Induction of Cdc25b Regulates Cell Cycle Resumption After Genotoxic Stress Pallavi Bansal and John S

Research Article

Induction of Cdc25B Regulates Cell Cycle Resumption after Genotoxic Stress Pallavi Bansal and John S. Lazo

Department of Pharmacology, University of Pittsburgh Drug Discovery Institute, University of Pittsburgh, Pittsburgh, Pennsylvania

Abstract providing the first stimulus of Cdk1 activity (6). Therefore, Cdc25B Cdc25 phosphatases propel cell cycle progression by activating potentially has a unique role in initiating mitosis that warrants cyclin-dependent kinases (Cdk). DNA damage is generally further investigation. thought to inhibit Cdc25 functionality by inducing proteasomal Cdc25A and Cdc25B but not Cdc25C have documented degradation of Cdc25A and phosphorylation-mediated seques- oncogenic properties (7). Overexpression of Cdc25B in human tration of Cdc25B and Cdc25C to the cytoplasm. More recently, tumors correlates with poor prognosis (8–10) and ectopic Cdc25B a critical role for Cdc25B in the resumption of cell cycle overexpression in mammary glands increases susceptibility to progression through mitosis after DNA damage has been breast cancer induction by 9,10-dimethyl-1,2benzanthracene (11). identified. In this study, the fate of Cdc25B after mechanistically Previously, we found that benzo(a)pyrene diol epoxide, the ultimate distinct DNA-damaging agents (etoposide, cisplatin, bleomycin, carcinogen found in cigarette smoke, increases Cdc25B expression ionizing irradiation, or UV irradiation) was examined, and in lung cancer cells, indicating that Cdc25B could contribute to benzo(a)pyrene diol epoxide induced lung carcinogenesis (12). surprisingly a rapid increase in cellular Cdc25B levels was observed after DNA damage. Using UV irradiation as the Eukaryotic cells have evolved surveillance mechanisms to guard prototypic damaging agent, we found that the increase in their DNA from genotoxic stress (13). One critical mechanism is Cdc25B levels was checkpoint dependent and was controlled by inhibition of cell cycle progression, thus allowing cells to repair a p53-independent mechanism. Cdc25B levels controlled the damaged DNA and preventing replication or transmission of number of cells progressing into mitosis after UV, but they did altered DNA to the next generation (13). To induce cell cycle arrest, a complex signaling network is used to activate checkpoint kinases not affect G2-M checkpoint engagement immediately after DNA damage. Increased Cdc25B reduced the time required for cell Chk1 and Chk2 (14). These kinases induce proteasome-mediated degradation of Cdc25A (15–20) and cytoplasmic retention of cycle resumption. These data support a model in which Cdc25B 216 accumulation is an important anticipatory event for cell cycle Cdc25C mediated by phosphorylation of Ser (21). Cdc25B has resumption after DNA damage. [Cancer Res 2007;67(7):3356–63] also been reported to be affected by at least some forms of genotoxic stress. Thus, in response to UV, activation of the p38/ mitogen-activated protein kinase-activated protein kinase 2 signal- Introduction 309 ing pathway leads to phosphorylation of Cdc25B at Ser and The Cdc25 subfamily of the protein tyrosine phosphatases are subsequent 14-3-3 binding in vitro (22). Binding to 14-3-3 is thought important regulators of mammalian cell cycle checkpoints, which to restrict Cdc25B to the cytoplasm (23, 24). However, the nature of control proliferation and genomic integrity (1). Cdc25 was initially the genotoxic insult as well as the magnitude of the DNA damage identified in fission yeast as a mitotic inducer (2). The three may influence the final fate of Cdc25 family members (25, 26). mammalian homologues Cdc25A, Cdc25B, and Cdc25C positively Although DNA damage clearly can cause cell cycle arrest, the regulate cell cycle progression by activating their cyclin-dependent factors that control resumption of cell cycle have only recently kinase (Cdk)/cyclin substrates. Cdc25A primarily activates G1-S become the subject of attention. It seems that several components specific Cdks (1) and is required for entry of cells into the S phase of the eukaryotic checkpoint signaling pathway are essential for and also regulates G2-M progression (3). Cdc25B and Cdc25C have resumption of cell cycle progression after genotoxic stress in a a more restricted role in promoting progression from G2 phase to process known as ‘‘recovery’’ (27). Specifically, polo-like kinase 1 mitosis. Thus, microinjection of neutralizing Cdc25B and Cdc25C and the serine/theronine phosphatase PPM1D were shown to antibodies into cells results in mitotic delay (4). Despite the regulate cell cycle resumption after DNA damage–induced G2 seemingly similarity in functions, Cdc25B and Cdc25C have arrest (28, 29). Chk1 and claspin, a regulator of Chk1 activation, are temporally distinct roles in cells with Cdc25B activity peaking targeted for degradation after replication stress to facilitate before Cdc25C (4). Cdc25B seems to activate a cytoplasmic pool of resumption after genotoxic stress (30–32). The tyrosine phospha- Cdk1/cyclin B, triggering centrosomal microtubule nucleation (5). tase Cdc25B is also thought to be essential in regulating resump- Moreover, Cdc25B undergoes Aurora-A dependent phosphorylation tion of cell cycle progression after genotoxic stress (28, 33). Thus, at the centrosome, which may permit entry into mitosis by we have reevaluated the effects of different types of DNA-damaging agents on Cdc25B. We now report that mechanistically distinct DNA-damaging agents rapidly induced Cdc25B expression and that levels of Cdc25B determined the kinetics of cell cycle resumption Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). after DNA damage–induced cell cycle arrest. Requests for reprints: John S. Lazo, Department of Pharmacology, Drug Discovery Institute, Biomedical Science Tower 3, Suite 10040, 3501 Fifth Avenue, University of Pittsburgh, Pittsburgh, PA 15260. Phone: 412-648-9200; Fax: 412-648-9009; E-mail: Materials and Methods [email protected]. I2007 American Association for Cancer Research. Cell culture and chemicals. A549 cells (ATTC, Manassas, VA) were doi:10.1158/0008-5472.CAN-06-3685 maintained in basal medium Eagle supplemented with 1% fetal bovine

