i

TITLE

EVALUATION OF GENETIC DIVERSITY, DRUG RESISTANCE MUTATIONAL AND CYTOKINE PATTERNS ON HEPATOTOXICITY MARKERS AMONG HIV PATIENTS IN NORTHWEST REGION, CAMEROON

LEM EDITH ABONGWA, (M.Sc.)

(I84F/30736/2015)

A THESIS SUBMITTED IN FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF THE DEGREE OF DOCTOR OF PHILOSOPHY (MEDICAL MICROBIOLOGY) IN THE SCHOOL OF PURE AND APPLIED SCIENCES OF KENYATTA UNIVERSITY

MAY, 2019

ii

DECLARATION

This thesis is my original work and has not been presented for a degree or other awards in any other university

Signature ………………………… Date ………..………………… LEM Edith ABONGWA Department of Biochemistry, Microbiology, and Biotechnology

We confirm that the work reported in this thesis was carried out by the candidate under our supervision.

SUPERVISORS

Sign……………………… Date…………………………… Dr. Anthony Kebira Department of Biochemistry, Microbiology, and Biotechnology Kenyatta University

Sign……………………… Date…………………………… Prof. Okemo Paul Department of Biochemistry, Microbiology, and Biotechnology Kenyatta University

Sign…… … Date……13/05/2019………… Prof. Fokunang Charles Department of Pharmacotoxicology and Pharmacokinetics University of Yaounde, Cameroon

Sign…………… ………… Date…13/05/2019…………… Prof. Judith Torimiro Chantal Biya International Center for Research on HIV/AIDS (CIRCB) Yaounde, Cameroon

iii

DEDICATION

This work is dedicated to my parents; Susana and Michael Abongwa, my kids;

Abongwa Clinton Luzah, Sama Clifford Luzah and Chofor Anthony Luzah and to my late brother Anthony Ategha Abongwa. iv

ACKNOWLEDGMENTS

I thank God Almighty for His gift of good health and protection throughout my life.

All I have ever been and will ever be in life, I owe it all to you, Lord.

I do acknowledge Kenyatta University for the opportunity to undertake this study.

I am greatly indebted to my supervisors Dr. Anthony Kebira, Profs: Okemo Paul,

Fokunang Charles, and Judith Torimiro who have diligently directed this work. I appreciate your invaluable support, unreserved advice, guidance, constructive suggestions that made my entire research study a success.

Special appreciation also goes to Drs: Nchinda G., Fokam J., Teto G. Aubain N., Mr.

Takou D. and my lab mates especially Rene K., and Loveline N. of CIRCB Yaounde for your support and fruitful discussions on various aspects of this study.

I am equally indebted to my loving husband Dr. Alus Luzah, and our kids, for supporting and enduring my absence during this period. A big thank you to my brothers and sisters; Emmanuel, Eric, Irene, Annabella, Christian, Stella and

Augustina, In a special way, I thank Mr. Akenji M. and Mr. (late)/Mrs. Kikah I., of

Ntenefor Credit union for their financial and emotional support that motivated me to realize this project. To all my friends, I say thank you.

Special thanks to the health care providers and laboratory technicians of the study sites. To the study participants I say thank you and may God grant you good health.

This work was partly supported by funds from Centre International de Référence

“Chantal Biya” (CIRCB), Yaounde and an EDTCP Grant (TA.2010.40200.016),

TWAS 12059RG /bio/af/acG), and Grand Challenge Canada Grant (0121-01) to Dr.

Godwin W. Nchinda. v

TABLE OF CONTENTS

TITLE ...... i

DECLARATION ...... ii

DEDICATION ...... iii

ACKNOWLEDGMENTS ...... iv

TABLE OF CONTENTS ...... v

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

LIST OF APPENDICES ...... x

ABBREVIATIONS AND ACRONYMS ...... xi

ABSTRACT ...... xiv

CHAPTER ONE: INTRODUCTION ...... 1

1.1 Background information ...... 1

1.2 Statement of problem ...... 9

1.3 Justification of the study ...... 11

1.4 Research hypothesis ...... 12

1.5 Objectives ...... 13

1.6 Significance of the study...... 13

CHAPTER TWO: LITERATURE REVIEW ...... 15

2.1 HIV structure ...... 15

2.2 The HIV genome ...... 16

2.3 HIV replication ...... 18

2.4 HIV genetic diversity ...... 19

2.5 HIV treatment ...... 21

2.6 HIV drug resistance ...... 27

2.7 HIV and hepatotoxicity ...... 38 vi

2.8 Cytokines in response to HIV infection ...... 43

CHAPTER THREE: MATERIALS AND METHODS ...... 47

3.1 Study sites ...... 47

3.2 Study design ...... 49

3.3 Sampling technique ...... 50

3.4 Sample population and size determination ...... 50

3.5 Inclusion and exclusion criteria ...... 50

3.6 Demographic data ...... 51

3.7 Sample collection ...... 52

3.8 Hepatitis B and hepatitis C screening ...... 52

3. 9 Measurement of liver function enzymes (ALT, AST, and ALP) ...... 52

3.10 Cytokine measurement ...... 54

3.11 HIV subtyping and drug resistance determination ...... 54

3.12 Data analysis ...... 59

CHAPTER FOUR: RESULTS ...... 62

4.1 Study population ...... 62

4.2 Socio-demographic and clinical characteristics of the study population ...... 62

4.3: Variation of liver biochemical markers ...... 64

4.4 Risk factors associated with severe hepatotoxicity ...... 67

4.5 Inflammatory markers and hepatotoxicity ...... 73

4.6 HIV-1 genetic diversity ...... 76

4.7 Prevalence of transmitted drug resistance ...... 80

CHAPTER FIVE: DISCUSSION, CONCLUSIONS, AND RECOMMENDATIONS ...... 84

5.1 Discussion ...... 84

5.1.1a Variation of liver biochemical markers in relation to the duration of treatment ...... 84 vii

5.1.1b Variation of liver biochemical markers in relation to drug type ...... 85

5.1.2 Risk factors associated with severe hepatotoxicity ...... 86

5.1.3 Inflammatory markers associated with hepatotoxicity ...... 94

5.1.4 HIV-1 genetic diversity ...... 97

5.1.5 Transmitted drug resistance ...... 100

5.2 Conclusions ...... 107

5.3 Recommendations...... 108

5.3.1 Areas for further research ...... 108

REFERENCES ...... 109

APPENDICES ...... 128

viii

LIST OF TABLES

Table 2.1: Resistance mutations to NRTIs ...... 32

Table 2.2: Resistance mutation to NNRTIs ...... 33

Table 2.3: Mutation resistance to protease inhibitors ...... 35

Table 2.4: Resistance mutation to integrase inhibitors ...... 36

Table 2.5: Resistance mutation to fusion inhibitors...... 37

Table 4.1: Socio-demographic and clinical characteristics of the study population by

drug type ...... 63

Table 4.2: Clinical and hepatic markers at baseline ...... 64

Table 4.3: Variation of ALT, AST and ALP during the study duration ...... 65

Table 4.4: Variation of ALT (U/L), AST (U/L), and ALP (U/L) with drug type and

duration ...... 66

Table 4.5: Cox proportional univariate analysis for baseline characteristics of patients 71

Table 4.6: Cox proportional multivariate analysis for baseline characteristics of patients

with or without severe hepatotoxicity ...... 73

Table 4.7: Descriptive characteristics of study participants (n=81) ...... 78

Table 4.8: Demographic and immunologic characteristics of patients with TDR and

predicted ARV drug resistance ...... 82

Table 4.9: Assessing the presence of TDR and prevalence of hepatotoxicity at end of

D180 ...... 83

ix

LIST OF FIGURES

Figure 2.1: The structure of Human immunodeficiency virus ...... 16

Figure 2.2: HIV-1 genome ...... 17

Figure 2.3: The life cycle of HIV...... 19

Figure 2.4: Targets for ARVs ...... 22

Figure 3.1: Map of the Northwest region (Bamenda) showing the study sites ...... 48

Figure 3.2: Schematic representation of the study design ...... 49

Figure 3.3: Verification of amplified RT-PCR product on 1% agarose gel ...... 56

Figure 3.4: Verification of amplified semi-nested PCR product on 1% agarose gel ... 57

Figure 4.1: Flow chart showing the study population...... 62

Figure 4.2: Prevalence (%) of hepatotoxicity by ALT relating to treatment duration

...... 67

Figure 4.3: Prevalence (%) of hepatotoxicity by AST with regard to treatment

duration ...... 68

Figure 4.4: Prevalence (%) of hepatotoxicity by ALP regarding treatment duration .. 68

Figure 4.5: Prevalence (%) of hepatotoxicity within the study duration ...... 69

Figure 4.6: Relationship between CD4+ T-cell counts with ALT and AST at D0 ...... 74

