TRANSCRIPTIONAL SILENCING OF FOXD3 IS AN EARLY EVENT MEDIATING EPIGENETIC SILENCING IN TCL1 POSITIVE CHRONIC LYMPHOCYTIC LEUKEMIA
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Shih-Shih Chen, M.S.
The Ohio State University 2008
Dissertation Committee: Approved by Professor Christoph Plass, Advisor
Professor John C. Byrd, Advisor
Professor Michael Ostrowski ______Professor Susan Cole Advisor Professor Natarajan Muthusamy Graduate Program in Molecular Genetics
ABSTRACT
Chronic lymphocytic leukemia (CLL) is one of the most common types of leukemia in adults; recent findings in CLL diagnosis, mechanism of pathogenesis and therapy options are reviewed in in the introductory Chapter 1. Early stages in the development of CLL have not been explored mainly due to the inability to study normal
B-cells in route to transformation. Over-expression of human TCL1, a known CLL oncogene, in murine B-cells leads to the development of mature CD19+/CD5+/IgM+ clonal leukemia with a similar disease phenotype seen in human CLL. In Chapter 2, we used this TCL1 murine model of CLL and corresponding human CLL samples in a cross- species Epigenomics approach to address the timing and relevance of epigenetic events occurring during leukemogenesis. In the TCL1 positive B-cells, aberrant DNA methylation of CpG islands occurred progressively more frequently with age. We found a high concordance of methylated genes in the TCL1 mouse and human CLL. Increased methylation at 9 to 14 months correlated with progressively decreasing levels of microRNAs miR29b/miR29c and increased protein levels of their targets DNMT3A/3B.
While the increased protein levels of de novo DNMT transferases can not explain methylated targets in TCL1 mice, in Chapter 3, a predicted Foxd3 binding sequence was much more frequently found in methylated genes (70%) as compared to unmethylated
ii genes (29%). Specifically, Foxd3 promoter methylation is noted at five months, and its
expression is silenced within one month as a consequence of a TCL1 activated NFκB repressor complex. Similar silencing of FOXD3 was also found in human CLL. Loss of the FOXD3 transcription factor leads to silencing of downstream targets, chromosome remodeling, promoter specific DNA methylation and thus manifesting its role in early leukemogenesis. During the disease development, one of the Foxd3 target genes,
inhibitor of DNA binding protein 4 (Id4) is found methylated at a late stage of
leukemogenesis in TCL1 mice. While Id4 has been suggested as a tumor suppressor gene
in many types of leukemia including CLL, double or hetero knockout Id4 mice do not
develop leukemia. To elucidate the role of late-stage methylated genes in CLL
development, in Chapter 4, the outcome of loss of Id4 was further investigated using
genetically modified mice. In the presence of the heterozygous TCL1 transgene, the mice
with haploid loss of Id4 exhibited elevated white blood cells counts, accelerated death
accompanied with enlarged spleens and B cells infiltrated secondary organs; while the
same background TCL1 mice tend to have slower disease progression. Non-transformed
B-lymphocytes from wild-type as opposed to Id4 haplotype deficiency were more
resistant to dexamethasone therapy. Overall, our findings suggest aberrant DNA
methylation as an early and accumulated event during CLL disease development, the loss
of targets might be required for disease progression in both mouse and human CLL-cells.
Finally, in Chapter 5 we discuss the relevance of the findings in the preceding chapters
and the future direction of this body of work to understanding the pathogenesis of CLL.
iii
THIS IS DEDICATED TO MY PARENTS, BROTHER, AND HUSBAND FOR THEIR UNCONDITIONAL LOVE, SUPPORT, ENCOURAGEMENT, AND CONFIDENCE IN ME WHICH HAS ENABLED ME TO OVERCOME CHALLENGES AND ACHIEVE THESE ACCOMPLISHMENTS.
iv
ACKNOWLEDGMENTS
I would like to, especially, thank my advisors, Dr. Christophe Plass and Dr. John
C. Byrd, for their wisdom and guidance during my graduate years. Their excellent ideas have led me into a great field with exciting science which can really help patients. Their kindness and open minds have brought me opportunities to meet brilliant scientists in the field. I am very blessed to have both of them as my advisors. I am also grateful to my committee Dr. Michael Ostrowski and Dr. Susan Cole for being so accommodating through this process, and for their helpful comments. Fellow members of the Plass lab,
Aparna Raval, Björn Hackanson, Kristi Bennett, Martin Brena, Shu-Huei Wang and other members, have been like a family to me in the past several years. There is no word that can describe my deep thank to them. I also thank the Byrd lab members, especially Dr.
Amy Johnson, Erin Hertlein, David Lucas, and Raj Muthusumy, for all of their thoughtful discussions and warm friendship. I thank my classmates Shih-Yin Tsai and
Hui-Lin Liu who supported me with great helps and encouragement, especially during all the difficult times. Finally, I am grateful for the unconditional love and support my parents, brother and husband provided. I have been truly blessed to have their emotional support and instructive guidance through these years, enabling me to complete this academic accomplishment.
v
VITA
September 1998………………………. B.S. Biology Fu-Jen Catholic University, Taiwan
August, 1999……………...... Research Scientist SINON Bio-Pharmaceutical Company
1999- July, 2001 ………………………MS. Pharmacology National Yang-Ming University, Taiwan
2001- 2003 …………………………… Research Assistant Medical Research of Veterans Hospital
2003 – 2005 ………………………….. Teaching Asstistant The Ohio State University.
2003 – present …………………………Graduate Research Associate Department of Molecular Genetics Division of Human Cancer Genetics The Ohio State University.
PUBLICATIONS
1. Hackanson B, Bennett K, Brena RM, Chen SS, Jiang J, Maharry K, Whitman SP, Schmittgen TM, Lübbert M, Marcucci G, Bloomfield CD, Plass C. 2007 Dual epigenetic control of CCAAT/enhancer binding protein α (C/EBPα) expression in acute myeloid leukemia. In Press, Cancer Research, 2008.
2. Smiraglia DJ, Kazhiyur-Mannar R, Oakes CC, Wu YZ, Hall J, Liang P, Ansari T, Su J, Rush L, Smith L, Yu L, Liu C, Dai ZY, Chen SS, Wang SH, Costello J, Ioschikhes I, Dawson DW, Hong JS, Teitell MA, Szafranek A, Camoriano M, Song F, Elliot R, Held W, Trasler JM, Plass C, Wenger R. 2007 Restriction vi Landmark Genomic Scanning (RLGS) spot identification by second generation virtual RLGS in multiple genomes with multiple enzyme combinations. BMC Genomics 30(8):446.
3. Raval A, Tanner SM, Byrd JC, Angerman EB, Perko JD, Chen SS, Hackanson B, Grever MR, Lucas DM, Matkovic JJ, Lin TS, Kipps TJ, Murray F, Weisenburger D, Sanger W, Lynch J, Watson P, Jansen M, Yoshinaga Y, Rosenquist R, de Jong PJ, Coggill P, Beck S, Lynch H, de la Chapelle A, Plass C. 2007 Downregulation of death-associated protein kinase 1 (DAPK1) in chronic lymphocytic leukemia. Cell 129(5):879-90.
4. Dawson DW, Hong JS, Shen RR, French SW, Troke JJ, Wu YZ, Chen SS, Gui D. Regelson M, Marahrens Y, Morse HC, Plass C, Teitell MA. 2007 Global DNA methylation profiling reveals silencing of a secreted form of Epha7 in mouse and human germinal center B-cell lymphomas. Oncogene 26(29):4243-52.
5. Liu TH, Raval A, Chen SS, Matkovic JJ, Plass C. 2006 CpG island methylation and expression of the secreted frizzled-related protein gene family in chronic lymphocytic leukemia. Cancer Res. 66(2):653-8.
6. Juan CC, Kan LS, Huang CC, Chen SS, Ho LT, Au LC. 2003 Production and characterization of bioactive recombinant resistin in Escherichia coli. J. Biotechnol. 103(2):113-7.
FIELDS OF STUDY
Major Field: Molecular Genetics
vii
TABLE OF CONTENTS
Page
Abstract……………………………………………………………………………... ii
Dedication………………………………………………………………………...... iv
Acknowledgments………………………………………………………………… v
Vita…………………………………………………………………………………. vi
List of Tables……………………………………………………………………….. x
List of Figures……………………………………………………………………… xi
Chapters:
1. Chronic lymphocytic leukemia introduction.….…………………………..… 1 1.1 Introduction to CLL 1.1.1 Biology of CLL……………………………………………….…. 1 1.1.2 Symptoms and detection of the disease…………………………. 3 1.1.3 Clinical prognosis and course of the disease……………………. 5 1.1.4 Current treatment options……………………………………….. 7 1.1.5 Risk factors to CLL and epidemiology…..……………………… 9 1.1.6 Early changes in CLL…………………………..……………….. 10 1.2 Epigenetic contributions in CLL…..…………………………………… 12 1.2.1 DNA methylation, histone modification and gene regulation…. 12 1.2.2 Aberrant DNA methylation in CLL ..………………………….. 15 1.2.3 MicroRNA regulation ....…………………………….………… 16 1.2.4 Epigenetic therapy ……….....………………………………….. 18 1.3 Genetic alterations in CLL……………………………………………… 20 1.3.1 Stage-dependent chromosomal abnormalities……………….… 20 1.3.2 Genetic aberrations in signaling pathways...... 22 1.3.3 Drug targeting and apoptosis………………………...... 23 1.4 CLL mouse models………………....……………………………….….. 24
viii 2. Epigenetic changes during CLL progression in the TCL1 transgenic mouse 26 model …….…………………………....…..………………………………… 2.1 Background……………………………………………………………… 26 2.2 Material and methods………………………………………….………… 28 2.3 Results…………………………………………………………………… 33 2.3.1 DNA methylation patterns in TCL1 transgenic mice...... 33 2.3.2 Aberrant DNA methylation is an early event in Eµ-TCL1 B- 34 cells……………………………………………………………... 2.3.3 Progressive hypomethylation of repetitive DNA elements in 36 Eµ-TCL1 B-cells....…...... 2.3.4 Increased DNA methyltransferases and decreased microRNA 37 29 in Eµ-TCL1 mice…………………………………...……... 2.4 Discussion……………………………………………………………...... 37 2.5 Acknowledgments………………………………………………………. 42 3. Early silenced Foxd3 mediates aberrant DNA methylation targeting in CLL 55 3.1 Background……………………………………………………………… 55 3.2 Material and methods…………….……………………………………… 57 3.3 Results…………………………….………………………………………62 3.3.1 Methylated genes in Eµ-TCL1 transgenic mice are putative 62 Foxd3 targets…………………………………………………... 3.3.2 Early silencing prior to DNA methylation of Foxd3 in CLL ….. 63 3.3.3 Down-regulated Foxd3 by TCL1 through PI3K/NFκB pathways 64 3.3.4 Lost of Foxd3 triggers DNA methylation on the target genes…. 65 3.3.5 Re-expression of Foxd3 targets requires both Foxd3 restoration 67 and DNA demethylation………………………………………. 3.4 Discussion……………………………………………………………….. 67 3.5 Acknowledgments………………………………..……………………… 71 4. Haploid loss of Id4 leads to accelerated CLL progression in TCL1 83 transgenic mice…………….………………………………………………… 4.1 Background……………………………………………………………… 83 4.2 Material and methods……………………………………………………. 86 4.3 Results……………………………………………………….……………89 4.3.1 Late -methylated Id4 in Eµ-TCL1 mice is transcriptional 89 silenced by Foxd3………………....…………………………... 4.3.2 Haploid loss of Id4 accelerates TCL-1 induced 90 lymphomagenesis....……………………………………………. 4.3.3 P53-independent anti-apoptotic response in Id4+/-Tcl1+/tg 92 lymphocytes prior to cell transformation ……...... 4.3.4 Id4+/-Tcl1+/tg Lymphocytes are resistant to corticosteroid 93 mediated apoptosis prior to transformation…………………….. 4.4 Discussion……………………………………………………………...... 93 4.5 Acknowledgments……………………………………………………….. 96 5 Future Directions…………………………………………………………….. 108 References……………………………………………………………………. 119
ix
LIST OF TABLES
Table Page
1 Different diagnosis of CD19/CD5/CD20/CD23 positive lymphocytosis 4
2 Outcome by interphase chromosomal abnormalities ………….………. 6
3 Characteristics of methylated NotI fragments in TCL1 transgenic mice 43 spleen cells ….…………………………………………………………..
4 B lymphocytes infiltrated lymphoid and non-lymphoid organs in heterozygous TCL1 transgenic mice with or without haploid loss of Id4……………………………………………………..……………….. 92
5 Summary of primer sequence...………………………………………… 118
x
LIST OF FIGURES
Figure Page
1 CLL Lymphocytes in peripheral blood...……………………………….. 2
2 Current proposed mechanism of CLL disease …………………………. 11
3 Epigenetic modifications of the DNA …………………………………. 14
4 Chromosomal aberrations lead to loss of microRNA...... 17
5 Summary of HDACi induced cell death in CLL ……………………….. 20
6 Specific aberrant DNA methylation pattern in Eµ-TCL1 mice 47 recapitulates changes in human CLL ……….…………………………
7 Aberrant DNA methylation is an early event with increased frequency 49 in TCL mice ……………………………………………………………
8 Elevated global hypomethylation of repetitive sequences in CLL…...... 51
9 Decreased miR29s and increased DNMTs in Eµ-TCL1 mice…………. 53
10 Proposed mechanism of the initiation and accumulation of aberrant 71 DNA methylation in CLL ………………………………………………
11 Consensus transcription factor binding sequence in the promoter region 72 of genes methylated in Eµ-TCL1 mice …………………………………
12 Methylated and silenced Foxd3 in mouse and human CLL……………. 74
13 Luciferase activity of Foxd3 in TCL1 transfected cell lines……………. 76
14 Foxd3 is repressed by p50 homodimer/HDAC1 complex in TCL1 78
xi overexpressed cells …………………….………………………………..
15 Silenced, methylated predicted Foxd3 target genes accompanied with 79 chromatin remodeling in Foxd3 knockdown cells………………………
16 Binding of Foxd3 transcription activator on the predicted target genes 81 in Raji cells ……………………………………………………………..
17 Methylated Id4 in TCL1 mice is regulated by Foxd3…………………. 97
18 Methylated Id4 in TCL1 mice is accelerated by Foxd3……………….. 99
19 Accelerated peripheral blood lymphocytosis…………………………… 101
20 B cell infiltrations in lymphoid and non-lymphoid tissues in Id4 mutant 102 mice with TCL1 transgene ……………………………………………...
21 Methylation status of Id4 in Id4+/-Tcl+/tg and Id4+/+Tcl+/tg mice………… 103
22 Antiapoptotic Id4 mutant TCL1+/tg cells…………………………..….. 106
23 Proposed mechanism of TCL1 overexpression initiated accumulated aberrant epigenetic changes and anti-apoptotic CLL leukemiogenesis… 107
xii
CHAPTER 1
CHRONIC LYMPHOCYTIC LEUKEMIA INTRODUCTION
1.1 Introduction to CLL
1.1.1 Biology of CLL
Chronic lymphocytic leukemia (CLL) is a common and extremely heterogeneous disease. The incidences of CLL in the United States are 3.5 per 100,000 per year [1].
Approximately ninety percent of CLL patients are older than 50 years with the median age for diagnosis of the disease being 72 [1]. CLL is characterized by an accumulation of
B lymphocytes in the peripheral blood, bone marrow and lymphoid organs. Under the microscope, the typical CLL lymphocytes are small, with condensed chromatin, a large nucleus: cytoplasm ratio, and lack notable nucleoli. An atypical group of circulating lymphocytes in CLL can also be noticed in patients with bad prognosis, with a larger size and characterized by a less condensed chromatin (Figure 1). 1
Figure 1. CLL Lymphocytes in peripheral blood. May-Grunmwald-Giemsa-stained
blood smear from one CLL patient. The black arrow indicates a CLL lymphocyte with
typical morphology; the gray arrow indicates an atypical CLL lymphocyte. Modified
from Matutes et al. [2]
The accumulation of B lymphocytes is a result from an imbalance of cell death and cell birth [3]. A large body of evidence is suggesting that CLL lymphocytes have a defect in apoptosis or program cell death. Common features in CLL patients such as
chromosomal abnormalities, aberrant DNA methylation, and deregulated microRNA
render CLL cells the ability of avoiding cell death, mainly through the deregulated
expression of anti-apoptotic and pro-apoptotic genes [4]. In addition to the anti-apoptotic
ability, recent studies have found that CLL cells can also multiply; a small population
(about 0.1 to 1.75% per day) CLL cells were found consistently generated in patients [5]. 2 The proliferating population of CLL cells possesses surface marker CD38. In comparison of CD38- cells, CD38+ cells have higher expression levels of cell-cycle regulators (i.e.
Ki-67) and cell signaling molecules (i.e. ZAP70) [6]. Overall, current evidence suggests
that CLL cells are in a dynamic equilibrium whereby most of cells have long-survival due
to the resistance to cell death and new-borne cells that exceed loss of the dying
population.
1.1.2 Symptoms and detection of the disease
CLL patients are usually asymptomatic in early stages [7], when the disease is
symptomatic, the median survival of patients is between 18 months and six years. Current
therapy can help with symptoms but it remains unclear whether treatment can extend
survival of patients. The symptoms of CLL include weight loss or energy loss, due to low
red cell counts. When the CLL cells accumulate in the lymph nodes or spleen, some of
the patients notice pain at the local site, abdominal distension or early satiety. Extensive
infiltration of CLL cells in the bone marrow might lead to neutropenia with
accompanying repeated infection, anemia, and/or thrombocytopenia.
The diagnosis of CLL is based on blood lymphocyte count and morphology,
concurrent with a signature immunophenotype. Histology on bone marrow, spleen or
lymph node can further clarify uncertain cases [8]. CLL disease is defined by the
lymphocytes counts greater than 5x109/L in peripheral blood. Immunophenotyping is
required to distinguish CLL from other types of B cell leukemia; rarely genomic
3 aberration specific to certain types of lymphoma such as the t(11;14) can also be used as
diagnostic markers [9].
The immunophenotype of CLL lymphocytes is CD19+, CD5+, CD20+, CD23+, and low
expression or absence of CD22, CD79b, surface immunoglobulin (IgM or IgD) and
FMC7. While the same immunophenotype can also be found in lymphocytes of small
lymphocytic leukemia (SLL) and monoclonal B cell lymphocytosis (MBL) [4], the
diagnosis standard criteria of each leukemia is basically based on the different degree and
site of lymphocyte infiltration of blood, lymph node, and bone marrow. Table 1 lists the
different affected organs involved in each group of patients. The lymphocyte count in
blood or bone marrow is another diagnostic marker between MBL and CLL while MBL
patient has lower amount of lymphocytes than the defined number for CLL diagnosis [4,
10].
B lymphocytes CLL Monoclonal B cell Small Affected tissues lymphocytosis Lymphocytic CD19+ (MBL) Leukemia (SLL) CD5+ Lymph nodes or other + - + CD20+ tissues CD23+ Peripheral blood + + - CD22- CD79B-/(+) Surface Ig+/- Bone marrow + + - FMC7-/+ Table 1. Different diagnosis of CD19/CD5/CD20/CD23 positive lymphocytosis
4 1.1.3 Clinical prognosis and course of the disease
The clinical course of CLL varies among patients. Some patients can live with the disease for an extended period without development of symptoms or need for therapy.
Other CLL patients present with symptomatic disease and require therapy immediately.
The survival time of CLL patients therefore varies from a year to decades. To determine the stage of disease, Rai [11] and Binet [12] systems have been used most often from
1975 until now. The Rai system divides CLL into stage 0, I, II, III and IV; patients at stage 0 have only lymphocytosis in blood and bone marrow, the average survival rate is
12 years; Stage I and II patients have lymphocytosis accumulated in lymph nodes, spleen and liver, the average survival is 7 years; patients have anemia or thrombocytopenia are ranged in stage III and IV with average survival less than 1-2 years. The Binet system also divides patients into three groups: patients with Hb greater than 10g/dL and platelets counts over 100 x 109/L are ranked in stage C, otherwise are in stage A or B. Stage C patients have median survival of 2 years, while stage A and B patients have more than 5 years. The criteria to distinguish stage A and B are by the range of involved organs. Stage
A patients are considered early stage. Additionally, independent of staging systems, prognostic markers such as cytogenetic aberrations, mutations of the variable region of the immunoglobulin heavy chain (IgVH) and the expression of CD38 and ZAP70, may increase the ability to predict who will progress soon after diagnosis to require therapy.
As part of clinical trials, this might help determine who requires therapy for their disease.
[13]. Table 2 lists the chromosomal abnormalities that can be used as markers for bad or good prognosis [14]. Notably, these markers are not CLL specific.
5
Prognosis marker % patients Affected Median overall
affected Putative survival (mo)
Gene
Bad prognostic marker del17p13.1 7 P53 32
del11q22.3 17 ATM 79
trisomy 12 14 114
None 18 111
Good prognostic marker del13q14 36 miR15 133
miR16
Table 2. Outcome by interphase chromosomal abnormalities[14]
Recent studies have confirmed based upon the IgVH mutation status, CLL patients
can be separated into two groups; good prognostic patients have mutated IgVH, and bad
prognostic patients have unmutated IgVH. Overall, somatic mutations of IgVH gene occur in 50-70% CLL patients, these patients have good prognosis marker del13q14 and longer survival of 25 years [15]; IgVH unmutated patients have bad prognosis marker trisomy
12, early clonal evolution, and median survival of 8 years [16, 17]. While most of the
cases, only IgVH unmutated patients occur to have clonal evalution and advanced disease, the karyotype instablitiy has been considered as one of the mechanisms of CLL pathogenesis [18].
6 Other prognostic markers associated with IgVH mutation have also been applied for
diagnosis since the IgVH mutation assay is difficult for most clinical labs. A gene
expression study on 13,868 genes found ZAP70 is the most distinct gene that can predict the IgVH mutation status [19, 20]. ZAP70 is a 70kD zeta-associated oncoprotein and its
expression can favor IgM signaling in B cells and enhance cell proliferation [21-24].
Both ZAP70 and IgVH mutation can predict prognosis. On the other hand, IgVH unmutated patients often have more than 30% CD38+ cells, while the mutated patients often have less than 30% CD38+ cells [16, 25, 26]. CD38 is therefore considered by some as another useful diagnostic marker. The function of CD38 was suggested as stimulating cell proliferate by binding with CD31 ligand [27].
With CD38 and ZAP markers and the Rai and Binet staging systems, physicians can better predict the disease progression in patients. However, the methods for some prognostic markers such as IgVH mutation are not accessible in most of the clinical labs.
Markers that can be detected easily in serum such as CD38 may be of equal prognostic significance but are not definitely established [28]. Moreover, with current markers, there are patients with high CD38 or ZAP70 that have mutated IgVH. Identification of new
biomarkers with particular relevance to biologic targeting is still needed.
1.1.4 Current treatment options
Current treatments options do help in preventing CLL progression but do not improve
survival in patients with indolent disease [7] [29]. The timing for treatment outside of
7 clinical trials is at the time symptomatic disease develops. Chemotherapy, immunotherapy and chemoimmunotherapy are the current options.
Traditional chemotherapeutic drugs for CLL include alkylating agents and purine
analogues. Akylating agents, such as Chlorambucil and Cyclophosphamide, can attack
DNA structure by forming cyclic ammonium ions with nitrogen, therefore stopping
double strand DNA uncoiling and cell division. Purine analogs, such as Fludarabine, can
inhibit DNA synthesis by interfering ribonucleotide reductase and DNA polymerase,
therefore target both dividing and resting cells [30]. Overall, purine analog agents reveal
better response and longer prognosis-free periods than akylating agents in randomized
trials [31]. The combination of these two classes of agents is another option and
laboratory synergy exists to support this [32]. Randomized phase III studies have
demonstrated this combination approach is better than monotherapy with fludarabine [33-
36].
Problems of chemotherapy are drug-refractoriness or relapse. Very limited treatment
can be used on relapsed patients previously treated with fludarabine. Fludarabine-
resistant patients tend to have poor immune function, more infections, and very short
survival (median 10 months) [37, 38]. Combined drug treatments may be effective with
trials using Fludarabine-Cyclophosphamide-Mitoxantrone demonstrating a 50% complete
remission in relapsed or resistant CLL patients [39-41]. The other options of advanced
therapy are immunotherapy or immunochemotherapy using monoclonal antibodies.
8 Immunotherapy using monoclonal antibodies can deplete B cells by targeting B cell surface antigens. Anti-CD20 and Anti-CD52 monoclonal antibodies Rixuimab, and
Alemtuzumab are actively utilized in the therapy of CLL. Both of these antibodies can induce antibody-dependent cell cytotoxicity, complement dependent cytotoxicity, and apoptosis in CLL cells; although Alemtuzumab but not Rituximab has been shown to be effective in patients with P53 deletion or mutation [42-47]. Alemtuzumab is an approved drug for both previously untreated and fludarabine resistant or relapse CLL patients [48-
51]. Rituximab is not Food and Drug Administration (FDA) approved for CLL but is often used as monotherapy in up-front or relapsed disease or in combination with other effective therapy (fludarabine, fludarabine/cyclophosphamide, or pentostatin/cyclophosphamide) [29, 52-54]. The anti-CD40 monoclonal antibody
HCD122 (CHIR-12.12) is in clinical trials and may influence CD40 signaling due to the block of CD40 antigen stimulated survival signals in germinal center [55, 56]. Other antibodies targeting CD23, CD74, and HLA-DR are in clinical trials.
