DOCSLIB.ORG

Mouse Cfdp1 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Cfdp1 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Cfdp1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cfdp1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cfdp1 gene (NCBI Reference Sequence: NM_011801 ; Ensembl: ENSMUSG00000031954 ) is located on Mouse chromosome 8. 7 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000034432). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cfdp1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-91B18 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 7.34% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 8932 bp, and the size of intron 2 for 3'-loxP site insertion: 3103 bp. The size of effective cKO region: ~618 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 7 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cfdp1 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7118bp) | A(25.72% 1831) | C(20.13% 1433) | T(31.86% 2268) | G(22.28% 1586) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr8 - 111845462 111848461 3000 browser details YourSeq 302 2490 3000 3000 87.2% chr9 - 43136070 43136540 471 browser details YourSeq 295 2486 2960 3000 85.4% chr5 - 92046906 92047354 449 browser details YourSeq 291 2483 2981 3000 87.3% chr14 + 27292876 27293314 439 browser details YourSeq 279 2485 2993 3000 85.4% chr17 - 46761858 46762358 501 browser details YourSeq 275 2490 2977 3000 89.9% chrX + 20294442 20295075 634 browser details YourSeq 273 2513 2954 3000 88.3% chr7 + 25828977 25829397 421 browser details YourSeq 271 2216 2981 3000 87.2% chr11 + 100450040 100450739 700 browser details YourSeq 264 2212 2993 3000 85.1% chr18 + 34227716 34228144 429 browser details YourSeq 263 2487 2993 3000 89.8% chr4 + 149292243 149292843 601 browser details YourSeq 255 2687 3000 3000 89.7% chr1 - 86649152 86649461 310 browser details YourSeq 253 2521 2979 3000 86.1% chr15 + 99046029 99046460 432 browser details YourSeq 252 2515 2970 3000 89.6% chr11 - 69530348 69531131 784 browser details YourSeq 251 2676 3000 3000 90.1% chr2 - 154945752 154946084 333 browser details YourSeq 251 2687 3000 3000 89.4% chr2 - 32114741 32115052 312 browser details YourSeq 250 2697 3000 3000 91.8% chr2 - 144286629 144287127 499 browser details YourSeq 248 2550 2993 3000 91.4% chr7 - 141347058 141347803 746 browser details YourSeq 247 2483 2993 3000 85.0% chr2 - 180229582 180229915 334 browser details YourSeq 247 2674 3000 3000 88.2% chr11 + 74937694 74938009 316 browser details YourSeq 246 2677 2993 3000 92.1% chr8 + 117289750 117290090 341 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr8 - 111841844 111844843 3000 browser details YourSeq 206 676 1095 3000 86.2% chr15 - 102391467 102391817 351 browser details YourSeq 158 676 866 3000 92.0% chr3 + 90585123 90585316 194 browser details YourSeq 155 674 1111 3000 91.9% chr11 + 55813191 55813687 497 browser details YourSeq 153 679 862 3000 92.3% chr13 - 55806651 55806834 184 browser details YourSeq 153 675 867 3000 90.0% chr1 + 39820321 39820514 194 browser details YourSeq 152 675 864 3000 90.5% chr13 + 66728536 66728729 194 browser details YourSeq 149 676 856 3000 90.4% chr3 + 154628757 154628935 179 browser details YourSeq 149 675 858 3000 90.8% chr13 + 66303668 66303851 184 browser details YourSeq 148 678 1060 3000 83.0% chr7 - 127125047 127125369 323 browser details YourSeq 148 675 857 3000 90.7% chr13 - 65493297 65493479 183 browser details YourSeq 148 675 857 3000 90.7% chr13 + 66449719 66449901 183 browser details YourSeq 147 675 858 3000 90.2% chr13 + 65829412 65829595 184 browser details YourSeq 146 675 864 3000 88.9% chr13 + 65603906 65604099 194 browser details YourSeq 145 675 843 3000 91.1% chr11 - 69184261 69184427 167 browser details YourSeq 144 674 1246 3000 83.0% chr3 - 103950644 103950873 230 browser details YourSeq 144 672 843 3000 89.9% chr15 - 68442664 68442831 168 browser details YourSeq 142 676 843 3000 90.4% chr19 - 53728265 53728430 166 browser details YourSeq 140 676 843 3000 89.8% chr10 - 116933741 