Cancer Res 2007; 67: (7). April 1, 2007 3356 www.aacrjournals.org

+/+ serum (FBS), 1% L-glutamine, and 1% penicillin-streptomycin; p53 , previously (12). The PCR conditions for the amplification of Cdc25B and À À À À p53 / , and Chk2 / HCT116cells (a gift from Prof. Bert Vogelstein, Johns b-actin genes were 24 cycles at 94jC for 30 s, 55jC for 30 s, and 72jCfor Hopkins University) in McCoy’s medium with 10% FBS and 1% penicillin- 1 min, followed by a final incubation at 72jC for 7 min. Amplified products streptomycin; HeLa (ATTC) in DMEM with 10% FBS, 1% penicillin- were separated by 2% agarose gel electrophoresis, and bands were streptomycin; wild-type and knockout Cdc25B mouse embryonic fibroblasts visualized by staining with ethidium bromide.

(MEF; a gift from Dr. Peter Donovan, Johns Hopkins University) in DMEM G2 checkpoint recovery assay and flow cytometry. For G2 checkpoint with 20% FBS, 1% L-glutamine, and 1% penicillin-streptomycin; recovery assay, we plated U2OS cells for 24 h and induced Cdc25B by and U2OS-expressing HA-Cdc25B3 under tetracycline-regulated promoter thoroughly washing cells and culturing in the absence of tetracycline for (a gift from Prof. Bernard Ducommun, Universite´Paul Sabatier) in DMEM 16h. After the 16-hinduction, cells were mock or UV treated (as indicated) supplemented with 10% FBS, G418 (100 Ag/mL), 1% penicillin-streptomycin, and cells were either harvested at the indicated time points (asynchronous and 2 Ag/mL tetracycline. Etoposide, cisplatin, and bleomycin were cells) or were trapped in mitosis with a 23-h nocodazole (1 Amol/L) obtained from Sigma-Aldrich Co. (St. Louis, MO). Caffeine, nocodazole, incubation. For HCT116Scr and Cdc25B4#2 cells, cells were plated for MG132, and tetracycline were purchased from Calbiochem (La Jolla, CA). 24 h and were either mock or UV treated (as indicated). Cycling cells were Cells were plated and incubated for 24 h at 25% to 30% density before UV or then trapped in mitosis with an 18-h nocodazole (1 Amol/L) incubation. compounds exposure (Stratagene, UVC Cross linker, La Jolla CA). Identification of mitotic cells was carried out by simultaneously staining Antibodies and western blotting. Cdc25B was detected with cells with propidium iodide (PI) and phospho-histone H3 (Ser10)as a monoclonal antibody from BD Transduction Laboratories (Lexington, described previously (34). Briefly, cells were fixed overnight in 70% ethanol KY). Antibodies for p53, Chk1 (Ser345), and poly(ADP-ribose) polymerase and permeabilized with PBS, 0.25% Triton X100 for 8 min on ice. After were obtained from Cell Signaling Technology (Danvers, MA). Cdc25A, washing in PBS–1% bovine serum albumin, cells were incubated with 1 Ag Cdc25C, and Chk1 were detected with antibodies from Santa Cruz of anti–phospho-histone H3 for 2 h. Cells were again washed before Biotechnology (Santa Cruz, CA). Phospho-histone H3 antibody was incubating with antirabbit IgG Alexa 488 (1:75 for U20S and 1:100 for purchased from Upstate Biotechnology (Lake Placid, NY), anti-HA antibody HCT116cells) for 40 min in the dark. After cell washing and resuspension in from Covance (Berkeley, CA), and h-tubulin antibody from Cedarlane 500 AL PI for 15 min, 20,000 cells were analyzed by fluorescence-activated Laboratories (Hornby, Ontario, Canada). Bound primary antibodies were cell sorting and WinMDI to determine phospho-histone H3 positive cells. detected with either horseradish peroxidase (HRP)–goat anti-mouse antibody or HRP-goat anti-rabbit antibody (Jackson ImmunoResearch, West Grove, PA), and proteins were visualized by chemiluminescence using Results the enhanced chemiluminescence reagent (Amersham Pharmacia, Piscat- Cdc25B induction by DNA damage. After an extensive away, NJ). Cell were harvested and lysed in modified radioimmunopreci- pitation assay buffer [50 mmol/L Tris (pH 7.6), 1% Triton X-100, 0.1% SDS, investigation of commercially available Cdc25B antibodies to detect endogenous Cdc25B, we determined that an anti-Cdc25B 150 mmol/L NaCl, 1 mmol/L EDTA, 2 mmol/L Na3VO4, 12 mmol/L h-glycerol phosphate, 10 mmol/L NaF, 10 Ag/mL aprotinin, 10 Ag/mL monoclonal antibody from BD Transduction Laboratories was leupeptin, 100 Ag/mL 4-(2-aminoethyl)-benzenesulfonylfluoride hydrochlo- most specific. As shown in the Fig. 1A, this Cdc25B monoclonal ride, 10 Ag/mL soybean trypsin inhibitor, and 1 mmol/L phenylmethylsul- antibody detected two bands in the lysates of wild-type Cdc25B fonyl fluoride], incubated on ice for 30 min with brief vortex mixing every MEFs in a region of the predicted molecular mass (f65 kDa) of Â 10 min, and centrifuged at 13,000 g for 15 min to clear the lysates. Cdc25B, whereas in the Cdc25B null MEF lysates only the lower Western blotting was done as described (12) with the exception that band was detected even after loading more lysate (Fig. 1A, lane 3). proteins were transferred overnight to a nitrocellulose membrane at 30 V to These results confirmed that the upper band was Cdc25B. Other allow maximum protein transfer. commercially available antibodies to Cdc25B cross-reacted with RNA interference and RNA measurements. The vector for creating Cdc25B knockdown HCT116cells was obtained from Ambion (Austin, TX; many additional bands and were unaffected in the MEFs lacking pSilencer 4.1 containing a gene for puromycin resistance). Oligonucleotides Cdc25B or after shRNAi (data not shown). With the BD encoding short hairpin RNA interference (shRNAi) targeting Cdc25B (target Transduction antibody, the Cdc25B band ran closer to the sequence for Cdc25B4 vector AAAGGCGGCTACAAGGAGTTC or Cdc25B3 recombinant His-tagged human Cdc25B2 protein, further support- vector GTTCAGCAACATCGTGGATAA) were ligated into the vector ing that the upper band was indeed Cdc25B. This was further according to the manufacturer’s instructions. Vector expressing interference corroborated by a decreased expression of Cdc25B in the clones RNA with limited homology to any known sequence (scramble vector) was picked after Cdc25B-specific shRNAi treatment (Fig. 1B). Similar provided by the manufacturer and used as a negative control. The pSilencer results were obtained when we used Cdc25B smartpool (Dharma- plasmid was transfected in HCT116using LipofectAMINE Plus (Invitrogen, con) in transient transfection assays (Supplementary Fig. S1). Carlsbad, CA) according to manufacturer’s instructions, and 24 h after Notably, Cdc25B specific shRNAi/siRNA did not decrease the levels transfection, cells were replated and allowed to attach overnight. Thereafter, clones were selected with 0.5 Ag/mL puromycin. Clones were picked of the nonspecific lower band. 2 weeks later, expanded by culturing in the presence of 0.5 Ag/mL Thus, for all subsequent experiments, we used the BD puromycin, and screened for Cdc25B knockdown using Western blotting. Transduction monoclonal antibody to detect endogenous Cdc25B For Cdc25B smartpool small interfering RNA (siRNA; Dharmacon, Inc., in cells. To investigate the effects of DNA-damaging agents on Lafayette, CO) transfection, HCT116cells were plated and incubated for endogenous Cdc25B expression, we treated asynchronous A549 24 h to yield 50% to 55% density. Cells were transfected according to cells with different clinically used anticancer drugs: topoisomerase manufacturer’s recommendation (Invitrogen). Briefly, 100 nmol/L of Cdc25B II poison etoposide (30 Amol/L), DNA cross-linker cisplatin smartpool siRNA was transfected using LipofectAMINE 2000, and 24 h later (25 Amol/L), and radiomimetic bleomycin (25 Amol/L) for 0, 1, 4, cells were split to yield 30% to 35% density the next day when harvested. and 24 h (Fig. 1B). These drug concentrations were based on Reverse transcription–PCR. Total RNA was extracted from cells using previous published findings revealing significant DNA damage RNeasy (Qiagen, Valencia, CA). cDNA was synthesized from 2 Ag of RNA using random hexamer (Amersham, Buckinghamshire, United Kingdom) (35, 36). Unexpectedly, all of these agents increased cellular with Superscript RNase H reverse transcriptase (Life Technologies, Inc., Cdc25B protein levels within 1 h (Fig. 1B). With etoposide Gaithersburg, MD). The reverse-transcribed cDNA from each sample was treatment, Cdc25B was elevated for at least 24 h, whereas, with subjected to PCR amplification using Taq polymerase (Promega, Madison, cisplatin and bleomycin treatment, the increase in Cdc25B was WI) and primers. The sequence of the primers used was as described more transient and basal levels were seen at 24 h. Treatment with www.aacrjournals.org 3357 Cancer Res 2007; 67: (7). April 1, 2007