1.1.5 Risk factors for CLL and Epidemiology
None or very limited correlation can be found in CLL and environmental factors such as radiation, chemicals, lifestyle; or medical factors such as autoimmunity and infections
[57, 58]. Genetic risk factor including previously described chromosomal aberrations, age and other lesions that have been applied as diagnostic markers, is the major risk factor of
CLL. In addition, family history and ethnic differences are also potential risk factors.
Ethnic difference has been suggested to be more important than other environmental
9 factors by the statistical results of five times more incidence of CLL in Americans than
Chinese, Japanese and Filipino people living in US with American lifestyles [59]. Family
history is another important factor, CLL first degree relatives have a three times higher
risk to develop CLL or other lymphoproliferative disorders than those without such
history [60]. Recently one germ line mutation in a suppressor sequence for DAPK1 has
been found that may result in a predisposition to CLL [61]. This mutation was however restricted to one CLL family and not seen in other families. Germ line mutations of selected miRs relevant to CLL have also been described in a mouse model (Ref.).
1.1.6 Early changes in CLL
Current chemotherapy and chemoimmunotherapy approaches are not curative for
CLL. A novel approach to this disease would be targeting the “CLL precursor cells” before the phenotype manifested completely. However, the origin of CLL cells is still obscure. Figure 2 shows the current proposed mechanism of CLL disease established by studies of immunoglobulin heavy chain, cell surface markers and receptors of CLL B cells. Briefly, the initial genetic lesions might occur in immature B cells in circulation or in bone marrow, the following stimulation by antigens might cause genetic lesions. The accumulated lesions might lead to the transformation of leukemia cells [58, 62, 63].
In order to track a step back from CLL development, more and more studies have been focusing on seeking the relationship between CLL and MBL, which shares the same immunophenotype with CLL but with lower numbers in bone marrow and circulating
10 blood (Table 1) [64]. MBL have del13q14, mutated IgVH and slower disease progression
as compared with Rai stage 0 CLL patients, suggesting it is close to indolent but not
aggressive CLL. These patients only progress at a rate of 1-2% per year. Considering the
incidence of MBL is 10-1000 folds higher compare with CLL, only a small proportion
MBL cells actually develop into CLL [65]. Whether MBL is the precursor of CLL, or
how the MBL cells develop into CLL still remains unknown. Even so, one study on familial CLL first degree relatives found unaffected first degree CLL relatives tend to
have higher percentage of MBL cells as compared to normal individuals at same age[66].
This finding suggests MBL might be a useful tool to study early changes in CLL.
B cell receptor
Surrogate B cell µ heavy chain light chain receptor Immature-B cell
B cell receptor Pro-B cell Pre-B cell Immature-B cell
Immature-B cell with genetic lesions
Antigen-induced maturation
Mutated IgVH Unmutated IgVH
ZAP70- ZAP70+ CD38- CD38+
Repeat antigen stimulation
Less aggressive CLL Aggressive CLL
Figure 2. Current proposed mechanism of CLL disease. CLL cells might be
originated from immature B cells with genetic lesions. After maturation process, the 11 mature CLL lymphocytes might have genetic lesions after repeated antigen stimulation.
The disease stage preferential of CLL cells can be defined by mutation status of the
immunoglobulin heavy chain variable region.
1.2 Epigenetic contributions in CLL
1.2.1 DNA methylation, histone modification and gene regulation
DNA methylation is an epigenetic modification that can alter gene expression status
without changing the actual genetic sequence (Figure 3). The modification is
accomplished by transferring a methyl group from methyl donor S-Adenosinemethionine,
to position 5 of the cytosine ring in the DNA. This reaction is catalyzed by DNA
methyltransferases (DNMT) [67]. De novo methyltransferases (i.e. DNMT3A, 3B and
3L) establish the initial DNA methylation pattern within the genetic sequence [68], whereas the maintenance enzyme (DNMT1) maintains the methylation pattern during
DNA replication [69]. At the embryogenesis stage, the first de novo DNA methylation occurs to establish a distinct DNA methylation pattern which provides proper tissue and organ formation by tissue-specific gene methylation [70], differential methylation on imprinting genes [70], X-chromosome inactivation [71] and repetitive sequences such as
LINE1 elements and transposons to prevent chromosomal instability [72, 73].
Furthermore, increased global DNA methylation but not CpG island methylation within the mammalian genome occurs naturally with aging [74, 75].
12 Most CG dinucleotides within the genome are methylated, but there are about 1-2%
CpG dinucleotides in the CG-dense region that are normally unmethylated. The CG- dense regions are called CpG islands, which is CG rich sequences >200bp with CG content >50%, and observed CG/ expected CG >60% [76]. In the human genome, about
29,000 CpG islands are associated with 50-60% of known genes, located generally within the promoter, first exon or first intron regions. These unmethylated CpG islands allow gene transcription to maintain normal cellular functions [77]. In addition to DNA methylation, histone modifications can also affect gene transcription as a second epigenetic mechanism. Modifications such as methylation, acetylation, phosphorylation, or ubiquitination of histones (H2A, H2B, H3, and H4) can alter the associated chromatin structure. Generally, histone acetylation with opened chromatin structure and unmethylated promoter region allows for gene transcription [78, 79]. Both DNA methylation and histone acetylation are dynamic processes; DNA methylation is regulated by DNMTs and DNA demethylase, [80, 81]; while histone modification are regulated by histone acetyltransferases (HATs), deacetylases (HDACs); histone methyltransferases (HMTs) and demethylase (such as the recently found histone trimethyllysine specific demethylase, JMJD2 family members) [82-86] (Figure 3C).
13 A Cytosine 5-methylcytosine
NH NH CH N N 5
O N N O B de novo methylation
CH CH CH CH CH CH
CH CH CH CH CH DNMT3A DNMT3B CH Methylated cytosine
Maintenance DNA methylation
CH CH CH CH CH CH CH CH CH3 CH
CH CH CH CH CH DNMT1 CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH
CH CH CH CH CH CH CH CH CH CH
C
Methylated cytosine
Unmethylated cytosine
Ac Ac Ac
Figure 3. Epigenetic modifications of the DNA. A. DNMTs mediated DNA methylation. B. The family members of DNMT have two distinct functions; de novo
DNMTs create methylated CpG dinucleotides in unmethylated DNA, whereas maintenance DNMT preferentially attaches methyl groups to semi-methylated DNA. C.
14 Reversible changes of DNA methylation and chromatin modification control gene transcription.
1.2.2 Aberrant DNA methylation in CLL
In contrast to normal cells, cancer cells tend to have global hypomethylation.
Hypomethylation mediated oncogene over-expression, such as seen for TCL1A, MYC and anti-apoptotic BCL2 [87-89], accompanied with overall decreased CG content and increased repetitive sequences hypomethylation has been shown in CLL [90, 91]. While hypomethylation induced thymic lymphoma mouse model has been generated, the global genomic hypomethylation might be one of the mechanisms of CLL development [92, 93].
Aberrant CpG hypermethylation has also been suggested as one of the mechanisms of tumorigenesis. Global CpG hypermethylation involved in 138 genes was found in CLL patients [94], many novel tumor suppressor genes, such as DAPK1, SFRPs, ID4 and Win- inhibitory factor-1 were found methylated. In vitro assays demonstrated the majority of these genes are involved in apoptosis [61, 95-97]. Additionally, cell cycle regulators
CDKN2A (p16INK4), CDKN2B (p15INK4) [98-100]; and prognosis markers ZAP70,
TWIST2 are also found methylated in CLL patients [101, 102]. Although in vivo transgenic or knockout mouse models of these putative CLL regulators are lacking, current evidence suggests that aberrant DNA methylation may be involved in CLL pathogenesis. A global epigenetic study on different stages of patients might help understanding the mechanism of disease transition from early to advanced disease.
15 1.2.3 MicroRNA regulation
MicroRNAs (miRs) are regulatory genes that can target mRNAs and in this way further alter gene expression by regulating mRNA translation or mRNA decay.
MicroRNAs are transcribed from genomic DNA, and the expression is time- and tissue
restricted [103]. Although very little is known about the regulation of microRNA
transcription, a recent publication suggests that DNA methylation of CpG island within
the 5’ coding region of microRNAs might repress the expression [104]. The newly
transcribed microRNA is called primary microRNA, which then undergoes maturation by
binding with Drosha in the nucleus. A hairpin structure RNA with the length of 70-100nt
(so-called precursor RNA) is then exported into the cytoplasm, where the processing
enzyme Dicer cuts and produces a mature single stranded microRNA. The mature
microRNA binds usually to the 3’ untranslated region of a target mRNA which has high-
homology but usually does not completely match the complementary sequence. Finally,
microRNA directed RNA-induced silencing complex (RISC) either mediate mRNA
decay or translational repression (Figure 4) [105].
16 CH 3
Pri-miRs X Drosha
Pre-miRs Nucleus
Cytoplasm Dicer
RISC
ORF RISC
Translational Target mRNA repression cleavage
Figure 4. Chromosomal aberrations lead to loss of microRNA. CpG island
methylation and chromosomal deletion might activate oncogene expression by the loss of
microRNA transcription.
The global expression pattern of microRNA in CLL has been studied by microarray
screening. The results from over 100 CLL patients indicate that the expression levels of
13 microRNA can associate with disease prognosis, using markers of ZAP-70, del13q14 and IgVH mutation [106, 107]. Notably, two of the 13 microRNA signatures, miR15 and
miR16 are transcribed from chromosome 13q14, one of the most frequent deleted regions
in CLL. The deleted or lower expression of miR15 and 16 in CLL have been suggested as
the molecular mechanism for increased expression of target BCL2, an anti-apoptotic 17 gene highly expressed in CLL patients [108]. The increased expression of oncoproteins
TCL1A, ERK have also been proven to be regulated by the loss of miR29 and 181 or
miR 143 and 145 in CLL, respectively [109, 110]. Moreover, a recent study found in lung
cancer, one of the targets of miR29s is de novo DNA methyltransferase, DNMT 3A and
3B [111]. Together with the low-expressed miR29s in CLL [107], an increased de novo
DNA methylation might occur in CLL cells.
1.2.4 Epigenetic therapy
DNA demethylating drugs and histone deacetylase inhibitors are the two major
epigenetic treatment options available. The application of epigenetic therapy in CLL
patients is still limited. The demethylating drug Decitabine (5-aza-2’-deoxycytidine) is a
small molecule cytidine analogue which incorporates into DNA strand during replication.
The modified C5 on ring of Decitabine traps DNMT to prevent the recycling, the progeny cells are therefore hypomethylated, methylated putative tumor suppressor genes are reactivated, and cells undergo apoptosis [112, 113]. Thus, in order for proper Decitabine function, the treated cells have to proliferate. Also, the effect of Decitabine is transient, the aberrant event might be returned after removing the drug. Moreover, demethylation is global, there is evidence that shows that methylated genes of interest are not reactivated, which might be due to the reactivation of other negative regulators, such microRNAs
[104]. The advantage of DNA demethylating agents, however, is the low effective dose while the majority of re-activated genes are potential tumor suppressor genes which can boost drug effect.
18
Both HDAC class I (HDAC1, 2, 3 and 8) and class II (HDAC6) are expressed in CLL
[114]. Previous reports indicate TRAIL-induced apoptosis is through the inhibition of class I but not class II HDAC, suggesting a better cytotoxicity effect of class I HDACi
[114]. Published HDACi trials in CLL include Class I HDACi: MS-275 [115],
Depsipeptide [116-118], Valproic Acid [119], Romidepsin [116]; and broad HDACi
Belinostat (PXD101) [116, 120], OSU-HDAC42 [121, 122]. Each HDACi has a functional group that can bind to the zinc catalytic domain of the HDACs and further inhibit enzymatic activity. Like other cancer types, the outcome of HDACi treatments on
CLL patients is not only the accumulation of histone acetylation, but also cell death.
Figure 5 lists the mechanisms of HDACi induced cell death in CLL including acetylated and activated p21 induced cell cycle arrest [117]; caspase dependent apoptosis [116,
119]; and cell death by blocking NFκB pathway through blocking the degradation of
IKB, or blocking HDACI-p65 mediated transcription repression [116].
19 Cell cycle arrest
Cyclin D Cdk4 IKBα
p21 p65 p50
IKK HDAC inhibitors Truncated Bid P
Caspase 8 IKBα
IK p65 p50 B α
Bcl-2 / Bax P Bid
Ac Caspase 9 Pro-caspase 9 p65
Caspase 3 Pro-caspase 3 HDAC Apoptosis p65 X
Figure 5. Summary of HDACi induced cell death in CLL. Caspase-dependent apoptosis (left) and anti-NFκB pathway mediated cell death (right) have found in HDACi treated CLL (red lines indicate the targets of HDACi).
1.3 Genetic alterations in CLL
1.3.1 Stage-dependent chromosomal abnormalities
Over 80% of all CLL patients have chromosomal abnormalities, including deletion of
13q14 (55%), 11q22 (18%), 17p13 (7%), 6q21 (6%) and copy number gains on 20 chromosome 12q13 (16%), 8q24 (5%) and 3q26 [123]. Among these, many can be used
as stage-independent prognosis markers. However, little is known about the cytogenetic
signature in early stages of the disease until recent [124, 125]. Several articles on Binet
stage-A, untreated CLL patients found high percentage early stage patients also have
chromosomal abnormalities. The common genomic aberrations such as trisomy 12,
del11q22, del17p13 and del13q14 were found by both groups. In addition, novel findings
of deletions on chromosome 5q, 6q, and Xp were also found frequently occur in early stage patients [125].
Interestingly, chromosomal del13q14 positive patients tend to have clonal expansion
[18] but the cytogenetic abnormalities change during the stage transitions. The early stage
patients were found tend to have good prognostic markers (17p and 11q-), but during the
clonal expansion, chromosomal aberrations sigatures in the same patiens changed to poor
prognostic markers (13q- and trisomy 12), the reported frequency is 27.8% (5/18) [126].
The new acquisited chromosomal abnormalities such as additional copy number gains on
5q and 11p when disease progressed was also observed [125]. While chromosomal abnormalities change during the progression of the disease, Microarray studi identified 58 genes with different expression patterns between the initial and advanced stages of the progressed patients. Changed genes include increased expression of cell cycle or cell
growth regulators, and down-regulated inhibitors of cell adhesion and motility. But no further validation has been pursued [125].
21 1.3.2 Genetic aberrations in signaling pathways
Three pathways, TCL1, TNF/NFκB and BCL2 induced apoptotic pathway have been suggested involved in CLL pathogenesis. As a single gene, within several genes that have been tested, only TCL1 over-expressed mice develop CLL [127, 128]. TCL1 is a 14KD protein, with the β-barrel structure and planar regions for protein-protein interactions that it folds into an eight stranded [129]. TCL1 protein has at least two separate domains, one allows the homodimerization and another interacts with AKT [130, 131]. The interaction between AKT and TCL1 activates the AKT kinase. The phosphorylated AKT activates downstream targets including IKKα-NFκB pathway, suggesting further triggered cell proliferation and survival [132]. However, the evidence of an activated AKT pathway in
TCL1 transgenic CLL mouse model is still absent. The only indirect evidence was shown by the mTOR inhibitor Rapamycin treated TCL1 cells transplanted into wild type mice, where some improvement but no cure of disease was observed [133].
Up-regulated BCL2 mediated by loss of miR15/16 in the early stage patients with del13q14 suggests that the anti-apoptotic gene BCL2 may contribute to CLL pathogenesis. BCL2 is a member of a family including pro-apoptotic (i.e. Bax, BAD and
Bak) or anti-apoptotic genes (i.e. BCL2, BCL-xL, BCL-w). BCL2 proteins can inhibit the release of cytochrome C into cytosol; further inhibit caspase 9 and caspase 3-induced apoptosis (Figure 5). BCL2 single transgenic mice do not have phenotype [134], but double transgenic TRAF2DN/BCL2 mice develop leukemia similar to CLL [123]. TNF- receptor associated factor 2 (TRAF2) is an adaptor protein binds to TNF receptor and
22 activate NFκB pathway. The findings of TRAF2DN/BCL2 double transgenic mice suggest an important role of the cooperation between BCL2 and TNF-dependent NFκB
pathway in CLL pathogenesis.
NFκB pathway in CLL has been suggested stimulated by activated CD40
lingand/CD40, VEGF/VEGFR2, BAFF/APRIL and TNF/TNFα-R mediated signals [135,
136]. NFκB is a family of transcription factor with five members: p50, p52, p65 (or
RelA), RelB and c-Rel. p65 (RelA), RelB and c-Rel have a transctivation domain in the C
terminal that can activate transcription of target genes. P50 and p52 are the cleavage
products from p105 and p100. The process of p100 cleavage to generate p52 is regulated
by the stimulation of BAFF/APRIL, while the producing of p50 from p105 is
constitutive. P50 and p52 subunits do not have transactivation domains, but they can
form homodimers or heterodimers with p65, RelB or C-Rel. The outcome of activated
NFκB pathway leads to cell proliferation or survival by the induced expression of a
variety of target genes in CLL include survivin, Bcl-2, and XIAP [137, 138].
1.3.3 Drug targeting and apoptosis
While several anti-apoptosis or anti-proliferation genes have been identified that can
be targeted with drugs, these strategies have only rarely demonstrated success. This
likely relates to several causes including 1) multiple genes being disrupted in the CLL
leukemia cell clone; 2) absent target modulation by the drug in the tumor cell; 3) rapid
transport of the drug out of the CLL cell; and 4) pharmacokinetic properties in vivo that
23 prevent effective dosing. BCL-2 represents an outstanding target for CLL yet targeting
this with Oblimersen Sodium (Bcl-2 antisense) in combination with fludarabine and
cyclophosphamide was pursued in the phase III study of relapsed CLL. The addition of
Oblimersen Sodium slightly improved remission rate but did not improve progression-
free or overall survival for the entire study group [139, 140]. Similarly, the proteaosome
inhibitor Bortezomib that blocks the degradation of IκB thereby trapping NFκB subunits
in the cytoplasm was found to have minimal activity in CLL patients. Both of these
agents had pharmacologic features of either not being able to get into the CLL cell
(oblimersen sodium) or high plasma protein binding that prevented its release into the
cell. Additionally, these trials did not determine if the target in the CLL was modulated
thereby preventing differentiation of target failure versus pharmacologic failure.
Another drug called flavopiridol that actively influences an important target (MCL-1) and
promotes apoptosis was successfully applied to the clinic by considering both
pharmacologic and target optimization [141, 142]. This same approach must be applied
to epigenetically targeted therapy.
1.4 CLL mouse models
Three mouse models have been developed to study the pathogenic mechanisms leading to CLL. These mouse models of disease could represent a better opportunity to study early events in transformation. Double transgenic TRAF2/BCL-2 mice die at 6-14 months with expansion of malignant B220+CD5+ cells, but whether these cells can be transplanted for drug study is still uncertain [123]. New Zealand Black (NZB) mice
24 develop spontaneous autoimmunity disease and B cell lymphoproliferative disorder when
mice are aged [143]. Similar to human CLL cells, a germline mutation in miR16 and
mutation of region orthologous to chromosome del13q14 have also been observed in
NZB mouse model B cells [108, 144] [145]. The importance of TCL1 in CLL
pathogenesis is best exemplified by the Eµ-TCL1 transgenic mouse model, where initial
expansion of non-clonal B1 lymphocytes with eventual transformation to a mature B-cell leukemia with an immunophenotype characteristic of human CLL is seen [146]. With disease progression, enlarged lymph nodes, spleen, liver and elevated blood lymphocyte counts are noted with body dissemination of leukemia ultimately resulting in death at a median of 11 months [146, 147]. Characterization of murine TCL1 leukemia cells demonstrate uniform occurrence of unmutated IgVH status, over-expression of MCL-1,
and abnormal expressed murine microRNA genes mmu-miR-15a and mmu-miR-16-1
similar to what has been described in human CLL [146, 148, 149].
25
CHAPTER 2
EPIGENETIC CHANGES DURING CLL PROGRESSION IN THE TCL1 TRANSGENIC MOUSE MODEL
2.1 Background
A better understanding of especially early molecular events in malignant
transformation should help to improve the development of novel therapies.
Unfortunately, limited studies of the early events leading to development of CLL have
been pursued, in part due to absence of a well defined precursor state of this disease.
While the recognition of a precursor disease of CLL called monoclonal B-cell lymphocytosis (MBL) [150] has recently been reported and classified, its occurrence is isolated to 3-5% of the population over the age of 60 and has only a 1-2% frequency per
year of progressing to symptomatic CLL. MBL B-cells are virtually all IgVH mutated and
lack unfavorable interphase abnormalities relevant to CLL. Thus, MBL does not
represent a good precursor model of IgVH un-mutated CLL. MBL also lacks full disease 26 phenotype expression, and is very difficult to study due to small cell numbers present
[151]. Studies of changes in early stage CLL cells (Rai stage-0 or Binet stage-A) are still
limited as well. The majority of early stage CLL patients have chromosomal
abnormalities including del13q14 and trisomy 12, mutated IgVH, low ZAP70, and rare p53 mutation [124, 125], suggesting that genetic and epigenetic changes might be involved in CLL pathogenesis. Indeed, aberrant DNA methylation has been found involved in both familial and sporadic CLL as well as mouse CLL [61, 94, 95, 127], but no epigenetic study has been done on early stage patients or early stages in CLL mouse models. However, while miR29s, and miR29 regulated TCL1 both have been found associated with disease progression, suggests the aberrant epigenetic changes might be involved in CLL disease transition [106].
As the only found single gene transgenic mouse model that develops CLL, TCL1 is
not expressed in mature B cells, but overexpressed in almost all CLL patients. Relative low TCL1 in indolent CLL and high TCL1/ low miR29s in aggressive CLL further support the potential function of TCL1 involved in the progression of CLL [110, 152].
Notably, Eµ-TCL1 mice do not develop the disease until 7-10 months (the timing of
elevated white blood cell counts), even though AKT or other downstream pathways of
TCL1 are also involved in other cancer types that develop diseases in a very short time,
such as acute myeloid leukemia and acute T cell leukemia [153, 154], suggests that other
factors or pathways might be involved in the disease progression. Supporting evidence
published recently demonstrates frequent global aberrant DNA methylation in B and T
cells transgenic TCL-1 mice [127].
27
In the present study, we investigate the timing and molecular mechanisms leading to
aberrant DNA methylation in the TCL1 transgenic mouse model. We demonstrate that
the mouse model recapitulates the DNA methylation changes seen in CLL patients and
that these events represent an early step and accumulating process in leukemogenesis.
Moreover, we provide evidences of the deregulated miR29 family and de novo DNMTs levels as a potential mechanism leading to increased aberrant DNA methylation during the process of CLL development.
2.2 Material and methods
Mouse experiments, tissue preparation
Wild type and homozygous TCL1 transgenic mice (both C3H/B6 background) were kept in a sterile environment with sterile water and food supply. Three to five transgenic mice at 3, 5, 7, and 9 month old were used. Another group of mice was sacrificed when they became visibly ill (n=5, >11 month old). For the control mice, three wild type mice at 4,
8 and 11 month of age were used. Spleen cells from each mouse were used for DNA and
RNA isolation or B-cell selection. CD19+ B cells were isolated by Ficoll density gradient centrifugation and magnetic-activated cell sorting (MACS) beads using LS columns
(Miltenyi Biotec, Auburn, CA).
Patient samples
28 Two sets of patient samples were used for this study. To correlate gene expression and
methylation, samples from 30 CLL patients with mutated or unmutated IgVH phenotypes
were used to purify DNA and RNA. For DNA methylation analysis, additional 70
samples form CLL patients were used. CD19+ B cells and peripheral blood samples
(PBL) were obtained from healthy donors. Peripheral blood samples were obtained from the Ohio State University, using IRB approved protocols. All patients had NCI criteria defined CLL [155].
Cell lines and 5-aza-2’-deoxycytidine treatment
Jurkat, Raji and WAC3CD5 cells were incubated in RPMI 1640; and K562 cell line was incubated in IMDM with 10% heat-inactivated fetal bovine serum2 mM L-glutamine, penicillin (100 units/ml), streptomycin (100 µg/ml) (Invitrogen, Carlsbad, CA).
WAC3CD5 cell line has been described as CLL cell line with confirmed CD19, CD20,
CD23, and CD5 antigen expression, del(13q14), and a slow proliferation rate similar to primary CLL samples [156] [94]. For decitabine (5-aza-2’-deoxycytidine, 5aza-dC) experiments, the Raji cells were treated with 0.5µM 5aza-dC (Sigma, St. Louis MO) for
3, 6, 9 and 12 days; and WAC3CD5 cell line was treated with different doses (0 to 5 µM) of 5aza-dC for 3 days.
DNA and RNA isolation
High-molecular weight genomic DNA from tissues was isolated using previously published protocols for RLGS analysis and sodium bisulfite treatment [157]. Plasmid
DNA was obtained by QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). RNA was
29 isolated by Trizol (Invitrogen) following manufacturers’ recommendations and protocols.
DNA from cell lines was isolated from the Trizol phase following RNA extraction as describe in the manufacture’s recommendations.
Bisulfite sequencing, COBRA and MassARRAY analysis
Genomic DNA was sodium bisulfite treated as described previously [158]. The bisulfite treated DNA was amplified by the condition which can not amplify the untreated DNA.
After purification with the QIAquick gel extraction kit (Qiagen), the PCR products were digested by enzymes detecting a difference in the methylated and unmethylated sequences following bisulfite conversion. The digestion products were separated on 8% acryamide gel. For the quantitative DNA methylation assay, MassARRAY system
(Sequenome, San Diego, CA) was preformed as previously described [159]. In brief, sodium-bisulfite treated DNAs were PCR amplified, in vitro transcribed, cleaved by
RNase A, and then analyzed by matrix-assisted laser desorption ionization-time of flight
(MALDI-TOF). The quantitative data was converted and presented in color for easy visualization using the Multiple Experimental Viewer software (MeV) [160]. Primer sequences are listed in Table 5.