116933906 166 browser details YourSeq 140 674 843 3000 89.3% chr10 + 45492433 45492600 168 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Cfdp1 craniofacial development protein 1 [ Mus musculus (house mouse) ] Gene ID: 23837, updated on 12-Aug-2019 Gene summary Official Symbol Cfdp1 provided by MGI Official Full Name craniofacial development protein 1 provided by MGI Primary source MGI:MGI:1344403 See related Ensembl:ENSMUSG00000031954 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Bcnt; Cfdp; cp27; AA408409; Bucentaur Expression Broad expression in CNS E11.5 (RPKM 77.7), placenta adult (RPKM 58.1) and 16 other tissues See more Orthologs human all Genomic context Location: 8; 8 E1 See Cfdp1 in Genome Data Viewer Exon count: 7 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 8 NC_000074.6 (111766682..111854337, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 8 NC_000074.5 (114292373..114378210, complement) Chromosome 8 - NC_000074.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 1 transcript Gene: Cfdp1 ENSMUSG00000031954 Description craniofacial development protein 1 [Source:MGI Symbol;Acc:MGI:1344403] Gene Synonyms Bcnt, Bucentaur, cp27 Location Chromosome 8: 111,768,491-111,854,291 reverse strand. GRCm38:CM001001.2 About this gene This gene has 1 transcript (splice variant), 288 orthologues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Cfdp1-201 ENSMUST00000034432.6 1178 295aa ENSMUSP00000034432.5 Protein coding CCDS22680 O88271 TSL:1 GENCODE basic APPRIS P1 105.80 kb Forward strand 111.76Mb 111.78Mb 111.80Mb 111.82Mb 111.84Mb 111.86Mb Contigs < AC127315.4 Genes (Comprehensive set... < Cfdp1-201protein coding < Tmem170-201protein coding Regulatory Build 111.76Mb 111.78Mb 111.80Mb 111.82Mb 111.84Mb 111.86Mb Reverse strand 105.80 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000034432 < Cfdp1-201protein coding Reverse strand 85.80 kb ENSMUSP00000034... MobiDB lite Low complexity (Seg) Pfam BCNT-C domain PROSITE profiles BCNT-C domain All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 40 80 120 160 200 240 295 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Gene Family: Gene Duplication and Retrotransposon Insertion
    21 Bucentaur (Bcnt)1 Gene Family: Gene Duplication and Retrotransposon Insertion Shintaro Iwashita and Naoki Osada Iwaki Meisei University / National Institute of Genetics Japan 1. Introduction Members of multiple gene families in higher organisms allow for more refined cellular signaling networks and structural organization toward more stable physiological homeostasis. Gene duplication is one the most powerful ways of providing an opportunity to create a novel gene(s) because a novel function might be acquired without the loss of the original gene function (Ohno, 1970). Gene duplication can result from unequal crossing over by recombination, retroposition of cDNA, or whole-genome duplication. Furthermore, a replication-based mechanism of change in gene copy number has been proposed recently (Hastings et al., 2009). Gene duplication generated by retroposition is frequently accompanied by deleterious effects because the insertion of cDNA into the genome is nearly random or unlinks the original gene location resulting in an alteration of the original vital functions of the target genes. Thus retroelements such as transposable elements and endogenous retroviruses have been thought of as “selfish”. On the other hand, gene duplication caused by unequal crossing over generally results in tandem alignment, which less frequently disrupts the functions of other genes. Recent genome-wide studies have demonstrated that retroelements can definitely contribute to the creation of individual novel genes and the modulation of gene expression, which allows for the dynamic diversity of biological systems, such as placental evolution (Rawn & Cross, 2008). It is now recognized that tandem duplication and retroposition are among the key factors that initiate the creation of novel gene family members (Brosius, 2005; Sorek, 2007; Kaessmann, 2010).