as indicated by using isogenic HCT116cells that expressed or lacked p53 (Fig. 2B). We also studied the effect of UV on Cdc25B wild-type and null MEFs. Cdc25B expression was increased in the Cdc25B wild-type MEFs, whereas no Cdc25B was detected in Cdc25B null cells as expected (Fig. 2C). Furthermore, Cdc25B induction was attenuated in cells stably expressing Cdc25B shRNAi (Cdc25B4#2) compared with cells with scrambled shRNAi (Fig. 2C). Finally, to study the effect of UV irradiation on overexpressed Cdc25B, we treated U20S cells expressing a tetracycline-regulated HA-tagged Cdc25B. After removal of tetracycline from the medium, HA-Cdc25B expression was induced and cells were either mock or UV treated. Cells treated with UV expressed more HA-Cdc25B at 24 h and 48 h compared with the mock-treated cells. Induction of exogenous Cdc25B was confirmed using an antibody to the HA-epitope tag (Fig. 2C). We next determined the minimum dose of UV required to increase endogenous Cdc25B expression. In A549 cells, doses as

Figure 1. Agents causing different forms of DNA damage–induced endogenous Cdc25B protein levels. A, early passage of Cdc25B wild-type (+/+) and null (À/À) MEFs were harvested to analyze the Cdc25B expression. RP, recombinant full-lengthpurified humanHis-tagged Cdc25B2. Cdc25B expression was also analyzed in cells selected for stable knock down of Cdc25B. Arrow, Cdc25B; asterisks, nonspecific band; LE, long exposure. B, A549 cells were treated with DMSO or etoposide (30 Amol/L), cisplatin (25 Amol/L), and bleomycin (25 Amol/L) and harvested at different time points. HCT116 cells were treated with IR (10 Gy) and harvested at different time points. Levels of indicated proteins were examined by Western blotting. Representative of n = 4-6. anticancer drugs did not affect the levels of the lower band (data not shown). As expected, treatment with these drugs decreased Cdc25A and transcriptionally increased p53 levels, although the kinetics for p53 induction was slower than that for Cdc25B. Addi- tionally, Cdc25B levels increased within 1 h after treatment with 10 Gy of ionizing irradiation, a prototypical DNA-damaging agent, with levels remaining high for at least 4 h (Fig. 1B). The kinetics of Cdc25B increase after ionizing irradiation was similar to that of p53. Therefore, Cdc25B induction was a promiscuous response shared by mechanistically distinct DNA-damaging agents, and this observation supports our previous finding that the DNA-damaging carcinogen, benzo(a)pyrene diol epoxide, increases Cdc25B expression in these lung cancer cells. p53 independence of Cdc25B induction by UV. We next Figure 2. Cdc25B induction by UV is independent of p53 levels. A, A549 and examined the effect of DNA damage by UV irradiation on Cdc25B HeLa cells were washed with PBS twice and then irradiated with 60 J/m2 of UV in the absence of medium. After exposure, cell culture medium was added and expression. As shown in Fig. 2A, A549 cells treated with UV cells were harvested at different time points for determination of endogenous 2 (60 J/m ) had increased Cdc25B protein levels within 30 min after Cdc25B expression by Western blotting. B, HCT116 (p53+/+) and HCT116 À/À +/+ À/À irradiation and the levels were persistently increased for 24 h (p53 ) cells were treated as described for (A). C, Cdc25B and Cdc25B MEFs were treated as described above. HCT116 Scr and Cdc25B4#2 cells posttreatment. Because of a previous report (22) showing that were treated witheithermock or UV (60 J/m 2) for 16 has indicated. NS, Cdc25B levels were unaffected in HeLa cells exposed to UV, we nonspecific band. U2OS cells were cultured either in the presence or absence of tetracycline to induce HA-Cdc25B3, and the effect of either mock or UV (15 J/m2) examined the effect of UV irradiation on endogenous Cdc25B irradiation on exogenous Cdc25B was analyzed at the indicated time points. expression in HeLa cells to exclude cell type–specific effects. We D, A549 cells were treated withdifferent doses of UV, and 1 hlater cells were observed increased Cdc25B levels within 30 min after UV exposure, harvested. We plated 800 HCT116 (p53+/+) cells in 6-cm dish, and 24 h later cells were treated with different doses of UV. The surviving clones were harvested which remained elevated for at least 24 h, similar to A549 cells 8 d posttreatment for Cdc25B expression. Levels of indicated proteins were (Fig. 2A). Furthermore, Cdc25B induction was independent of p53, examined by Western blotting. Representative of n = 4-6.