RLGS analysis
RLGS and RLGS analysis were done as previously described [161, 162]. Following the elimination of the age-dependent methylation differences and polymorphic spots a total of 1,491 RLGS fragments were analyzed in each RLGS profile. The age-dependent changed RLGS fragments were determined by the comparison of profiles of wild type
30 C3H/B6 mice at 4, 8 and 11-month old of ages. The polymorphic spots were identified by
the comparison of the profiles of wild type C3H and B6 mice. The RLGS profiles from
spleen samples of Eµ-TCL1 mice at 3 and 5 month of age were compared with the
profiles of spleen samples from 4 month old wild type mice. The profile of an 8 month
old wild type mouse was used for comparison with profiles from 7 and 9 month old Eµ-
TCL1 mice. For the group of sick Eµ-TCL1 mice (>11month old), the profiles of 11
month old wild type mice were used for comparison. For the RLGS analysis on the
isolated splenic B cells, except for the sick mice, two groups of combined isolated B cells
from three TCL1 or age-matched wild type mice were used to generate RLGS profiles.
Southern and Western analysis
Southern blotting was performed as described [157]. Briefly, for the hypomethylation study, genomic DNA from different groups of mice and patients were digested with MspI or HpaII restriction enzymes overnight, 3µg digested DNA from each sample was loaded on a 1% agarose gel. Samples were then separated by gel electrophoresis at 35V overnight. After vacuum transfer, the membranes were hybridized with the probes of intracisternal A particle (IAP) or centromeric repeat sequences (CMS) [73]. Mouse IAP,
CMS and human LINE1 probes were prepared by PCR amplified (IAP Forward primer
5’CGTCATTGTTCAGAGCCAGA3’ and Reverse primer: 5’TCCCGGAAACTTT-
TGTTCAC3’; CMS Forward primer: 5’GATAAAAACCTACACTGTAG3’, Reverse:
5’GTTTCTAATTGTAACTCATTG3’; LINE1 forward CGGGTGATTTCTGCATTTCC and Reverse primer: GACATTTAAGTCTGCAGAGG). Western blot analysis was performed as previously described. The primary antibodies used for Western were anti-
31 Foxd3 (Millipore, Bedford, MA), anti-TCL1 (MBL international Inc., Japan), anti-
DNMT1, DNMT3A and DNMT3B antibody (Santa Cruz Biotechnology, Santa Cruz,
CA) or anti-α-tubulin antibody (Oncogene Science, Manhasset, NY). The protein expression pattern was detected by a chemiluminescent detection system (Amersham
Pharmacia Biotech, Piscataway, NJ).
SYBR green and TaqMan real time PCR
RT-PCR was performed as described previously [95]. Briefly, 1 µg of total RNA was used for reverse transcription using SUPERSCRIPTTM First-Strand Synthesis kit
(Invitrogen). SYBRgreen real time PCR was done in duplicates with IQ SYBR Green
Supermix (Bio-Rad, Hercules, CA) in a BioRad icycler. The expression data was obtained by subtracting cycle number at which the fluorescent signal first exceeds the threshold of the internal control (GAPDH for mouse or GPI for human samples) from the value of the target gene. For the analyses of miR29 expression, we used TaqMan RT-
PCR as described by the manufacturers (Applied Biosystems, Foster City, CA). Primer sequences are listed in Table 5.
Cluster analysis and statistical analysis
Hierachical cluster analysis of samples was performed by applying phi-correlation [163] similarity metric with compact linkage method, using all the spots with at least one methylation (1491 spots) across samples. For the statistical analysis, comparisons of 2 groups were performed by using non parametric Wilcoxon rank sum test [164] and
32 student t-test. Trend in methylation over time was evaluated by the Jonckheere-Terpstra test [164]. All the analyses were performed by R 2.5.1 statistical program (http://www.r- project.org/) and EXCEL. Bar plots were developed by using mean ± SEM of respective data.
2.3 Results
2.3.1 DNA methylation patterns in TCL1 transgenic mice
Human CLL samples have been characterized by a severe epigenetic defect resulting in loss of 5-methycytosine and aberrant silencing of genes. In order to establish the Eµ-
TCL1 transgenic mouse model of CLL for epigenetic questions, we examined global
DNA methylation profiles from leukemia cells of mice with symptomatic disease (>11 month old) using Restriction Landmark Genomic Scanning (RLGS) analysis. RLGS provides an unbiased and quantitative screen for CpG island methylation [157]. Analysis of DNA isolated from spleens of age matched wild type mice with the same genetic background were used as controls (see Figure 6A for examples). After eliminating 522 polymorphic fragments and 6 age-dependent methylation events, a total of 1491 RLGS fragments were scored in 5 CLL samples. We found an overall increase in DNA methylation in the TCL1 spleen cells with symptomatic disease, ranging from 2.5% to
5.5% of all evaluated RLGS fragments. These frequencies of promoter methylation are comparable to the frequencies previously reported for human CLL (2.5-8.1%) [94].
Table 3 provides the list of methylated RLGS fragments in the TCL1 transgenic mice.
33 Furthermore the patterns of aberrant methylation are unique to this mouse model as demonstrated in a comparison to aberrant methylation patterns reported for the mouse model of T/natural killer acute lymphoblastic leukemia [96] and a mouse model of lymphoma [165] (Figure 6B).
Eight genes were chosen for quantitative DNA methylation analysis on 67 human
CLL patient samples by MassARRAY analysis. For seven off these genes a number of
CLL samples showed significantly elevated levels of DNA methylation as compared to normal CD19+ B cells and peripheral blood cells (P<0.05) (see Figure 6C and 6D).
Taken together, this data establishes that aberrant DNA methylation patterns in Eµ-TCL1 mice recapitulate epigenetic changes in human CLL including the targeting of orthologous genes in mouse and human.
2.3.2 Aberrant DNA Methylation is an early event in Eµ-TCL1 B-cells
We next sought to determine of the earliest time point for aberrant promoter methylation in cells from Eµ-TCL1 mice. Using splenic cells from 3, 5, 7, and 9 month old mice we were able to demonstrate aberrant methylation as early as 3 months of age.
Interestingly, the frequency of altered DNA methylation significantly (P= 4.701e-06) increased over time from 0.4%, 0.6%, 1.2%, 1.9% (3, 5, 7 and 9 months respectively).
The Eµ-TCL1 lymphocytes at 10-14 months with symptomatic CLL had the highest degree of methylation (3.9%) (Figure 7A). In addition, consistent with a previous report of an infrequent occurrence of age-dependent changes in CpG island methylation [75],
34 we found only minor age-dependent changes in wild type control mice, indicating that the
increased frequency of DNA methylation is not age-dependent (Figure 7B).
In order to assure that the DNA methylation changes described are occurring in B-
cells, we performed RLGS analysis on purified CD19+ B cells from CLL mice as well as
combined B cells from three to five age-matched wild mice and young Eµ-TCL1 mice
(≤7 month old). Similar to the splenic cells selected CD19+ Eµ-TCL1 B-cells also
showed increased aberrant DNA methylation frequency over time from 0.3% (1 month),
1.0% (5 month), 1.8% (7 months), and 3.8% to 5.2% in mice with symptomatic disease
(>11 months). Total 147 RLGS fragments identified as hypermethylated in at least one
sample at one or more time points.
MassARRAY analysis was then performed to validate the early aberrant DNA
methylation in Eµ-TCL1 B-cells. Consistent with RLGS data, early methylated genes
(Sox3, EphA7, Pcdh10 and Gpc6) and late methylated genes (Dlx1 and Dapk1) were
confirmed (Figure 7B; P<0.05). To check whether the methylated genes are
transcriptional silenced, the expression of early methylated genes were analyzed by real-
time PCR. Reduced Sox3 expression was detected in almost all the Eµ-TCL1 mice, and
the expression of Gpc6 was about 50% reduced in all the sick CLL mice (Figure 7C).
Gene expression in cell lines with methylated promoter sequences can be restored by
treatment with demethylating agent 5-aza-2’-deoxycytidine (5-aza-dC) (Figure 7D;
P<0.05). Notably, the previously reported human putative tumor suppressor genes for
35 CLL including Dapk1 and Id4 (data not shown) are methylated only in the Eµ-TCL1
mice with symptomatic disease.
2.3.3 Progressive Hypomethylation of Repetitive DNA elements in Eµ-TCL1 B-cells
Previous tumor studies reported concurrent with the gene-specific CpG island hypermethylation, an overall decrease in 5-methylcytosine levels arising from hypomethylation of normally methylated repetitive elements might also contribute to tumorigenesis [166]. Thus we analyzed whether global hypomethylation is occurring in the CLL cells of Eµ-TCL1 mice. The proviral sequences related to the intracisternal A particle (IAP) and centromeric repeat sequences were used as the probe for methylation analysis on the repetitive sequences by Southern blot. After the comparison of HpaII and
MspI digests of DNA, we found that IAP (Figure 8A) and centromeric repeat sequences
(Figure 8B) were heavily methylated in 4 and 11 month old wild type C3H/B6 mice; but hypomethylated in Eµ-TCL1 mice from 7 and 9 month old as well as CLL mice.
Moreover, hypomethylation of LINE1 repeat elements is also increased in comparing of primary untreated and relapsed CLL patients (Figure 8C). Of note, global hypomethylation becomes most frequent with disease progression from early stage CLL to chemoimmunotherapy refractory-CLL. The summarized results from ImageQant of each blot are shown in Figure 8D.
36 2.3.4 Increased DNA methyltransferases and decreased microRNA 29 in Eµ-TCL1
mice
To investigate whether the increased aberrant DNA methylation noted in Eµ-TCL1
mice might be due to either maintenance (DNMT1) or initiating (DNMT3A and 3B)
DNA methyltransferase levels, we examined mRNA expression of these enzymes in
CD19+ splenocytes from Eµ-TCL1 and wild type control mice at 3, 5, 7, 9, and 11-14
months. No significant changes were noted (data not shown). In contrast, examination of
protein expression levels of DNMT3A, 3B and DNMT1 from Eµ-TCL1 and wild type
control B-cells demonstrated an increased DNMT3A and DNMT3B protein level in Eµ-
TCL1 mice, starting from spleen B cells of 1 month old mice. DNMT1 protein levels in
Eµ-TCL1 B-cells do not change over time (Figure 9A). These data suggests a post- transcriptional regulation of DNMT3A/3B. To investigate whether the increased
DNMT3A and DNMT3B protein levels in Eµ-TCL1 B-cells are due to decreased
miR29s, the expression levels were examined. Diminished expression of miR29B and
miR29C but not miR29A was noted at 5 and 7 months corresponding to the increased
DNMT3A and DNMT3B protein expression in line with the assumption of a direct
regulation (Figure 9B).
2.4 Discussion
Herein we have demonstrated the genesis of epigenetic gene silencing that occurs in
the Eµ-TCL1 model of CLL as an early event, accumulated aberrant DNA hyper- and
37 hypo- methylation are observed in both Eµ-TCL1 model and CLL patients. The accumulation was only seen in CLL, but not in wild types with increased age. Notably, the frequency of DNA methylation was specific to the Eµ-TCL1 model of CLL.
Surprisingly, the overall patterns of altered DNA methylation in the TCL1 murine mouse model of CLL recapitulates what was subsequently shown to occur in the human disease and thus allowed us to investigate disease progression in this mouse model. The dramatic increase in aberrant DNA methylation noted at 5-7 months corresponded to onset of decreased miR29A, miR29B, and miR29C and increased de novo DNA methyltransferase
3A and 3B.
Patients with genetic alterations of unmutated IgVH, del17p13 and higher ZAP70 have been found prone to have clonal evolution, suggesting the cytogenetic abnormalities might contribut to the disease stage transition [18, 125, 126]. While TCL1 expression correlates with CLL progression and TCL1 transgenic mice model is considered as an aggressive CLL mouse model with un-mutated IgVH status [148], the changes involved in the onset of disease in Eµ-TCL1 mice may represent the required extra event for the disease to progress.
Here, instead of screening genetic abnormalities at early stage of Eµ-TCL1 mice, we performed a global epigenetic study. The common chromosomal aberrations observed in overall 80% CLL patients including inherited familial CLL and early stage CLL suggests global hypomethylation may have triggered genome instability and mutation at a very early stage. Indeed, with the probe of repetitive sequences in both human and mouse
38 CLL, we observe hypomethylation in 3 and 5 month old Eµ-TCL1 mice, as well as early
stage patients, but the change is very minor. Interestingly, significant increased level of
hypomethylation occurred in mice at 7 month, the timing of elevated white blood cell
counts in average, as well as the late stage patients. These findings suggest an
accumulation global hypomethylation that may produce chromosomal instability in both
human and mouse CLL; while global hypomethylation has found able to induce
tumorigenesis in the mouse model [92], our data suggest global hypomethylation might
be involved in CLL pathogenesis.
Excitingly, the very early change we found in Eµ-TCL1 mice is the expression of de
novo DNA methyltransferase 3A and 3B at 1 month of the age. A significant increased
expression of both de novo DNMTs during the progression of disease was found in Eµ-
TCL1 mice but not in aged wild type mice demonstrates an accumulated aberrant DNA methylation might occur in the Eµ-TCL1 mice. Moreover, support previous finding of
regulated DNMT3A and 3B by miR29 family members, we also found a nice correlation
of decreased miR29B and C with disease progression, although the regulation of DNMTs
by miR29s in B cells still has to be confirmed.
By using RLGS analysis, a highly-reproducible technique that can screen more than
3,000 CpG sites, most within CpG islands in the genome at once [167], we demonstrate
the aberrant DNA methylation as an early even in Eµ-TCL1 mice. The confirmed early
changed genes were Sox3, EphA7, Pcdh10, Gpc6 (Figure 7) and Foxd3 (data not shown).
All of these genes were found methylated at 5 month in the RLGS results from TCL1
39 spleen unselected and selected B cells. Expression of Foxd3 and Sox3 transcription
factors is required for normal development [168]. EphA7 was suggested involved in ERK
phosphorylation in human acute leukemia [169]. The function of Gpc6 is unclear, but
Glypican family members have been found involved in both cell growth regulation and tumorigenesis [170]. Moreover, Pcdh10 has also been found regulated by epigenetic changes, it’s role as a tumor suppressor gene has also been suggested in nasopharyngeal, esophageal and multiple other carcinomas with frequent methylation [171]. Interestingly, several methylated genes in Eµ-TCL1 mice such as Axin1, have been suggested involved in WNT signaling pathway [172]. While the altered WNT signal targets have been found in CLL patients [95], our data suggest an activated WNT signal pathway might also occur in Eµ-TCL1 mice, but further confirm is required.
In addition to Axin1, many putative tumor suppressor genes that have been found
methylated or silenced in CLL patients are also methylated in Eµ-TCL1 mice. ID4 and
DAPK1 have been found methylated in human CLL [61, 96]. The role of mutated DAPK1
in familial CLL has also been established. Interestingly, both Id4 and Dapk1 methylation
was found in the majority of the mice at late stage of the disease. In addition to the
known genes, we tested whether Eµ-TCL1 mice can recapitulate methylation changes in
CLL patients by investigating the methylation status of additional nine novel genes that
are methylated in Eµ-TCL1 mice. Except SPRY2, all other 8 genes are highly methylated
with high frequency in CLL patients, including FOXD3. Overall, our findings suggest
that the TCL1 mouse model can represent the epigenetic changes in CLL patients.
40 Moreover, the aberrant DNA methylation in Eµ-TCL1 mice is accumulated during
the progression of the disease. This finding correlates with the increased DNMT3A and
DNMT3B. Combine with miR29B and C expression profiles in Eµ-TCL1 mice, our
results suggest that deregulated miR29B and C during the process of disease development
might lead to the activation of de novo DNA methyltransferases. The deregulated
DNMT3A and DNMT3B might trigger global CpG island hypermethylation and lead to
the accumulation of aberrant DNA methylation in Eµ-TCL1 mice. Interestingly, a
previous study indicates that DNMT3A and 3B are essential for the self-renewal of
hematopoietic stem cells [173]. While CD38+ cells have been suggested as proliferating
cells in CLL [6], whether deregulated DNMT3A and DNMT3B lead to uncontrolled cell proliferation in CLL needs further investigation.
Here we present the first report showing methylation and silencing of genes at different time points during the development of murine CLL that bears significant relevance to what is observed in human disease. This supports the fact that the CLL mouse model is extremely helpful in identifying the genes that may have causal role in the onset of disease. The aberrant DNA methylation was found as an early and disease- dependent accumulated event, suggesting multiple hits might be required for CLL progression. Since the epigenetic-based therapy with demethylation agents is currently under development, identifying genes that are silenced in CLL due to promoter methylation and elucidating their function is necessary to develop improved targeted therapies. Given the potential observation of progressive global hypomethylation of
41 repeated DNA elements with disease progression, a change in paradigm to “promoting global methylation” may be warranted.
2.5 Acknowledgements
The work was supported by Leukemia Lymphoma Society, Chronic Lymphocytic
Leukemia Research Consortium (CRC) and National Cancer Institute (NCI). The authors thank Dr. Carlo Croce for kindly offered TCL1 transgenic mice, Dr. Sandya
Liyanarachchi and Dr. Ramana Davuluri from Davuluri’s group for the help of cluster analysis. Thank you to the members of both Plass lab and Byrd lab for thoughtful discussions.
42
Eu- 3 5 7 9 >11 Chb Contextc Gene of CpG TCL1 mo mo mo mo mo Homology Islandd micea
1C11 1D19 2B11 19 5’end Cdk2ap2 Y 2B26 2D27 2 5’end Snx5 Y 3F19 5 5’end Zfp326 Y 3F70 14 5’end GPC6 Y 4D25 4D53 4F01 13 5’end BY715663 Y 4F31 5B17 11 body 1500004A08Rik Y 1C07 1D15 2 5’end Wdr5 Y 1E19 4 5’end AK032132 Y 2B31 10 5’end BC079845 Y 2C09 4 5’end Foxd3 Y 2D47 18 5’end AK147279 Y 2E22 2E37 17 5’end AK041052 Y 2F37 X 5’end Sox3 Y 3D03 2 5’end Fign Y 3D10 5 5’end Cpeb2 Y 3D26 3E25 3F33 6 5’end Egr4 Y 4B13 4D57 4 5’end Epha7 Y 4F32 4F81
Table 3. Characteristics of methylated NotI fragments in TCL1 transgenic mice spleen cells 43 Table 3. Continue
5C24 5C30 13 5’end Gas1 Y 1D06 13 5’end Phf2 Y 1D16 7 5’end Zfp537 Y 2B17 8 5’end Irx5 Y 2B21 13 5’end Adarb2 N 2C14 2C33 13 5’end Gas1 Y 2C35 9 5’end AK135132 Y 2D26 2D40 2E25 17 5’end AF176529 Y 2E45 2F85 13 5’end Foxc1 Y 3C17 3D07 3 5’end Tspan5 Y 3E06 3E11 9 3’end BC042784 Y 3E47 3E75 14 5’end Cacna2d3 Y 3F09 3 5’end Pcdh10 Y 3F15 3F30 3F39 3F56 12 5’end Foxg1 Y 4B03 12 5’end Yy1 Y 4B22 5 5’end AK147478 N 4C21 4D40 4E27 9 5’end Rora Y 4E70 11 5’end Hic1 Y 5B27 10 5’end 6330407J23Rik Y 5D25 7 5’end Zfp537 Y
(Continue)
44 Table 3. Continue
6E07 2 5’end Stk39 Y 1D02 1D28 3 5’end Dcamkl2 Y 1E16 18 5’end CJ103567 Y 1E20 8 5’end Hapln4 Y 2B42 2C03 2C45 2D11 2D15 2D17 2E38 2 5’end Pkp4 Y 2E46 2F39 4 5’end AK044806 Y 2F44 3C15 8 5’end Tmem28 Y 3D28 12 5’end Tmem30b Y 3F14 2 5’end 2900006F19Rik Y 3F42 1 3’end Sox17 Y 4B42 3 5’end AK087060 Y 4D16 4D46 4D49 13 5’end Vmp Y 4E06 13 5’end Ptch1 Y 4E10 4E74 5B13 4 5’end Foxd3 Y 1D11 1D13 1D20 6 5’end Cast1 Y 2B07 3 5’end Bhlhb5 Y 2B38 2D07 9 5’end Ncam1 Y
(Continue)
45 Table 3. Continue
2D29 9 5’end Aste1 Y 2D41 17 5’end Axin1 Y 2E06 13 5’end Ssbp2 Y 2E18 2E34 18 5’end AK046456 Y 2G41 13 5’end Id4 Y 3C24 3C27 2 5’end Evx2 Y 3D22 4 3’end Cdkn2a N 3D67 3E13 19 5’end AK163590 Y 3E34 6 5’end Gpr27 Y 3F61 17 5’end Axin1 Y 4B11 2 5’end AK090153 Y 4C10 13 5’end Foxc1 Y 4D11 14 5’end Spry2 Y 4D24 4D26 10 Intergenic Intergenic Y 4D45 2 5’end Dlx1 N 4D47 10 5’end AK015334 Y 5B21 13 5’end AK151379 Y 5E24 10 5’end AK044134 Y 5E45 5E52 8 5’end AK004006 Y 6B03 6B05 6D20 4 5’end AK052809 Y
aRLGS profiles were generated from three 3 month old, four 5 month old, four 7 month old, four 9 month old mice and five mice at age older than 11 month old with symptomatic disease. bBLAT search results using February 2006 freeze. Chromosome location is given. Black to white square, 100%, 99-51%, 50%, 49-1% and no RLGS fragment loss. c5’ end, the NotI site is in the upstream of a known gene’s transcription start site; 3’ end, within the genomic structure of the known gene’s exons or introns. dAll sequences were analyzed for CpG isand characteristics with WebGene.
46
s changes in human CLL Eµ-TCL1 mice recapitulate
Figure 6. Specific aberrant DNA methylation pattern in Figure 6. Specific aberrant DNA methylation (continue)
47 Figure 6 (continue). A. RLGS analysis on CLL mice. Schematic representation of the section of RLGS profiles including RLGS fragments 3C24 and 2E38 (arrows) from a 13 month old TCL1 mouse and a wild type mouse at matched age. B. Hierarchical cluster analysis with 5 TCL1 CLL leukemia, 8 Myc T/NK cell leukemia and 8 IL15 T cell leukemia mice, using total 1,491 RLGS fragments that were found methylated in at least one of the samples. C. Quantitative result from MassARRAY analysis showing consistent methylation pattern in human CLL compare to that in mouse CLL (Axin1 and Dlx1, p- value= 0.047 and 0.002; the others have P-value ≤5.9e-7). D. Schematic representation of MassARRAY assay on 7 CD19+ B-cells, 4 peripheral blood cells (PBL) from normal donors; Raji, WaC3CD5 cell lines; and 67 CLL patient cells. Each square represents a CpG unit; each line indicates a samples. Heat map presents the quantitative methylation data from light yellow (0%) to dark blue (90%).
48
WT Pre-leukemia CLL 483579 M F M M M F M F M F M F 1 2 3 4 5 100%
Figure 7. Aberrant DNA methylation is an early event with increased frequency in TCL mice (continue).
49 Figure 7 (continue). A. Correlation between aberrant DNA methylation and CLL development in TCL mice. Left: Each dot represents data from one mouse. The frequency of aberrant DNA methylation is significantly increased overtime (P= 4.701e-06). Right: Average methylation at different timepoints in Eµ-TCL1 mice shows significant increase frequency compare to the wild type at matched age. P values are shown in the figure. B. MassARRAY results confirmed RLGS data. DNA from isolated CD19 positive B cells from two 3-month old and two 13-month old wild type mice; as well as two Eµ-TCL1 mice at each indicated timepoint were used. Amplicons for the analysis cover the region in CpG island near transcription start site. Eµ-TCL1 mice from early-stage (>5 month old) show significant higher methylated Sox3, EphA7, pcdh10 and Gpc6 genes in comparing with all the wild type mice (P<0.05). In contrast, Dlx1 and Dapk1 only show significant higher-methylation in mice with symptomatic disease (P<0.05 Wilcoxon test). Star represents the average methylation frequency of amplicon in each sample. C. Expression of early methlated genes in Eµ-TCL1 mice. Isolated male TCL1 spleen B cells from different timepoints were used for SYBR-Green real time PCR. Expression of two early methylated genes was investigated. Each bar represents average data with standard deviations from triplicate experiments from samples of two mice (*, P<0.05 Wilcoxon test). D. Re-activation of gene expression after 5aza-dC treatment. Re- activation of GPC6 was investigated by SYBR-Green PCR in 0.5µM 5aza-dC treated Raji cells as well as WaC3CD5 cell line treated with different dose of 5aza-dC for 3 days.
50
Figure 8. Elevated global hypomethylation of repetitive sequences in CLL (continue).
51 Figure 8 (continue). Genomic DNA of spleen cells from wild type and Eµ-TCL1 mice at indicated timepoints, or Eµ-TCL1 mice with symptomatic disease (n=5), was digested by MspI (M) and HpaII (H) restrication enzymes. A. The blots were hybridized with intracisternal A particle probe (IAP); B. The blots were then stripped and re-hybridized with probe of centromeric repeat sequences (figure B). MspI digested DNA was used as control. Undigested product of HpaII digestion represents methylated DNA, while only unmethylated DNA is HpaII digestible. C. HpaII and MspI digestion was applied on genomic DNA from CLL patient cells. Probe of LINE1 repetitive sequence was hybridized to each blot. D. ImmageQuant 5.1 was used for relative intensity of unmethylated versus methylated bands.
52 A
B
Figure 9. Decreased miR29s and increased DNMTs in Eµ-TCL1 mice (continue).
53 Figure 9 (continue). A. Western blot of DNMT1, 3A and 3B in early and late time- points of mouse CLL. Spleens from two 1-month old Eµ-TCL1 mice were combined for B cell isolation, while each sample from other timepoints used B cells from one mouse. 100ug cell lysates per lane was loaded. B. TaqMan PCR of miR29s in TCL1 mouse B cells. Each bar represents the average relative expression of miR29s from three mice at each timepoint normalized by data from untransformed TCL1 B cells from 1 month old mice. Standard deviation was calculated by using mean ± SEM of respective data. Two tail student T test was applied, star represents significant results with P value less than 0.05.