    [Show full text]
  • Identifying Genetic Risk Factors for Coronary Artery Angiographic Stenosis in a Genetically Diverse Population
    Please do not remove this page Identifying Genetic Risk Factors for Coronary Artery Angiographic Stenosis in a Genetically Diverse Population Liu, Zhi https://scholarship.miami.edu/discovery/delivery/01UOML_INST:ResearchRepository/12355224170002976?l#13355497430002976 Liu, Z. (2016). Identifying Genetic Risk Factors for Coronary Artery Angiographic Stenosis in a Genetically Diverse Population [University of Miami]. https://scholarship.miami.edu/discovery/fulldisplay/alma991031447280502976/01UOML_INST:ResearchR epository Embargo Downloaded On 2021/09/26 20:05:11 -0400 Please do not remove this page UNIVERSITY OF MIAMI IDENTIFYING GENETIC RISK FACTORS FOR CORONARY ARTERY ANGIOGRAPHIC STENOSIS IN A GENETICALLY DIVERSE POPULATION By Zhi Liu A DISSERTATION Submitted to the Faculty of the University of Miami in partial fulfillment of the requirements for the degree of Doctor of Philosophy Coral Gables, Florida August 2016 ©2016 Zhi Liu All Rights Reserved UNIVERSITY OF MIAMI A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy IDENTIFYING GENETIC RISK FACTORS FOR CORONARY ARTERY ANGIOGRAPHIC STENOSIS IN A GENETICALLY DIVERSE POPULATION Zhi Liu Approved: ________________ _________________ Gary W. Beecham, Ph.D. Liyong Wang, Ph.D. Assistant Professor of Human Associate Professor of Human Genetics Genetics ________________ _________________ Eden R. Martin, Ph.D. Guillermo Prado, Ph.D. Professor of Human Genetics Dean of the Graduate School ________________ Tatjana Rundek, M.D., Ph.D. Professor of Neurology LIU, ZHI (Ph.D., Human Genetics and Genomics) Identifying Genetic Risk Factors for Coronary Artery (August 2016) Angiographic Stenosis in a Genetically Diverse Population Abstract of a dissertation at the University of Miami. Dissertation supervised by Professor Gary W.
    [Show full text]
  • Population-Haplotype Models for Mapping and Tagging Structural Variation Using Whole Genome Sequencing
    Population-haplotype models for mapping and tagging structural variation using whole genome sequencing Eleni Loizidou Submitted in part fulfilment of the requirements for the degree of Doctor of Philosophy Section of Genomics of Common Disease Department of Medicine Imperial College London, 2018 1 Declaration of originality I hereby declare that the thesis submitted for a Doctor of Philosophy degree is based on my own work. Proper referencing is given to the organisations/cohorts I collaborated with during the project. 2 Copyright Declaration The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work 3 Abstract The scientific interest in copy number variation (CNV) is rapidly increasing, mainly due to the evidence of phenotypic effects and its contribution to disease susceptibility. Single nucleotide polymorphisms (SNPs) which are abundant in the human genome have been widely investigated in genome-wide association studies (GWAS). Despite the notable genomic effects both CNVs and SNPs have, the correlation between them has been relatively understudied. In the past decade, next generation sequencing (NGS) has been the leading high-throughput technology for investigating CNVs and offers mapping at a high-quality resolution. We created a map of NGS-defined CNVs tagged by SNPs using the 1000 Genomes Project phase 3 (1000G) sequencing data to examine patterns between the two types of variation in protein-coding genes.