Figure 4.7: Mean cytokine variation between patients presented with and without

hepatotoxicity at D30 ...... 75

Figure 4.8: Mean cytokine variation between patients presented with and without

hepatotoxicity at D180...... 76

Figure 4.9: A phylogenetic tree of HIV-1 pol gene ...... 79

Figure 4.10: Prevalence (%) of hepatotoxicity by HIV subtypes ...... 80

x

LIST OF APPENDICES

Appendix I: First and second lines HIV treatments currently recommended in

Cameroon ...... 128

Appendix II: List of amino acids ...... 129

Appendix III: Ethical clearance ...... 130

Appendix IV: Information sheet (in English) ...... 131

Appendix V: Information sheet (in French)...... 133

Appendix VI: Informed consent form (in English) ...... 135

Appendix VII: Informed consent form (in French) ...... 136

Appendix VIII: Questionnaire ...... 137

Appendix IX: Composition of reagents (R) used for ALT, AST, and ALP

measurement ...... 139

Appendix X: Sequences and accession numbers in GenBank ...... 140

xi

ABBREVIATIONS AND ACRONYMS

$: US dollars /r: Administered with ritonavir for pharmacokinetic boosting 3TC: Lamivudine Ab: Antibodies ABC: Abacavir ADR: Acquired drug resistance AIDS: Acquired Immune Deficiency Syndrome ALP: Alkaline Phosphatase ALT: Alanine Amino Transferase ART: Antiretroviral Therapy ARV: Antiretroviral AST: Aspartate Amino Transferase ATV: Atazanavir AZT: Zidovudine cART: Combination of Antiretroviral Therapy CD4+: Cluster of Differentiation 4 CDC: Center for Diseases Control CRFs: Circulating recombinant forms CrS: Serum Creatinine Levels D: Day D4T: Stavudine DDI: Didanosine DNA: Deoxyribonucleic Acid dNTP: Deoxynucleoside triphosphate DR: Drug resistance DRM: Drug resistance mutation DRV: Darunavir Ds DNA: Double stranded deoxyribonucleic Acid EFV: Efavirenz env: Viral envelope ETR: Etravirine FBC: Full Blood Count xii

FPV: Fosamprenavir FTC: Emtricitabine gag: Group specific antigen gene gp: Glycoprotein HAART: Highly active anti-retroviral therapy HBsAg: Hepatitis B soluble Antigen HCC: Hepatocellular cancer HIV: Human Immune Virus HIV-1: HIV type 1 HIV-2: HIV type 2 IDV: Indinavir IFN- γ: Interferon gamma IL: Interleukin INI: Integrase Inhibitors IQR: Interquartile range LANL: Los Alamos National Library LDH: Lactate dehydrogenase LPV: Lopinavir LTR: Long terminal repeats; repetitive sequence of bases M: Major or Main group MDH: Malate dehydrogenase Min: Minute MTCT: Mother-to-child-transmission N: Non-M, non-O group NAD+: Oxidized Nicotinamide adenine dinucleotide NADH: Reduced Nicotinamide adenine dinucleotide Nef: encodes for negative regulator protein NFV: Nelfinavir NK cells: Natural killer cells NNRTI: Non-nucleoside Reverse Transcriptase Inhibitors NRTI: Nucleoside reverse transcriptase inhibitors NVP: Nevirapine NWR: North West Region O: Outlier group xiii

OD: Optical Density P: Protease p: Viral protein PCR: Polymerase Chain Reaction. PI: Protease Inhibitor PMTCT: Prevention of mother to child transmission Pol: Polymerase gene RAM: Resistance-associated mutations Rev: Regulator of expression of viral protein RNA: Ribonucleic Acid Rpm: Revolution per minute RPV: Rilpivirine RT: Reverse Transcriptase S: Second SDRM surveillance drug resistance mutation SEM: Standard error of mean SQV/r: Saquinavir SsDNA: Single-stranded deoxyribonucleic Acid ssRNA: Single-stranded ribonucleic Acid TAM: Thymidine analogue mutation Tat: Transactivator protein TDF: Tenoforvir TDR: Transmitted drug resistance TNF-α: Tumour necrosis factor-α TPV/r: Tipranavir US: United State Vif: Viral infectivity Vpr: Viral protein R Vpu: Viral protein U WHO: World Health Organization

xiv

ABSTRACT

Highly active anti-retroviral therapy (HAART) has been known to cause hepatotoxicity despite its benefit to improve the morbidity and mortality associated with HIV infections. However, the impact of HAART on HIV subtypes, drug resistance mutations and cytokine profiles, is not yet fully elucidated especially in the Northwest Region (NWR) of Cameroon. Therefore, this study was carried out with aim of determining the effect of HIV-1 subtypes, drug resistance mutations, cytokine profiles and risk factors on hepatotoxicity markers among HIV-1 drug naïve adults in the NWR of Cameroon. This was a longitudinal study conducted from February to November 2016 and newly diagnosed HIV-1 drug-naive patients were recruited into the study. Stratified and simple random sampling techniques were used in selecting the five study sites. Blood samples were collected prior to HAART initiation Day (D) 0 and at D30 and D180. The participants were placed on either Tenofovir (TDF) + Lamivudine (3TC) + Efavirenz (EFV) or Zidovudine (AZT) + 3TC + Nevirapine (NVP) or AZT+3TC+EFV regimens. Serum levels of alanine aminotransferases (ALT), aspartate aminotransferases (AST) and alkaline phosphatase (ALP) were analyzed. Human Th1/Th2/Th17 cytokines were measured using a cytometric bead array assay. Genotypic and transmitted drug resistance (TDR) analyses were performed by sequencing HIV virus using an in-house protocol. Data were analyzed using SPSS vs. 23 and Graph pad prism 6. HIV-1 subtypes were determined phylogenetically using MEGA vs. 7 while TDR and resistance-associated mutations (RAMs) were identified using the Stanford HIVDR interpretation program. The level of significance was set at 5%. In all, 100 individuals participated in the study with a mean (age range) of 36.5 (18-61) years. Of this, 37(37%) and 49(49%) patients presented with hepatotoxicity while 15% and 28% of patients had severe hepatotoxicity at D30 and D180 respectively. Serum levels of ALT, AST and ALP increased significantly (p<0.05) with increased treatment duration and in patients on AZT+3TC+NVP treatment. Multivariate analysis showed that age <30 years, low BMI, low monthly income and the use of AZT+3TC+NVP regimen were independent risk factors for severe hepatotoxicity. Mean interleukin (IL)-6 and IL-17A, were significantly (p<0.05) high in patients with hepatotoxicity compared to patients without hepatotoxicity at D30 and D180. HIV-1 subtype revealed that CRF02 _AG (75.3.0%) was the most predominant subtype. The prevalence of hepatotoxicity was highest at 70.3% (26/37) among individual harboring CRF02_AG virus. This study shows that 9 (11.1%) patients were infected with HIV variants that carried RAMs associated with NRTI; 8.6% (7/81), NNRTI; 4.9% (4/81) and PI; 1.2% (1/81). Seven of the nine patients with TDR developed hepatotoxicity of different grades at D180. Thus the use of NVP based regimen should not be recommended for patients less than 30 years and with low baseline BMI. IL-6 and IL-17A seem to play a significant role in the pathophysiology of hepatotoxicity. CRF02_AG was the most predominant HIV strain. Despite the sample size, these findings highlight a caution in the management of hepatotoxicity and the need for continuous surveillance for TDR. 1

CHAPTER ONE: INTRODUCTION

1.1 Background information

Human immunodeficiency virus (HIV) infection still remains a global health problem despite the intense medical and scientific research being done (Elmi Abar et al., 2012;

UNAIDS, 2018). Since the beginning of the epidemic, about 77.3 [59.3–100.0] million people have been infected with HIV (WHO, 2018). Globally, there were about

1.8 million new cases of HIV in 2017 (UNAIDS, 2018) and about 36.7 [31.1–43.9] million persons were living with HIV in 2017. Sub-Saharan Africa carries the highest burden of HIV and AIDS universally and accounts for about 64% of all new HIV infections (USAIDS, 2018; WHO, 2018). HIV prevalence in Cameroon was 4.3% in

2016 (Fokam et al., 2015; Patino-Galindo et al., 2017; Teto et al., 2017; WHO, 2017) and has dropped to 3.4% in 2018 affecting about 680, 000 inhabitants with close to

28,000 new infections (www.cameroononline.org/cameroon-hiv-aids-prevalence).

The advent of highly active antiretroviral therapy (HAART) has significantly reduced the morbidity and mortality of HIV infected patients by more than 51% since the peak in 2004 (UNAIDS, 2018). Thus has significantly improved their quality of life (Kan et al., 2017; Onywera et al., 2017). This has led to increased access to HAART from

7.7 million in 2010 and 17.1 million in 2015 to 21.7 million in 2017 (UNAIDS, 2018;

WHO, 2018). HAART was introduced in Cameroon in 2002 where patients had to pay US $23–$100 for their drugs monthly. The Government of Cameroon with financial support from the Global Fund to Fight AIDS, Tuberculosis and Malaria reduced the cost from US $23–$100 in 2002, to US $10 at the beginning of 2004 and by May 2007 all eligible individuals received ARV drugs free of charge through a national distribution program (Burda et al., 2010). As such there has been a rapid 2 scale-up of HAART with an increasing national coverage from 0% in 2001, 2% in

2003, 32% in 2016 and 49.3% by the end of June 2018 of the eligible patients

(Billong et al., 2016; Teto et al., 2017; National AIDS control committee, 2018).

Although HAART helps to reduce HIV associated morbidity and mortality, toxicity and drug resistance remains a challenge in this field of medicine as it has resulted in other complications such as liver toxicity, hematuria, decreased bone density, cardiovascular disease, gastrointestinal tract infection, hypersensitivity reaction, lactic acidosis, lipodystrophy, myopathy, Steven Johns syndrome, among others (Soriano et al., 2008; Wambani et al., 2015; De Luca et al., 2017). These complications are associated with both short and long-term toxicity effects which may be life- threatening and likely to cause significant morbidity and mortality. These effects vary from organ to organs such as the kidney and the liver (Wondemagegn et al., 2013;

Osakunor et al., 2015; Abongwa et al., 2017). In the era of effective HAART, 1–

54.0% of patients are shown to have liver toxicity (also known as hepatotoxicity) and have been attributed to discontinuation of HAART which has increased the morbidity and mortality rates among HIV-infected patients (Wondemagegn et al., 2013;

Priyanka and Ezhilarasan, 2014; Wambani et al., 2015; Wenderlein et al., 2016).