54
CHAPTER 3
EARLY SILENCING OF FOXD3 MEDIATES ABERRANT DNA METHYLATION TARGETING IN CLL
3.1 Background
Epigenetic mechanisms of gene deregulation have now been recognized as frequent
and early events during tumorigeneisis. This is also true for CLL where global gene-
specific aberrant DNA methylation in hundreds of genes has been reported [94].
Epigenetic silencing events in ZAP-70 or TWIST2 for example correlated with specific adverse risk factors including IgVH mutational status [101, 174], epigenetic alterations
have been found during the earliest steps of development of solid tumors including colon, lung and prostate cancer [175]. However, the precise mechanism of how altered DNA methylation is initiated in pre-cancerous or cancer cells remains unclear.
55 Elevated Dnmt3A/3B expression levels in Eµ-TCL1 (described in Chapter 2) can
only partially explain the increase in aberrant DNA methylation since only small subsets
of genes were found to be methylated. Thus additional mechanisms are required that
participate in the establishment of specific DNA gene methylation patterns. Several
reports indicate that certain DNA sequences are found to be more prone to de novo
methylation [176-179]. In addition, sequences containing oncogenic transcription factor
binding sites can be silenced by the transcription factor based recruitment of DNA
methyltransferases and other co-repressors to these sites [180-182]. However, in vivo
studies of Myc transgenic mice found a complete absence of aberrant DNA methylation
in the precancerous cells, suggesting that direct recruitment in this model system may not be occurring [165, 182].
An alternative mechanism based on the studies of colon cancer and breast cancer proposed that chromatin remodeling during the initial phases of gene silencing in cancer occurs prior to the DNA methylation and is a result of initial gene silencing [78, 183,
184]. The sequence-identified RLGS fragments in the well characterized mouse model of CLL show an overrepresentation of methylated and silenced transcription factors during disease progression (Figure 7). Thus one could propose that a large component of epigenetic silencing may occur through deregulation of transcription factors.
In the present study, we investigate the mechanisms leading to aberrant DNA methylation initiation and accumulation in the transgenic TCL1 mouse model and provide evidences suggesting that early loss of transcription factor Foxd3 as a
56 consequence of the TCL1 activated NFκB pathway leads to increased and non-random,
aberrant DNA methylation during the development of CLL.
3.2 Material and methods
Patient samples Rosette-Sep (Stem Cell Technologies, Vancouver, Canada) selected B cells from peripheral blood of health donors and CLL patients from the Ohio State University were used in this study: Sampeling was performed according to IRB approaved protocols. All patients had NCI criteria defined CLL [155].
Cell culture and drug treatments Jurkat, Raji and WAC3CD5 cells were cultured in condition described in chapter 2. Rosette-Sep selected normal and CLL patient cells were cultured in RPMI supplemental with 10% human serum at cell density 1x108 cells per ml. Drug treatment was applied on fresh cells at the day peripheral blood was received and processed. An 80%/20% (live/dead) cell ratio in these culture conditions was confirmed by Annexin/PI flow cytometry after 72 hours.
DNA and RNA isolation High-molecular weight genomic DNA from tissues was isolated using previously published protocols for RLGS analysis [157]. Plasmid DNA was obtained by QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). RNA was isolated by Trizol (Invitrogen) following manufacturers’ recommendations and protocols. DNA from cell lines was isolated from the Trizol phase following RNA extraction as describe in the manufacture’s recommendations.
57 Bisulfite sequencing, COBRA and MassARRAY analysis Genomic DNA was sodium bisulfite treated as described previously [158]. The bisulfite treated DNA was amplified by the condition which can not amplify the untreated DNA. After purification with the QIAquick gel extraction kit (Qiagen), the PCR products were digested by enzymes detecting a difference in the methylated and unmethylated sequences following bisulfite conversion. The digestion products were separated on 8% acryamide gel. For the quantitative DNA methylation assay, MassARRAY system (Sequenome, San Diego, CA) was preformed as previously described [159]. In brief, bisulfite treated DNAs were PCR amplified, in vitro transcribed, cleaved by RNase A, and then analyzed by matrix-assisted laser desorption ionization-time of flight (MALDI- TOF). The quantitative data was converted and presented in color for easy visualization using the Multiple Experimental Viewer software (MeV) [160]. Primer sequences are listed in Table 5.
Electrophoretic mobility shift assay (EMSA) and Western analysis EMSA was performed as described previously [185] with following modifications. The probe sequence contains the putative NFκB binding sequence in the Foxd3 promoter. The sequence of the oligonucleotide is 5’-cagtccttaaaacgggactttcgactaccggggcttcgg-3’, (underlined the putative NFκB binding site). The double-stranded oligonucleotides were end labeled with [γ-32P] ATP using T4 polynucleotide kinase enzyme (NEB). The free probe was removed by purification in G50 Sephadex spin columns. The binding reaction was conducted at room temperature for 20 min with 5µg of nuclear extract, 40,000 dpm (0.08 to 0.4 ng) of radiolabelled oligonucleotide probe, in 1x Ficoll buffer (10mM Tris (pH 7.5), 1 mM DTT, 1mM EDTA and 4% Ficoll), 250 ng of poly-(deoxyinosinic- deoxycytidylic acid) in 75 mM KCl and double distilled H2O to make the volume to 15 µl. For supershift assay, 1 µg each of p65, p50, HDAC1, HDAC3, control IgG antibodies (Santa Cruz Biotechnologies, Santa Cruz, CA) or TCL1 (MBL international Inc., Japan) was added and the mixture was incubated at room temperature for additional 30 min. The DNA-protein complexes were fractionated by electrophoresis in 6% nondenaturating polyacrylamide gel, run in 0.5X Tris-borate-EDTA at 140 Volts for 4 hrs at 4° C. The gel
58 was then dried on 3M Whatman paper and subjected to autoradiography. Radioactivity was visualized by autoradiography and was analyzed using STORM860 image analyzer (Amersham Biosciences, NJ) [186]. Western blot analysis was performed as previously described. The primary antibodies used for Western were anti-Foxd3 (Millipore, Bedford, MA) and anti-α-tubulin antibody (Oncogene Science, Manhasset, NY). The protein expression pattern was detected by a chemiluminescent detection system (Amersham Pharmacia Biotech, Piscataway, NJ).
SYBR green and TaqMan real time PCR RT-PCR was performed as described previously [95]. Briefly, 1 µg of total RNA was used for reverse transcription using SUPERSCRIPTTM First-Strand Synthesis kit (Invitrogen). SYBRgreen real time PCR was done in duplicates with IQ SYBR Green Supermix (Bio-Rad, Hercules, CA) in a BioRad icycler. The expression data was obtained by subtracting cycle number at which the fluorescent signal first exceeds the threshold of the internal control (GAPDH for mouse or GPI for human samples) from the value of the target gene. For the analyses of Foxd3 and miR29A, miR29B, miR29C expression we used TaqMan RT-PCR as described by the manufacturers (Applied Biosystems, Foster city, CA). Primer sequences are listed in Table 5.
Identifying overrepresented transcription factor binding sites in methylated promoters A length of 3kb mouse and its orthologous human promoter sequences for both methylated and unmethylated genes were retrieved from the OMGP database, an integrated information data resource ([187]; http://bioinformatics.med.ohio-state.edu/OMGProm). Transcription factor binding sites (TFBSs) for all possible transcription factors within the promoter regions were identified by the MATCH program [188], using the PWMs (positional weight matrices) from the TRANSFAC database [189]. For each pair of mouse and human orthologous promoters, we searched for ~300 family TFs with ~500 PWMs corresponding to known human transcription factors using “minFN_good83.prf” profile (profile of cut-off values with minimum number of false-negative predictions) of MATCH.
59 Each predicted TFBS was evaluated by 5 parameters: 1) mouse core score, 2) mouse PWM score, 3) human core score, 4) human PWM score, and 5) the percentage of identical base- pairs from the ClustalW [190] aligned sequences between mouse and human orthologous pairs. A set of cutoff values for the five parameters of 0.95 for a mouse core score, 0.90 for a mouse PWM score, 0.8 for a human core score, 0.7 for a human PWM score, 60% for the sequence identity were used to determine the conserved binding sites on a basis of previous studies in our laboratory [128, 191]. A total of 143 conserved TFBSs were obtained for both methylated and unmethlated promoters by using above cutoff values. A Fisher's exact test (two tailed) was then used to calculate the p value in order to evaluate the significance of each binding site overrepresented in methylated promoters versus unmethylated promoters. A final set of 39 TFBSs were considered to be significantly overrepresented in methylated genes at a p value less than 0.05.
Expression vectors and Luciferase assay pJ6-Foxd3 and pCMV5-TCL1 expression vector was obtained as gifts from Dr. Hromas [192] and Dr. Pekarsky (The Ohio State University). The full length of Foxd3 cDNA was cloned into pcDNA3 vector (Invitrogen) for stable transfection. For luciferase assay, the pGL3 basic vector (Promega, Madison, WI) was used to ligate the PCR amplified promoter constructs. SV40 promoter reporter construct was used as a positive control. Constructs were confirmed by sequencing. 1 µg plasmid pGL3 vector and 20 ng of pRL- TK internal control vector (Promega) were co-transfected into cells using the Amaxa Nucleofector apparatus and programs following manufacture’s instruction (Amaxa Biosystems, Cologne, Germany). Luciferase assay was performed after 48 hours according to manufacture’s instructions (Promega); each experiment was performed in triplicate. NFκB subunits overexpression vectors were received as gifts from Dr. Denis Guttridge, pCMV-TCL1 overexpression vector was a gift Dr. Yuri Perkasky from the Ohio State University.
60 Chromatin immunoprecipitaion (ChIP) assay Chromatin immunoprecipitaion was performed by the ChIP assay kit (Upstate Biotechnology, Lake Placid, NY) as described previously [193]. The antibodies used for immunoprecipitationwere anti-FOXD3 (Millipore), anti-acetyl-histone H4 (Upstate Biotechnology), and anti-Histone H3 dimethyl K4 or dimethyl K9 antibodies (Abcam, Cambridge, MA). Five micrograms of each antibody was used for immunoprecipitation and no antibody or 5 µg of rabbit IgG were used as negative controls. SYBR-green semi- quantitative PCR was performed as described before for the quantification. Fold difference was calculated for each cell line relative to the input DNA and negative control rabbit IgG. Primer sequences are listed in Table 5.
Small hairpin RNA (shRNA) constructs and transfection The plasmid of 29mer shRNA construct against human Foxd3 was obtained from Origene (Rockville, MD). The shRNA vector was cloned in pRS plasmid under U6 promoter for the expression. 1µg purified plasmid of shRNA and negative control non- effective GFP plasmid or pRS plasmid alone were transfected into human cell lines. The transfection was done by using Amaxa apparatus (Amaxa Biosystems). For the Amaxa system transfection, 2 million Jurkat or K562 cells were harvested, washed once in PBS (phosphate buffered saline) buffer, and resuspended in 100 µl of electroporation buffer (Nucleofector kit V; Amaxa Biosystems). Next the plasmid DNA was nucleofected with an Amaxa NucleofectrorTM apparatus. After 24 hours, positive cells were selected for by puromycin.
Cluster analysis and statistical analysis Hierachical cluster analysis of samples was performed by applying phi-correlation [163] similarity metric with compact linkage method, using all the spots with at least one methylation (1491 spots) across samples. For the statistical analysis, comparisons of 2 groups were performed by using non parametric Wilcoxon rank sum test [164] and student t-test. Trend in methylation over time was evaluated by the Jonckheere-Terpstra
61 test [164]. All the analyses were performed by R 2.5.1 statistical program (http://www.r- project.org/) and EXCEL. Bar plots were developed by using mean ± SEM of respective data.
3.3 Results
3.3.1 Methylated genes in Eµ-TCL1 transgenic mice are putative Foxd3 targets
The increased expression of de novo DNA methyltransferases in TCL1 mice overtime can not explain that only certain genes are targeted by DNA methylation. While transcription factors have been found to bring the repressor complex including DNMTs or HDACs, loss of other transcription factors were found to be involved in the initiation of aberrant DNA methylation on the target genes. In order to seek for a conserved sequence of a transcription factor binding site in the promoter region of all the methylated genes (n=34) in Eµ-TCL1 mice, we screened the transcription factor consensus binding sites in the region -2kb to +1kb relative to the transcription start site. Similarly 34 sequences were identified from randomly selected unmethylated genes in Eµ-TCL1 mice to build a control set. Figure 11A shows the list of ten predicted transcription factors with the largest difference in frequency between the two groups. Based on this analysis, the Foxd3 binding site (5'-A[AT]T[AG]TTTGTTT-3’, [192, 194]) is most significantly
(P=0.007) overpresented in the promoter regions from methylated genes (in 70.6%) as compared to the unmethylated genes (29%; Figure 11B).
62 3.3.2 Early silencing prior to DNA methylation of Foxd3 in CLL
Based on these findings we hypothesize that the loss of Foxd3 can lead to novel DNA methylation on the target genes, suggesting a chain reaction after the loss of one transcription factor affecting epigenetic silencing of multiple target sequences. To investigate the timing of Foxd3 silencing in Eµ-TCL1 mice, the promoter activity was first studied by luciferase assays. We found that the region [-468 to +10] provides the highest promoter activity. The further treatment with the SssI methylase enzyme on the region [-468 to +10] demonstrates that methylation reduces promoter activity. This promoter region of Foxd3 is overlapping with the region regulated by aberrant DNA methylation is found in CLL-cells (Figure 12A). This region has a high homology to human FOXD3 [195]. We further performed COBRA analysis for this region; the result is consistent with previous RLGS data, methylated Foxd3 is shown from 5 month old of the age in the Eµ-TCL1 mice. Interestingly, heavy methylated Foxd3 can correlate with the white blood cell counts of each sick mouse (data not shown). Also, selected peripheral blood cells from 30 sporadic CLL patient samples show significantly higher level of Foxd3 promoter methylation, ranging from 22.3% to 68% (average 43.7%), as compared to the average DNA methylation frequency in the normal CD19+ B cells and peripheral blood cells (16.9% and 13.5%, p=2.718e-06) (Figure 12B). Down-regulated
Foxd3 was shown in the B cells of Eµ-TCL1 mice; including the non-transformed B cells
(from 1 month old mice). The quantitative RT-PCR showed significant lower expression of Foxd3 in the CLL patient samples as compared to the normal CD19+ B cells (Figure
12C and 12D).
63 3.3.3 Down-regulated Foxd3 by TCL1 through PI3K/NFκB pathways
Foxd3 is silenced before the promoter becomes methylated in mouse CLL. To
understand the mechanism leading to Foxd3 repression in Eµ-TCL1 mice, we first
performed luciferase assays using different proportion of the promoter region of Foxd3,
with co-transfection of the TCL1 overexpression vector in Raji cells, we saw decreased
expression of Foxd3, suggesting that the transcription of Foxd3 is repressed by TCL1
either directly or indirectly (Figure 13A). Interestingly, the Foxd3 promoter region (-483
to transcription start site) has a putative NFκB transcription factor binding sequence
ggactttcg, position [-483 to -491]. It’s known that the NFκB pathway is activated in most
CLL patients, and regulated NFκB by TCL1 has also been suggested [132, 137, 138]. To link the repression of Foxd3 with the TCL1-mediated pathway, we further performed luciferase assays on constructs containing the putative binding sequence of NFκB. The
luciferase results show repressed activity with p50, p65, p65 and p50 co-transfection and
C-Rel. These are the subunits of NFκB that can form hetero- or homo-dimers. In
addition, RelB, which can only form heter- dimmer, with single transfection can not
affect promoter activity, moreover, overexpression of IKBα, the inhibitor of NFκB
pathway abolished the repression effect of NFκB that was seen with C-Rel, p65 and p50.
The transfected cell lines represent transformed human peripheral blood. EBV
transformation has shown to lead to the activation of the NFκB/PI3K pathway in the
transformed cells, which may be the reason for the repressed luciferase activity of Foxd3
even if NFκB subunits are transfected. Notable, the most significant further repression in
TCL1 overexpressed PBL is shown in the p50 single transfection, suggesting that p50-
64 p50 homodimer might act as a transcription repressor on the promoter of Foxd3. Finally, with the PCMV control vector transfection, we again showed the repressed Foxd3 in
TCL1 overexpressed cells (Figure 13B).
The possibility of p50 homodimer on putative NFκB binding sequence of the Foxd3 promoter was then further investigated by EMSA. The result demonstrates a complex binding to the putative NFκB binding site on Foxd3 promoter in the nuclear extract of peripheral blood from CLL patients, but not normal individual. By using p50, p65, and two classI HDACs, HDAC1 and HDAC3, we found a supershift with p50 and HDAC1 antibodies, further supporting the possibility of the repression complex p50-p50 homodimer and HDAC1 on the Foxd3 promoter region in TCL1 overexpressed cells. The binding and repression activity of NFκB on Foxd3 expression was further confirmed by
NFκB inhibitor, Bay11. With treatment of CLL patient cells with 10 µM Bay11 for 48 hours, abolished binding of the repressor complex and reactivation of Foxd3 expression were shown. Interestingly, the binding of p50-p50 homodimer to the promoter region is not affected by HDAC inhibitors, even though HDAC1 is in the complex; suggests
HDAC inhibitor might only remove HDACs from the binding (Figure 14A and 14B).
3.3.4 Loss of Foxd3 triggers DNA methylation on the target genes
Our data showed that Foxd3 silencing might be an early event of the disease in Eµ-
TCL1 mice (Table 4). The fact that putative Foxd3 binding sites were found in many methylated genes, suggests that the loss of Foxd3 may trigger DNA methylation and
65 epigenetic silencing on downstream target genes. To test this hypothesis, we knocked down Foxd3 expression by shRNA in both Jurkat T cells and K562 chronic myelogenous leukemia cell lines and measured gene expression of Foxd3 targets (Figure 15A). Most
of the putative Foxd3 target genes that we found in Eµ-TCL1 mice were methylated and
silenced in both cell lines, only six genes were found partial or unmethylated (data not
shown). Consistent with the assumption that Foxd3 is an activator in lymphocytes, three
out of six putative target genes that we checked were silenced after knockdown of Foxd3
(Figure 15B). From the three silenced genes, we were able to design primers for different
amplicons for Phf2 and Dlx1 to measure the methylation levels using the quantitative
MassARRAY. By comparing with vector-control transfected cells, we found that both
Phf2 and Dlx1 are methylated in the Foxd3 knowdown Jurkat cells (P<0.05; Figure
15B). Although the increased DNA methylation level of Dlx1 was not found in K562
cells, by ChIP assay, we did see evidence of heterochromatin change favoring repression
of expression including dimethyl H3K9, on the promoter region of Dlx1 in the
knockdown cells, but not in the control Jurkat or K562 cells (Figure 15C). In contrast to
dimethyl H3K9, we saw the binding of an activator mark, dimethyl H3K4 is decreased in
the knockout cells. In addition to Dlx1, the increased binding of dimethyl H3K9 and decreased dimethyl H3K4 were also shown on the promoter region of Phf2 in the knowdown Jurkat or K562 cells. Our results indicate that loss of Foxd3 can trigger DNA methylation and chromatin remodeling at target genes, suggesting a mechanistic link to aberrant DNA methylation of genes in the CLL mouse model.
66 3.3.5 Re-expression of Foxd3 target genes require both Foxd3 restoration and DNA demethylation
The putative Foxd3 target sequences were then confirmed by luciferase assays. Dlx1
and EphA7 are the methylated genes in Eµ-TCL1 mice with putative Foxd3 binding sites.
The promoter sequences were cloned into luciferase reporter constructs and transfected
with the Foxd3 expression vector into Raji cells. The results showed that the tested predicted binding sites were bound by Foxd3 with increased luciferase activity (Figure
16A). Luciferase results were further confirmed by ChIP assays in pcDNA-Foxd3 or vector control transfected WAC3CD5 cells further confirmed the predicted Foxd3 binding sties of Dlx1, EphA7 and Pcdh10. The detectable binding of Foxd3 to all tested gene promoters was found in 5aza-dC treated cells accompanied with removal of DNA methylation (Figure 16B). The increased expression of putative Foxd3 target genes in the overexpressed Raji cells after 5aza-dC treatment also suggested the transcription activator function of Foxd3 in lymphocytes (Figure 16C).
3.4 Discussion
Herein we have demonstrated the genesis of epigenetic gene silencing that occurs in
the Eµ-TCL1 model of CLL where the TCL-1 protein down-regulates mRNA expression
of Foxd3 at one month of age followed by a sequential expansion of additional
methylated genes predicted in great part by having a Foxd3 promoter binding.
Surprisingly, both the silencing of Foxd3 mRNA and the overall patterns of altered DNA
methylation in the TCL1 murine mouse model of CLL recapitulates what was
67 subsequently shown to occur in the human disease and thus allowed us to investigate disease progression in this mouse model. Methylation of specific genes was not random, we identified that over 70% of the methylated genes in Eµ-TCL1 mice contained Foxd3 binding sites in their promoter regions.
Our data demonstrate that Foxd3 mRNA expression was silenced at 1 month by over- expression of TCL-1, and methylation occurs at 5 month old in Eµ-TCL1 mice. Down- regulated expression accompanied with chromatin remodeling and DNA methylation of
Foxd3 target genes in the Foxd3 knockdown cells implies that loss of transcription signaling can trigger epigenetic silencing of downstream targets as a second event for stable repression. Moreover, the fact that many Foxd3 target genes are also transcription factors implies a chain reaction which may explain the accumulated number of targets of methylation in Eµ-TCL1 mice. Indeed, in this study, we show that the loss of Foxd3 can lead to the aberrant DNA methylation in the downstream targets. Most of the methylated regions on Foxd3 target gene are close to the TSS, the transcription start site, but not within the binding sequence.
Foxd3 is a member of forkhead-box (FOX) family transcription factors characterized by a 100 amino acid monomeric DNA binding domain, which is highly conserved among all FOX proteins for nuclear localization and transcriptional regulation [196-198].
Several FOX family member are expressed in hematopoietic cells (i.e. FoxOs, FoxP1,
FoxP3 and FoxD3) [199-203] or in embryonic stem cells (FoxH1, FoxO1, FoxG1 and
FoxD3) [197, 204-206]. Foxd3 plays a curtail role gene regulation and is involved in a 68 tight regulatory feedback loop with Oct4 and Nanaog. The interaction and balanced
expressions in this negative feedback loop formed by Foxd3, Oct4 and Nanog have been
found essential in maintaining the multipotent properties of stem cells [192, 194, 207,
208]. Future investigation focused on understanding the regulation of Foxd3 in B-cells is
indicated based upon our findings described herein.
Importantly, we provide evidence showing the regulation of Foxd3 is controlled by
TCL1 downstream NFκB pathway. Whether the regulation is through AKT needs further
validation. We found that the repression of Foxd3 is mediated by NFκB p50-p50 homo-
dimer and HDAC1 complex. Previous reports have shown the repression activity of p50
in macrophage and tumor cells [209-211]. The proposed mechanism suggests that p50
homodimer forms a complex with HDAC1, the formed repressor complex can then bind
to the target genes [212]. Supporting this mechanism, we also found the repression
machinery for Foxd3 regulation might be p50-HDAC1 complex. Although 48 hours
treatments with HDAC inhibitors do not show the loss of complex binding, the
expression level of Foxd3 is above 30 fold in most of the treated cells compare to untreated, suggesting HDAC1 might be required for the repression. Overall, our work suggests that the activated NFκB pathway by overexpressed TCL1 in CLL cells can suppress the transcription of Foxd3 by forming p50-p50 homodimer and HDAC1. The transcription silenced Foxd3 then occurs to have DNA methylation on the promoter region. The loss of Foxd3 transcription activator leads to the silencing and methylation on downstream targets. Notably, high percentage of Foxd3 targets we found in Eµ-TCL1 mice are also transcription factors, suggest this whole process might be amplified during
69 CLL progression. Strategies to re-express Foxd3, particularly in conjunction with hypomethylating agents may represent an attractive strategy to treat CLL.
In summary of the first two chapters, we have demonstrated in the Eµ-TCL1 model of CLL that early transcriptional silencing by TCL-1 may contribute to the later genesis of select genomic methylation observed. All tested CpG promoter regions of early and late-methylated genes in Eµ-TCL1 mice were also found methylated and silenced in human CLL, indicating a similar pattern of DNA methylation changes between mouse model and human CLL. Therefore, genes undergoing hypermethylation at different stages of Eµ-TCL1 mice may provide a better understanding of the progression of human CLL.
Our work also demonstrates the contribution of early key transcription factor silencing to down-stream methylation in leukemia pathogenesis. While epigenetic-based therapy with demethylation agents is currently under development that can re-express multiple genes, our work suggests that efforts to re-express single transcription factors silenced early in the disease such as Foxd3 could have similar affects. This provides a new pathway to target early epigenetic silencing in CLL (Figure 17).
70 HDAC p50 p50 Foxd3 Foxd3 targets
HDAC p50 p50 Foxd3
Accumulated aberrant DNA methylation NFkB
TCL1 Foxd3 binding sequence NFkB binding sequence ? miR29s DNMT3A Methylated cytosine DNMT3B Unmethylated cytosine
Figure 10. Proposed mechanism of the initiation and accumulation of aberrant DNA methylation in CLL
3.5 Acknowledgements
The work was supported by D. Warren Brown Foundation, Leukemia Lymphoma
Society, Chronic Lymphocytic Leukemia research consortium (CRC) and National
Cancer Institute (NCI). The authors thank Dr. Perkasky for PCMV-TCL1 overexpression
vector; Dr. Teitell’s group for EBV-transformed PBLs, and Dr. Guttridge’s group for
NFκB subunits overexpression vectors. Also, thank Dr. Davuluri’s group for the help on
the screening of consensus transcription factor binding site. Thank you to the members of
both Plass lab and Byrd lab for thoughtful discussions.