Cancer Res 2007; 67: (7). April 1, 2007 3358 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Cdc25B and Genotoxic Stress low as 15 J/m2 were sufficient to induce Cdc25B within 1 h (Fig. 2D). To examine the effect of UV treatment on endogenous Cdc25B expression in a long-term assay, we treated HCT116 (p53+/+) cells with UV doses ranging from 5 to 60 J/m2 and harvested clones 8 days later. In this assay, doses at z5 J/m2 induced significant levels of Cdc25B (Fig. 2D). The effect of doses >15 J/m2 could not be evaluated due to toxicity and lack of sufficient colonies for analysis. These results support previous findings, demonstrating an increase in Cdc25B levels after chronic exposure to ionizing radiation (37). Checkpoint regulates Cdc25B induction. Checkpoint activation in response to DNA damage results in the Chk1-dependent phosphorylation of Cdc25A and Cdc25C (15, 18, 21). Because Cdc25B has canonical Chk1/Chk2 phosphorylation sites and Chk1 has been shown to phosphorylate Cdc25B (38, 39), it is reasonable to hypothesize that Cdc25B induction might be checkpoint- regulated. Indeed, Chk1 was rapidly phosphorylated and activated in HCT116cells after UV treatment (Fig. 3 A). To investigate the role of ATR/Chk1 pathway, we pretreated cells with caffeine (5 mmol/L) to block ATR/ATM activation for 30 min before mock or UV (60 J/m2) irradiation. As illustrated in Fig. 3A, pretreatment with caffeine blocked the increase in Cdc25B seen 1 h after UV exposure. Similar results were also observed in A549 cells (data not shown). To determine the role of Chk1 in Cdc25B up-regulation, we Figure 3. Cdc25B induction after UV irradiation is regulated by ATR/Chk1. A, HCT116 cells were pretreated withvehicleor caffeine (5 mmol/L) for 30 min pretreated cells with UCN-01 (300 nmol/L) for 30 min and measured before UV (60 J/m2) or mock irradiation for 1 h. B, HCT116 cells were pretreated Cdc25B levels 1 h after mock or UV treatment (60 J/m2). UCN-01 withUCN-01 (300 nmol/L) for 30 min or vehiclebefore UV (60 J/m 2) or mock blocked the increase in Cdc25B expression with UV (Fig. 3B). irradiation for 1 h. Representative of n =4. UCN-01 prevented loss of Cdc25A after UV (Supplementary Fig. S2), confirming the efficacy of UCN-01 in inhibiting Chk1 activity. These results also highlight the mechanistically distinct regulation of In the absence of DNA damage, 69.2 F 2.8% of control cells (Scr; Cdc25A and Cdc25B isoforms by checkpoint signaling after DNA n = 3) and 59.4 F 4.0% of Cdc25B depleted cells (n = 3) were À À damage. We also examined Cdc25B induction in HCT116Chk2 / trapped in mitosis (Fig. 4B and C), consistent with previous studies cells. Cells were either mock or UV (60 J/m2) treated and harvested suggesting Cdc25B is not required for normal cell cycle progression 1 h later. As shown in Supplementary Fig. S3, the increase in Cdc25B (41). After 30 J/m2 UV, we observed a slight decrease in percentage level was independent of Chk2. We also noted similar Cdc25B of cells trapped in mitosis by nocodazole for control cells (60.3 F mRNA levels 4 h after UV treatment using semiquantitative reverse 0.5%; n = 4), whereas only 40.5 F 1.1% of Cdc25B depleted cells transcription-PCR (Supplementary Fig. S4). The labile nature of (n = 4) were arrested in mitosis. The difference in mitotic trapping Cdc25B was confirmed by MG132-mediated proteasomal inhibition, was even more pronounced at a higher dose of UV (60 J/m2), in which revealed increased Cdc25B levels by 24 h (Supplementary which 25.0 F 1.1% of control cells (n = 5) and 14.7 F 0.6% of Fig. S4C). These results support previous findings, showing Cdc25B depleted cells (n = 5) were trapped in mitosis. At both proteasome-mediated degradation of Cdc25B (40). Collectively, doses of UV, the difference between Scr and Cdc25B depleted cells our results support a model that the increase in Cdc25B protein was statistically significant (Fig. 4D). Interestingly, with all of the levels after UV is regulated by ATR/Chk1 pathway via posttran- conditions, f80% of the cell population was in G2-M (Fig. 4D), scriptional mechanism, potentially by affecting Cdc25B protein suggesting that, even after DNA damage, a majority of cells could stability. progress from G1 and S phase into G2 phase but entry into mitosis Cdc25B regulates mitotic entry after DNA damage. Recent was dependent on levels of Cdc25B and was directly correlated to evidence suggests that Cdc25B, but not Cdc25A or Cdc25C, the intensity of DNA damage. These results were confirmed using regulates cell cycle reentry after DNA damage produced by different shRNAi against Cdc25B (Supplementary Fig. S5), suggest- doxorubicin (28). Stimulated by our observation that Cdc25B ing that this was not due simply to an off-target effect of a single expression was increased within 1 h in cells after exposure to shRNAi. mechanistically distinct DNA-damaging agents, we hypothesized To understand how increased levels of Cdc25B affected cellular that levels of Cdc25B might be crucial in regulating the rate of cell progression after DNA damage, we exploited a previously described cycle resumption after DNA damage–induced cell cycle arrest. tetracycline-regulated U2OS cell system (33). Ectopic HA-Cdc25B Thus, asynchronous cells were treated with mock or UV irradiation, expression was induced before treatment with either mock or UV and cells exiting G2 were trapped in mitosis with nocodazole irradiation (Fig. 5A). In the absence of DNA damage, 73.5 F 1.4% of (1 Amol/L) treatment for 18 h (HCT116) or 23 h (U2OS). Mitotic control cells (+tet) were trapped in mitosis by nocodazole, which arrest was detected either by probing lysates with a phospho- was similar to Cdc25B overexpressing (Àtet) cells (69.4 F 1.1%; histone H3 (Ser10) antibody or by staining cells with PI and Fig. 5B and C). In the presence of DNA damage (UV at 30 J/m2), phospho-histone H3 (Ser10) and analyzing cells with a flow however, 4.1 F 0.3% of UV exposed control (+tet) cells and 8.1 F cytometer. To examine the effect of Cdc25B in this assay, we 0.5% of UV exposed Cdc25B overexpressing (Àtet) cells were reduced intracellular Cdc25B levels by >75% using shRNAi (Fig. 4A). trapped in mitosis by nocodazole (Fig. 5B–D). In our experiments, www.aacrjournals.org 3359 Cancer Res 2007; 67: (7). April 1, 2007