Nevertheless, the hepatic complications due to the use of antiretroviral therapy (ART) have not yet received enough attention in our African milieu in general and the

Northwest region in particular.

The liver is one of the vital organs in the reticuloendothelial system and is useful in the metabolism of drugs and their detoxification. Its thus contains several enzymes which are markers of cellular damage such that their serum levels are increased in individuals with various forms of liver disease (Osakunor et al., 2015; Seki and 3

Schwabe, 2015). Example of these enzymes includes; alanine aminotransferase

(ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), among others

(Elameen and Abdrabo, 2013). With the widespread use of HAART and the availability of new ART, antiretroviral (ARV) drugs have gained prominent attention owing to its negative impact on these biochemical enzymes (Wambani et al., 2015;

Wenderlein et al., 2016).

Hepatotoxicity has been reported across all families of HAART which include; non- nucleoside reverse transcriptase inhibitors (NNRTIs), nucleoside/nucleotide reverse transcriptase inhibitors (Ns/NtRTIs) and protease inhibitors (PIs) though some may cause liver injury more frequently than others in individuals and different regions

(Ofotokun et al., 2007; Wenderlein et al., 2016). Previous studies have shown that the contribution of each particular drug to the development of hepatotoxicity varies and is difficult to assess (Mugusi et al., 2012; Wambani et al., 2015; Wenderlein et al.,

2016). Thus, with the increased use and development of new HAART, there is a need to continuously monitor its involvement in the liver cells via the estimation of serum levels of these hepatic enzymes.

Hepatotoxicity evaluation can be done by both invasive and non-invasive methods.

The invasive method includes liver biopsy while non-invasive methods include molecular serum biomarkers tests and imaging techniques which have gained interest recently in identifying and describing hepatotoxicity (Liu et al., 2009; Sumida et al.,

2014). However, little work has been done in evaluating the effect of these biomarkers in HIV patients on HAART in resource-limited countries. Identifying such markers may lead to defining common pathways in the pathophysiology of 4 hepatotoxicity (McBurney et al., 2012) which may be helpful in the management of these patients.

Although HAART has been associated with increases in serum transaminases, little is known about the risk factors associated with severe hepatotoxicity. Treatment initiation and switch are only based on clinical and immunological assessments with little or no assessment on its level of hepatotoxicity. Apart from ARV drugs, it has been shown that other factors such as baseline levels of CD4+ T cells count, AST, and

ALT, hepatitis B and C, alcohol, age, gender, other drugs (for example tuberculosis drugs, paracetamol, among others), jaundice, poor nutrition among others. can influence hepatotoxicity. These risk factors vary by studies from different regions and localities (Kontorinis, and Dieterich, 2003; Wondemagegn et al., 2013). As such, additional studies are needed to gain a better appreciation for the different risk factors associated with hepatotoxicity.

Cytokine levels are known to control the nature, amount and duration of the immune response in a particular individual (Tudela et al., 2014; Akase et al., 2017) and are produced by virtually all nucleated cells in the body including the Kupffer cells of the liver (Neuman, 2003). Both in vivo and in vitro studies conducted indicate that HIV infection results in dysregulation of the cytokine profiles (Reuter, et al., 2012; De

Medeiros et al., 2016; Akase et al., 2017). Most research studies carried out between cytokines and HIV have relied on evaluating the impact of different cytokines on HIV replication or disease progression (De Medeiros et al., 2016; Akase et al., 2017), comparing the cytokine expression profile of HIV-infected and uninfected donors

(Spear et al., 2005; Williams et al., 2013), measuring cytokine production from in vitro infected cells (Reuter et al., 2012; Akase et al., 2017) or its approach with 5 respect to diagnosis, treatment and vaccine development (Reuter, et al., 2012;

Williams et al., 2013). In addition, many studies have shown that a switch from type 1 cytokines to type 2 patterns is indicative of HIV disease progression and replication

(Vishwanath et al., 2011; Akase et al., 2017). As such, cytokine measurements are considered evolution markers regarding ART markers (Meira et al., 2008).

A few studies have revealed that there is a possible relationship between cytokines and liver injury in patients with Hepatitis B virus (Lian et al., 2014; Deng et al.,

2015). As such an imbalance in cytokine production plays a key role in the development of liver damage, necro-inflammation and subsequent fibrosis (Galun and

Axelrod, 2002; Seki and Schwabe, 2015). However, the existence of any relationship between cytokine and HAART induced hepatotoxicity has not been proven and there is, therefore, an urgent need to investigate if cytokines play a vital role in HAART- induced hepatotoxicity. This study will, therefore, provide information for the first time, on the cytokine profile among HIV patients on HAART with and without hepatotoxicity. The alterations of cytokines levels following HAART induced hepatotoxicity might favor viral replication which leads to the development of resistant mutations. In addition, it might also stimulate the production of free radicals that may weaken the host immunity (Vishwanath et al., 2011). On the other hand, the release of cytokines into circulation may regulate the internal conditions of the cells and thus enhance immunity against chronic intracellular infections in almost all situations (Xing et al., 1998). Thus regulating the level of these cytokines might serve as a potential means of therapy for HIV-1 and other hepatic diseases. Results from this study may allow new cytokine therapeutic approaches based on the use of either recombinant cytokines or specific cytokine antagonists, with the aim of limiting the spread of HIV and the clinical manifestations associated with it. 6

Genetic diversity remains one of the major hindrances to the eradication of HIV and has been shown to have consequences in global distribution, vaccine design, therapy success and disease progression (Nyamache, 2012; Santoro and Perno, 2013; Patino-

Galindo et al., 2017). The upward trend in global HIV-1 diversity has continued to increase, with newer groups, subtypes, unique and circulating recombinants forms being identified in most African countries (Courtney et al., 2016; Teto et al., 2017;

Fokam et al., 2018) and Western countries (Li et al., 2013; Siemieniuk et al., 2013;

Patino-Galindo et al., 2017). These subtypes, however, vary significantly in types, regions and in range (Veras et al., 2011; Patino-Galindo et al., 2017). The differences among subtypes have been reported mostly in relation to prevalence, drug studies, vaccine development and disease progression (Santoro and Perno, 2013; Sallam et al.,

2017). However, it has not been proven if the genetic variation has any impact on the development of hepatotoxicity. As such there exist critical gaps that limit the understanding of the effect of the different HIV-1 subtypes on biochemical markers of hepatotoxicity. Furthermore, there is a need to regularly monitor and screen for new or rare HIV variants, as increasing variants are being reported in different areas and localities.

Cameroon still remains an ideal country to explore the genetic diversity of HIV-1 and its impact on the global pandemic. In Cameroon, despite the low infection rate among the general population, phylogenetic analysis of the gag, pol and env gene sequences have shown that the genetic diversity of the virus is very broad and all group M clades: A (A1, A2), B, C, D, F (F1, F2) G H, J, K and several circulating recombinant forms (CRFs) have been identified. These CRFs include; CRF01_AE, CRF02_AG,

CRF06_cpx, CRF09_cpx, CRF11_cpx, CRF13_cpx, CRF18_cpx, CRF22_01A1,

CRF36_cpx, and CRF37_cpx with CRF02_AG being the predominant type (Powell et 7 al., 2010; Ragupathy et al., 2011; Agyingi et al., 2014; Negedu-Momoh et al., 2014;

Teto et al., 2017). Although several studies have reported a high genetic variability of non recombinant and different recombinant forms of HIV-1 from the different parts of

Cameroon such as in the Centre, Northern, Southwest, Eastern, and Littoral regions

(Veras et al., 2011; Aghokeng et al., 2013; Billong et al., 2013; Agyingi et al., 2014;

Teto et al., 2017), adequate information is lacking in the Northwest region (NWR).

Furthermore, research on genetic diversity in Cameroon with many distinct subtypes and recombinant forms is of great importance as there is a possibility of viral recombination with recombinant viruses. This might lead to the complexity of new circulating HIV strains. This diverse genetic diversity is a public health concern in the area of diagnosis, therapeutics, and development of an effective HIV vaccine.

However, studies carried out in the NWR have identified some new stains despite the low sample size used (Tebit et al., 2002; Sherri et al., 2004). This study, therefore, seeks to find the different variants and to determine if HIV-1 genetic diversity has an effect on biochemical markers of hepatotoxicity. As such it is of prime importance to identify possible new strains especially in the NWR with dearth data on genetic diversity. Results from such findings will anticipate the complex forms that may be introduced with time.

In 2017, it was found that over half of all the people harboring the HIV (59%) now have access to life-saving treatment compared to 8 million in 2010 (UNAIDS, 2018;

WHO, 2018). With increased treatment coverage, HIV drug resistance (HIVDR) and onward transmission of drug resistance mutations (DRMs) are expected to increase, especially in settings relying on clinical and CD4 monitoring to detect treatment failure. However, the emergence of drug-resistant HIV strains have been shown to compromise the effectiveness of HIV management and this is a major threat to the 8 scaling up of ART especially in developing countries (Li et al., 2015; Abdissa et al.,

2014; Barennes et al., 2014; Ferreira et al., 2017; Machnowska et al., 2017).

The increased survival of individuals on HAART favors the onward transmission of

HIV resistant strains. Transmission of ARV drug-resistant HIV strains has been reported in both developed and developing countries with limited project-driven access to treatment (Xiaobai et al., 2014; Onywera et al., 2017; Teto et al., 2017).