71 A Methylated genes group Transcription Unmethylated genes group 100 10 30 40 20 60
Frequency in genes are 50 70
that 80 Factors methylated unmethylated Significance 90 FOXD3 70.6% 29.4% 0.007 MEF2 82.2% 52.8% 0.004 EFC 48.9% 19.4% 0.006 HNF3B 62.2% 33.3% 0.009 FOXO1 55.6% 27.8% 0.012 MYCMAX 66.7% 38.9% 0.012 CEBPbeta 68.9% 41.7% 0.014 IK2 93.3% 66.7% 0.002 TCF4 62.2% 36.1% 0.019 HES1 73.3% 47.2% 0.016 B Methylated genesa Unmethylated genesa Chb Gene TF BSc 3mo 5mo 7mo 9mo CLL Chb Genes TF BSc 2D27 2 Snx5 1E24 16 Sfrs10 Foxd3 3F19 5 Zfp326 Foxd3 1F27 2 Ss18l1 Foxd3 2C09 4 Foxd3 1F40 11 Ubtf Foxd3 1E19 4 Mtg8 Foxd3 2B27 7 Pde3b 2F37 X Sox3 Foxd3 2B40 9 Rbm15b 3D03 2 Fign Foxd3 2C06 1 Enah 4D57 4 EphA7 Foxd3 2C07 7 Fgf3 2B21 13 Adarb2 2C27 9 Tle3 5D25 7 Zfp537 2C29 13 Elov12 2C33 11 CBX8 Foxd3 2C36 7 Hmx3 1D06 13 Phf2 Foxd3 2C39 4 Tgfbr1 Foxd3 3C02 18 Tcf8 Foxd3 2C55 18 SSXT 3D07 3 Tspan5 2F28 4 Faf1 3D10 5 Cpeb2 2F57 14 Tgfb1i4 3E75 14 Cacna2d3 Foxd3 2F61 12 Tspan13 Foxd3 3F09 3 Pcdh10 Foxd3 3C10 2 Zdhc5 Foxd3 3F56 12 Foxg1 Foxd3 3D04 8 Cog8 3F30 16 Hmgn1 3D30 11 Hs3st3b1 4C10 13 Foxc1 Foxd3 3E54 10 Egr2 Foxd3 3D28 12 Tmem30b Foxd3 4B05 5 Tmed2 Foxd3 3F42 1 Sox17 Foxd3 4B07 3 Sep15 2D17 13 Id4 Foxd3 4C18 X Slc6a8 2E38 2 Pkp4 Foxd3 4D28 10 Mars 4D49 13 Vmp Foxd3 4E24 11 Slc16a11 1D20 6 Cast1 4E40 3 Act16a 3E34 6 Gpr27 Foxd3 4E47 6 Nup210 3C24 9 Tbx18 Foxd3 4E72 11 Zfpn1a1 2B07 3 Bhlhb5 Foxd3 4F59 16 Ephb3 Foxd3 4D45 2 Dlx1 Foxd3 5B15 4 Ccne2 5B21 13 Rnf180 5C04 16 Scarf2 4D11 14 Spry2 Foxd3 5D36 4 Nr4a3 6B05 3 Golph4 Foxd3 5E47 10 Onecut3 Foxd3 2D07 9 Ncam1 Foxd3 5F75 14 Gfra2 2D41 17 Axin1 6C25 6 PTPRK Frequencyc 70% Frequencyc 29%
Figure 11. Consensus transcription factor binding sequence in the promoter region of genes methylated in Eµ-TCL1 mice (continue).
72 Figure 11 (continue). A. The 10 most frequently found putative transcription factors binding sites in the promoter region of methylated genes in Eµ-TCL1 mice compare to unmethylated. B. Prediction of Foxd3 binding targets in Eµ-TCL1 mice. aAll Methylated RLGS fragments of known genes and randomly chosen same number of unmethylated RLGS fragments of known genes were used for MATCH program analysis. bBLAT search results using February 2006 freeze [50]. Chromosome is given. Black square, RLGS fragment loss in at least one of the RLGS profiles; white square, no change detectable. cTranscription factor binding sites (TF BS) that found on most of methylated known genes compare to the investigated unmehtylated genes is Foxd3. Frequency was calculated by the number of genes with predicted Foxd3 binding site in the total number of genes that was analyzed.
73
Figure 12. Methylated and silenced Foxd3 in mouse and human CLL (continue).
74 Figure 12 (continue). A. Luciferase assay for Foxd3 promoter activity Diagram shows the 5’ region of mouse Foxd3. Red bar shows the region covered with CpG island. Different portions of the unmethylated Foxd3 promoter were cloned into luciferase reporter vectors. The promoter construct of pGL3-Foxd3 #2 was then treated with SssI methylase (filled rectangle) and religated with pGL3 basic vector. The whole experiment was performed in Raji cells. Relative luciferase activity is shown by comparing to the activity of pGL3 basic control vector. B. Methylation analysis of Foxd3 in mouse and human CLL. Top, the result of COBRA analysis of mouse Foxd3 using primers located in the promoter region (blue arrows in figure A). Samples used were two wild type mice at 4, 11 month old; Eµ-TCL1 mice at 3 5, 7, 9 month old; and mice at age older than 11month with symptomatic disease. Digested DNA products correspond as methylated DNA while each lane represents the result from one mouse. DNA treated with SssI methylase served as a positive control (Pctrl). Bottom, MassARRAY analysis of human Foxd3 5’ region within CpG island (red bar). The amplicon (short black bar) covers 50 CpGs and extends from -522 to -100bps. Samples used were eleven CD19+ B-cells and three peripheral blood cells (PBL) from normal donors; B cell lines Raji and 30 CLL patient peripheral blood cells. Bar of heat map showing quantitative methylation data from light blue (0%) to dark blue (100%). Each square represents a CpG unit containing one or more than one CpGs analyzed; each line indicates a samples. Gray shows the CpG unit with data unavailable. C. Expression of Foxd3 in Eµ-TCL1 mice. Foxd3 SYBR- Green PCR was done on CD19+ B cells from wild type (WT) and Eµ-TCL1 mice. Six wild type or Eµ-TCL1 mice were used in 1-month old group, whereas three of each was used in other age groups. Blue dots present the data from each mouse. The boxplot margins represent the interquartile range; the thick line indicates the median (*, P- value<0.01 by student T test). D. Expression of FOXD3 in CLL patients. Diagram shows the relative TaqMan PCR results from 49 CLL patients in comparing with four normal CD19+ B cells. Blue dots present the data from each patient. The boxplot margins represent the interquartile range whereas the thick line indicates the median (*, P-value < 0.0002, Wilcoxon rank sum test).
75 A pCMV pCMV-TCL1 TCL1
pCMV pCMV-TCL1
B
TCL1
Figure 13. Luciferase activity of FOXD3 in TCL1 transfected cell lines (continue).
76 Figure 13 (continue). A. Downregulated luciferase activity of FOXD3 in TCL1 overexpressed WAC3CD5 cell lines. 1µg pCMV-TCL1 and control vector were transfected into WAC3CD5 cells lines. Cell lysates were collected after 48 hours for western and luciferase assays. The diagram shows human FOXD3 5’ promoter region. Different portions of the region were cloned into pGL3 vector and then co-transected with 1 µg pCMV-TCL1 expression vector or vector alone into WAC3CD5 cells. The relative luciferase activity was calculated by comparing with the activity of pGL3-basic vector (NC). Gray bars represent the luciferase activity in Tcl1 overexpressed cells. The result shown is the average of results from duplicated experiments with bar using mean ± SEM of respective data. The putative NFκB binding site is indicated in the diagram (red bar). B. Repressed FOXD3 in NFκB subunits transfected PBL-TCL1 cell line. Established human PBL cell lines with or without TCL1 overexpression were transfected with FOXD3 luciferase construct [-85 to -535] and 500 ng of each NFκB overexpression vectors. Cell lysates were collected after 48 hours for Western and luciferase assays. The relative luciferase activity was normalized by pcmv only transfected PBL-puro cells, which was transfected with the control vector and selected by puromycin while doing TCL1 transfection. Black and gray bars represent the luciferase activity in PBL-TCL1 or PBL-puro, respectively. The amount of transfected TCL1 expression vector was shown in the Y axis. The result shown is the average of results from triplicated experiments with bar using mean ± SEM of respective data.
77 A
Normal Pt6 Pt7 Supershift - Bay11 - Bay11 - Bay11 h42 mg p65 p65 p50 h1 h3 IgG
B 25 *
20
15
10
5 0 media Bay11 media Bay11 normal CLL patients Relative expression of Foxd3 expression Relative
Figure 14. Foxd3 is repressed by p50 homodimer/HDAC1 complex in TCL1 overexpressed cells. A. EMSA assays using NFκB binding sequence on Foxd3 promoter as the oligo. 5 µg Nuclear extract (NE) from Rosette-Sep selected normal and CLL patient peripheral blood B cells treated with 10 µM Bay11, 0.5 µM HDAC-42 (h42) and classI HDAC inhibitor (mg) for 48 hours. Supershift was done using p65 (1 µg and 10 µg), p50, HDAC1 (h1), HDAC3 (h3) and control IgG antibody. B. SYBR-Green PCR results from Rosette-Sep selected 4 normal individuals and 9 CLL patients treated with or without 10 µM Bay11 48 hours (* P<0.001).
78 Silenced, methylated predicted FOXD3 target genes accompanied with chromatin with chromatin FOXD3 target genes accompanied Silenced, methylated predicted
Figure 15. remodeling in FOXD3 knockdown cells (continue).
79 Figure 15 (continue). A. Downregulated FOXD3 and target genes in FOXD3 shRNA transfected cells. SYBR-Green real time PCR was performed using samples from FOXD3 or control shRNA stable-transfected Jurkat (left) and K562 [157] cells to detect the expression of FOXD3 and target genes after shRNA transfection (*, P<0.05). B. Increased DNA methylation of FOXD3 target genes in shRNA transfected cells. Diagrams show the 5’ region of human DLX1 and PHF2 genes. Arrows represent the transcription start site; red bars show the location of CpG island, and the black bars indicate the amplicons analyzed by MassARRAY analysis. Color from light yellow (0%) to dark purple (80%) represents the percentage of DNA methylation. The average methylation frequency of all CG units for each gene in the cells transfected with control shRNA (ctrl) or FOXD3 shRNA (shRNA) is indicated in the right panel. C. Histone tail modification of FOXD3 target genes in the FOXD3 knockdown cells. Antibodies against di-methylated histone H3 lysine 9 (H3K9me2), acetylated histone 4 (AcetylH4), and di-methylated histone H3 lysine 4 (H3K4me2) were used for ChIP assay pull-down. ChIP-PCR primers of Dlx1 and Phf2 are located in regions found methylated. The relative binding activity was calculated by using ChIP PCR cycle numbers from IgG, chromatin remodeling antibodies pull down, and total input DNA. Methylated di-methyl H3K9 was found on the promoter region of both Dlx1 and Phf2 genes in the Foxd3 knockdwon cells (black or gray bars). Significant decreased methylated di-methyl H3K4 but not acetylated histone 4 was also found on both genes in the Foxd3 knockdown cells comparing with the control-shRNA transfected Jurkat and K562 cells (dark and light blue). Star represents data with p-value less than 0.05.
80
Figure 16. Binding of FOXD3 transcription activator on the predicted target genes in Raji cells. A. Luciferase assay of putative FOXD3-target genes in Raji cells with FOXD3 overexpression. The diagrams show the 5’ region of putative target genes containing predicted Foxd3 binding sites [190]. Red bar shows the location of CpG island while the arrow indicates the transcription start site. The cloned reporter vectors were then transfected into pcDNA3-FOXD3 or pcDNA3 vector transfected Raji cells for 48hrs. The relative luciferase activity was normalized by the activity of pGL3-basic vector (continue).
81 Figure 16 (continue). B. ChIP assay of FOXD3 to confirm the binding in Raji cells. Primers designed for ChIP PCR were used to amplify the predicted Foxd3 binding sites. The black rectangle and black bar present one of the binding sites, while the white rectangle and bar indicate another binding site. ChIP assay was done in 0.5 µM 5aza-dC treated or untreated FOXD3-overexpressed Raji cells using FOXD3 antibody for pull- down. The relative binding activity was calculated by using ChIP PCR cycle numbers from IgG, FOXD3 antibody pull down, and the total input DNA. Only numbers above zero indicate the binding of FOXD3. C. Re-activation of FOXD3 target genes in FOXD3- overexpress Raji cells. RNA from 0.5 µM 5aza-dC treated or untreated Raji cells transfected with Foxd3 or vector only were isolated for SYBR-Green real time PCR. The relative expression of each gene was normalized by the result of first amplified sample. Figure shows the result from triplicate experiments.
82
CHAPTER 4
HAPLOID LOSS OF ID4 LEADS TO ACCELERATED CLL PROGRESSION IN TCL1 TRANSGENIC MICE
4.1 Background
In the previous studies, we found 147 out of 1700 RLGS fragment hypermethylated in selected B cells from TCL1 mice. Among these, 34 fragments had sequence homology to known genes (Figure 11). Many of these genes have been suggested involved in CLL patients [94] and TCL1 mice [127]. Interestingly, we found that not only genes in Akt-
PI3K pathways are methylated in CLL mouse model, but also those altered pathways found in patients previously, such as WNT [213] and TGF-β [214] signaling pathways.
Moreover, many of the methylated targets have been considered as tumor suppressors in leukemia or other types of cancers, suggesting that the loss of tumor suppressor genes at different timepoints might be involved in TCL1 driven leukemiogenesis.
83 However, for some methylated tumor suppressor genes in TCL1 mice, such as Axin1,
Dlx1, Tbx18, Sox17, EphA7, Foxc1, Sox3, and even Foxd3 [207, 215-221], the single or
double knockout mice have been generated. However, in all the genetic manipulated
mice, only defects in the process of development with deregulated apoptosis or cell
proliferation was found, there is no dysfunction lymphocyte or CLL has been observed.
One possibility is that the loss of genes, especially at late stage, is the result but not the
cause of the disease. While many genes, including Foxd3 targets were found only
methylated in Eµ-TCL1 mice with severe disease, we can not exclude the possibility that
the aberrant alteration of these genes may not affect disease progression. Another
possibility would be these methylated genes are TCL1-dependent.
To elucidate whether the late-methylated genes can be involved in CLL development, the best example would be inhibitor of DNA binding protein 4 (Id4). By RLGS, Id4 was found methylated in mice older than 9month, while the double knockout Id4 mice show high frequency of embryonic lethal and the heterozygous knockout mice have defects in neurogenesis, none of the Id4 mutant mice have shown deregulated lymphocytosis [222,
223]. Moreover, ID4 is known as an oncogene with established mechanism in many types of solid tumors [224-226]. In contrast to that, Id4 is methylated in both TCL1 mice and most of CLL patients, as well as in many other types of leukemia [96, 227]. The role of
ID4 as a tumor suppressor gene was suggested by the fact that overexpression ID4 leads to caspase/cAMP involved cell apoptosis, and the ID4-overexpressed cell line engrafted mice have delayed tumorigenesis [96, 228, 229]. However, there is no evidence from an
84 in vivo study; no report indicates ID4 is involved in B lymphopoiesis; and no Id4 mutatnt
mouse model develops leukemia [222, 223, 230].
ID4 is a member of basic helix-loop-helix (bHLH) transcription factor family [231,
232]. bHLH transcription factors can form homodimer or heterodimer with each other by
bHLH domain. Majority of bHLH members also have a DNA binding domain adjacent to
the N-terminal of bHLH domain. Unlike these members, ID4 and other ID family
members do not have DNA binding domain, but still possess HLH domain to form
homodimer or heterodimers with other HLH transcription factors. The Id members bound
bHLH transcription factors therefore lost the ability of DNA binding. In solid tumors,
most known ID4 targets are tumor suppressor genes, such as BRCA1 in breast cancer;
which therefore suggest an oncoprotein function of ID4 [224, 233, 234]. The binding partner or the mechanism of ID4 as a tumor suppressor gene is still unknown.
Here, as the first report that the loss of Id4 in TCL1+/tg background mice develops
CLL, our data suggest that the loss of a transcription factor, Foxd3, might lead to the loss
and methylation of Id4 in Eµ-TCL1 mice. With a haploid loss of Id4 in TCL1+/tg background, mice develop with an accelerated disease progression with elevated white blood cell counts, enlarged spleen and lymphoid tissues, the symptoms that have been shown on TCL1 mice as well. In contrast, control mice with the same background of
TCL1+/tg revealed a more extended time to disease progression. Haploid loss of Id4 in
TCL1 transgenic background mice also leads to B cells with resistance to corticosteroid
mediated apoptosis. All together with the findings from other two chapters, we have
85 found a potential mechanism of CLL pathogenesis that is centered on deregulated apoptosis and initiated with transcriptional and then epigenetic silencing of critical transcription factors.
4.2 Methodology and Method
Mouse model
The Id4 heterozygous knockout mice were received as gifts from Dr. Fred Sablitzky from the University of Nottingham [222]. Id4 is required for neuron development. Over 50% of
Id4-/- mice died either in uteri and/or neonatally, and only about 20% of Id4-/- mice survived to adulthood. We therefore generated heterozygous Id4 knockout mice in TCL1 transgenic background by the cross of Id4 heterozygous knockout mice in CD1 background, and homozygous TCL1 transgenic mice in C3H/B6 background. Only first generations of the littermates were used in all the studies. Selection of CD19+ B-cells was done by Ficoll density gradient centrifugation and magnetic-activated cell sorting
(MACS) beads using LS columns (Miltenyi Biotec, Auburn, CA).
Histopathology
Unless experimental requirements, animals were euthanized when mice are sick and meet the criteria of early removal. Tissues were fixed in 10% buffered formalin and embedded in paraffin. Sections were HE stained by standatd protocols and analyzed by mouse pathologists (The Ohio State University)
.
86 DNA and RNA isolation
High-molecular weight genomic DNA from tissues was isolated using previously
published protocols for RLGS analysis and sodium bisulfite treatment [157]. Plasmid
DNA was obtained by QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). RNA was isolated by Trizol (Invitrogen) following manufacturers’ recommendations and protocols.
DNA from cell lines was isolated from the Trizol phase following RNA extraction as describe in the manufacture’s recommendations.
Bisulfite sequencing, COBRA and MassARRAY analysis
Genomic DNA was sodium bisulfite treated as described previously [158]. The bisulfite treated DNA was amplified by the condition which can not amplify the untreated DNA.
After purification with the QIAquick gel extraction kit (Qiagen), the PCR products were digested by enzymes detecting a difference in the methylated and unmethylated sequences following bisulfite conversion. The digestion products were separated on 8%
acryamide gel. For the quantitative DNA methylation assay, MassARRAY system
(Sequenome, San Diego, CA) was preformed as previously described [159]. In brief,
bisulfite treated DNAs were PCR amplified, in vitro transcribed, cleaved by RNase A,
and then analyzed by matrix-assisted laser desorption ionization-time of flight (MALDI-
TOF). The quantitative data was converted and presented in color vor easy visualization
using the Multiple Experimental Viewer software (MeV) [160].
87 SYBR green and TaqMan real time PCR
RT-PCR was performed as described previously [95]. Briefly, 1 µg of total RNA was used for reverse transcription using SUPERSCRIPTTM First-Strand Synthesis kit
(Invitrogen). SYBRgreen real time PCR was done in duplicates with IQ SYBR Green
Supermix (Bio-Rad, Hercules, CA) in a BioRad icycler. The expression data was obtained by subtracting cycle number at which the fluorescent signal first exceeds the threshold of the internal control (Gapdh for mouse or GPI for human samples) from the value of the target gene. Primer sequences are listed in Table 5.
Southern blot analysis
Southern blotting was performed as described [157]. For the allele specific hypermethylation study, genomic DNA from purified B cells from the indicated group of mice were digested by HindIII, which generates different size of digested products from lacZ targeted allele or wild-type allele of Id4. The different combinations of HindIII with methylation sensitive enzymes were also used to investigate the allele-specific methylation. The digested patterns from targeted and wild-type alleles were shown in
Figure 21.
WBC preparation and Immunophenotyping study
Mice peripheral blood cells were collected from the cavernous sinus; smears were immediately prepared and stained by May-Grunwald-Giemsa. For immunophenotyping study, blood cells were treated with 0.165M smmonium chloride to eliminate red cells.
The counts of CD19+ B cells were determined by Flow cytometry (Beckman Coulter
88 EPICS XL, Fullen, CA) using antibody specific for murine CD19 and IgM (BD
Biosciences, San Jose, CA).
Statistical analysis
The survival curve for mice in the Id4+/- TCL1+/tg and Id4+/+ TCL1+/tg groups were analyzed by Kaplan-Meier survival curve. The 95% confidence intervals (CI) were also calculated by using MedCalc statistical software version 9.3.0.0 (MedCalc software,
Belgium) and analyzed by logrank test. The comparisons of two groups were performed by using non parametric Wilcoxon rank sum test [164] and students t-test. All the analyses were performed by EXCEL. Bar plots were developed by using mean ± STD of respective data.
4.3 Results
4.3.1 Late -methylated Id4 in Eµ-TCL1 mice is transcriptional silenced by Foxd3
The methylation status of ID4 (Table 4, RLGS fragment 2G41) in Eµ-TCL1 mice was first confirmed by MassARRAY analysis (Figure 17A). MassARRAY data demonstrates that methylated Id4 only occurs in homozygous Eµ-TCL1 mice with severe
CLL. Id4 was found as one of Foxd3 putative targets (Figure 11). To verify the regulation of Id4 by Foxd3, different proportions of the promoter sequences were cloned into luciferase reporter constructs and transfected into Foxd3-overexpressed Raji cells.
The results showed the promoter activity of the predicted binding sites with increased
89 luciferase activity in the Foxd3 overexpressed cells (Figure 17B). Luciferase results were
further confirmed by real time PCR on pcDNA-Foxd3 or vector control transfected Raji
cells with 5-aza-dC-treatment for up to 4 days. Reactivation of Id4 was only found in the
5-aza-dC treated Raji cells with Foxd3 overexpression, supporting Id4 is epigenetically regulated and also provides another evidence of the transcription activator function of
Foxd3 in the regulation of Id4 in lymphocytes (Figure 17C).
4.3.2 Haploid loss of Id4 accelerates TCL-1 induced lymphomagenesis
The fact that Id4 is methylated at end-points of CLL disease raises a question whether the silencing of Id4 is required for disease progression. To investigate this issue, TCL1 transgenic mice were mated with Id4 heterozygous knockout mice. The generated F1 offspring were heterozygous Eµ-TCL1 mice with or without one allele of Id4 mutation.
While the mutant allele of Id4 was constructed by the insertion of lacZ, genotyping was
+/tg done by using lacZ primers [222]. A total of 43 F1 littermates in TCL1 transgenic
background, of 24 Id4-mutant and 19 Id4 wild type mice were monitored from birth until
death (Figure 18A). Kaplan-Meyer survival curve done on these 43 mice indicates the
death in heterozygous Eµ-TCL1 mice at a median of 16 months (range, 11-21 months), while the haploid loss of Id4 mice with the same background showed death at a median
of 12 months (range, 9-15 months) (Figure 18B). This difference in survival was highly
significant (p<0.0001, 95% CI: 0.062 to 0.316).
90 By blood smear and CD19 immunophenotyping, the development of a clonal
leukemia initially manifested by peripheral blood lymphocytosis or splenomegaly was
noted at a median of 9 months in the Id4 mutant mice, while the timing of noted initial
elevated lymphocytosis in blood or spleen was noted in a wide range (range 8 months to
16 months) in the same background mice with only one allele of Tc1l transgene. By
Comparing the disease development history, Id4 mutant mice showed significant higher
white blood cell counts starting from 3 month old (p<0.002, Figure 19) time period.
Autopsies performed on mice with severe leukemia revealed enlarged spleens in both
genotypes of mice with significant hyperplasia of the white pulp. The infiltration of
lymphocytes to liver, lung, kidney and brain were found in both types of mice, the
frequency however is higher in the mice with haploid loss of Id4. In mice with
extramedullary disease, we performed histopathology in 9 Id4+/- TCL1+/tg mice and 5
Id4+/+ TCL1+/tg mice. 4/9 Id4+/- TCL1+/tg mouse has lymphoma in lymph nodes (intestine
and the lymph nodes in the intersection of shoulder and neck), while 1/9 occurred in
Id4+/+ TCL1+/tg mice (salvory gland). Four Id4+/- TCL1+/tg mice were found either have B
cell infiltration in brain, pancreas or kidney while none of Id4+/- TCL1+/tg mice have
shown the same defects. In addition, both Id4+/- TCL1+/tg and Id4+/+ TCL1+/tg mice developed lymphoma in spleenand liver (Figure 20 and Table 4).
91 Microscopy Exam with HE staning
Id4+/-Tcl1+/tg mice Id4+/+Tcl1+/tg mice Affected organs Frequency Diagnosis Affected organs Frequency Diagnosis Lymphod organs Lymphod organs Spleen 9/9 Lymphoma Spleen 5/5 Lymphoma Non-lymphoid organs Non-lymphoid organs Liver 8/9 Lymphoma Liver 5/5 Lymphoma Small intestine 3/9 Lymphoma Salivary gland 1/5 Lymphoma Pancreas 1/9 Lymphoma Small intestine 0/5 Brain 2/9 Lymphoma Brain 0/5 Kidney 1/9 Lymphoma Kidney 0/5 Mass on shoulder 1/9 Lymphoma Mass on shoulder 0/5 Table 4. B lymphocytes infiltrated lymphoid and non-lymphoid organs in heterozygous TCL1 transgenic mice with or without haploid loss of Id4
4.3.3 Accelerated DNA methylation in Id4+/-TCL1+/tg lymphocytes
The fact that Id4 is methylated at late timepoint in TCL1 double transgenic mice
raises the question whether the methylation occurs and lead to the reduced amount of Id4
in Id4+/+TCL1+/tg mice as well. While 12 and 16 month are the median ages of death in group of Id4+/-TCL1+/tg and Id4+/+TCL1+/tg mice, respectively; isolated CD19 positive
spleen B cells from Id4+/-TCL1+/tg mice at 5, 10 or 11month old and Id4+/+TCL1+/tg mice at matched age were used to confirm the methylation status at the promoter region of Id4.