Figure 4. Depletion of Cdc25B decreases the entry into mitosis after DNA damage. A, HCT116 cells were transfected with scramble (Scr) and Cdc25BB4#2 shRNAi. Clones were selected to enhance Cdc25B depletion. Asynchronous cells were harvested to analyzed Cd25B levels. B, Western blot analysis of phospho-histone (Ser10; mitosis marker) in Scr (controls cells) and Cdc25B shRNAi cells after mock or UV (60 J/m2) irradiation and subsequent treatment with 1 Amol/L nocodazole for 18 hto trap cells in mitosis. C, cells were fixed at the end of 18 h of trapping, and phospho-histone H3 positive cells were determined. D, bar graphand histogram representation of the data in (C). Columns, mean (n = 3–5); bars, SE. Statistical significance was determined by two-tailed unpaired t test. ***, P < 0.0001. Histogram: percentage, mean of cells in G2-M.

U20S cells were more sensitive to the toxic effects of UV compared normalized to unirradiated controls, 0.36 F 0.01% of control with HCT116cells (data not shown). Also, HCT116cells are cells and 0.34 F 0.02% of Cdc25B-overexpressing cells were in deficient in the mismatch repair protein hMLH1, which impairs mitosis (Fig. 6B). At 12 h posttreatment, the G2-M checkpoint was F their ability to arrest in G2-M for prolonged period after DNA still enforced in control cells (0.22 0.01%) whereas Cdc25B- damage (42). overexpressing cells resumed cell cycle followed by an increase in Finally, if Cdc25B were important in the regulation of cell cycle the percentage of the population in mitosis (0.86 F 0.06%; Fig. 6A resumption, then cells expressing more Cdc25B should exit the and B). Collectively, these results show that Cdc25B had a G2-M checkpoint earlier than control cells. To test this hypothesis, fundamental role in cells progression into mitosis after DNA we induced Cdc25B for 16h by removing tetracycline and treated damage and checkpoint exit. asynchronous cells with either mock or UV irradiation (15 J/m2). At 2, 4, and 8 h of posttreatment, phospho-histone H3 (Ser10) staining decreased indicative of a loss of the mitotic population and the Discussion engagement of a G2-M checkpoint, which was independent of It is well documented that Cdc25s are targeted in response to Cdc25B levels (Supplementary Fig. S6). In contrast, at 12 and 24 h, DNA damage but the exact contributions of the three mammalian Cdc25B overexpressing cells (Àtet) recovered from G2-M check- Cdc25 homologues toward the resumption of cell cycle progression point, whereas in control cells (+tet), the G2-M checkpoint was still are not completely understood. Interestingly, Cdc25A stabilization enforced. Similar results were observed by examining phospho- does not seem to be sufficient to overcome ionizing or UV histone H3 (Ser10) using flow cytometry (Fig. 6A). Four hours after irradiation–induced S phase checkpoints (16). In addition, Cdc25C UV treatment, control and Cdc25B-overexpressing cells had fewer knockout cells have normal G2-M checkpoint response (43). These mitotic cells compared with the corresponding mock-treated cells findings indicate additional regulators cooperate to regulate cell consistent with the activation of the G2-M checkpoint. When cycle progression after DNA damage. In this report, we describe a