This has limited ARV treatment responses to first-line ART among naive HIV infected persons and increases the risk of treatment failure. Consequently, the development and transmission of drug resistant viruses have become a major concern with the scaling up of ART (Pennings, 2013; Barennes et al., 2014; Xiaobai et al.,

2014). Although transmitted drug resistance (TDR) mutations have been studied extensively in high-income countries such as France, United States and Denmark

(Abdissa et al., 2014; Pennings, 2013; Xiaobai et al., 2014), there is still a paucity of data from resource-limited settings like ours. Previous studies in other countries have identified DRM in naïve patients ranging from 3.4-29% (Xiaobai et al., 2014; De

Luca et al., 2017; Onywera et al., 2017) and from 3.6 to 44%, in Cameroon (Laurent et al., 2005; Burda et al., 2010; Ragupathy et al., 2011; Ceccarelli et al., 2012;

Agyingi et al., 2014; Zoufaly et al., 2014; Teto et al., 2017). Currently, TDR testing is not consistent in most resource-limited settings, including Cameroon. It has been shown that TDR surveillance is required to evaluate the appearance and spread of drug-resistant HIV strains so as to update HIV treatment guidelines. However, the prevalence and pattern of HIV TDR in the Northwest region of Cameroon remain uncertain. Studies on TDR mutation patterns in drug naïve patients are more likely to reveal the right drug resistance pattern. Thus, this study will examine the recent HIV drug resistance pattern in patients naïve to treatment in the NWR. 9

Studies on HIV-1 DR are mostly prevalence studies or are associated with drug types.

Results from these studies vary across regions and countries (Vergne et al., 2006,

Aghokeng et al., 2013; Teto et al., 2017). However, it has not been shown if the HIV

DR pattern has an effect on the development of hepatotoxicity which we seek to investigate. Such a study is essential especially with the scale-up of the ART program that has led to a tremendous increase in ART coverage.

Since new HIV-1 viral variants emerge due to recombination with well documented or existing recombinant forms or from entirely new viral variants, it is important to continuously evaluate the development of HIV-1 genetic diversity and the effectiveness of ART in different populations of the world as the potential for recombination plays an important role in the development of resistance against ARV drugs (Kantor et al., 2005; Agyingi et al., 2014). Thus, in this study, we shall also be identifying naïve individuals with drug-resistant mutations and their effect on liver toxicity.

1.2 Statement of problem

In Cameroon, research work on HIV is mostly on the prevalence, treatment outcome, genetic diversity, drug resistance, mother to child transmission, hepatotoxicity and prevention in regions like the Centre and Littoral regions with little attention in the

Northwest region. Although several patterns of response after initiation of HAART have been observed in persons with HIV infection, adequate knowledge on its toxicity effects in organs like the liver and kidney is not established. Taking into consideration the important role the liver plays in the body in metabolism and drug detoxification, it is of prime importance to monitor the biochemical markers of hepatotoxicity and risk 10 factors associated with HAART. It is, therefore, imperative that the liver is monitored; and the HAART regimens that may be toxic to it identified so that changes or modifications can be made to enhance patient care.

Despite recorded low HIV prevalence of 3.4% in Cameroon (5.1% in the NWR) compared to most Sub Saharan countries (CAMPHIA; 2018; www.cameroononline.org, 2018), all circulating HIV-1 subtypes have been detected in Cameroon hence the possibility of viral combinations (Billong et al., 2013;

Agyingi et al., 2014; Teto et al., 2017). This HIV-1 diversity causes variations in immune response and transmission fitness by the different subtypes and therefore causes challenges in vaccine design. Nevertheless, the distribution of these HIV subtypes in other regions, especially in the Northwest region of Cameroon, is not fully determined. In addition, with the increasing number of patients on HAART, there is a high demand for new drugs. Based on the high prevalence (1.1- 44%) of DR variants in drug-naive clients there is need to evaluate treatment response to first-line drugs and advise to a switch in treatment in case of treatment failure.

Even though some cytokines have been shown to play a vital role in the pathogenesis or up-regulator of HIV replication, approaches to evaluate the relationship between cytokines and HIV have relied only on comparing the cytokine expression profile and not of its importance in the development of hepatotoxicity. As such, there is a need to evaluate immune response through induced inflammation due to viral infection and drug toxicity. This, therefore, calls for serious consideration to determine the role of genetic diversity, HIV-1 drug resistance mutation and cytokine profiles on biochemical markers of hepatotoxicity. 11

1.3 Justification of the study

The role of monitoring hepatotoxicity has not been fully studied in resource-limited settings. Since the introduction of ART in 2003 in Cameroon, there has been little evidence on the trend, analysis studies to determine this effect and risk factors associated with it. This is mostly because laboratory equipment is either not available, not functioning properly, reagents are expired or out of stock or there is a shortage of skilled laboratory personnel. This makes access to laboratory diagnostic tests limited and very expensive for most HIV clients on treatment. With the adoption of the WHO new policies of “test and treat” where any individual who is tested positive for HIV is placed on HAART irrespective of the clinical and immunological status

(www.who.int/mediacentre), there is an increase in the number of HIV infected patients on HAART. Several factors have been identified to cause hepatotoxicity in

HIV persons on HAART (Wambani et al., 2015; Wenderlein et al., 2016). However, these findings do not fully convince researchers as being universally applicable based on diverse regions, cultures, and specific human adaptations. It is for this reason that researchers are still being encouraged to carry out such studies in other regions and setups to determine if similar findings will result.

Although cytokines have shown to play an essential role in the pathogenesis or replication of many infections (Vishwanath et al., 2011; Akase et al., 2017), its role in hepatotoxicity has not been done. In addition, despite the low infection rate among the general population, the genetic diversity of the viruses infecting individuals in

Cameroon is broad (De Oliveira et al., 2017). However, studies carried out in the

NWR have identified some new strains despite the low sample size used (Tebit et al.,

2002; Sherri et al., 2004). The small sample size used and the diversity in strains make it important to carry out similar research with a larger population size. 12

Moreover, studies on genetic diversity in Nigeria a neighbouring country to the NWR, revealed that, in addition to the subtypes which are common in Cameroon there exist some rare complex recombinant forms like CRF15_01B and CRF19_cpx, (Chaplin et al., 2011; Negedu-Momoh et al., 2014) which are not common in Cameroon.

Furthermore, studies on DR in Cameroon have shown that DR ranges from 3.6%-44%

(Billong et al., 2013; Agyingi et al., 2014; Teto et al., 2017) in different parts of the country after a certain period of drug initiation. However, this information is lacking in the NWR especially among drug naïve clients. Consequently, the need to monitor the evolving diverse strains and its impact on ART regimens in Cameroon in order to ensure continuous efficacy of the limited available ART as new antiretroviral agents become available with the increasing number of clients on HAART. Therefore, the findings of this present study would provide baseline information on the magnitude of liver toxicity in relation to antiretroviral agents, genetic diversity, cytokine profile, and drug-resistant pattern. This study will also identify possible risk factors of hepatotoxicity in this area.

1.4 Research hypothesis

i. Different ARV drugs and duration of treatment do not affect liver biochemical

markers

ii. The different risk factors associated with HAART does not induce

hepatotoxicity iii. Some inflammatory markers are not associated with hepatotoxicity iv. HIV-1 subtypes do not differ among individuals of the Northwest Region and

also have no effect on the development of hepatotoxicity

v. The difference in the HIV drug resistance patterns has no effecton the

development of hepatotoxicity 13

1.5 Objectives

1.5.1 General objective

To determine the effect of HIV-1 genetic diversity, drug resistance, patterns and cytokine profiles on hepatotoxicity markers among HIV patients.

1.5.2 Specific objectives

i. To determine the variation of liver biochemical markers in relation to drug

type and duration of treatment

ii. To determine risk factors associated with severe hepatotoxicity iii. To determine inflammatory markers associated with hepatotoxicity iv. To determine HIV-1 genetic diversity and its effect on the development of

hepatotoxicity among individuals on treatment in the NWR of Cameroon

v. To determine the HIV drug resistance pattern and its effects on hepatotoxicity

1.6 Significance of the study

It is expected that findings from this study will provide a better understanding of direct and indirect factors responsible for hepatotoxicity from the Cameroonian settings. This would also impart an important message to policymakers to integrate certain cytokine profiles as a monitoring tool of assessing biochemical markers of hepatotoxicity at a rate affordable and accessible by all. The identification of reliable biochemical markers linked with the progression of hepatotoxicity will also be used by pharmaceutical companies to overcome the negative impact of HAART. Similarly, the identification of the circulating HIV genotypes in the NWR of Cameroon will contribute to the knowledge required for vaccine development. These research findings will facilitate a better understanding of the rapidly evolving ART guidelines. 14

Furthermore, the identification of resistant genes is critically important to the continued success of ART scale-up as it will optimize strategies to help clinicians to identify predictive treatment failure and advice on second-line drugs. Lastly, it is hoped that the results of this study would act as a pioneering piece of study in

Cameroon that would help the Ministry of Health, health-related institutions, health practitioners and academicians to conduct wider research into the dynamics of

HAART induced hepatotoxicity.

15

CHAPTER TWO: LITERATURE REVIEW

2.1 HIV structure

HIV is a retrovirus (enveloped virus) of the genus lentivirus (McGovern et al., 2002).