Overall we found the methylation only occur in the purified spleen B cells from Id4+/-
TCL1+/tg mice older than 10 months old, and no Id4+/+TCL1+/tg mice that were tested
have methylated Id4. The allele specific methylation studies by Southern, COBRA and
bisulfite sequencing indicate the methylation occur in both wile-type and knockout
92 alleles, but higher percentage of methylation occurs within the lacZ targeted allele
(Figure 21).
4.3.4 Id4+/-TCL1+/tg Lymphocytes are resistant to corticosteroid mediated apoptosis
prior to transformation
We further confirmed the anti-apoptotic effect of Id4 mutant cells by an ex vivo
model. To investigate the initial changes, untransformed spleen cells from 1 month old
mice were used. After Ficoll separation, spleen cells from both types of mice were treated
with Dexamethasone and Fludarabine for 24hrs. The primary cell culture conditions were
optimized, with consistent average live/death ratio ~80/20%, hybridoma medium
supplemental with 1% beta-mercaptoethanol was used. The results from 6 mice of each genotype show haploid loss of Id4 in TCL1+ lymphocytes decreases sensitivity to dexamethasone but not fludarabine-mediated apoptosis (Figure 22), suggesting a role of
Id4 in antagonizing apoptosis mediated by select lymphocytotoxic agents in B lymphocytes.
4.4 Discussion
In this study, we demonstrate that the loss of a late-methylated gene, Id4 in TCL1 mice can accelerate CLL progression. From 1 month old mice, spleen cells of Id4 mutant
TCL1 transgenic mice reveal decrease sensitivity to Dexamethsone induced apoptosis, and the elevated white blood cell counts compare to heterozygous TCL1 mice was found
93 from three month old of the age; render the potential mechanism of increased white blood
cell counts in the TCL1 mice with haploid loss of Id4. Moreover, the Kaplan-Meyer
survival curve demonstrates the accelerated death in Id4 mutant mice with TCL1
transgenic background with the immunopathology symptoms similar to CLL such as
enlarged spleen, liver and lymph nodes with B cell lymphoma developed. Notably, the
heterozygous TCL1 mice in mixed background of CD1/C3H/B6 show slower disease
progression compare with the homozygous TCL1 mice in C3H/B6, either due to the dose
of onco-protein TCL1 or the murine strain background.
Although the role of Id4 as a tumor suppressor gene has been suggested in leukemia,
direct evidence from an in vivo study is absent, and the mechanism is also obscure. Here,
we show the regulation of Id4 is through an early repressed transcription factor, Foxd3,
which is repressed by the activated NFκB pathway in TCL1 overexpressed mouse model,
suggesting Id4 is a downstream target of NFκB pathway. Furthermore, we show that
TCL1 cells with Id4 mutation are more resistant to Dexamethasone induced apoptosis
pathway. Dexamethasone is a glucocorticoid drug; in CLL cells, dexamethasone can
induce BAX and BAK conformation changes and capspase activity apoptosis
independent of p53 [235]. While apoptosis can be induced by mitochondria involved intrinsic pathway or TNF triggered extrinsic pathway, the finding that partial loss of Id4 increases resistance to dexamethasone but not fludarabine mediated apoptosis suggests the later extrinsic apoptotic pathway is most relevant to ID4 influence. Further evaluation of the pathway of apoptosis utilized by ID4 is required.
94 Different from the double transgenic TCL1 mice, which usually die due to CLL
disease from 9 to 13 month old of the age, Id4+/+TCL1+/tg mice occur to have the median
age of death at 16 months old. The methylation of Id4 is not detected in the mice younger
than 10 month old mice, indicates the loss of Id4 is delayed in the mice with only one allele of TCL1 transgene. The correlation between less amount of TCL1 oncoprotein,
delayed methylation of Id4 and prolonged disease-caused death, supports our hypothesis
of Id4 as a downstream target of TCL1 pathway (Figure 23). Interestingly, although one
might think the lacZ targeted allele already lost the normal expression level of Id4,
therefore the silencing of allele might not be required. Our results demonstrate that both
wild type and lacZ targeted allele are methylated. The even higher percentage of
methylation within the targeted allele suggests the forced silencing of the foreign
sequence overtime. This finding is consistent with a previous study, the allele-specific
methylation study by Southern blot has also shown heavier methylation of the lacZ
targeted allele in the Hic1 heterozygous knockout mice, although methylation-specific
PCR (MSP) result is not consistent with southern data in this study [236]. The finding
that the methylation on both alleles only occurs in Id4+/-TCL1+/tg mice at late stage (10-11
month old while the median age of death is 12 month old), but not in Id4+/+TCL1+/tg mice at matched age, further support the requirement of Id4 in the balanced B cell growth and death.
In summary of the findings in chapter 2-4, we have found that the pathogenesis of
CLL might be due to the deregulated miR29s and de novo DNMTs, as well as a silenced transcription factor, Foxd3 due to TCL1 activated NFκB pathways. Foxd3 targets
95 including Id4 are putative tumor suppressor genes, the loss of Foxd3 lead to the silencing
and methylation of the downstream targets and therefore lead to the transformation of anti-apoptotic CLL cells (Figure 23).
4.5 Acknowledgements
The work was supported by D. Warren Brown Foundation, Leukemia Lymphoma
Society, Chronic Lymphocytic Leukemia research consortium (CRC) and National
Cancer Institute (NCI). The authors thank Dr. Fred Sablitzky from the
University of Nottingham for kindly providing the Id4 heterozygous mice for our studies.
Thank you to the members of both the Plass lab and Byrd lab for thoughtful discussions.
96 A Id4
0% 90%
B 1200 1600 400 800 0
PGL3-Id4#1 Luc PGL3-Id4#2 Luc PGL3-Id4#3 Luc Vector control PGL3-Id4#4 Luc Foxd3 positive PGL3-Id4#5 Luc
C
Figure 17. Methylated ID4 in TCL1 mice is regulated by Foxd3 (continue).
97 Figure 17 (continue). A Schematic representation of MassARRAY assay on isolated CD19 positive B cells from two 3-month old and two 13-month old wild type mice; as well as two Eµ-TCL1 mice at each indicated timepoint were used. Amplicons for the analysis cover the region in CpG island near transcription start site. ID4 only show significant higher-methylation in mice older than 9month with symptomatic disease (P<0.05 Wilcoxon test). Star represents the average methylation frequency of amplicon in each sample. B Diagram shows the promoter activity of mouse ID4. Red bar shows the region covered with CpG island. The whole experiment was done in Raji cells with control vector or Foxd3. Relative luciferase activity is shown by comparing to the activity of pGL3 basic control vector. C The overexpression of Foxd3 in Raji cells is confirmed by western (left); both cell lines were treated with or without 0.5µM 5aza-dC. The relative expression of each gene was done by SYBR-Green real time PCR and normalized by the result of first amplified sample. Figure shows the result from triplicate experiments.
98 A
+/- +/- +/- +/-
Id4 X TCL1 +/+ P1 LacZ
Id4 +/- +/- WT +/- +/- WT +/- +/- F1 Id4 LacZ
Tcl1 +/- +/- +/- +/- +/- +/- +/- +/-
Tcl1
B
Figure 18. Methylated ID4 in TCL1 mice is accelerated by Foxd3 (continue).
99 Figure 18 (continue). A The top diagram was modified from Bedford et al. [222], shows the lacZ disrupted region of Id4 including the HLH domain. The genotyping was done by PCR amplifying lacZ, Id4 and TCL1. B Survival curves (Kaplan-Meyer life-table analysis) of the groups of F1 littermates of heterozygous TCL1 transgenic mice with or without a haploid loss of Id4 indicating a median 4 months accelerated death by the loss of Id4. The heterozygous TCL1 mice in a mixed background C3H/B6/CD1 show relatively slower and wide-range variable disease progression in comparison, as well as when compare with the homozygous transgenic TCL1 in C3H/B6 background [146, 147] (P<0.0001).
100
14 * * * ID4 +/- TCL1 tg mice * 12 ID4 WT/ TCL1 tg mice 10 8 6 4 2 0 WBCcells/ml) (10^3 counts 1mo 2mo 3mo 4mo 5mo 6mo 7mo
120% * 100% * * * * 80%
60%
40%
20% Id4+/-Tcl1+/tg Id4+/+Tcl1+/tg Percentage of CD19Percentage of B cells 0% 8mo 9mo 10mo 11mo 12mo 13mo 14mo 15mo 16mo
Figure 19. Accelerated peripheral blood lymphocytosis. Top The white blood cell counts (WBC) were tracked from 1 month to 7 month on both groups of mice. Significant elevated counts in heterozygous transgenic TCL1 mice with haploid loss of Id4 were observed at 3month (P<0.01). Bottom Counts of CD19 positive cells were measured by flow cytometry after 8 month old of the age. The consistent higher percentage of CD19 positive B cell population in the peripheral blood from the Id4 mutant group was observed at 9 to 13 month old (P<0.002). The measurement experiment stops at 14 month old of the age since only two mice left in the experimental group.
101 A
B
C
D
Figure 20. B cell infiltrations in lymphoid and non-lymphoid tissues in Id4 mutant mice with TCL1 transgene A. Left The enlarged spleen from one of the Id4 mutant mice in transgenic TCL1 background. Right Enlarged lymphoid tissue identified as B cell lymphoma at serosal/ mesenteric region of intestine. B Obliterative lymphoma is present in the periarteriolar lymphoid sheaths (white pulp) of spleen. C Evidence of circulating lymphoblasts [10] is suggested in approximately 25% of the liver sections by intrasinusoidal neoplastic cells. D Marked hippocampal neuronal necrosis was observed in the section from brain, as well as moderate multifocal cerebral, cerebellar, and meningeal hemorrhage. Circulating lymphocytosis (lymphoid leukemia) is shown in the section. (Left, 40X; Right, 400X magnification).
102 A Methylation Frequency (%)
Id4+/- Tcl+/tg 29.1% 10mo
Id4+/+ Tcl+/tg 1.3%
Id4+/- 2.8% Tcl+/tg 5mo
Id4+/+ 1.5% Tcl+/tg
B
BstUI BssHII EagI WT allele Southern probe 1. HindIII-HindIII: 2.8Kb (Methylated) 2. HindIII-BssHII: 562bp SmaI HpaII NotI 3. HindIII-EagI: 1187bp 4. HindIII-smaI: 2021bp 5. HindIII-NotI: 1190bp (Unmethylated) 6. HindIII-HpaII: 361bp 7. HindIII-BstUI: 551bp
BstUI BssHII EagI KO allele
NotI SmaI SmaI HpaII LacZ 1. HindIII-HindIII: 7.8Kb (Methylated) 2. HindIII-BssHII: 562bp 3. HindIII-EagI: 1187bp 4. HindIII-smaI: 1251bp 5. HindIII-NotI: 1190bp (Unmethylated) 6. HindIII-HpaII: 361bp 7. HindIII-BstUI: 551bp
Figure 21. Methylation status of Id4 in Id4+/-TCL1+/tg and Id4+/+TCL1+/tg mice (continue).
103
BC(continue) Primer: KO allele WT allele
Age 5m 10m 5m 10m 5m 10m Genotype +/- +/- +/- +/- +/+ +/+ BstUI/HindII EagI/HindII HpaII/HindII HindIII BssHII/HindII SmaI/HindII NotI/HindII
KO allele (7.8kb)
WT allele Methylated
(2.8kb) WT
KO
Unmethylated
D
LacZ
Bisulfite sequencing of 10mo Id4+/- blood DNA
KO allele (80%)
WT allele (10.4%)
Figure 21. Methylation status of Id4 in Id4+/-TCL1+/tg and Id4+/+TCL1+/tg mice (continue).
104 Figure 21 (continue). A. The diagram shows the structure of moue Id4 gene with the promoter region covered by CpG island (red bar), the sequence within the CpG island in the promoter region is analyzed by bisulfite sequence (green arrows). One mouse from each group at 10 and 5 month old were used for the study. The filled circle represents the methylated CG dinucleotide, while the unfilled circle represents the unmethylated CG. B. The allele specific methylation was then analyzed by Southern using the restriction enzyme that can distinguish wild type (WT) and lacZ disrupted knockout (KO) alleles. Isolated CD19 positive spleen B cells from one 11month old Id4+/-TCL1+/tg mouse was used. Combine with methylation sensitive anzymes, the methylation status of both alleles can also be studied. The enzymes used for digestion were shown on the top of the gel; the allele specific patterns are indicated by arrows. C. COBRA analysis using Id4+/-TCL1+/tg mice at 5 and 10 month old, as well as Id4+/+TCL1+/tg mice at the matched age, the digested products indicate the methylated allele, and the undigested bands demonstrate unmethylated CG sites that are tested. D. To confirm the Southern result, the cells from 11 month old Id4+/-TCL1+/tg mice were then used to perform bisulfite sequencing to check overall CGs. By the allele specific 3’ end primer, each allele can be amplified and analyzed. The diagram on the top shows the structures of WT allele and KO allele disrupted by lacZ gene. The filled circles indicate methylated CGs while the empty circles represent unmethylated CGs.
105 100% Dexamethasone 2-fara 1um 2-fara 5um
50% 24hrs drug treatment
% of live CD19 cells after * 0% 0 WT KO WT KO WT KO
Figure 22. Heterozygous loss of Id4 in TCL1+ B-cells Inhibits Dexamethasone Mediated Apoptosis. Compared with spleen cells from 6 heterozygous TCL1 mice, haploid loss of Id4 in TCL1+ lymphocytes show decreases sensitivity to Dexamethasone but not Fludarabine-mediated Apoptosis (P<0.0001)..
106 HDAC p50 p50 Foxd3 Foxd3 targets
HDAC p50 p50 Foxd3 Anti-Apoptotic CLL cells
NFκB
TCL1 Foxd3 binding sequence NFκB binding sequence ? miR29 DNMT3A Methylated cytosine DNMT3B Unmethylated cytosine
Figure 23. Proposed mechanism of TCL1 overexpression initiated accumulated aberrant epigenetic changes and anti-apoptotic CLL leukemiogenesis. Overexpressed TCL1 activated NFκB pathway leads to the silencing of Foxd3 in TCL1 mice at 1 month old. The loss of Foxd3 activator therefore leads to the inactivated downstream targets. Many of the targets are putative tumor suppressor genes, such as Id4, involved in apoptosis. The anti-apoptotic CLL cells initiated from the loss of single transcription factor or deregulated microRNA and resulted accumulation of aberrant epigenetic changes might be the potential mechanism of CLL pathogenesis.
107
CHAPTER 5
FUTURE DIRECTIONS
.
I. Early changes outside of Foxd3 gene silencing could be involved in transformation
In this current study we have focused on early methylation targets that contain Foxd3
binding sites. However, other genes including Snx5, CDK2-associated protein 2
(Cdk2AP2) and Zfp326 were found methylated even earlier than Foxd3 at 3 months in
TCL1 mice. By RLGS analysis, Cdk2AP2 was found to be methylated in spleen cells of
TCL1 mice, but not in the isolated B cells. And the COBRA analysis on Snx5 and Zf326
did not give us results consistent with RLGS analysis suggesting methylation was not present. The additional confirmed methylated genes at early stages of 5months are Mtg8,
Sox3, Fign and EphA7. These genes may bear relevance for further study in the pathogenesis of B-cell malignancies.
108 Human Fidgetin (FIGN) is located on chromosome 2q24. Fign is a newly defined gene with unknown function. Fign is expressed in almost all the tissues including spleens in adults. Fign encoded ATPase associated with diverse cellular activities (AAA proteins), The role of AAA proteins has been found as chaperons that have diverse functions. Fign double knockout mice have developmental defects such as reduced semicircular canals, skeletal abnormalities and small eyes due to cell cycle delay [237].
Whether the loss of Fign is involved in CLL cell anti-apoptosis or cell proliferation needs further elucidation.
Ephrin receptor A7 (EPHA7) is located on chromosome 6q16. Ephrin receptors belong to the protein-tyrosine kinase family. EphA7 has been shown as a target of DNA hypermethylation in TCL1 B cells [127]. There are multiple EphA7 transcripts that have been identified. Interestingly, in sorted B and T cells, only a 50kD soluble form of EphA7 is expressed. The function of the soluble form EphA7 at 50kD was suggested by an in vitro study showing the inhibition of B cell migration. Moreover, the EphA7 homozygous knockout mice show the decreased cell apoptosis and reduced caspase activity in cortical progenitor cells during neuron development [238], suggest a potential function of EphA7 in the regulation of apoptosis.
The function of Mtg8 again, has never been investigated in B cells. Human MTG8 is located on chromosome 8. MTG8 has been found interacting with cyclin AMP-dependent protein kinase in lymphocytes, which further shorten the cell doubling time and sufficient to induce tumorigenicity [239, 240]. In acute myeloid leukemia, the chromosome
109 transloction t(8;21)(q22;q22) produces the chimeric gene, RUNX1/MTG8. The chimeric protein can recruit histone deacetylase and DNMT1, further block hematopoietic differentiation and lead to AML [181]. However, there is no evidence of MTG8 involvement in CLL pathogenesis. In addition to MTG8, SOX3 is also only known as an oncogene in cancer cells. The expression of SOX3 is present in the embryonic development stage, but downregulated in the adult cell. Also, the overexpression of SOX3 has been found in many types of cancer cells. While Sox3 is methylated in TCL1 mice at
5 months, Sox3 as a tumor antigen has been suggested by showing the high expression in small lung cancer and T-cell lymphomas but not in normal adult tissue [241-243].
Whether SOX3 and MTG8 are tumor suppressor genes in B cells is still unknown.
Increased aberrant DNA hypermethylation as an early event in TCL1 mice suggesting an epigenetic therapy might prevent disease development. For this purpose, the epigenetic drugs such as Decitabine or 5-azacytidine might be applied to therapy of
TCL1 mice and trace the disease progression. Since it takes more than a year for disease to development in the mouse model, an alternative model of TCL1 cells transplanted wild type mice might be used to shorten the process [133]. Except decitabine or 5-azacytidine, there are several demethylating agents under clinical trials, such Zabularine (nucleotide analogs that traps DNMTs), or other non-nucleoside analogs, such as RG108, both targets to DNMT1 [244]. Another DNMT1 specific hypomethylating agent is Bortezomib. The expression of DNMT1 was found mediated by the Sp1/NFκB complex, Bortezomib can reduce the DNA binding activity of both Sp1 and NFκB, therefore decrease the DNMT1 expression. The induced hypomethylation was further identified in MV-4 and K562
110 exnograft mice treated with Bortezomib suggesting Bortezomib as a novel epigenetic
drug [245]. However, the only altered DNMTs in CLL cells we found was DNMT3A and
3B, whether these DNMT1-targeted drugs can also be used in CLL needs further
investigated. While the global hypomethylation in DNMT1 mutant mice have been found
contribute to tumorigenesis [93], the outcome of the DNMT1-specific demethylating
drugs treatment in TCL1 mice may not be the delayed disease; but induced global
hypomethylation and accelerated CLL progression.
While TCL1 is important in CLL disease development, the mechanism of how B cells
with TCL1 overexpression transform into tumor cells resembling human CLL is still
unknown [246]. The suggested TCL1 interaction partner AKT was found in T cells, and
the phosphorylated Akt has not been shown in CLL mice. This may be due to the level of
TCL1 in these artificial T-cell systems previously published as compared to CLL cells.
Additionally, it may be due to PTEN being present and functional in CLL cells whereas
in the cell lines studied for mechanism of TCL1 it was lost. One way to test whether
AKY pathway is involved in the initial changes of TCL1 overexpressed CLL cells is the
treatment of AKT inhibitors in CLL cells. This is also a potential method to test whether
FOXD3 is regulated by NFκB through the activation of TCL1-AKT. Other than NFκB,
Nur77 is also one of the candidates activated by TCL1-AKT. NUR77 is a transcription
factor specifically expressed in lymphoid tissues. The reduced NUR77 has been
suggested in AKT pathway while AKT phosphorylates DNA binding domain of NUR77
and therefore repress the DNA binding activity and the transactivation activity [247,
248]. Interestingly, the Nur77 binding site was also found in the promoter region of
111 30.5% methylated genes and 11% of unmethylated genes in TCL1 mice, suggesting the loss of transactivation activity of Nur77 might also be involved in the early changes of
CLL transformation, but additional studies to confirm any relationship to Nur77 is required.
II. Earlier changes promoting transcriptional silencing of Foxd3
While the idea of earlier gene silencing triggered aberrant DNA methylation in cancer cells has been suggested [249], strong in vivo evidence of this in the pathogenesis of a disease has not been definitively observed. Here we show that the methylation of Foxd3 was found significantly later than the loss of mRNA expression in TCL1 mice, supports the idea that silencing of a gene can come first and methylation comes as second to stably repress the expression. Reasons for this might include that methylation requiring new cell division and the relatively slow proliferation of these B-cells early in the genesis of transformation. Additionally, it might relate to lack of initiating methyltransferases
(DNMT3A and DNMT3B) being present early in the genesis of transformation. The early silenced Foxd3 by overexpressed TCL1 has been proven by us and the finding of the repressor complex p50:p50:HDAC1 within the promoter region of Foxd3 only in
TCL1 cells but not in normal cells suggests the regulation of Foxd3 by p50 dimer. An experiment with p50 specific shRNA might provide further support of this hypothesis.
The p50-p50 homodimer is known as a product of p105 (NFκB1) processing. The p105 pathway is known in TNF-alpha and interleukins involved immune and
112 inflammatory pathways. By the stimulation of TNF-alpha or interleukins, the IKK phosphorylation potentially by MAP kinase can release p50:p50 homodimer from p105, the phosphorylated p105 would be degraded by proteasome-polyubiquitination pathway.
The released p50-p50 homodimers are transported into nucleus and function as a repressor by recruiting HDAC1 on the target genes [250]. The activated TNF-alpha/NF-
κB pathway has been suggested involved in CLL pathogenesis [246], and the expression of NF-κB1 and MAP kinase have been suggested as good prognosis markers in CLL patients [251], suggest the early changes TNF-α/NF-κB pathway involved in early changes of CLL. Moreover, the activation of TNF-α/NF-κB has been shown to be AKT- dependent [252], suggesting the repressor complex p50:p50:HDAC1 on the promoter region of Foxd3 might be through the activation of TNF-α/NF-κB pathway by
TCL1/AKT in the CLL cells. Assay using inhibitors targeting AKT or TNF-α might provide further evidence. Additionally, NF-κB can be activated through PDK1 directly offering an alternative pathway for activation of this important transcription factor and supporting its suppressor capacity in this murine mouse model. Further study of how
TCL1 promotes enhanced expression of this NF-κB repressor complex is required.
In this study, we focused on early epigenetic changes in a CLL mouse model based upon B-cell specific transgenic expression of TCL1. This mouse model has been proven by our group and others to be highly relevant to human CLL, suggesting the changes might also occur in CLL patients. As previous described in chapter 1, CLL first degree relatives tend to have more MBL, suggesting the earliest changes of CLL in patients might occur in MBL. It would be interesting to investigate the epigenetic changes in
113 MBL by both hypomethylation and hypermethylation studies. Additionally, it would be
of great interest to see if changes such as silencing of Foxd3 and the active p50:p50
repressor complex is active in this precursor state. Identification of early changes such as
Foxd3 silencing but not other methylation changes would provide a sound role for
targeting NF-κB or HDAC1 with pharmacologic agents in an attempt to diminish the phenotype of the disease.
III. Late methylated Id4 in CLL
The outcome of activated TNFα/NFκB pathway in CLL cells has been suggested by
our finding of the increased anti-apoptosis effect on TCL1 cells with Id4 mutation, the
remaining question would be whether cells are also undergoing more proliferation. To
investigate this, the B cell stimulating mitogen, CpG685NO168 might be used to treat the
TCL1 mice with or without Id4 mutation, after treatment, the size of spleen can provide
an in vivo evidence of proliferating cells from Id4 mutant CLL cells. The potential
mechanism involved in the anti-apoptosis and potential proliferating effects can be
investigated by the expression levels of genes involved in cell cycle, cell growth or
apoptosis by microarray. The result from microarray might also provide a hint on the
bHLH binding partner of Id4 as a tumor suppressor gene. Then a Co-IP assay can be used
to screen the candidates.
Interestingly, Id4 is found as a downstream target of Foxd3 in our study. While Id4 is
methylated only in mice with severe CLL symptoms, and Foxd3 is silenced in the very
114 early stage, suggesting there are other factors involved in the silencing of Foxd3
downstream targets. Moreover, the heterozygous TCL1 transgenic mice did not present the methylation of Id4 until 11month, the timepoint all the homozygous TCL1 mice show the methylated Id4, suggesting the expression level of Foxd3 is not complete lost in the
TCL1+/tg B cells. The expressed Foxd3 might still activate the expression of Id4;
therefore the promoter of Id4 can not be stably repressed by methylation. But factors other than Foxd3 activated by TCL1 might also contribute to the methylation of genes we found in TCL1 mice. The differences in the strain of homozygous TCL1 transgenic mice
(C3H/B6) and heterozygous TCL transgenic mice (TCL1+/tg, C3H/B6/CD1) might be
another reason of the later- or un-methylated Id4 in the CLL cells. It would be interesting to study whether TCL1+/tg B cells eventually have methylated Id4, or only the
homozygous TCL1 transgenic CLL cells have methylated Id4.
IV. Potential novel diagnostic markers
In chapter 2, our data suggests the aberrant global hypomethylation might also be
involved in CLL pathogenesis. Data from different stages of CLL patients further support
this hypothesis. While many cytogenetic abnormalities occur in bad prognosis patients,
the mechanism of chromosomal aberrations in CLL patients with advanced disease is still
absent. Based on our result, the hypomethylation levels of repetitive sequences correlates
with disease development in both human and mouse CLL; one hypothesis would be the
chromosomal instability resulted from the global aberrant hypomethylation might be
involved in the mechanisms the common genetic defects in CLL patients. To further test
115 the mechanism leading to cytogenetic changes, the global hypomethylation study by
either Southern blot using repetitive sequence or an array for global 5-methlycytosine
content on the untransformed B cells from TCL1 mice (i.e. 1 month old mice) and patients with or without cytogenetic abnormalities might be able to provide further
information. Based in part upon the work described herein, efforts to correlate global methylation changes with acquisition of chromosomal abnormalities will be studied in human CLL.