Cancer Res 2007; 67: (7). April 1, 2007 3360 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Cdc25B and Genotoxic Stress previously unrecognized elevation in endogenous Cdc25B after phosphorylation at Ser309 after DNA damage (47), was rapidly DNA damage generated by diverse types of genotoxic insults. We induced after DNA damage and propose that this helps regulate propose that elevation in Cdc25B is an anticipatory response to cell cycle resumption. One could envisage that Cdc25B phosphor- 309 resume cell cycle after DNA damage–induced cell cycle arrest. ylation at Ser is operative only in the G2 cell population to Our results are in contrast with one report (22), in which no prevent premature entry into mitosis in the presence of DNA increase in Cdc25B levels were observed 1 to 2 h after UV (20 J/m2) damage. The decrease in mitotic cells at 4 h after UV, which was irradiation. One potential explanation for the differences in the independent of Cdc25B expression (Fig. 6), could be due to the lack experimental results could be the reagents used to detect endo- of dephosphorylation of Cdc25B Ser309, which is important for genous Cdc25B. The nature and specificity of the antibody used in progression through mitosis (48, 49). A key issue that needs to be those experiments are not clear. At the time of the previous publi- resolved, however, is how opposing functions are orchestrated in cation, Cdc25B null cells and Cdc25B shRNAi were unavailable. We an orderly manner to allow cells to recover from the effects of have observed that several commercially available antibodies are DNA-damaging agents without compromising genomic integrity. useful when Cdc25B is overexpressed but fail to detect endogenous One possible explanation is that in the period immediately after Cdc25B (data not shown). Other possible explanation could be the DNA damage, checkpoints regulating cell cycle arrest are more difference in the response of splice variants to DNA damage. There active, thus allowing time for DNA repair. This would be in are five splice variants of Cdc25B (44), and it is possible that Bulavin agreement with our data showing that cells overexpressing Cdc25B et al. (22) were detecting a splice variant which was not regulated in were arrested normally after DNA damage. Nonetheless, they response to DNA damage. This seem unlikely, however, as the resumed cell cycle progression significantly earlier than control monoclonal antibody used in our assay should detect all the splice cells (Fig. 6). As described previously (17, 20), degradation of variants. Nonetheless, this warrants further analysis. Cdc25A is a key event in arresting cells in G2 after DNA damage, The biochemical factors that regulate cell cycle resumption after whereas our data suggest that accumulation of Cdc25B regulates DNA damage are still being defined. Interestingly, at least some cell cycle resumption. Based on this, we proposed that initial cell factors that participate in the canonical checkpoint response cycle arrest after DNA damage might be more dependent on the seem to also regulate cell cycle resumption. Thus, Plk1, a well- loss of Cdc25A, whereas Cdc25B accumulation regulates cell cycle characterized checkpoint target, is inhibited in response to DNA resumption. This could explain the absence of checkpoint defects damage by ATM/ATR to induce cell cycle arrest (45, 46). Plk1 also in Cdc25BC double knockouts immediately after exposure to regulates cell cycle resumption after DNA damage–induced cell ionizing radiation (41). Cell cycle reentry after UV irradiation was cycle arrest (28). We now show that Cdc25B, which can be inhibited not formally studied in this background. Although a rapid increase by p38/mitogen-activated protein kinase-activated protein kinase 2 in Cdc25B expression would seem premature for its role in cell

Figure 5. Cdc25B regulates cell cycle resumption after DNA damage. A, expression of HA-tagged Cdc25B in U2OS cells expressing Cdc25B under the control of tetracycline-regulated promoter for 16 h. Cdc25B was detected using a HA antibody. B, U2OS cells were treated as in Fig. 4B except the dose of the UV was 30 J/m2 and cells were trapped for 23 hwithnocodazole. C, cells were fixed at the end of 23 h of trapping and phospho-histone H3 levels were determined. D, bar graphand histogram representation of the data in (C). Columns, mean (n = 6); bars, SE. Statistical significance was determined by two-tailed unpaired t test. ***, P < 0.0001. Histogram: percentage, mean of cells in G2-M.

www.aacrjournals.org 3361 Cancer Res 2007; 67: (7). April 1, 2007

Figure 6. Overexpression of Cdc25B accelerates resumption of cell cycle. A, Cdc25B was induced for 16 hbefore eithermock or UV (15 J/m 2) treatment. Cells were fixed at the indicated time points, and phospho-histone H3 levels were determined. B, bar graphrepresentation of thedata in ( A). Columns, mean of the percentage of mitotic cells after UV irradiation normalized to unirradiated control (n = 4–5); bars, SE. The tetracycline concentration used is indicated next to the bars. Statistical significance was determined by two-tailed unpaired t test. ***, P < 0.0001.

cycle resumption, temporally the Chk1 activity begins to decline 1 this phosphatase. It is possible that overexpression of Cdc25B in h after UV, which we have confirmed by examining Chk1 (Ser345) tumor cells overwhelms the process of cell cycle resumption and phosphorylation (activating phosphorylation) after UV (data not survival, resulting in division of cells with damaged DNA, thereby shown). These findings suggest a testable hypothesis that contributing to genomic instability observed in cancer cells. This increased Cdc25B is a cellular priming factor for cell cycle could explain the increased susceptibility to breast cancer resumption once DNA damage repair is complete and the ATR/ induction by 9,10-dimethyl-1,2-benzanthracene in mice that Chk1 pathway prepares the cells for cell cycle resumption before ectopically overexpressed Cdc25B in mammary glands (11). inactivation of checkpoint signaling. Alternatively, gradual accu- Finally, our results reinforce the attractive nature of Cdc25B mulation of Cdc25B after DNA damage may also be required to inhibition as an adjuvant approach for anticancer therapy because increase Cdk1 activity to a level that would be sufficient to inhibition of Cdc25B by small molecule inhibitor might impair overcome the inhibition accumulated during the DNA damage– checkpoint recovery and increase the efficacy of DNA-damaging induced cell cycle arrest. The dependence on increased Cdc25B agents. levels as a limiting factor only after DNA damage was supported by our result that overexpression of Cdc25B did not significantly increase the number of cells in mitosis in the absence of DNA damage (Fig. 5). Acknowledgments Van Vugt et al. (28) previously found Cdc25B and Plk1 were Received 10/5/2006; revised 1/27/2007; accepted 1/31/2007. not required for recovery for DNA damage in Wee1 depleted cells. Grant support: NIH grants CA78039 and CA52995, Fiske Drug Discovery Fund, and Department of Pharmacology Predoctoral Fellowships (P. Bansal). Cdk1 regulates Wee1 degradation at the onset of mitosis (50). The costs of publication of this article were defrayed in part by the payment of page Functionally, one attractive hypothesis for how elevated Cdc25B charges. This article must therefore be hereby marked advertisement in accordance might regulate cell cycle reentry after DNA damage could be by with 18 U.S.C. Section 1734 solely to indicate this fact. The authors thank Prof. Bernard Ducommun, Dr. Robert Abraham, and the promoting Wee1 degradation through activation of Cdk1, thus members of Lazo laboratory, especially Alexander P. Ducruet and Robert J. Tomko, ensuring sustained activation of Cdk1. Jr., for their helpful suggestions and criticism of this manuscript; John J. Skoko for his technical assistance in purifying full-length Cdc25B2; and Drs. Ducommun, The important role Cdc25B plays in regulating cell cycle Peter Donovan, and Baskaran Rajeskaran for providing U2OS tet-regulated Cdc25B resumption could also help explain the oncogenic properties of cells, wild-type and Cdc25B null MEFs, and UCN-01, respectively.