HIV, as shown in figure 2.1, is spherical in structure with a diameter of about 120 nm and has a nucleocapsid also known as viral protein (p) 24. Present within p24 is two identical, single strands (ss) of RNA genetic material that contain enzymes such as reverse transcriptase, protease, and integrase needed for the development of the virion

(Engelman and Cherepanov, 2012). It also has a matrix which is made up of the viral protein (p17) that surrounds the capsid and ensures the integrity of the virion particle.

The p17 is surrounded by the viral envelope (env) and is made up of phospholipids that are taken from the human cell membrane when the newly viral particle buds from the cell. Entrenched in the env are peg-like HIV proteins that protrude through the surface of the viral particle. Each peg consists of three or four glycoproteins (gp) 41

(the stem), capped with three or four gp120 (the head). The glycoprotein molecules allow the virus to attach to and fuse with target cells in order to begin the infectious cycle (Engelman and Cherepanov, 2012).

HIV is divided into two major types; HIV type 1 (HIV-1) and HIV type 2 (HIV-2).

The HIV-1 is reported to be related to viruses that originate from Chimpanzees and

Gorillas existing in the western part of Africa. On the other hand, HIV-2 viruses are closely related to viruses found in West African primate sooty mangabey. HIV-1 and

HIV-2 share many similarities and differences (Santiago et al., 2005; Kannangai et al., 2012). Their similarities include their essential gene arrangement, clinical findings, methods of transmission, replication pathways and both of them result in

AIDS. In terms of disease progression, both viruses demonstrate similar pathological 16 processes (Kannangai et al., 2012; Nyamweya et al., 2013). The differences between these two infections enlighten broader issues of retroviral pathogenesis, which remain incompletely understood (Nyamweya et al., 2013; Santoro and Perno, 2013). Unlike

HIV-2, HIV-1 includes four groups: M (main), O (outlier), N (non-M, non-O), and P

(putative), which have different geographic distributions but similar clinical symptoms (Veras et al., 2011; Santoro and Perno, 2013; Negedu-Momoh et al.,

2014).

Viral envelop

Lipid Membrane

Figure 2.1: The structure of Human immunodeficiency virus (Rajarapu, 2014)

2.2 The HIV genome

The HIV virus is characterized by broad genomic diversity as a result of multiple factors which include multiple zoonotic transmissions and high viral evolution and recombination rates (Santoro and Perno, 2013; Agyingi et al., 2014; De Oliveira et al., 2017). The HIV genome (Figure 2.2) contains nine genes that encode fifteen viral 17 proteins that control the ability of HIV to replicate, infect new cells and cause disease

(Engelman and Cherepanov, 2012; www.hiv.lanl.gov/content/sequence/HIV/MAP/landmark.html). These include the three major genes known as the gag (Matrix [p17], Capsid [p24], Nucleocapsid [p6 and p7]), pol (Protease, Reverse transcriptase (RT), Integrase), and env (gp120, gp41) which codes the viral structural proteins. The remaining genes code for the regulatory

(Tat, Rev) and accessory proteins (Vif, Vpr, Vpu/Vpx, Nef). The vpu is present only in HIV-1 while vpx is present only in HIV-2. At each end of its genome is found the

Long terminal repeat (LTR) that act as “sticky ends” and enable the integrase protein to insert the HIV genome into the host DNA

(www.hiv.lanl.gov/content/sequence/HIV/MAP/landmark.html).

Figure 2.2: HIV-1 genome

(www.hiv.lanl.gov/content/sequence/HIV/MAP/landmark, 2017) 18

2.3 HIV replication

In figure 2.3, HIV recognizes and attaches to T helper cells specifically the CD4+T cell receptors and causes a conformational change that allows the chemokine co- receptors (CCR5) and/or CXCR4 co-receptors to interact with extracellular gp120 and transmembrane gp41 viral surface proteins (Chan and Kim, 1998). This allows gp41 to insert its hydrophobic terminals into the cell membrane and enable the fusion of the two membranes (step 1). The viral nucleocapsid then enters the host cell and releases the 2 viral ssRNA and the 3 essential enzymes; reverse transcriptase, integrase, and protease (step 2). Reverse transcriptase transcribed HIV RNA into single-strand (ss) and eventually double-strand (ds) proviral DNA (Oguntibeju, 2012). Ribonuclease breaks down RNA and the polymerase complete the remaining ssDNA to a dsDNA helix (step 3). The integrase then transfers the dsDNA into the host cell genome.

Activation of the cell induces transcription of proviral DNA into mRNA (step 4). The viral mRNA migrates into the cytoplasm where building blocks for a new virus are synthesized some of which is processed by the virus using the enzyme protease.

Protease clip longer proteins to smaller core proteins (step 5). The two viral RNA strands and a replication enzyme then come together and more proteins assemble around them forming the capsid. This immature viral protein leaves the cells acquiring envelope of host and viral proteins (step 6) the virion matures and is ready to infect other cells (step 7).

19

Figure 2.3: The life cycle of HIV (www.niaid.nih.gov/diseases-conditions/hiv- replication-cycle)

2.4 HIV genetic diversity

Among other virus studied, HIV-1 displays a greater degree of genetic and antigenic variability due to it high mutation rate during viral replication (Santoro and Perno,

2013; Siemieniuk et al., 2013). So far, HIV-1 has 4 distinct groups (M, O, N and P) with at least 9 different subtypes (A [A1, A2, A3, A4], B, C, D, F [F1, F2], G, H, J and K), 98 circulating recombinant forms (CRFs) and numerous unique recombinant forms (URFs) within the major M Group

(http://www.hiv.lanl.gov/content/sequence/HIV/CRFs/CRFs.html). This is due to the high mutation rate of the reverse transcriptase (RT) enzyme that lacks the proof- reading activity and high potential for recombination (Santoro and Perno, 2013;

Recordon-Pinson et al., 2018). Phylogenetic classifications are presently based either 20 on nucleotide sequences derived from multiple subgenomic regions (gag, pol and env) of the same isolates or the complete genome sequence analysis (Veras et al., 2011;

Elmi Abar et al., 2012; De Oliveira et al., 2017; Patino-Galindo et al., 2017). Studies have shown that the genetic variation within a subtype ranges from 15 to 20%, whereas variation between subtypes ranges from 25 to 35% (Santoro and Perno,

2013). The diversity and distribution of HIV-1 subtypes and CRFs have influenced the spectrum of disease progression, antiretroviral therapy as well as complicated the development of effective vaccines (Kantor et al., 2005; Abdissa et al., 2014;

Recordon-Pinson et al., 2018).

It is estimated that the HIV prevalence in Cameroon is about 3.4% in about 20 million inhabitants (www.cameroononline.org). Although this prevalence is low, Cameroon has the widest genetic arrays where all known groups and multiple variants strains of

HIV-1 (M, N, O, and P) have been identified. These multiple variants include;

CRF02_AG, the predominant strain with a prevalence of 48.6–80%. Other subtypes

A1, A2, A3, A4, B, D, C, F1, F2, G, H, J, K, CRF01_AE, CRF02_AG, CRF06_cpx,

CRF09_cpx, CRF11_cpx, CRF13-cpx, CRFs 14_BG, CRF16_A2D, CRF18-cpx, ,

CRF22_01A1, CRF22-cpx, CRF25_cpx, CRF27_cpx, CRF36_cpx, CRF37_cpx, and

CRF43_02G (Tebit et al., 2002; Ndembi et al., 2008; Powell et al., 2010; Ragupathy et al., 2011; Agyingi et al., 2014; Negedu-Momoh et al., 2014; Courtney et al., 2016;

Teto et al., 2017). Recently a unique new inter-group HIV-1/MO has been identified

(De Oliveira et al., 2017) suggesting that Cameroon is considered as one of the epicenters of the HIV epidemic. 21

2.5 HIV treatment

One of the greatest accomplishments in the fields of biology, pharmacology, and medicine has been the transformation of AIDS from an unavoidably fatal illness to chronic and controllable disease in most countries where HIV infected persons have complete access to HAART (Simon et al., 2006; Oguntibeju, 2012). Of the 36.7 million people living with HIV, 20.9 million had access to ART in 2017 (USAIDS,

2018). HAART has extensively reduced morbidity and mortality from HIV-1 infection. Nevertheless, it is still not curative (Aghokeng et al, 2013; Li et al., 2013).

The goal of ART is to improve the quality of life by reducing viral load and reconstitution of immune competence (Teklay et al., 2013). Although ART does not completely destroy the virus and cannot cure the infection/disease, it has greatly reduced the viral load and significantly slows down the disease progression rates, thereby increasing life expectancy and improving the quality of life of people living with HIV and AIDS (Oguntibeju, 2012; Wambani et al., 2016). In addition, HAART has shown to also contribute to the prevention of HIV-1 spread, as low viral load diminishes the risk of HIV-1 transmission (Dimitrov et al., 2016; Sallam et al., 2017).

The use of ART in medical practice depends on their ease or complexity of use and efficacy based on clinical evidence, practice guidelines, and clinician preference

(Oguntibeju, 2012; Minister of Public Health [MPH], 2015).

2.5.1 Types of antiretroviral drugs

Six classes of antiretroviral agents currently exist; nucleoside/nucleotide reverse- transcriptase inhibitors (NsRTIs/NtRTIs), nonnucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (PIs), integrase inhibitors (INIs), fusion inhibitors, and chemokine receptor antagonists (Oguntibeju, 2012). Each class of 22

ART targets a different step in the viral life cycle (Figure 2.4) as the virus infects

CD4+ T lymphocyte or other target cells (Oguntibeju, 2012). The mechanisms of action of these ARV inhibitors occur in two phases which include the enzymatic and the entry processes. The enzymatic inhibitors that target HIV-1 replication comprise of the protease inhibitors, reverse transcriptase, and integrase while the entry inhibitors that prevent the entry process fall into three major classes based on the specific entry process and include the attachment, co-receptor and fusion inhibitors

(Iyidogan and Anderson, 2014, https://www.webmd.com/hiv-aids/aids-hiv- medication).

