA is expressed by naling, although they are unrelated to motifs in BTLA. Expression maturing thymocytes, naive T cells, and APC. Our finding that of CD200R is primarily restricted to myeloid cells and T cells in The Journal of Immunology 5939 mice and humans (27, 28). In contrast, CD200 is expressed by a highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods broader range of cell types, including neural cells, endothelial 223:77. 12. Alberola-Ila, J., and G. Hernandez-Hoyos. 2003. The Ras/MAPK cascade and the cells, follicular DCs, and lymphocytes (29, 30). The interaction of control of positive selection. Immunol. Rev. 191:79. CD200 and CD200R inhibits granulocyte and macrophage activa- 13. Ravetch, J. V., and L. L. Lanier. 2000. Immune inhibitory receptors. Science 290:84. tion, and interference in this interaction by gene targeting or Ab 14. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, inhibition exacerbates autoimmune disease in murine models (27, L. Notarangelo, R. Geha, M. G. Roncarolo, et al. 1998. The X-linked lympho- 31). Similarly, experimental allergic encephalomyelitis is exacer- proliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature 395:462. bated in BTLA-deficient mice (3). Whether this effect is mediated 15. Poy, F., M. B. Yaffe, J. Sayos, K. Saxena, M. Morra, J. Sumegi, L. C. Cantley, by lymphocytes and/or APC remains to be determined. The C. Terhorst, and M. J. Eck. 1999. Crystal structures of the XLP protein SAP CD200-CD200R interaction has been proposed to maintain the reveal a class of SH2 domains with extended, phosphotyrosine-independent sequence recognition. Mol. Cell 4:555. basal inactivated state of myeloid cells and/or regulate myeloid 16. Swat, W., M. Dessing, H. von Boehmer, and P. Kisielow. 1993. CD69 expression cell function (31, 32). Like CD200, expression of BTLA is com- during selection and maturation of CD4ϩ8ϩ thymocytes. Eur. J. Immunol. 23:739. mon to B and T lymphocytes, although in this case BTLA is the 17. D’Ambrosio, D., D. C. Fong, and J. C. Cambier. 1996. The SHIP phosphatase receptor with inhibitory signaling function. B7x, a member of the becomes associated with Fc␥RIIB1 and is tyrosine phosphorylated during ‘neg- B7 family of proteins, has been demonstrated to be a ligand for ative’ signaling. Immunol. Lett. 54:77. 18. Villalba, M., J. Hernandez, M. Deckert, Y. Tanaka, and A. Altman. 2000. Vav BTLA (3), but the detailed expression pattern of this protein has modulation of the Ras/MEK/ERK signaling pathway plays a role in NFAT ac- yet to be reported, and other ligands for BTLA may yet exist. tivation and CD69 up-regulation. Eur. J. Immunol. 30:1587. Whether BTLA, like the linked CD200-CD200R pair, plays a 19. Blank, C., I. Brown, R. Marks, H. Nishimura, T. Honjo, and T. F. Gajewski. 2003. Absence of programmed death receptor 1 alters thymic development and more global role in regulating lymphocyte and myeloid cell inter- enhances generation of CD4/CD8 double-negative TCR-transgenic T cells. J. Im- actions with each other or other cell types must await further munol. 171:4574. 20. Shevach, E. M. 2002. CD4ϩ CD25ϩ suppressor T cells: more questions than experimentation. answers. Nat. Rev. Immunol. 2:389. 21. Lanier, L. L. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359. 22. Bates, E. E., N. Fournier, E. Garcia, J. Valladeau, I. Durand, J. J. Pin, Acknowledgments S. M. Zurawski, S. Patel, J. S. Abrams, S. Lebecque, et al. 1999. APCs express We thank Parinaz Aliahmad for critical reading of the manuscript. This is DCIR, a novel C-type lectin surface receptor containing an immunoreceptor ty- manuscript 16201-IMM from the Scripps Research Institute. rosine-based inhibitory motif. J. Immunol. 163:1973. 23. Huang, X., Z. Yuan, G. Chen, M. Zhang, W. Zhang, Y. Yu, and X. Cao. 2001. Cloning and characterization of a novel ITIM containing lectin-like immunore- References ceptor LLIR and its two transmembrane region deletion variants. Biochem. Bio- phys. Res. Commun. 