Cancer Res 2007; 67: (7). April 1, 2007 3362 www.aacrjournals.org

References against radioresistant DNA synthesis. Nature 2001;410: 35. Kondo Y, Woo ES, Michalska AE, Choo KH, Lazo JS. 842–7. Metallothionein null cells have increased sensitivity to 1. Ducruet AP, Vogt A, Wipf P, Lazo JS. Dual specificity 18. Busino L, Chiesa M, Draetta GF, Donzelli M. Cdc25A anticancer drugs. Cancer Res 1995;55:2021–3. protein phosphatases: therapeutic targets for cancer phosphatase: combinatorial phosphorylation, ubiquity- 36. Rusnak JM, Calmels TP, Hoyt DG, Kondo Y, Yalowich and Alzheimer’s disease. Annu Rev Pharmacol Toxicol lation and proteolysis. Oncogene 2004;23:2050–6. JC, Lazo JS. Genesis of discrete higher order DNA 2005;45:725–50. 19. Zhao H, Watkins JL, Piwnica-Worms H. Disruption of fragments in apoptotic human prostatic carcinoma 2. Russell P, Nurse P. Cdc25+ functions as an inducer in the checkpoint kinase 1/cell division cycle 25A pathway cells. Mol Pharmacol 1996;49:244–52. the mitotic control of fission yeast. Cell 1986;45:145–53. abrogates ionizing radiation-induced S and G2 check- 37. Kang CM, Cho HN, Ahn JM, et al. Alteration of gene 3. Mailand N, Podtelejnikov AV, Groth A, Mann M, Bartek points. Proc Natl Acad Sci U S A 2002;99:14795–800. expression during radiation-induced resistance and J, Lukas J. Regulation of G(2)/M events by Cdc25A 20. Mailand N, Falck J, Lukas C, et al. Rapid destruction tumorigenesis in NIH3T3 cells revealed by cDNA through phosphorylation-dependent modulation of its of human Cdc25A in response to DNA damage. Science microarrays: involvement of MDM2 and CDC25B. stability. EMBO J 2002;21:5911–20. 2000;288:1425–9. Carcinogenesis 2004;25:123–32. 4. Karlsson C, Katich S, Hagting A, Hoffmann I, Pines J. 21. Peng CY, Graves PR, Thoma RS, Wu Z, Shaw AS, 38. Sanchez Y, Wong C, Thoma RS, et al. Conservation of Cdc25B and Cdc25C differ markedly in their properties Piwnica-Worms H. Mitotic and G2 checkpoint control: the Chk1 checkpoint pathway in mammals: linkage of as initiators of mitosis. J Cell Biol 1999;146:573–84. regulation of 14-3-3 protein binding by phosphorylation DNA damage to Cdk regulation through Cdc25. Science 5. Gabrielli BG, De Souza CP, Tonks ID, Clark JM, of Cdc25C on serine-216. Science 1997;277:1501–5. 1997;277:1497–501. Hayward NK, Ellem KA. Cytoplasmic accumulation of 22. Bulavin DV, Higashimoto Y, Popoff IJ, et al. Initiation 39. Kramer A, Mailand N, Lukas C, et al. Centrosome- cdc25B phosphatase in mitosis triggers centrosomal of a G2/M checkpoint after ultraviolet radiation requires associated Chk1 prevents premature activation of microtubule nucleation in HeLa cells. J Cell Sci 1996;109: p38 kinase. Nature 2001;411:102–7. cyclin-B-Cdk1 kinase. Nat Cell Biol 2004;6:884–91. 1081–93. 23. Davezac N, Baldin V, Gabrielli B, et al. Regulation of 40. Cans C, Ducommun B, Baldin V. Proteasome- 6. Dutertre S, Cazales M, Quaranta M, et al. Phosphor- CDC25B phosphatases subcellular localization. Onco- dependent degradation of human CDC25B phosphatase. ylation of CDC25B by Aurora-A at the centrosome gene 2000;19:2179–85. Mol Biol Rep 1999;26:53–7. contributes to the G2-M transition. J Cell Sci 2004;117: 24. Mils V, Baldin V, Goubin F, et al. Specific interaction 41. Ferguson AM, White LS, Donovan PJ, Piwnica-Worms 2523–31. between 14-3-3 isoforms and the human CDC25B H. Normal cell cycle and checkpoint responses in mice 7. Galaktionov K, Lee AK, Eckstein J, et al. CDC25 phosphatase. Oncogene 2000;19:1257–65. and cells lacking Cdc25B and Cdc25C protein phospha- phosphatases as potential human oncogenes. Science 25. St Clair S, Giono L, Varmeh-Ziaie S, et al. DNA tases. Mol Cell Biol 2005;25:2853–60. 1995;269:1575–7. damage-induced downregulation of Cdc25C is mediated 42. Davis TW, Wilson-Van Patten C, Meyers M, et al. 8. Ito Y, Yoshida H, Matsuzuka F, et al. Cdc25A and by p53 via two independent mechanisms: one involves Defective expression of the DNA mismatch repair cdc25B expression in malignant lymphoma of the direct binding to the cdc25C promoter. Mol Cell 2004;16: protein, MLH1, alters G2-M cell cycle checkpoint arrest thyroid: correlation with histological subtypes and cell 725–36. following ionizing radiation. Cancer Res 1998;58:767–78. proliferation. Int J Mol Med 2004;13:431–5. 26. Chen F, Zhang Z, Bower J, et al. Arsenite-induced 43. Chen MS, Hurov J, White LS, Woodford-Thomas T, 9. Hernandez S, Hernandez L, Bea S, et al. Cdc25a and Cdc25C degradation is through the KEN-box and Piwnica-Worms H. Absence of apparent phenotype in the splicing variant cdc25b2, but not cdc25B1, -B3 or -C, ubiquitin-proteasome pathway. Proc Natl Acad Sci mice lacking Cdc25C protein phosphatase. Mol Cell Biol are over-expressed in aggressive human non-Hodgkin’s U S A 2002;99:1990–5. 