Figure 2.4: Targets for ARVs (Berns and Kasbekar, 2006)

2.5.1.1 Nucleoside/nucleotide RT inhibitors (NRTIs/NtRTIs)

These were the first drug available for the treatment of HIV infection (Simon et al.,

2006). Although NsRTIs/NtRTIs have been found to be less potent against HIV than 23

NNRTIs and PIs, the NRTIs have a principal role in ARV treatment. They remain part of the current standard of care and have been shown to inhibit both HIV-1 and

HIV-2 (Oguntibeju, 2012). NRTIs are reverse transcriptase inhibitors (RTI) known as

DNA chain terminators or faulty DNA building blocks. They are structurally similar to the DNA nucleoside bases and become efficiently incorporated into the viral DNA at the 3'-end as an NRTI monophosphate by HIV-1 RT while competing with the natural deoxynucleoside triphosphates (dNTPs). Upon incorporation, they inhibit the elongation of viral DNA chain due to the lack of a 3'-hydroxyl group or an altered sugar moiety (purine and pyrimidine nucleosides) that prevents the incorporation of next incoming nucleotide (Iyidogan and Anderson, 2014). When one of these defective building blocks is added to a growing HIV DNA chain, further HIV DNA synthesis is blocked. Examples include Lamivudine (3TC), Abacavir (ABC) didanosine (DDI), emtricitabine (FCT) Tenofovir disoproxil fumarate (TDF),

Zidovudine (AZT), Stavudine (D4T), Tenofovir alafenamide (TAF)

(https://www.webmd.com/hiv-aids/aids-hiv-medication).

2.5.1.2 Non-nucleoside reverse transcriptase inhibitors (NNRTIs)

The NNRTIs are RTIs that causes an allosteric inhibition of the reverse transcriptase enzyme by binding directly to the enzyme at a site different from the nucleoside binding component. The binding of NNRTIs changes the spatial conformation of the substrate-binding site and reduces the polymerase activity. This prevents the conversion of viral RNA to DNA, thereby preventing it from being copied into the cell‟s DNA (Arts and Hazuda, 2012). Thus they act as non-competitive inhibitors of the enzyme since they do not interfere with dNTP binding. Examples include;

Nevirapine (NVP), Efavirenz (EFV), Etravirine (ETR), Rilpivirine (RPV), 24

Delavirdine (DLV), Doravirine, (DOR) (https://www.webmd.com/hiv-aids/aids-hiv- medication).

2.5.1.3 Protease inhibitors (PI)

PIs prevent viral replication by competitively binding to the active site of the HIV protease and inhibit its action (Oguntibeju, 2012). Thus they prevent the HIV protease from cleaving the polypeptide precursors of the virus proteins and enzymes into structural proteins and mature enzymes that go on to infect new cells (Oguntibeju,

2012; Iyidogan and Anderson, 2014). Example of PIs includes Atazanavir (ATV),

Darunavir (DRV), Fosamprenavir (FPV), Indinavir (IDV), Lopinavir (LPV),

Nelfinavir (NFV), Saquinavir (SQV), Tipranavir (TPV) and Ritonavir (RTV)

(https://www.webmd.com/hiv-aids/aids-hiv-medication).

2.5.1.4 Integrase inhibitors (INIs)

INIs chelate the divalent cation (Mg2+ or Mn2+) in the active site of the enzyme that is required for integrase enzymatic activity thereby preventing the integration of viral

DNA into the host DNA (Wang et al., 2011). This inhibition is called strand transfer inhibition and prevents HIV from replicating (Arts and Hazuda, 2012). Examples include Raltegravir (RAL), Elvitegravir (EVG), Dolutegravir (DTG), Bictegravir

(BIC) (www.webmd.com/hiv-aids/aids-hiv-medication).

2.5.1.5 Entry and co-receptor inhibitors

They are relatively new generation of antivirals drugs which interfere with the virus ability to bind to host cells. The entry inhibitors block the attachment of HIV gp120 to either the CD4+ T cell receptor, while the co-receptor inhibitors block the interaction between gp120 and CCR5 or CXCR4 (Arts and Hazuda, 2012; Iyidogan and 25

Anderson, 2014). An example includes Maraviroc (MVC)

(https://www.webmd.com/hiv-aids/aids-hiv-medication).

2.5.1.6 Fusion inhibitors

Fusion inhibitors prevent membrane fusion by averting the interaction between the heptad repeat (HR) regions 1 (HR1) and 2 (HR2). This blocks the formation of the fusion pore thereby preventing the release of the viral core into the host cytoplasm

(Miller and Hazuda, 2004). An example includes Enfuvirtide (ENF, T-20) that mimics an HR2 fragment (https://www.webmd.com/hiv-aids/aids-hiv-medication).

2.5.2 Combination therapy

ART which is also known as HAART is a term that refers to the use of the combination of three or more antiretroviral agents to suppress a wide variety of HIV infection effectively (Osakunor et al., 2015; Teto et al., 2017). The advent of combined therapy has significantly changed the perception of HIV/AIDS from a fatal to a chronic and potentially manageable disease, thus decreasing the morbidity and mortality rates of the people living with HIV/AIDS (Oguntibeju, 2012; Iyidogan and

Anderson, 2014; Zhang et al., 2017).

Combination therapy uses three drugs from at least two classes. Most of the combination therapies include two NRTIs and one NNRTI or PI. In addition, combinations of integrase or entry inhibitors with RT inhibitors and PIs are used as an alternative treatment strategy (WHO, 2001; Iyidogan and Anderson, 2014; Aidsinfo,

2015). The main aim of employing HAART in HIV infected individuals is that if one drug is not able to suppress the virus at a particular stage, the other drugs used in this combination will be more likely to suppress the HIV (Priyanka and Ezhilarasan, 26

2014). Combination antiretroviral therapy dramatically suppresses viral replication and reduces the plasma HIV-1 viral load to below the limits of detection thereby resulting in a significant reconstitution of the immune system which is measured by an increase in the circulating CD4+ T cell-lymphocytes (Arts and Hazuda, 2012). In addition, it helps to decrease the likelihood of resistance because it reduces HIV replication at multiple steps in viral replication (Iyidogan and Anderson, 2014;

Aidsinfo, 2015).

Increased access to ART in Cameroon has been improved through the implementation of the WHO simplified approach and the decentralization of ART services (Lucien et al., 2010; Aghokeng et al., 2013). The standard first and second line therapy consists of 2 NRTIs plus 1 NNRTI and one ritonavir-boosted protease inhibitor [PI/r], plus two NRTIs (Billong et al., 2013, MPH, 2015) respectively. In 2010 these regimens were modified when WHO recommended the replacement of Stavudine with

Tenofovir. As such the reference first-line ARVs in Cameroon (Appendix I) included;

AZT, TDF, FTC, ABC plus 3TC as NRTIs and NVP or EFV as NNRTIs (MPH,

2015). First-and second-line treatments have been freely provided to eligible patients since 2007, and treatment initiation and monitoring has been guided by clinical and/or immunological data (Aghokeng et al., 2013). First-line ARV regimens are recommended for use in naive patients whereas a change to second-line occurs when there is treatment failure of the first-line as proven by clinical, immunological and virological factors or when the virus has the ability to tolerate a drug (WHO, 2001;

Aidsinfo, 2015). 27

2.6 HIV drug resistance

This is the ability of HIV to mutate and reproduce itself in the presence of drugs

(Suraj and Prasanna, 2015). Drug resistance is a major contributing factor to the failure of ART (WHO, 2001; Wensing et al., 2017). Antiretroviral drugs were developed using the subtype B isolates. However, ARV drugs have reduced the morbidity and mortality of both HIV B and non-B subtypes patients (Kantor et al.,

2005; Negedu-Momoh et al., 2014; Kan et al., 2017; Onywera et al., 2017). This has led to increased access to ARTs during the past decade to reach millions of HIV-1 infected persons (Agyingi et al., 2014; Billong et al., 2016; De Luca et al., 2017; Teto et al., 2017). Despite the remarkable achievement derived from ART, drug resistance mutations (DRM) are known to develop and are major hindrances in the management of both HIV treated and therapy-naïve patients (Negedu-Momoh et al., 2014; Teto et al., 2017). These mutations develop as a result of an amino acid (AA) changes in the virus genome compared to the wild type (HXB2) taken as a reference (Wensing et al.,

2017).

Mutations can either be major mutations or accessory mutations. Major mutations are the first mutations selected during therapy and causes decreased binding of the drug to its enzyme target to confer phenotypic resistance (WHO, 2001; Burda et al., 2010).

While accessory mutations contribute to drug resistance by improving the fitness of viruses carrying the primary mutations or increase resistance in the presence of major mutations. They have very little direct effect on inhibitor binding or on the level of resistance in the absence of primary mutations (WHO, 2001; Wensing et al., 2017).

Mutations are described using a number to denote the mutant codons or amino acids

(Appendix II) with letters before and after the codon number denoting the AA 28 associated with “wild-type” and mutant virus respectively. For example, M184V indicates that 184 is the AA position, M (methionine) is the wild type AA, and V

(valine) is the mutant AA. When both wild-type and mutant AA are detected it is represented as M184M/V and is known as a quasi-species.