    [Show full text]
  • Ejhg2009157.Pdf
    European Journal of Human Genetics (2010) 18, 342–347 & 2010 Macmillan Publishers Limited All rights reserved 1018-4813/10 $32.00 www.nature.com/ejhg ARTICLE Fine mapping and association studies of a high-density lipoprotein cholesterol linkage region on chromosome 16 in French-Canadian subjects Zari Dastani1,2,Pa¨ivi Pajukanta3, Michel Marcil1, Nicholas Rudzicz4, Isabelle Ruel1, Swneke D Bailey2, Jenny C Lee3, Mathieu Lemire5,9, Janet Faith5, Jill Platko6,10, John Rioux6,11, Thomas J Hudson2,5,7,9, Daniel Gaudet8, James C Engert*,2,7, Jacques Genest1,2,7 Low levels of high-density lipoprotein cholesterol (HDL-C) are an independent risk factor for cardiovascular disease. To identify novel genetic variants that contribute to HDL-C, we performed genome-wide scans and quantitative association studies in two study samples: a Quebec-wide study consisting of 11 multigenerational families and a study of 61 families from the Saguenay– Lac St-Jean (SLSJ) region of Quebec. The heritability of HDL-C in these study samples was 0.73 and 0.49, respectively. Variance components linkage methods identified a LOD score of 2.61 at 98 cM near the marker D16S515 in Quebec-wide families and an LOD score of 2.96 at 86 cM near the marker D16S2624 in SLSJ families. In the Quebec-wide sample, four families showed segregation over a 25.5-cM (18 Mb) region, which was further reduced to 6.6 Mb with additional markers. The coding regions of all genes within this region were sequenced. A missense variant in CHST6 segregated in four families and, with additional families, we observed a P value of 0.015 for this variant.
    [Show full text]
  • The Human Cranio Facial Development Protein 1 (Cfdp1)
    www.nature.com/scientificreports OPEN The human Cranio Facial Development Protein 1 (Cfdp1) gene encodes a protein required for Received: 30 September 2016 Accepted: 20 February 2017 the maintenance of higher-order Published: 03 April 2017 chromatin organization Giovanni Messina1,2, Maria Teresa Atterrato1,2, Yuri Prozzillo1,2, Lucia Piacentini2, Ana Losada3 & Patrizio Dimitri1,2 The human Cranio Facial Development Protein 1 (Cfdp1) gene maps to chromosome 16q22.2-q22.3 and encodes the CFDP1 protein, which belongs to the evolutionarily conserved Bucentaur (BCNT) family. Craniofacial malformations are developmental disorders of particular biomedical and clinical interest, because they represent the main cause of infant mortality and disability in humans, thus it is important to understand the cellular functions and mechanism of action of the CFDP1 protein. We have carried out a multi-disciplinary study, combining cell biology, reverse genetics and biochemistry, to provide the firstin vivo characterization of CFDP1 protein functions in human cells. We show that CFDP1 binds to chromatin and interacts with subunits of the SRCAP chromatin remodeling complex. An RNAi-mediated depletion of CFDP1 in HeLa cells affects chromosome organization, SMC2 condensin recruitment and cell cycle progression. Our findings provide new insight into the chromatin functions and mechanisms of the CFDP1 protein and contribute to our understanding of the link between epigenetic regulation and the onset of human complex developmental disorders. Chromatin organization is highly dynamic and subject to many epigenetic changes, mediated by histone modify- ing enzymes and ATP-dependent chromatin remodeling complexes1. These complexes are multi-protein molec- ular devices able to slide or displace nucleosomes, thus making DNA more accessible to specific binding proteins that control essential cellular processes, such as transcription, replication and DNA repair.