2001;21:3853–61. lymphomas. Int J Cancer 2000;89:148–52. 27. van Vugt MA, Bras A, Medema RH. Restarting the cell 44. Baldin V, Cans C, Superti-Furga G, Ducommun B. 10. Broggini M, Buraggi G, Brenna A, et al. Cell cycle- cycle when the checkpoint comes to a halt. Cancer Res Alternative splicing of the human CDC25B tyrosine related phosphatases CDC25A and B expression corre- 2005;65:7037–40. phosphatase. Possible implications for growth control? lates with survival in ovarian cancer patients. Anticancer 28. van Vugt MA, Bras A, Medema RH. Polo-like kinase-1 Oncogene 1997;14:2485–95. Res 2000;20:4835–40. controls recovery from a G2 DNA damage-induced 45. van Vugt MA, Smits VA, Klompmaker R, Medema RH. 11. YaoY,SlosbergED,WangL,etal.Increased arrest in mammalian cells. Mol Cell 2004;15:799–811. Inhibition of polo-like kinase-1 by DNA damage occurs susceptibility to carcinogen-induced mammary tumors 29. Lu X, Nannenga B, Donehower LA. PPM1D dephos- in an ATM- or ATR-dependent fashion. J Biol Chem in MMTV-Cdc25B transgenic mice. Oncogene 1999;18: phorylates Chk1 and p53 and abrogates cell cycle 2001;276:41656–60. 5159–66. checkpoints. Genes Dev 2005;19:1162–74. 46. Smits VA, Klompmaker R, Arnaud L, Rijksen G, 12. Oguri T, Singh SV, Nemoto K, Lazo JS. The carcinogen 30. Mailand N, Bekker-Jensen S, Bartek J, Lukas J. Nigg EA, Medema RH. Polo-like kinase-1 is a target (7R,8S)-dihydroxy-(9S,10R)-epoxy-7,8,9,10-tetrahydro- Destruction of claspin by SCFhTrCP restrains Chk1 of the DNA damage checkpoint. Nat Cell Biol 2000;2: benzo[a]pyrene induces Cdc25B expression in human activation and facilitates recovery from genotoxic stress. 672–6. bronchial and lung cancer cells. Cancer Res 2003;63: Mol Cell 2006;23:307–18. 47. Manke IA, Nguyen A, Lim D, Stewart MQ, Elia AE, 771–5. 31. Peschiaroli A, Dorrello NV, Guardavaccaro D, et al. Yaffe MB. MAPKAP kinase-2 is a cell cycle checkpoint h 13. Zhou BB, Elledge SJ. The DNA damage response: SCF TrCP-mediated degradation of claspin regulates kinase that regulates the G2/M transition and S phase putting checkpoints in perspective. Nature 2000;408:433–9. recovery from the DNA replication checkpoint response. progression in response to UV irradiation. Mol Cell 2005; 14. Bartek J, Lukas J. Chk1 and Chk2 kinases in checkpoint Mol Cell 2006;23:319–29. 17:37–48. control and cancer. Cancer Cell 2003;3:421–9. 32. Zhang YW, Otterness DM, Chiang GG, et al. 48. Bulavin DV, Higashimoto Y, Demidenko ZN, et al. 15. Sorensen CS, Syljuasen RG, Falck J, et al. Chk1 Genotoxic stress targets human Chk1 for degradation Dual phosphorylation controls Cdc25 phosphatases and regulates the S phase checkpoint by coupling the by the ubiquitin-proteasome pathway. Mol Cell 2005;19: mitotic entry. Nat Cell Biol 2003;5:545–51. physiological turnover and ionizing radiation-induced 607–18. 49. Margolis SS, Walsh S, Weiser DC, Yoshida M, accelerated proteolysis of Cdc25A. Cancer Cell 2003;3: 33. Bugler B, Quaranta M, Aressy B, Brezak MC, Prevost Shenolikar S, Kornbluth S. PP1 control of M phase 247–58. G, Ducommun B. Genotoxic-activated G2-M checkpoint entry exerted through 14-3-3-regulated Cdc25 dephos- 16. Neely KE, Piwnica-Worms H. Cdc25A regulation: to exit is dependent on CDC25B phosphatase expression. phorylation. EMBO J 2003;22:5734–45. destroy or not to destroy-is that the only question? Cell Mol Cancer Ther 2006;5:1446–51. 50. Watanabe N, Arai H, Iwasaki J, et al. Cyclin- Cycle 2003;2:455–7. 34. Xu B, Kim S, Kastan MB. Involvement of Brca1 in S- dependent kinase (CDK) phosphorylation destabilizes 17. Falck J, Mailand N, Syljuasen RG, Bartek J, Lukas J. phase and G(2)-phase checkpoints after ionizing irradi- somatic Wee1 via multiple pathways. Proc Natl Acad Sci The ATM-Chk2-Cdc25A checkpoint pathway guards ation. Mol Cell Biol 2001;21:3445–50. U S A 2005;102:11663–8.

www.aacrjournals.org 3363 Cancer Res 2007; 67: (7). April 1, 2007

Pallavi Bansal and John S. Lazo

Cancer Res 2007;67:3356-3363.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/67/7/3356

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2007/03/29/67.7.3356.DC1

Cited articles This article cites 50 articles, 23 of which you can access for free at: http://cancerres.aacrjournals.org/content/67/7/3356.full#ref-list-1

Citing articles This article has been cited by 7 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/67/7/3356.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/67/7/3356. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.