Factors contributing to drug resistance include both viral and host factors. The viral factors include extreme high degree of genetic variability and evolution rate of HIV-1 as a result of the rapid turnover in HIV replication (estimated at 109 new viral particles each day) and the high error rate of the reverse transcriptase enzyme during viral replication (Arts and Hazuda, 2012; Suraj and Prasanna, 2015). This is explained by the fact that the virus population within an infected person consists of a complex mixture of heterogeneous strains, termed “quasi-species” (Santoro and Perno, 2013;

Suraj and Prasanna, 2015). Patient factors on the other hand include poor adherence

(the regimen, toxicity and social and personal issues), insufficient drug level (use of substandard ARV regimens, wrong dose, poor potency, host genetics, poor absorption, rapid clearance, drug interaction), gaps in service delivery (inadequate drug supply systems, patient retention and inadequate human resources) and lack of plasma viral load monitoring (Nyamache, 2012; Aghokeng et al., 2013; Hamers et al.,

2013; Teto et al., 2017).

2.6.1 Types of resistance

Drug resistance can be categorized into transmitted drug resistance (TDR) or acquired drug resistance (ADR), both of which present serious threats to the health sector

(Sallam et al., 2017; Zhang et al., 2017).

29

2.6.1.1 Primary or transmitted drug resistance (TDR)

Transmitted drug resistance is defined as resistance to one or more ARV drugs classes in patients not previously exposed to any ARV therapy as a result of direct transmission from a patient harboring DR mutants (Suraj and Prasanna, 2015; Sallam et al., 2017). As such, there is evidence for a rapid increase in TDR in the years after the rollout of ART (Gupta et al., 2012). Evidence arising from the prevalence of TDR has been reported in almost all classes of ARV that is NRTIs, NNRTIs, PI, INI, and

CCR5 (Agyingi et al., 2014; Barennes et al., 2014; De Luca et al., 2017; Wensing et al., 2017; https://hivdb.stanford.edu). Previous studies from other regions in

Cameroon have identified TDR ranging from 3.6-44% (Billong et al., 2013; Agyingi et al., 2014; Zoufaly et al., 2014; De Luca et al., 2017; Onywera et al., 2017) in the adult population and about 3.6-40.7% in children (Ikomey et al., 2016). Increase in

TDR has been shown to causes early treatment failures in the newly infected individuals and thus, jeopardizes both preventive and treatment efforts in HIV patients (Wittkop et al., 2011; Hamers et al., 2013; Ferreira et al., 2017; Sallam et al.,

2017).

2.6.1.2 Secondary or acquired drug resistance (ADR)

This is the development of resistance while on ART (Suraj and Prasanna, 2015). The prevalence of acquired resistance is on the rise and ranges from 16.4-81.5% in

Cameroon (Laurent et al., 2005; Burda et al., 2010; Aghokeng et al., 2013; Agyingi et al., 2014; Zoufaly et al., 2014; Teto et al., 2017) and 9.5-89.6% in other countries

(Elmi Abar et al., 2012; Negedu-Momoh et al., 2014; De Luca et al., 2017; Onywera et al., 2017). The dynamics of the rapid evolution of HIV-1 facilitated by its error- prone reverse transcriptase, the rapid rate of HIV replication, alongside patients, 30 physicians, and drug-related factors, has led to the emergence of HIV resistant strains in most patients (Billong et al., 2016; Sallam et al., 2017).

2.6.2 Mechanism of drug resistance

Drug resistance mutation in HIV develops differently depending on the drug class and can evolve through different pathways for specific drugs. Resistance mutations have been identified in all the major classes of ARVs. The most common resistance- associated mutations are within the NNRTI, followed by the NRTI and the PIs drug classes (Suraj and Prasanna, 2015; Teto et al., 2017). The development of DR further complicates clinical management because of the high level of cross-resistance within all three drug classes; NRTI, NNRTI, and PI (WHO, 2001; Li et al., 2015; Onywera et al., 2017).

2.6.2.1 Resistance to reverse transcriptase inhibitors (RTIs)

Studies have identified mutations to NRTIs and NNRTIs from patients on treatment within a range of 16.4-84.4%, and in drug naïve individuals within the range from

1.4-48% in most African countries (Laurent et al., 2 005; Burda et al., 2010;

Ragupathy et al., 2011; Hamers et al., 2013; Agyingi et al., 2014; De Luca et al.,

2017; Onywera et al., 2017).

2.6.2.1.1 Resistances to nucleoside/nucleotide reverse transcriptase inhibitors

(NRTIs)

There are two principal resistance mechanisms to NRTIs which include the discrimination and excision mechanisms.

31

2.6.2.1.2 Discrimination mechanism

Several mutations in reverse transcriptase can promote resistance by selectively impairing the ability of reverse transcriptase to incorporate it analogue into DNA. In this mechanism, the RT enzyme prevents the binding of the NRTI while retaining the ability to recognize the analogous natural deoxynucleoside triphosphate (dNTP) substrates (WHO, 2001). Once this false substrate is incorporated into the viral reverse transcriptase, it will prevent the synthesis of new viral DNA due to the absence of the OH group in the 3‟ direction. The most implicated mutations in this mechanism are the K65R, L74V, V75I, Y115F, Q151M and M184V (WHO, 2001;

Iyidogan and Anderson, 2014).

2.6.2.1.3 Excision mechanism

In this mechanism, RT utilizes ATP or inorganic pyrophosphate as a co-substrate to remove the incorporated nucleoside analog after it has been incorporated into the viral

DNA allowing reverse transcription to resume (Iyidogan and Anderson, 2014;

Schneider et al., 2016). Example of this type of mutations are those selected by AZT and D4T (Naeger et al., 2002). The AZT and D4T are both thymidine nucleoside analogs and share common resistance mutations known as the thymidine analog mutations (TAMs) as well as an insertion at position 69 (Wensing et al., 2017). The

TAMs may develop by one of two distinct pathways: the TAM 1 pathway (including mutations M41L, L210W, and T215Y) or the TAM 2 pathway (including mutations

D67N, K70R and K 219E/Q) (Chaplin et al., 2011; El-Khatib et al., 2011). Once RT acquires TAM complex mutations with high resistance to thymidine analogs, it could also develop further mutations like T69 insertion complex and become resistant to a variety of NRTIs resulting to cross-resistance to all members of NRTI class (Iyidogan 32 and Anderson, 2014; Suraj and Prasanna, 2015). The TAMs are involved in resistance to all NRTIs, except Lamivudine (3TC). However, the degree of cross-resistance depends on the NRTI considered and the number of TAMs on the virus. Some interactions exist between the different mechanisms of resistance for example the

M184V/I mutations, selected by 3TC and emtricitabine (FTC), delay the appearance of TAMs and increase the in vitro susceptibility to AZT and D4T. The mutations to this group are summarized in table 2.1

Table 2.1: Resistance mutations to NRTIs (https://hivdb.stanford.edu/hivdb/by- sequences).

Non-TAMs TAMs MDR

POS 184 65 70 74 115 41 67 70 210 215 219 69 151

CON M K K L Y M D K L T K T Q

3TC VI R Ins M

FTC VI R Ins M

ABC VI R E VI F L W W FY Ins M

DDI# VI R E VI L W FY Ins M

TDF *** R E F L R W FY Ins M

D4T# *** R E L N R W FY QE Ins M

ZDV *** *** * * L N R W FY QE Ins M

Legend: Mutations in Bold/underline: High-level reduced susceptibility or virological response. Bold: reduced susceptibility or virological response. Plain text: reduced susceptibility in combination with other NRTI-resistance mutations. Asterisk: increased susceptibility. #: no longer recommended. Abbreviations: ABC; Abacavir, Cons; Consensus AA, FTC; Emtricitabine, 3TC; Lamivudine, MDR; Multidrug resistance mutations, Pos; AA position, TDF; Tenofovir, AZT; Zidovudine, D4T; Stavudine, DDI; Didanosine, TAMs; Thymidine analog mutations. 33

2.6.2.1.4 Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs)

Mutations responsible for NNRTI resistance are situated in the hydrophobic pocket targeted by NNRTI and thus changing the conformation of the dNTP binding pocket.

These changes reduce the affinity of the drug to bind to the target site. There are four essential groups of mutations involved in the resistance to NNRTIs (WHO, 2001).

These mutations are found in clusters between codons 100-108 and 179-190 and confer broad-based cross-resistance to all available drugs in this class (Wensing et al.,

2017). Since the drugs bind to the same site on RT, mutations that confer resistance to

1 drug in this class generally confer cross-resistance to most other NNRTIs (Table

2.2). In addition, mutations in the NNRTI binding pocket may interfere with NRTI resistance. The most commonly selected mutations are Y181C and Y188C, followed by K103N (Ren and Stammers, 2008).

Table 2.2: Resistance mutation to NNRTIs (hivdb.stanford.edu, Wensing et al.,

2017)

Legend: Bold/underline: High-level reduced susceptibility or virological response. Bold: reduced suceptibility or virological response. Plain text: reduced susceptibility in combination with other NNRTI-resistance mutations. Asterisk: increased susceptibility. Abbreviations: EFV; Efavirenz, ETR; Etravirine, NVP; Nevirapine, RPV; Rilpivirine 34

2.6.2.2 Resistance to protease inhibitors (PIs)

Resistance to PIs results from the step-wise accumulation of mutations within the enzyme that leads to the reduced binding affinity of the inhibitors while maintaining the natural substrate binding interactions (Wensing et al., 2010; Iyidogan and

Anderson, 2014). Typically, there is a substitution in the substrate-binding cleft of the viral protease resulting in enlargement of the catalytic site. This enlargement leads to decreased binding to the inhibitor and therefore causing a decrease in drug sensitivity which leads to loss of viral fitness (Iyidogan and Anderson, 2014). This is considered primary or major mutations. Secondary or minor mutations may also occur at the neighboring non-active site pocket residues that compensate for the impaired protease activity via increasing the activity and/or the stability of the protein. Secondary mutations in conjunction with major mutations will improve the replication of viruses.