281:131. 1. Starr, T. K., S. C. Jameson, and K. A. Hogquist. 2003. Positive and negative 24. Fournier, N., L. Chalus, I. Durand, E. Garcia, J. J. Pin, T. Churakova, S. Patel, selection of T cells. Annu. Rev. Immunol. 21:139. C. Zlot, D. Gorman, S. Zurawski, et al. 2000. FDF03, a novel inhibitory receptor 2. Wilkinson, B., J. Y. Chen, P. Han, K. M. Rufner, O. D. Goularte, and J. Kaye. of the immunoglobulin superfamily, is expressed by human dendritic and my- 2002. TOX: an HMG box protein implicated in the regulation of thymocyte eloid cells. J. Immunol. 165:1197. selection. Nat. Immunol. 3:272. 25. Sinclair, N. R. 1999. Why so many coinhibitory receptors? Scand. J. Immunol. 3. Watanabe, N., M. Gavrieli, J. R. Sedy, J. Yang, F. Fallarino, S. K. Loftin, 50:10. M. A. Hurchla, N. Zimmerman, J. Sim, X. Zang, et al. 2003. BTLA is a lym- 26. Vieites, J. M., R. de la Torre, M. A. Ortega, T. Montero, J. M. Peco, phocyte inhibitory receptor with similarities to CTLA-4 and PD-1. Nat. Immunol. A. Sanchez-Pozo, A. Gil, and A. Suarez. 2003. Characterization of human cd200 4:670. glycoprotein receptor gene located on chromosome 3q12Ð13. Gene 311:99. 4. Kaye, J., M. L. Hsu, M. E. Sauron, S. C. Jameson, N. R. Gascoigne, and ϩ 27. Wright, G. J., M. J. Puklavec, A. C. Willis, R. M. Hoek, J. D. Sedgwick, S. M. Hedrick. 1989. Selective development of CD4 T cells in transgenic mice M. H. Brown, and A. N. Barclay. 2000. Lymphoid/Neuronal cell surface OX2 expressing a class II MHC-restricted antigen receptor. Nature 341:746. glycoprotein recognizes a novel receptor on macrophages implicated in the con- 5. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic trol of their function. Immunity 13:233. local alignment search tool. J. Mol. Biol. 215:403. 28. Wright, G. J., H. Cherwinski, M. Foster-Cuevas, G. Brooke, M. J. Puklavec, 6. Kaye, J., and D. L. Ellenberger. 1992. Differentiation of an immature T cell line: M. Bigler, Y. Song, M. Jenmalm, D. Gorman, T. McClanahan, et al. 2003. Char- a model of thymic positive selection. Cell 71:423. acterization of the CD200 receptor family in mice and humans and their inter- 7. Kaye, J., and C. A. Janeway, Jr. 1984. The Fab fragment of a directly activating actions with CD200. J. Immunol. 171:3034. monoclonal antibody that precipitates a disulfide-linked heterodimer from a 29. Barclay, A. N., M. J. Clark, and G. W. McCaughan. 1986. Neuronal/Lymphoid helper T cell clone blocks activation by either allogeneic Ia or antigen and self-Ia. membrane glycoprotein MRC OX-2 is a member of the immunoglobulin super- J. Exp. Med. 159:1397. family with a light-chain-like structure. Biochem. Soc. Symp. 51:149. 8. Chen, Y., T. Maguire, and R. M. Marks. 1996. Demonstration of binding of 30. Wright, G. J., M. Jones, M. J. Puklavec, M. H. Brown, and A. N. Barclay. 2001. dengue virus envelope protein to target cells. J. Virol. 70:8765. The unusual distribution of the neuronal/lymphoid cell surface CD200 (OX2) 9. Kishiro, Y., M. Kagawa, I. Naito, and Y. Sado. 1995. A novel method of pre- glycoprotein is conserved in humans. Immunology 102:173. paring rat-monoclonal antibody-producing hybridomas by using rat medial iliac 31. Hoek, R. M., S. R. Ruuls, C. A. Murphy, G. J. Wright, R. Goddard, lymph node cells. Cell Struct. Funct. 20:151. S. M. Zurawski, B. Blom, M. E. Homola, W. J. Streit, M. H. Brown, et al. 2000. 10. Kilmartin, J. V., B. Wright, and C. Milstein. 1982. Rat monoclonal antitubulin Down-regulation of the macrophage lineage through interaction with OX2 antibodies derived by using a new nonsecreting rat cell line. J. Cell Biol. 93:576. (CD200). Science 290:1768. 11. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, and 32. Nathan, C., and W. A. Muller. 2001. Putting the brakes on innate immunity: a G. Schuler. 1999. An advanced culture method for generating large quantities of regulatory role for CD200? Nat. Immunol. 2:17.