In addition, the RLGS study has provide many new targets for CLL study. One potential application would be searching for a new prognostic marker. While many genes that we found in TCL1 mice are methylated in almost all the patients, but there are many others such as Axin1, a regulator of Wnt signal pathway, are methylated in about 50% patients. These genes might be diagnostic marker for disease stage prediction but further study needs to be pursued.
Finally, while the decreased miR29s correlate with the increased DNMT3A and 3B in
TCL1 mice, which might be the mechanism of increased accumulation of aberrant DNA methylation, an alternative therapy option would be treating TCL1 mice with miR29s.
But how to deliver microRNA and have functional miRs is sill uncertain. Foxd3 might be another target of therapy, overexpression Foxd3 in CLL cells from TCL1 mice and re- transplant into a wild type mice to see whether the onset of disease might be delayed would offer another direct evidence for the CLL pathogenesis induced by the loss of
Foxd3. Since Foxd3 is shown as a downstream target of NFκB, the NFκB inhibitor
116 treated 1 month old TCL1 mice might have an upregulated Foxd3 and slowed disease development as well. Such studies might have great application to the human CLL by preventing full manifestation of the disease phenotype.
117
GENE FORWARD PRIMER REVERSE PRIMER NAME MASSARRAY HUMAN PCDH10 ATAAGAATTAGTTATGTGGATGTGT ATTTCTACCAATCCTAAAATCAACC FOXD3 TTTTAAGTAGAAAGTAATTTATTAGGTTAG AAAAAAAATTTAAATACCCCC FIGN AGATATTTAGGATTTTATTTATTTATAGGG AAAAAAAACTTTCTTTCCCAC AXIN1 GTTTTGGGATTTAGGAGGGTGGAG AAAAACTTTAACTTCCCAAAAAAC PKP4 GTTAATGGGGAGGGTTAGTTTTTT CCCTCTACCCCTTACCCATAATA DLX1 AGTTTTTAGGTTTTTTGGGTTTTA CCCAACTAACCACTCCAACTC DLX1 GTGGTTAGTTGGGTTTGGAGTAAT AAAAAACTAACCTCTACCTCTAAAAC DLX1 TTAGAGGTAGAGGTTAGTTTTTTTT TAATACTACTAAACTCCCCAAACTC EPHA7 GTTTGGTAGTTGAGAGAAGGTTTGT CACACTCCAATAATATCAATTAAAAAAAA SPRY2 GGTTTTTTGTTTATTGAGAAAAA ACTACACCTACTCCATATTACCCACAAC ID4 GGTTTTATAAATATAGTTG AAAAAATCTTTACTCAATAAAC PHF2 TTTTTTTTGATAGAGTTGATTAGTT TAATTAAAACACCACTTCCTCTTTC PHF2 TTTAATTAGAAATTTAGTGGGGAA AAAACTAAAAATAAAATAAAACCCC MOUSE SOX3 GGTTTTTAAGTAGGGGTTTAGAG AACTCCATAAAAAATTTACCAATAC SOX3 GTTGGTAATAGTAGGGTTTGGAGGT CCACCAATTAAAATCTCAAAAAATTTA SOX3 GGATTTGAGTAGGTATATAAGGGAT TCAATCTCCAACAAACTATACATC EPHA7 GATTTGTTGAGGTTGTTAATAAAAA AAATCCTAAACAAAAACCAATCAAC PCDH10 GAGGGAAAATATTTTAAAGGAAAAA ATAAATATAAAAACAAAAACAACCC PCDH10 GGGTTGTTTTTGTTTTTATATTTATATTTA CTTCAACCCCAATACTTATAATCTC GPC6 GGTTTTTTTAGTTTATGTGAAGTTGAG CCACAATAAAAATATTCAACCCTAC DLX1 ATTTTGGTTAGATTTTAGGAGGT CCAACTAACCACTCCAACTC DLX1 TAGAGGGTTTTTAAATTTAGATTTT ACTTCTTCTTAAAATCACCTAATCC ID4 TTTTGAAGAGTGATAGGGGATTTATAA AACCAACCAATCAAAAAAACAATAC ID4 GTGGTATTGTTTTTTTGATTGGTT AATAACCCACCCTAATCCCTAAAC COBRA DAPK 1 GGGTTTATATTTTGAGAGGA AAAACRCAACCACCACCTC FOXD3 GTGGGTAGGGGTTTTTTAATAGTT ACAAAAAAACCAAACCTAAATAATC REAL TIME PCR HUMAN GPC6 CAACATTGAGTCGGTCATGG ATTGTAGGGCCTGAAACGTG HZNF AGTGAAGGCGCGATATGAAC TCTCTTCATCCTCCTCATCTCC EPHA7 GCTGGCTACAATTCCCTTGA CACACTTGAATGCCAGTTCC TCF8 GCTGGGAGGATGACAGAAAG GTCCTCTTCAGGTGCCTCAG PKP4 TCCTCACCAGCAAGAGAACA GGAAAGTGAACTCGGTCATCA SPRY2 GATTGCTCGGAAGTTGGTCT GGTCACTCCAGCAGGCTTAG PHF2 GCATCGTCTCCAAACAACAA AGCAGAAGGATCCTGGCTTT GOLPH4 CAGCAGGAGGACAATGTTGA GCGGTTGTCATCTCGAACTT DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 AGTGAAGCCGCCTTACTCGTACAT AGCAGTCGTTGAGTGAGAGGTTGT MOUSE FOXD3 CTGCGAGTTCATCAGCAACC TGACGAAGCAGTCGTTGAGC CHIP PCR DLX1 TTGTGCCCTTAAACCAAAGG TCAAGCACATTTTGGCAGAG DLX1 GGCTGTTTAACGCTGAAAGG AACGGGGAAATGATCTTGTG PHF2 CTCGGCCTATCTTCCACCTT AGCGGCCTCTACGTCAGC EPHA7 TGTCTCACTTCGCTCAACAAA AGGTACCACCCACCACAATC EPHA7 GTGCGAGCGAACAGGAGT TGGTGCATGAGCAGGTTTTA TABLE 5. PRIMER SEQUENCES INFORMATION
118
REFERENCES
1. National Cancer Institute SEER cancer statistic review 1975-2001. 2. Matutes, E. and A. Polliack, Morphological and immunophenotypic features of chronic lymphocytic leukemia. Rev Clin Exp Hematol, 2000. 4(1): p. 22-47. 3. Chiorazzi, N., Cell proliferation and death: forgotten features of chronic lymphocytic leukemia B cells. Best Pract Res Clin Haematol, 2007. 20(3): p. 399- 413. 4. Dighiero, G. and T.J. Hamblin, Chronic lymphocytic leukaemia. Lancet, 2008. 371(9617): p. 1017-29. 5. Messmer, B.T., et al., In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J Clin Invest, 2005. 115(3): p. 755-64. 6. Damle, R.N., et al., CD38 expression labels an activated subset within chronic lymphocytic leukemia clones enriched in proliferating B cells. Blood, 2007. 110(9): p. 3352-9. 7. Chemotherapeutic options in chronic lymphocytic leukemia: a meta-analysis of the randomized trials. CLL Trialists' Collaborative Group. J Natl Cancer Inst, 1999. 91(10): p. 861-8. 8. Matutes, E., A. Wotherspoon, and D. Catovsky, Differential diagnosis in chronic lymphocytic leukaemia. Best Pract Res Clin Haematol, 2007. 20(3): p. 367-84. 9. Matutes, E., et al., FISH analysis for BCL-1 rearrangements and trisomy 12 helps the diagnosis of atypical B cell leukaemias. Leukemia, 1999. 13(11): p. 1721-6. 10. Binet, J.-L., et al., Perspectives on the use of new diagnostic tools in the treatment of chronic lymphocytic leukemia. Blood, 2006. 107(3): p. 859-861. 11. Rai, K.R., et al., Clinical staging of chronic lymphocytic leukemia. Blood, 1975. 46(2): p. 219-34. 12. Binet, J.L., et al., A clinical staging system for chronic lymphocytic leukemia: prognostic significance. Cancer, 1977. 40(2): p. 855-64. 13. Rai, K.R., Pathophysiologic mechanisms of chronic lymphocytic leukemia and their application to therapy. Exp Hematol, 2007. 35(4 Suppl 1): p. 134-6.
119 14. Dohner, H., et al., Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med, 2000. 343(26): p. 1910-6. 15. Schroeder, H.W., Jr. and G. Dighiero, The pathogenesis of chronic lymphocytic leukemia: analysis of the antibody repertoire. Immunol Today, 1994. 15(6): p. 288-94. 16. Damle, R.N., et al., Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood, 1999. 94(6): p. 1840-7. 17. Hamblin, T.J., et al., Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood, 1999. 94(6): p. 1848-54. 18. Stilgenbauer, S., et al., Clonal evolution in chronic lymphocytic leukemia: acquisition of high-risk genomic aberrations associated with unmutated VH, resistance to therapy, and short survival. Haematologica, 2007. 92(9): p. 1242-5. 19. Wiestner, A., et al., ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood, 2003. 101(12): p. 4944-51. 20. Crespo, M., et al., ZAP-70 expression as a surrogate for immunoglobulin- variable-region mutations in chronic lymphocytic leukemia. N Engl J Med, 2003. 348(18): p. 1764-75. 21. Chen, L., et al., ZAP-70 directly enhances IgM signaling in chronic lymphocytic leukemia. Blood, 2005. 105(5): p. 2036-41. 22. Gobessi, S., et al., ZAP-70 enhances B-cell-receptor signaling despite absent or inefficient tyrosine kinase activation in chronic lymphocytic leukemia and lymphoma B cells. Blood, 2007. 109(5): p. 2032-9. 23. Richardson, S.J., et al., ZAP-70 expression is associated with enhanced ability to respond to migratory and survival signals in B-cell chronic lymphocytic leukemia (B-CLL). Blood, 2006. 107(9): p. 3584-92. 24. Castro, J.E., et al., ZAP-70 is a novel conditional heat shock protein 90 (Hsp90) client: inhibition of Hsp90 leads to ZAP-70 degradation, apoptosis, and impaired signaling in chronic lymphocytic leukemia. Blood, 2005. 106(7): p. 2506-12. 25. Hamblin, T.J., et al., Immunoglobulin V genes and CD38 expression in CLL. Blood, 2000. 95(7): p. 2455-7. 26. Hamblin, T.J., et al., CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease. Blood, 2002. 99(3): p. 1023-9. 27. Deaglio, S., et al., Human CD38 and its ligand CD31 define a unique lamina propria T lymphocyte signaling pathway. Faseb J, 2001. 15(3): p. 580-2. 28. Montserrat, E., et al., Serum beta-2 microglobulin in chronic lymphocytic leukaemia. Clin Lab Haematol, 1982. 4(3): p. 323-5. 29. Auer, R.L., J. Gribben, and F.E. Cotter, Emerging therapy for chronic lymphocytic leukaemia. Br J Haematol, 2007. 139(5): p. 635-44. 30. Keating, M.J., et al., Fludarabine: a new agent with major activity against chronic lymphocytic leukemia. Blood, 1989. 74(1): p. 19-25.
120 31. Rai, K.R., et al., Fludarabine compared with chlorambucil as primary therapy for chronic lymphocytic leukemia. N Engl J Med, 2000. 343(24): p. 1750-7. 32. Gandhi, V. and W. Plunkett, Cellular and clinical pharmacology of fludarabine. Clin Pharmacokinet, 2002. 41(2): p. 93-103. 33. Schiavone, E.M., et al., Fludarabine plus cyclophosphamide for the treatment of advanced chronic lymphocytic leukemia. Eur J Haematol, 2003. 71(1): p. 23-8. 34. Flinn, I.W., et al., Fludarabine and cyclophosphamide with filgrastim support in patients with previously untreated indolent lymphoid malignancies. Blood, 2000. 96(1): p. 71-5. 35. Eichhorst, B.F., et al., Fludarabine plus cyclophosphamide versus fludarabine alone in first-line therapy of younger patients with chronic lymphocytic leukemia. Blood, 2006. 107(3): p. 885-91. 36. Leporrier, M., et al., Randomized comparison of fludarabine, CAP, and ChOP in 938 previously untreated stage B and C chronic lymphocytic leukemia patients. Blood, 2001. 98(8): p. 2319-25. 37. Perkins, J.G., et al., Frequency and type of serious infections in fludarabine- refractory B-cell chronic lymphocytic leukemia and small lymphocytic lymphoma: implications for clinical trials in this patient population. Cancer, 2002. 94(7): p. 2033-9. 38. Keating, M.J., et al., Results of first salvage therapy for patients refractory to a fludarabine regimen in chronic lymphocytic leukemia. Leuk Lymphoma, 2002. 43(9): p. 1755-62. 39. Bosch, F., et al., Fludarabine, cyclophosphamide and mitoxantrone in the treatment of resistant or relapsed chronic lymphocytic leukaemia. Br J Haematol, 2002. 119(4): p. 976-84. 40. Johnson, S., et al., Multicentre prospective randomised trial of fludarabine versus cyclophosphamide, doxorubicin, and prednisone (CAP) for treatment of advanced-stage chronic lymphocytic leukaemia. The French Cooperative Group on CLL. Lancet, 1996. 347(9013): p. 1432-8. 41. Byrd, J.C., T.S. Lin, and M.R. Grever, Treatment of relapsed chronic lymphocytic leukemia: old and new therapies. Semin Oncol, 2006. 33(2): p. 210-9. 42. Voso, M.T., et al., Rituximab reduces the number of peripheral blood B-cells in vitro mainly by effector cell-mediated mechanisms. Haematologica, 2002. 87(9): p. 918-25. 43. McLaughlin, P., et al., Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol, 1998. 16(8): p. 2825-33. 44. O'Brien, S.M., et al., Rituximab dose-escalation trial in chronic lymphocytic leukemia. J Clin Oncol, 2001. 19(8): p. 2165-70. 45. Byrd, J.C., et al., Rituximab using a thrice weekly dosing schedule in B-cell chronic lymphocytic leukemia and small lymphocytic lymphoma demonstrates clinical activity and acceptable toxicity. J Clin Oncol, 2001. 19(8): p. 2153-64. 46. Hainsworth, J.D., et al., Single-agent rituximab as first-line and maintenance treatment for patients with chronic lymphocytic leukemia or small lymphocytic
121 lymphoma: a phase II trial of the Minnie Pearl Cancer Research Network. J Clin Oncol, 2003. 21(9): p. 1746-51. 47. Flynn, J.M. and J.C. Byrd, Campath-1H monoclonal antibody therapy. Curr Opin Oncol, 2000. 12(6): p. 574-81. 48. Keating, M.J., et al., Therapeutic role of alemtuzumab (Campath-1H) in patients who have failed fludarabine: results of a large international study. Blood, 2002. 99(10): p. 3554-61. 49. Rai, K.R., et al., Alemtuzumab in previously treated chronic lymphocytic leukemia patients who also had received fludarabine. J Clin Oncol, 2002. 20(18): p. 3891- 7. 50. Hillmen, P., et al., Alemtuzumab compared with chlorambucil as first-line therapy for chronic lymphocytic leukemia. J Clin Oncol, 2007. 25(35): p. 5616-23. 51. Byrd, J.C., et al., Phase 1 study of lumiliximab with detailed pharmacokinetic and pharmacodynamic measurements in patients with relapsed or refractory chronic lymphocytic leukemia. Clin Cancer Res, 2007. 13(15 Pt 1): p. 4448-55. 52. Byrd, J.C., et al., Randomized phase 2 study of fludarabine with concurrent versus sequential treatment with rituximab in symptomatic, untreated patients with B-cell chronic lymphocytic leukemia: results from Cancer and Leukemia Group B 9712 (CALGB 9712). Blood, 2003. 101(1): p. 6-14. 53. Tam, C.S. and M.J. Keating, Chemoimmunotherapy of chronic lymphocytic leukemia. Best Pract Res Clin Haematol, 2007. 20(3): p. 479-98. 54. Rai KR, B.J., Peterson BL, et al., A phase II study of fludarabine followed by alemtuzumab in previously untreated CLL patients with active disease. Blood, 2002. 100: p. 205a. 55. Crawford, D.H. and D. Catovsky, In vitro activation of leukaemic B cells by interleukin-4 and antibodies to CD40. Immunology, 1993. 80(1): p. 40-4. 56. Robak, T., Novel monoclonal antibodies for the treatment of chronic lymphocytic leukemia. Curr Cancer Drug Targets, 2008. 8(2): p. 156-71. 57. Shim, Y.K., et al., B cells behaving badly. Br J Haematol, 2007. 139(5): p. 658- 62. 58. Linet, M.S., et al., Chronic lymphocytic leukaemia: an overview of aetiology in light of recent developments in classification and pathogenesis. Br J Haematol, 2007. 139(5): p. 672-86. 59. Weiss, N.S., Geographical variation in the incidence of the leukemias and lymphomas. Natl Cancer Inst Monogr, 1979(53): p. 139-42. 60. Cuttner, J., Increased incidence of hematologic malignancies in first-degree relatives of patients with chronic lymphocytic leukemia. Cancer Invest, 1992. 10(2): p. 103-9. 61. Raval, A., et al., Downregulation of Death-Associated Protein Kinase 1 (DAPK1) in Chronic Lymphocytic Leukemia. Cell, 2007. 129(5): p. 879-90. 62. Chiorazzi, N., K.R. Rai, and M. Ferrarini, Chronic lymphocytic leukemia. N Engl J Med, 2005. 352(8): p. 804-15. 63. Herve, M., et al., Unmutated and mutated chronic lymphocytic leukemias derive from self-reactive B cell precursors despite expressing different antibody reactivity. J Clin Invest, 2005. 115(6): p. 1636-43.
122 64. Marti, G.E., et al., Diagnostic criteria for monoclonal B-cell lymphocytosis. Br J Haematol, 2005. 130(3): p. 325-32. 65. Marti, G., et al., Overview of monoclonal B-cell lymphocytosis. Br J Haematol, 2007. 139(5): p. 701-8. 66. de Tute, R., et al., Monoclonal B-cell lymphocytosis (MBL) in CLL families: substantial increase in relative risk for young adults. Leukemia, 2006. 20(4): p. 728-9. 67. Ferguson, A.T., et al., Role of estrogen receptor gene demethylation and DNA methyltransferase.DNA adduct formation in 5-aza-2'deoxycytidine-induced cytotoxicity in human breast cancer cells. J Biol Chem, 1997. 272(51): p. 32260- 6. 68. Kaneda, M., et al., Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting. Nature, 2004. 429(6994): p. 900-3. 69. Pickering, B.M., et al., Pharmacological inhibitors of NF-kappaB accelerate apoptosis in chronic lymphocytic leukaemia cells. Oncogene, 2007. 26(8): p. 1166-77. 70. Chen, T. and E. Li, Establishment and maintenance of DNA methylation patterns in mammals. Curr Top Microbiol Immunol, 2006. 301: p. 179-201. 71. Li, E., Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet, 2002. 3(9): p. 662-73. 72. Ghoshal, K. and S. Bai, DNA methyltransferases as targets for cancer therapy. Drugs Today (Barc), 2007. 43(6): p. 395-422. 73. Walsh, C.P., J.R. Chaillet, and T.H. Bestor, Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat Genet, 1998. 20(2): p. 116-7. 74. Ozanne, S.E. and M. Constancia, Mechanisms of disease: the developmental origins of disease and the role of the epigenotype. Nat Clin Pract Endocrinol Metab, 2007. 3(7): p. 539-46. 75. Tra, J., et al., Infrequent occurrence of age-dependent changes in CpG island methylation as detected by restriction landmark genome scanning. Mech Ageing Dev, 2002. 123(11): p. 1487-503. 76. Gardiner-Garden, M. and M. Frommer, CpG islands in vertebrate genomes. J Mol Biol, 1987. 196(2): p. 261-82. 77. Berger, S.L., The complex language of chromatin regulation during transcription. Nature, 2007. 447(7143): p. 407-12. 78. Jones, P.A. and S.B. Baylin, The fundamental role of epigenetic events in cancer. Nat Rev Genet, 2002. 3(6): p. 415-28. 79. Esteller, M., Cancer epigenomics: DNA methylomes and histone-modification maps. Nat Rev Genet, 2007. 8(4): p. 286-98. 80. Ramchandani, S., et al., DNA methylation is a reversible biological signal. Proc Natl Acad Sci U S A, 1999. 96(11): p. 6107-12. 81. Bhattacharya, S.K., et al., A mammalian protein with specific demethylase activity for mCpG DNA. Nature, 1999. 397(6720): p. 579-83. 82. Shi, Y., et al., Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell, 2004. 119(7): p. 941-53.
123 83. Tsukada, Y., et al., Histone demethylation by a family of JmjC domain-containing proteins. Nature, 2006. 439(7078): p. 811-6. 84. Whetstine, J.R., et al., Reversal of histone lysine trimethylation by the JMJD2 family of histone demethylases. Cell, 2006. 125(3): p. 467-81. 85. Tan, H., et al., The JMJD2 members of histone demethylase revisited. Mol Biol Rep, 2007. 86. Katoh, Y. and M. Katoh, Comparative integromics on JMJD2A, JMJD2B and JMJD2C: preferential expression of JMJD2C in undifferentiated ES cells. Int J Mol Med, 2007. 20(2): p. 269-73. 87. Yuille, M.R., et al., TCL1 is activated by chromosomal rearrangement or by hypomethylation. Genes Chromosomes Cancer, 2001. 30(4): p. 336-41. 88. Deguchi, Y., S. Negoro, and S. Kishimoto, Methylation of c-myc gene changes in human lymphoproliferative diseases. Biosci Rep, 1987. 7(8): p. 637-43. 89. Hanada, M., et al., bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood, 1993. 82(6): p. 1820-8. 90. Wahlfors, J., et al., Genomic hypomethylation in human chronic lymphocytic leukemia. Blood, 1992. 80(8): p. 2074-80. 91. Lyko, F., et al., Quantitative analysis of DNA methylation in chronic lymphocytic leukemia patients. Electrophoresis, 2004. 25(10-11): p. 1530-5. 92. Howard, G., et al., Activation and transposition of endogenous retroviral elements in hypomethylation induced tumors in mice. Oncogene, 2008. 27(3): p. 404-8. 93. Gaudet, F., et al., Induction of tumors in mice by genomic hypomethylation. Science, 2003. 300(5618): p. 489-92. 94. Rush, L.J., et al., Epigenetic profiling in chronic lymphocytic leukemia reveals novel methylation targets. Cancer Res, 2004. 64(7): p. 2424-33. 95. Liu, T.H., et al., CpG island methylation and expression of the secreted frizzled- related protein gene family in chronic lymphocytic leukemia. Cancer Res, 2006. 66(2): p. 653-8. 96. Yu, L., et al., Global assessment of promoter methylation in a mouse model of cancer identifies ID4 as a putative tumor-suppressor gene in human leukemia. Nat Genet, 2005. 37(3): p. 265-74. 97. Chim, C.S., et al., Infrequent Wnt inhibitory factor-1 (Wif-1) methylation in chronic lymphocytic leukemia. Leuk Res, 2006. 30(9): p. 1135-9. 98. Chim, C.S., et al., Methylation of INK4 and CIP/KIP families of cyclin-dependent kinase inhibitor in chronic lymphocytic leukaemia in Chinese patients. J Clin Pathol, 2006. 59(9): p. 921-6. 99. Tsirigotis, P., et al., Mutational and methylation analysis of the cyclin-dependent kinase 4 inhibitor (p16INK4A) gene in chronic lymphocytic leukemia. Eur J Haematol, 2006. 76(3): p. 230-6. 100. Pinyol, M., et al., p16(INK4a) gene inactivation by deletions, mutations, and hypermethylation is associated with transformed and aggressive variants of non- Hodgkin's lymphomas. Blood, 1998. 91(8): p. 2977-84. 101. Raval, A., et al., TWIST2 demonstrates differential methylation in immunoglobulin variable heavy chain mutated and unmutated chronic lymphocytic leukemia. J Clin Oncol, 2005. 23(17): p. 3877-85.