    [Show full text]
  • A Transcriptome-Wide Association Study Identifies Candidate Susceptibility Genes for Pancreatic Cancer Risk
    Published OnlineFirst September 9, 2020; DOI: 10.1158/0008-5472.CAN-20-1353 CANCER RESEARCH | GENOME AND EPIGENOME A Transcriptome-Wide Association Study Identifies Candidate Susceptibility Genes for Pancreatic Cancer Risk Duo Liu1,2, Dan Zhou3, Yanfa Sun2,4,5,6, Jingjing Zhu2, Dalia Ghoneim2, Chong Wu7, Qizhi Yao8,9, Eric R. Gamazon3,10,11, Nancy J. Cox3, and Lang Wu2 ABSTRACT ◥ Pancreatic cancer is among the most well-characterized cancer not yet reported for pancreatic cancer risk [6q27: SFT2D1 OR types, yet a large proportion of the heritability of pancreatic (95% confidence interval (CI), 1.54 (1.25–1.89); 13q12.13: cancer risk remains unclear. Here, we performed a large tran- MTMR6 OR (95% CI), 0.78 (0.70–0.88); 14q24.3: ACOT2 OR scriptome-wide association study to systematically investigate (95% CI), 1.35 (1.17–1.56); 17q12: STARD3 OR (95% CI), 6.49 associations between genetically predicted gene expression in (2.96–14.27); 17q21.1: GSDMB OR (95% CI), 1.94 (1.45–2.58); normal pancreas tissue and pancreatic cancer risk. Using and 20p13: ADAM33 OR (95% CI): 1.41 (1.20–1.66)]. The associa- data from 305 subjects of mostly European descent in the tions for 10 of these genes (SFT2D1, MTMR6, ACOT2, STARD3, Genotype-Tissue Expression Project, we built comprehensive GSDMB, ADAM33, SMC2, RCCD1, CFDP1, and PGAP3) remained genetic models to predict normal pancreas tissue gene expres- statistically significant even after adjusting for risk SNPs identified sion, modifying the UTMOST (unified test for molecular signa- in previous genome-wide association study.
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name craniofacial development protein 1 Gene Symbol CFDP1 Organism Human Gene Summary Description Not Available Gene Aliases BCNT, BUCENTAUR, CP27, SWC5, Yeti, p97 RefSeq Accession No. NC_000016.9, NT_010498.15 UniGene ID Hs.461361 Ensembl Gene ID ENSG00000153774 Entrez Gene ID 10428 Assay Information Unique Assay ID qHsaCID0015742 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000283882 Amplicon Context Sequence GGATTAAGCTGCTCTTGATTTAGCCCGTAACATCAAGGTTTCATTTTGCTCAGCC TGAGATCTCGCTCAATTTCAAACTGCCTGTGATCCACTCGGTCAAGGAAGGCTTT CCGTTCAATGTACCCCTCTTTCCCTCGATTATGGATGGCCAGTTCTTCACCAATC CCCTCTTCCTC Amplicon Length (bp) 146 Chromosome Location 16:75327818-75338974 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9993 cDNA Cq 19.54 cDNA Tm (Celsius) 83.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report CFDP1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • The BCAR1 Locus in Carotid Intima-Media Thickness and Atherosclerosis
    The BCAR1 Locus in Carotid Intima-Media Thickness and Atherosclerosis Freya Boardman-Pretty University College London Thesis submitted for the degree of Doctor of Philosophy 1 Declaration of work I, Freya Boardman-Pretty, confirm that the work presented in this thesis is my own and has been generated by me as the result of my own original research. Where information has been derived from other sources, this has been indicated in the text. My role in the work presented in each chapter is outlined below. In chapter 3 I carried out all bioinformatics analysis, including identification of SNPs in strong LD, analysis of regulatory marks associated with these SNPs using UCSC Genome Browser, HaploReg and ElDorado, and selection of candidate SNPs. I used the Gene-Tissue Expression (GTEx) browser and Gilad/Pritchard eQTL browser to investigate eQTLs. In chapter 4 I was responsible for genotyping the PLIC cohort for the SNP rs4888378. Genotype data and an analysis plan were sent to Danilo Norata and Andrea Baragetti (University of Milan), who carried out the statistical tests that I requested in PLIC and provided test results and the necessary data for the meta-analysis. I carried out the sex-stratified meta-analysis and additional event rate analysis. In chapter 5 I carried out electrophoretic mobility shift assays (EMSAs) on candidate SNPs, multiplex competitor EMSAs and supershift EMSAs. For the luciferase assay, I designed reporter fragments of interest and carried out the cloning experiments to create the four sets of reporter vectors, and carried out the luciferase assays. I also carried out transfection experiments.