124 102. Corcoran, M., et al., ZAP-70 methylation status is associated with ZAP-70 expression status in chronic lymphocytic leukemia. Haematologica, 2005. 90(8): p. 1078-88. 103. Valencia-Sanchez, M.A., et al., Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev, 2006. 20(5): p. 515-24. 104. Hackanson B, B.K., Brena RM, Chen SS, Jiang J, Maharry K, Whitman SP, Schmittgen TM, Lübbert M, Marcucci G, Bloomfield CD, Plass C. , Dual epigenetic control of CCAAT/enhancer binding protein α (C/EBPα) expression in acute myeloid leukemia. Cancer Res, 2008. In press. 105. Preall, J.B. and E.J. Sontheimer, RNAi: RISC gets loaded. Cell, 2005. 123(4): p. 543-5. 106. Calin, G.A., et al., MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci U S A, 2004. 101(32): p. 11755-60. 107. Calin, G.A., et al., A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med, 2005. 353(17): p. 1793-801. 108. Cimmino, A., et al., miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A, 2005. 102(39): p. 13944-9. 109. Akao, Y., et al., Downregulation of microRNAs-143 and -145 in B-cell malignancies. Cancer Sci, 2007. 98(12): p. 1914-20. 110. Pekarsky, Y., et al., Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res, 2006. 66(24): p. 11590-3. 111. Fabbri, M., et al., MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A, 2007. 104(40): p. 15805-10. 112. Issa, J.P., et al., Phase 1 study of low-dose prolonged exposure schedules of the hypomethylating agent 5-aza-2'-deoxycytidine (decitabine) in hematopoietic malignancies. Blood, 2004. 103(5): p. 1635-40. 113. Plimack, E.R., H.M. Kantarjian, and J.P. Issa, Decitabine and its role in the treatment of hematopoietic malignancies. Leuk Lymphoma, 2007. 48(8): p. 1472- 81. 114. Inoue, S., et al., Inhibition of histone deacetylase class I but not class II is critical for the sensitization of leukemic cells to tumor necrosis factor-related apoptosis- inducing ligand-induced apoptosis. Cancer Res, 2006. 66(13): p. 6785-92. 115. Lucas, D.M., et al., The histone deacetylase inhibitor MS-275 induces caspase- dependent apoptosis in B-cell chronic lymphocytic leukemia cells. Leukemia, 2004. 18(7): p. 1207-14. 116. Dai, Y., et al., Interactions between bortezomib and romidepsin and belinostat in chronic lymphocytic leukemia cells. Clin Cancer Res, 2008. 14(2): p. 549-58. 117. Byrd, J.C., et al., A phase 1 and pharmacodynamic study of depsipeptide (FK228) in chronic lymphocytic leukemia and acute myeloid leukemia. Blood, 2005. 105(3): p. 959-67. 118. Zhang, L., et al., Differential expression of histone post-translational modifications in acute myeloid and chronic lymphocytic leukemia determined by
125 high-pressure liquid chromatography and mass spectrometry. J Am Soc Mass Spectrom, 2004. 15(1): p. 77-86. 119. Bokelmann, I. and U. Mahlknecht, Valproic acid sensitizes chronic lymphocytic leukemia cells to apoptosis and restores the balance between pro- and antiapoptotic proteins. Mol Med, 2008. 14(1-2): p. 20-7. 120. Plumb, J.A., et al., Pharmacodynamic response and inhibition of growth of human tumor xenografts by the novel histone deacetylase inhibitor PXD101. Mol Cancer Ther, 2003. 2(8): p. 721-8. 121. Lu, Y.S., et al., Efficacy of a novel histone deacetylase inhibitor in murine models of hepatocellular carcinoma. Hepatology, 2007. 46(4): p. 1119-30. 122. Chen, C.S., et al., Histone deacetylase inhibitors sensitize prostate cancer cells to agents that produce DNA double-strand breaks by targeting Ku70 acetylation. Cancer Res, 2007. 67(11): p. 5318-27. 123. Zapata, J.M., et al., TNF receptor-associated factor (TRAF) domain and Bcl-2 cooperate to induce small B cell lymphoma/chronic lymphocytic leukemia in transgenic mice. Proc Natl Acad Sci U S A, 2004. 101(47): p. 16600-5. 124. Lehmann, S., et al., Molecular allelokaryotyping of early-stage, untreated chronic lymphocytic leukemia. Cancer, 2008. 112(6): p. 1296-305. 125. Fernandez, V., et al., Gene expression profile and genomic changes in disease progression of early-stage chronic lymphocytic leukemia. Haematologica, 2008. 93(1): p. 132-6. 126. Shanafelt, T.D., et al., Prospective evaluation of clonal evolution during long- term follow-up of patients with untreated early-stage chronic lymphocytic leukemia. J Clin Oncol, 2006. 24(28): p. 4634-41. 127. Dawson DW, H.J., Shen RR, French SW, Troke JJ, Wu YZ, Chen SS, Gui D, Regelson M, Marahrens Y, Morse HC, Said J, Plass C, Teitell MA., Global DNA methylation profiling reveals silencing of a secreted form of Epha7 in mouse and human germinal center B-cell lymphomas. Oncogene, 2007. published Jan 29, 2007. 128. Said, J.W., et al., TCL1 oncogene expression in B cell subsets from lymphoid hyperplasia and distinct classes of B cell lymphoma. Lab Invest, 2001. 81(4): p. 555-64. 129. Petock, J.M., et al., Structure of murine Tcl1 at 2.5 A resolution and implications for the TCL oncogene family. Acta Crystallogr D Biol Crystallogr, 2001. 57(Pt 11): p. 1545-51. 130. Kunstle, G., et al., Identification of Akt association and oligomerization domains of the Akt kinase coactivator TCL1. Mol Cell Biol, 2002. 22(5): p. 1513-25. 131. Laine, J., et al., The protooncogene TCL1 is an Akt kinase coactivator. Mol Cell, 2000. 6(2): p. 395-407. 132. Masayuki Noguchi, V.R., Christian Roumestand, and Futoshi Suizu Proto- oncogene TCL1: more than just as a coactivator for Akt. The FASEB Journal, 2007. published Mar 14, 2007. 133. Zanesi, N., et al., Effect of rapamycin on mouse chronic lymphocytic leukemia and the development of nonhematopoietic malignancies in Emu-TCL1 transgenic mice. Cancer Res, 2006. 66(2): p. 915-20.
126 134. Katsumata, M., et al., Differential effects of Bcl-2 on T and B cells in transgenic mice. Proc Natl Acad Sci U S A, 1992. 89(23): p. 11376-80. 135. Danilov, A.V., et al., Molecular pathogenesis of chronic lymphocytic leukemia. Curr Mol Med, 2006. 6(6): p. 665-75. 136. Dillon, S.R., et al., An APRIL to remember: novel TNF ligands as therapeutic targets. Nat Rev Drug Discov, 2006. 5(3): p. 235-46. 137. Ougolkov, A.V., et al., Inhibition of glycogen synthase kinase-3 activity leads to epigenetic silencing of nuclear factor kappaB target genes and induction of apoptosis in chronic lymphocytic leukemia B cells. Blood, 2007. 110(2): p. 735- 42. 138. Tracey, L., et al., Expression of the NF-kappaB targets BCL2 and BIRC5/Survivin characterizes small B-cell and aggressive B-cell lymphomas, respectively. J Pathol, 2005. 206(2): p. 123-34. 139. O'Brien, S., et al., Randomized phase III trial of fludarabine plus cyclophosphamide with or without oblimersen sodium (Bcl-2 antisense) in patients with relapsed or refractory chronic lymphocytic leukemia. J Clin Oncol, 2007. 25(9): p. 1114-20. 140. O'Brien, S.M., et al., Phase I to II multicenter study of oblimersen sodium, a Bcl-2 antisense oligonucleotide, in patients with advanced chronic lymphocytic leukemia. J Clin Oncol, 2005. 23(30): p. 7697-702. 141. Byrd, J.C., et al., Treatment of relapsed chronic lymphocytic leukemia by 72-hour continuous infusion or 1-hour bolus infusion of flavopiridol: results from Cancer and Leukemia Group B study 19805. Clin Cancer Res, 2005. 11(11): p. 4176-81. 142. Byrd, J.C., et al., Flavopiridol administered using a pharmacologically derived schedule is associated with marked clinical efficacy in refractory, genetically high-risk chronic lymphocytic leukemia. Blood, 2007. 109(2): p. 399-404. 143. Phillips, J.A., et al., The NZB mouse as a model for chronic lymphocytic leukemia. Cancer Res, 1992. 52(2): p. 437-43. 144. Calin, G.A., et al., Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A, 2002. 99(24): p. 15524-9. 145. Raveche, E.S., et al., Abnormal microRNA-16 locus with synteny to human 13q14 linked to CLL in NZB mice. Blood, 2007. 109(12): p. 5079-86. 146. Bichi, R., et al., Human chronic lymphocytic leukemia modeled in mouse by targeted TCL1 expression. Proc Natl Acad Sci U S A, 2002. 99(10): p. 6955-60. 147. Johnson, A.J., et al., Characterization of the TCL-1 transgenic mouse as a preclinical drug development tool for human chronic lymphocytic leukemia. Blood, 2006. 108(4): p. 1334-8. 148. Yan, X.J., et al., B cell receptors in TCL1 transgenic mice resemble those of aggressive, treatment-resistant human chronic lymphocytic leukemia. Proc Natl Acad Sci U S A, 2006. 103(31): p. 11713-8. 149. Pekarsky, Y., G.A. Calin, and R. Aqeilan, Chronic lymphocytic leukemia: molecular genetics and animal models. Curr Top Microbiol Immunol, 2005. 294: p. 51-70.
127 150. Caligaris-Cappio, F. and T.J. Hamblin, B-cell chronic lymphocytic leukemia: a bird of a different feather. J Clin Oncol, 1999. 17(1): p. 399-408. 151. Rawstron, A.C., F. Bennett, and P. Hillmen, The biological and clinical relationship between CD5+23+ monoclonal B-cell lymphocytosis and chronic lymphocytic leukaemia. Br J Haematol, 2007. 139(5): p. 724-9. 152. Herling, M., et al., TCL1 shows a regulated expression pattern in chronic lymphocytic leukemia that correlates with molecular subtypes and proliferative state. Leukemia, 2006. 20(2): p. 280-5. 153. Martelli, A.M., et al., Phosphoinositide 3-kinase/Akt signaling pathway and its therapeutical implications for human acute myeloid leukemia. Leukemia, 2006. 20(6): p. 911-28. 154. Horie, R., NF-kappaB in pathogenesis and treatment of adult T-cell leukemia/lymphoma. Int Rev Immunol, 2007. 26(5-6): p. 269-81. 155. Cheson, B.D., et al., National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood, 1996. 87(12): p. 4990-7. 156. Wendel-Hansen, V., et al., Epstein-Barr virus (EBV) can immortalize B-cll cells activated by cytokines. Leukemia, 1994. 8(3): p. 476-84. 157. Costello, J.F., et al., Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat Genet, 2000. 24(2): p. 132-8. 158. Frommer, M., et al., A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A, 1992. 89(5): p. 1827-31. 159. Brena, R.M., et al., Accurate quantification of DNA methylation using combined bisulfite restriction analysis coupled with the Agilent 2100 Bioanalyzer platform. Nucleic Acids Res, 2006. 34(3): p. e17. 160. Saeed, A.I., et al., TM4: a free, open-source system for microarray data management and analysis. Biotechniques, 2003. 34(2): p. 374-8. 161. Costello, J.F., D.J. Smiraglia, and C. Plass, Restriction landmark genome scanning. Methods, 2002. 27(2): p. 144-9. 162. Smiraglia, D.J., et al., Restriction landmark genomic scanning (RLGS) spot identification by second generation virtual RLGS in multiple genomes with multiple enzyme combinations. BMC Genomics, 2007. 8: p. 446. 163. Cohen J., C.P., Applied Multiple Regression/ Correlation Analysis for the Behavioral Sciences, 2nd Edition. Hillsdale, N.J. Lawrence Erlbum Associates Inc, 1983. 164. Hollander M., W.D.A., Nonparametric Statistical Methods, 2nd Edition. New York (NY): John Wiley & Sons Inc, 1999. 165. Opavsky, R., et al., CpG island methylation in a mouse model of lymphoma is driven by the genetic configuration of tumor cells. PLoS Genet, 2007. 3(9): p. 1757-69. 166. Rush, L.J. and C. Plass, Alterations of DNA methylation in hematologic malignancies. Cancer Lett, 2002. 185(1): p. 1-12. 167. Smiraglia, D.J. and C. Plass, The study of aberrant methylation in cancer via restriction landmark genomic scanning. Oncogene, 2002. 21(35): p. 5414-26.
128 168. Kelberman, D. and M.T. Dattani, Hypopituitarism oddities: congenital causes. Horm Res, 2007. 68 Suppl 5: p. 138-44. 169. Nakanishi, H., et al., ALL1 fusion proteins induce deregulation of EphA7 and ERK phosphorylation in human acute leukemias. Proc Natl Acad Sci U S A, 2007. 104(36): p. 14442-7. 170. Filmus, J., Glypicans in growth control and cancer. Glycobiology, 2001. 11(3): p. 19R-23R. 171. Ying, J., et al., Functional epigenetics identifies a protocadherin PCDH10 as a candidate tumor suppressor for nasopharyngeal, esophageal and multiple other carcinomas with frequent methylation. Oncogene, 2006. 25(7): p. 1070-80. 172. Dao, D.Y., et al., Axin1 and Axin2 are regulated by TGF- and mediate cross-talk between TGF- and Wnt signaling pathways. Ann N Y Acad Sci, 2007. 1116: p. 82-99. 173. Tadokoro, Y., et al., De novo DNA methyltransferase is essential for self-renewal, but not for differentiation, in hematopoietic stem cells. J Exp Med, 2007. 204(4): p. 715-22. 174. Orchard, J.A., et al., ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet, 2004. 363(9403): p. 105-11. 175. Baylin, S.B. and J.E. Ohm, Epigenetic gene silencing in cancer - a mechanism for early oncogenic pathway addiction? Nat Rev Cancer, 2006. 6(2): p. 107-16. 176. Bock, C., et al., CpG island methylation in human lymphocytes is highly correlated with DNA sequence, repeats, and predicted DNA structure. PLoS Genet, 2006. 2(3): p. e26. 177. Feltus, F.A., et al., Predicting aberrant CpG island methylation. Proc Natl Acad Sci U S A, 2003. 100(21): p. 12253-8. 178. Fang, F., et al., Predicting methylation status of CpG islands in the human brain. Bioinformatics, 2006. 22(18): p. 2204-9. 179. Das, R., et al., Computational prediction of methylation status in human genomic sequences. Proc Natl Acad Sci U S A, 2006. 103(28): p. 10713-6. 180. Di Croce, L., et al., Methyltransferase recruitment and DNA hypermethylation of target promoters by an oncogenic transcription factor. Science, 2002. 295(5557): p. 1079-82. 181. Liu, S., et al., Interplay of RUNX1/MTG8 and DNA methyltransferase 1 in acute myeloid leukemia. Cancer Res, 2005. 65(4): p. 1277-84. 182. Brenner, C., et al., Myc represses transcription through recruitment of DNA methyltransferase corepressor. Embo J, 2005. 24(2): p. 336-46. 183. Bachman, K.E., et al., Histone modifications and silencing prior to DNA methylation of a tumor suppressor gene. Cancer Cell, 2003. 3(1): p. 89-95. 184. Leu, Y.W., et al., Loss of estrogen receptor signaling triggers epigenetic silencing of downstream targets in breast cancer. Cancer Res, 2004. 64(22): p. 8184-92. 185. Chen, C.H., et al., Bidirectional signals transduced by DAPK-ERK interaction promote the apoptotic effect of DAPK. Embo J, 2005. 24(2): p. 294-304. 186. Frissora, F., et al., IFN-gamma-mediated inhibition of antigen receptor-induced B cell proliferation and CREB-1 binding activity requires STAT-1 transcription factor. Eur J Immunol, 2003. 33(4): p. 907-12.
129 187. Huttenhofer, A., J. Brosius, and J.P. Bachellerie, RNomics: identification and function of small, non-messenger RNAs. Curr Opin Chem Biol, 2002. 6(6): p. 835-43. 188. Kel, A.E., et al., MATCH: A tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res, 2003. 31(13): p. 3576-9. 189. Wingender, E., et al., TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res, 2000. 28(1): p. 316-9. 190. Thompson, J.D., D.G. Higgins, and T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 1994. 22(22): p. 4673-80. 191. Jin, V.X., et al., A computational genomics approach to identify cis-regulatory modules from chromatin immunoprecipitation microarray data--a case study using E2F1. Genome Res, 2006. 16(12): p. 1585-95. 192. Sutton, J., et al., Genesis, a winged helix transcriptional repressor with expression restricted to embryonic stem cells. J Biol Chem, 1996. 271(38): p. 23126-33. 193. Tada, Y., et al., Epigenetic modulation of tumor suppressor CCAAT/enhancer binding protein alpha activity in lung cancer. J Natl Cancer Inst, 2006. 98(6): p. 396-406. 194. Guo, Y., et al., The embryonic stem cell transcription factors Oct-4 and FoxD3 interact to regulate endodermal-specific promoter expression. Proc Natl Acad Sci U S A, 2002. 99(6): p. 3663-7. 195. Alkhateeb, A., P.R. Fain, and R.A. Spritz, Candidate functional promoter variant in the FOXD3 melanoblast developmental regulator gene in autosomal dominant vitiligo. J Invest Dermatol, 2005. 125(2): p. 388-91. 196. Lehmann, O.J., et al., Fox's in development and disease. Trends Genet, 2003. 19(6): p. 339-44. 197. Katoh, M. and M. Katoh, Human FOX gene family (Review). Int J Oncol, 2004. 25(5): p. 1495-500. 198. Berry, F.B., R.A. Saleem, and M.A. Walter, FOXC1 transcriptional regulation is mediated by N- and C-terminal activation domains and contains a phosphorylated transcriptional inhibitory domain. J Biol Chem, 2002. 277(12): p. 10292-7. 199. Arden, K.C., FoxOs in tumor suppression and stem cell maintenance. Cell, 2007. 128(2): p. 235-7. 200. Fuxa, M. and J.A. Skok, Transcriptional regulation in early B cell development. Curr Opin Immunol, 2007. 19(2): p. 129-36. 201. Hu, H., et al., Foxp1 is an essential transcriptional regulator of B cell development. Nat Immunol, 2006. 7(8): p. 819-26. 202. Chang, X., P. Zheng, and Y. Liu, FoxP3: a genetic link between immunodeficiency and autoimmune diseases. Autoimmun Rev, 2006. 5(6): p. 399-402. 203. Hromas, R., et al., Drosophila forkhead homologues are expressed in a lineage- restricted manner in human hematopoietic cells. Blood, 1993. 81(11): p. 2854-9.
130 204. Brandenberger, R., et al., Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation. Nat Biotechnol, 2004. 22(6): p. 707-16. 205. Tomescot, A., et al., Differentiation in vivo of cardiac committed human embryonic stem cells in postmyocardial infarcted rats. Stem Cells, 2007. 25(9): p. 2200-5. 206. Regad, T., et al., The neural progenitor-specifying activity of FoxG1 is antagonistically regulated by CKI and FGF. Nat Cell Biol, 2007. 9(5): p. 531-40. 207. Tompers, D.M., et al., Foxd3 is required in the trophoblast progenitor cell lineage of the mouse embryo. Dev Biol, 2005. 285(1): p. 126-37. 208. Pan, G., et al., A negative feedback loop of transcription factors that controls stem cell pluripotency and self-renewal. Faseb J, 2006. 20(10): p. 1730-2. 209. Saha, A., et al., Helicobacter pylori-induced H,K-ATPase {alpha}-subunit gene repression is mediated by NF-{kappa}B p50 homodimer promoter binding. Am J Physiol Gastrointest Liver Physiol, 2008. 294(3): p. G795-807. 210. Baer, M., et al., Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol, 1998. 18(10): p. 5678-89. 211. Plaksin, D., P.A. Baeuerle, and L. Eisenbach, KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells. J Exp Med, 1993. 177(6): p. 1651-62. 212. Zhong, H., et al., The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell, 2002. 9(3): p. 625-36. 213. Lu, D., et al., Activation of the Wnt signaling pathway in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A, 2004. 101(9): p. 3118-23. 214. Lagneaux, L., et al., TGF-beta activity and expression of its receptors in B-cell chronic lymphocytic leukemia. Leuk Lymphoma, 1998. 31(1-2): p. 99-106. 215. Yu, H.M., et al., The role of Axin2 in calvarial morphogenesis and craniosynostosis. Development, 2005. 132(8): p. 1995-2005. 216. Cobos, I., et al., Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy. Nat Neurosci, 2005. 8(8): p. 1059-68. 217. Airik, R., et al., Tbx18 regulates the development of the ureteral mesenchyme. J Clin Invest, 2006. 116(3): p. 663-74. 218. Kim, I., T.L. Saunders, and S.J. Morrison, Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells. Cell, 2007. 130(3): p. 470-83. 219. Miller, K., S.M. Kolk, and M.J. Donoghue, EphA7-ephrin-A5 signaling in mouse somatosensory cortex: developmental restriction of molecular domains and postnatal maintenance of functional compartments. J Comp Neurol, 2006. 496(5): p. 627-42. 220. Hayashi, H. and T. Kume, Forkhead transcription factors regulate expression of the chemokine receptor CXCR4 in endothelial cells and CXCL12-induced cell migration. Biochem Biophys Res Commun, 2008. 367(3): p. 584-9.
131 221. Rizzoti, K. and R. Lovell-Badge, SOX3 activity during pharyngeal segmentation is required for craniofacial morphogenesis. Development, 2007. 134(19): p. 3437-48. 222. Bedford, L., et al., Id4 is required for the correct timing of neural differentiation. Dev Biol, 2005. 280(2): p. 386-95. 223. Kee, Y. and M. Bronner-Fraser, Id4 expression and its relationship to other Id genes during avian embryonic development. Mech Dev, 2001. 109(2): p. 341-5. 224. Wu, Q., et al., Amplification and overexpression of the ID4 gene at 6p22.3 in bladder cancer. Mol Cancer, 2005. 4(1): p. 16. 225. Welcsh, P.L., et al., BRCA1 transcriptionally regulates genes involved in breast tumorigenesis. Proc Natl Acad Sci U S A, 2002. 99(11): p. 7560-5. 226. Beger, C., et al., Identification of Id4 as a regulator of BRCA1 expression by using a ribozyme-library-based inverse genomics approach. Proc Natl Acad Sci U S A, 2001. 98(1): p. 130-5. 227. Hagiwara, K., et al., Frequent DNA methylation but not mutation of the ID4 gene in malignant lymphoma. J Clin Exp Hematop, 2007. 47(1): p. 15-8. 228. Peddada, S., D.H. Yasui, and J.M. LaSalle, Inhibitors of differentiation (ID1, ID2, ID3 and ID4) genes are neuronal targets of MeCP2 that are elevated in Rett syndrome. Hum Mol Genet, 2006. 15(12): p. 2003-14. 229. Andres-Barquin, P.J., M.C. Hernandez, and M.A. Israel, Id4 expression induces apoptosis in astrocytic cultures and is down-regulated by activation of the cAMP- dependent signal transduction pathway. Exp Cell Res, 1999. 247(2): p. 347-55. 230. Rivera, R. and C. Murre, The regulation and function of the Id proteins in lymphocyte development. Oncogene, 2001. 20(58): p. 8308-16. 231. Lasorella, A., T. Uo, and A. Iavarone, Id proteins at the cross-road of development and cancer. Oncogene, 2001. 20(58): p. 8326-33. 232. Hara, E., M. Hall, and G. Peters, Cdk2-dependent phosphorylation of Id2 modulates activity of E2A-related transcription factors. Embo J, 1997. 16(2): p. 332-42. 233. Yuen, H.F., et al., Id proteins expression in prostate cancer: high-level expression of Id-4 in primary prostate cancer is associated with development of metastases. Mod Pathol, 2006. 19(7): p. 931-41. 234. Kersten, C., et al., BMP-6 inhibits human bone marrow B lymphopoiesis-- upregulation of Id1 and Id3. Exp Hematol, 2006. 34(1): p. 72-81. 235. Bellosillo, B., et al., Spontaneous and drug-induced apoptosis is mediated by conformational changes of Bax and Bak in B-cell chronic lymphocytic leukemia. Blood, 2002. 100(5): p. 1810-6. 236. Chen, W.Y., et al., Heterozygous disruption of Hic1 predisposes mice to a gender-dependent spectrum of malignant tumors. Nat Genet, 2003. 33(2): p. 197- 202. 237. Cox, G.A., et al., The mouse fidgetin gene defines a new role for AAA family proteins in mammalian development. Nat Genet, 2000. 26(2): p. 198-202. 238. Depaepe, V., et al., Ephrin signalling controls brain size by regulating apoptosis of neural progenitors. Nature, 2005. 435(7046): p. 1244-50.
132 239. Fukuyama, T., et al., MTG8 proto-oncoprotein interacts with the regulatory subunit of type II cyclic AMP-dependent protein kinase in lymphocytes. Oncogene, 2001. 20(43): p. 6225-32. 240. Wang, J., M. Wang, and J.M. Liu, Transformation properties of the ETO gene, fusion partner in t(8:21) leukemias. Cancer Res, 1997. 57(14): p. 2951-5. 241. Kim, R., et al., Genome-based identification of cancer genes by proviral tagging in mouse retrovirus-induced T-cell lymphomas. J Virol, 2003. 77(3): p. 2056-62. 242. Xia, Y., et al., The oncogenic potential of the high mobility group box protein Sox3. Cancer Res, 2000. 60(22): p. 6303-6. 243. Gure, A.O., et al., Serological identification of embryonic neural proteins as highly immunogenic tumor antigens in small cell lung cancer. Proc Natl Acad Sci U S A, 2000. 97(8): p. 4198-203. 244. Fandy, T.E., H. Carraway, and S.D. Gore, DNA demethylating agents and histone deacetylase inhibitors in hematologic malignancies. Cancer J, 2007. 13(1): p. 40- 8. 245. Liu, S., et al., Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-kappaB-dependent DNA methyltransferase activity in acute myeloid leukemia. Blood, 2008. 111(4): p. 2364-73. 246. Pekarsky, Y., et al., Animal models for chronic lymphocytic leukemia. J Cell Biochem, 2007. 100(5): p. 1109-18. 247. Masuyama, N., et al., Akt inhibits the orphan nuclear receptor Nur77 and T-cell apoptosis. J Biol Chem, 2001. 276(35): p. 32799-805. 248. Pekarsky, Y., et al., Akt phosphorylates and regulates the orphan nuclear receptor Nur77. Proc Natl Acad Sci U S A, 2001. 98(7): p. 3690-4. 249. Clark, S.J. and J. Melki, DNA methylation and gene silencing in cancer: which is the guilty party? Oncogene, 2002. 21(35): p. 5380-7. 250. Beinke, S. and S.C. Ley, Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology. Biochem J, 2004. 382(Pt 2): p. 393-409. 251. Rodriguez, A., et al., Molecular heterogeneity in chronic lymphocytic leukemia is dependent on BCR signaling: clinical correlation. Leukemia, 2007. 21(9): p. 1984-91. 252. Ozes, O.N., et al., NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature, 1999. 401(6748): p. 82-5.
133