    [Show full text]
  • Genetic Assessment of Inbred Chicken Lines Indicates Genomic Signatures of Resistance to Marek’S Disease Lingyang Xu1,2,3*†, Yanghua He1†, Yi Ding1, George E
    Xu et al. Journal of Animal Science and Biotechnology (2018) 9:65 https://doi.org/10.1186/s40104-018-0281-x RESEARCH Open Access Genetic assessment of inbred chicken lines indicates genomic signatures of resistance to Marek’s disease Lingyang Xu1,2,3*†, Yanghua He1†, Yi Ding1, George E. Liu2, Huanmin Zhang4, Hans H. Cheng4, Robert L. Taylor Jr.5 and Jiuzhou Song1* Abstract Background: Marek’s disease (MD) is a highly contagious pathogenic and oncogenic disease primarily affecting chickens. However, the mechanisms of genetic resistance for MD are complex and not fully understood. MD-resistant line 63 and MD-susceptible line 72 are two highly inbred progenitor lines of White Leghorn. Recombinant Congenic Strains (RCS) were developed from these two lines, which show varied susceptibility to MD. Results: We investigated genetic structure and genomic signatures across the genome, including the line 63 and line 72, six RCSs, and two reciprocally crossed flocks between the lines 63 and 72 (F1 63 ×72 and F1 72 ×63)using Affymetrix® Axiom® HD 600 K genotyping array. We observed 18 chickens from RCS lines were specifically clustered into resistance sub-groups distributed around line 63. Additionally, homozygosity analysis was employed to explore potential genetic components related to MD resistance, while runs of homozygosity (ROH) are regions of the genome where the identical haplotypes are inherited from each parent. We found several genes including SIK, SOX1, LIG4, SIK1 and TNFSF13B were contained in ROH region identified in resistant group (line 63 and RCS), and these genes have been reported that are contribute to immunology and survival.
    [Show full text]
  • Inference of Cell Type Composition from Human Brain Transcriptomic
    bioRxiv preprint doi: https://doi.org/10.1101/089391; this version posted December 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Running Head: PREDICTING CELL TYPE BALANCE INFERENCE OF CELL TYPE COMPOSITION FROM HUMAN BRAIN TRANSCRIPTOMIC DATASETS ILLUMINATES THE EFFECTS OF AGE, MANNER OF DEATH, DISSECTION, AND PSYCHIATRIC DIAGNOSIS *Megan Hastings Hagenauer, Ph.D.1, Anton Schulmann, M.D.2, Jun Z. Li, Ph.D.3, Marquis P. Vawter, Ph.D.4, David M. Walsh, Psy.D.4, Robert C. Thompson, Ph.D.1, Cortney A. Turner, Ph.D.1, William E. Bunney, M.D.4, Richard M. Myers, Ph.D.5, Jack D. Barchas, M.D.6, Alan F. Schatzberg, M.D.7, Stanley J. Watson, M.D., Ph.D.1, Huda Akil, Ph.D.1 1Mol. Behavioral Neurosci. Inst., Univ. of Michigan, Ann Arbor, MI, USA; 2 Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA, USA, 3Genet., Univ. of Michigan, Ann Arbor, MI, USA; 4Univ. of California, Irvine, CA; 5HudsonAlpha Inst. for Biotech., Huntsville, AL, USA; 6Stanford, Palo Alto, CA, 7Cornell, New York, NY, USA *Corresponding Author: Megan Hastings Hagenauer, Ph.D. e-mail: [email protected] Molecular Behavioral Neuroscience Institute (MBNI) 205 Zina Pitcher Pl. Ann Arbor, MI 48109 1 bioRxiv preprint doi: https://doi.org/10.1101/089391; this version posted December 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]