Another potential mechanism of resistance is through an amino acid insertion. Such insertions may lead to decrease in PIs susceptibility and slightly improve viral replication. Nevertheless, it can only contribute to PIs resistance when in combination with other mutations in protease or gag protein (Wensing et al., 2010). Due to the high binding capacity, PI requires more than one mutation to exert drug resistance to protease mutations (Table 2.3).

35

Table 2.3: Mutation resistance to protease inhibitors (Wensing et al., 2017)

Legend: Bold/underline: High-level reduced susceptibility or virological response. Bold: reduced susceptibility or virological response. Plain text: reduced susceptibility in combination with other PI-resistance mutations. Abbreviations: /r; Administered with ritonavir for pharmacokinetic boosting, ATV/r; Atazanavir/r, Cons; Consensus AA, DRV/r; Darunavir/r, FPV/r; Fosamprenavir/r, IDV/r; Indinavir/r, LPV/r; Lopinavir/r, NFV; nelfinavir, Pos; AA position, SQV/r; Saquinavir/r, TPV/r; Tipranavir/r.

36

2.6.2.3 Resistance to integrase inhibitors (INI)

Integrase inhibitors bind to the active site of the integrase enzyme and prevent it from functioning properly. Drug-resistant mutations against INIs are determined via drug selection and viral fitness studies. Several residues D64, C65, T66, H67, E92, N120,

F121, D116 Q62, I141, P142, Y143, I151, E152, N155, K156, and K159 are the targets of INI on which they bind and oppose strand transfer. Thus, any mutation at the level of these residues could modify the affinity of the enzyme for the inhibitors and impede their proper fixation, thus preventing their inhibition function. Significant cross-resistance has been observed among the INIs (Arts and Hazuda, 2012) (Table

2.4).

Table 2.4: Resistance mutation to integrase inhibitors (Wensing et al., 2017)

Cons T L E T F E G Y S Q N R Pos 66 74 92 97 121 138 140 143 147 148 155 263

DTG Y AK AS HKR H H EVG IAK QG A Y G HKR H H

RAL M Q A Y AK AS RHC HKR H H

Legend: Mutations in Bold/underline: High-level reduced susceptibility or virological response. Bold: reduced susceptibility or virological response. Plain text: reduced susceptibility in combination with other INI-resistance mutations. Abbreviations: Cons; Consensus AA, DTG; Dolutegravir, EVG; Elvitegravi, RAL; Raltegravir, Pos; AA position.

2.6.2.4 Resistance to fusion or entry inhibitors

Drug-resistant mutations against fusion inhibitors are mediated by amino acid substitutions within the first heptad repeat region (HR1) of gp41 at amino acids 36 to

45 (G36D, I37T, V38A, V38M, N42T, N42D, N43K) (Lobritz et al., 2010; Arts and

Hazuda, 2012). Any mutation at the level of these residues significantly reduced the 37 binding affinity of the enzyme for the inhibitors and impedes their proper fixation, thus preventing their inhibition function. (Arts and Hazuda, 2012) (Table 2.5). The impact on the loss of susceptibility to fusion inhibitors caused by changes at different positions varies considerably, although it appears that changes in simple amino acids may be responsible for high-level resistance to enfuvirtide in some cases (Lobritz et al., 2010; Iyidogan and Anderson, 2014). However, these mutations do not confer cross-resistance to other entry inhibitors such as attachment inhibitors or co-receptor inhibitors (Arts and Hazuda, 2012).

Table 2.5: Resistance mutation to fusion inhibitors (Wensing et al., 2017)

Cons G I V Q Q N N

Pos 36 37 38 39 40 42 43

Enfuvirtide DS V AME R H T D

2.6.2.5 Resistance to co-receptor inhibitors (CCR5)

Potential mechanisms of resistance include; tropism switching for CXCR4 instead of

CCR5 (gp120 has increased affinity for CCR5). Utilization of inhibitor to the entry receptor occurs at a faster rate thus inhibiting the entry step (Iyidogan and Anderson,

2014). It is suggested that most CCR5 antagonist-resistant strains preserve the use of the CCR5 co-receptor and that multiple mutations within different regions of gp120

(V3, V2 and constant regions 2 and 4) account for the drug-resistant phenotype

(Lobritz et al., 2010; Arts and Hazuda, 2012). 38

2.7 HIV and hepatotoxicity

Hepatotoxicity (liver disease) is often characterized by the elevation in serum hepatic enzymes (Bello et al., 2014). Potential causes of hepatotoxicity, especially among

HIV-infected patients, include medication-related (ART, non steroidal anti- inflammatory drugs and herbal remedies), comorbidity infection with other viruses

(hepatitis A, B and C), alcohol, non-alcoholic fatty liver disease, and less common causes include, opportunistic infections such as Cytomegalovirus, mycobacteria, parasitic infection, or lymphoma, autoimmune hepatitis and primary biliary cirrhosis

(Kress, 2005; Price and Thio, 2010; Pandit et al., 2012; Ayelagbe et al., 2014; Bello et al., 2014). In the era of ART, 1–54.0% of patients are shown to have hepatotoxicity which accounts for the discontinuation of ART (Barve et al., 2010; Lucien et al.,

2010; Osakunor et al., 2015; Wambani et al., 2015; Wenderlein et al., 2016).

2.7.1 Antiretroviral therapy and hepatotoxicity

Prevention and management of hepatotoxicity have emerged as a major issue for

HIV/AIDS treatment and care (Kontorinis and Dieterich, 2003; Fokunang et al.,

2010; Wenderlein et al., 2016). In the era of ART, hepatotoxicity has emerged as an important cause of death among persons with HIV accounting for 14-18% (Soriano et al., 2008; Price and Thio, 2010; Bello et al., 2014). Virtually, hepatotoxicity has been described in association with all major classes of ARV medication (Kress, 2005;

Soriano et al., 2008; Wenderlein et al., 2016) which challenge the management of

HIV infected patients to a greater extent. Even though all classes of ARVs have been linked with an increase in serum transaminases, NNRTIs (NVP and EFZ) and PIs

(Ritonavir, Nelfinavir, Indinavir, and Saquinavir) are commonly associated with liver enzyme elevations while NRTIs; (AZT > 3TC > TDF > DDI >D4T being the most 39 associated with severe hepatotoxicity) (Sulkowski et al., 2000; Kontorinis and

Dieterich, 2003; Nunez, 2006; Bello et al., 2014).

The severity of hepatotoxicity ranges from the absence of symptoms to liver decompensation which leads to liver failure and death (Kress, 2005; Nunez, 2006).

Although there has been broad variability in the criteria used in clinical studies to categorize the severity of hepatotoxicity, hepatotoxicity is classified using elevated levels of transaminases above the upper limits of normal (ULN). Severe hepatic injury is defined as >5 ULN AST and/or ALT levels during antiretroviral treatment (Nunez,

2006; Fokunang et al., 2010) and has been reported to occur in 5 to 10% of HIV patients on HAART for a period of over six months (Soriano et al., 2008; Wambani et al., 2015).

2.7.2 Mechanisms of hepatotoxicity

The pathophysiologic mechanisms underlying ARV related hepatotoxicity are not fully understood. Postulated hepatotoxic mechanisms include direct drug toxicity, immune-mediated hypersensitivity reaction, mitochondrial toxicity (associated with lactic acidosis or lipodystrophy syndrome, and steatohepatitis, underlying liver disease) and other metabolic abnormalities (Nunez, 2006).

2.7.2.1 Direct or drug-related toxicity

Drugs including ARVs (especially Nevirapine) are metabolized in the liver through the cytochrome pathways and may cause liver toxicity through enzyme polymorphisms (Pandit et al., 2012). These idiosyncratic polymorphisms of the enzymatic complexes lead to the development of hepatotoxicity in certain individuals

(Nunez, 2006). They may also cause oxidant stress and cell injury that initiates 40 additional liver injury that leads to hepatotoxicity (Maiuri et al., 2015; Wambani et al., 2015).

2.7.2.2 Hypersensitivity reactions

Hypersensitivity reactions have been observed with all NNRTIs, the NRTI (Abacavir) and PI (Amprenavir, Fosamprenavir) (Spengler et al., 2002). Hypersensitivity reactions are due to idiosyncratic reactions of the host. These immune-mediated drug reactions may cause the production of neoantigens as a result of the covalent bonds formed between the liver proteins and the drug metabolites which then result to liver damage (Nunez, 2006; Pandit et al., 2012; Wambani et al., 2015). Clinical features that may suggest an acute, immune-mediated hypersensitivity response include fever, skin rash and eosinophilia. Hepatic histopathology can vary considerably and includes hepatocellular necrosis, cholestasis, tissue eosinophilia, parenchyma and periportal infiltrates with a predominance of lymphocytes and plasma cells (Spengler et al.,

2002; Kontorinis and Dieterich, 2003).

2.7.2.3 Mitochondrial toxicity

Mitochondria play an important role in energy production, glucose and fat metabolism (Soriano et al., 2008). The ability of NRTIs (DDI, D4T, AZT, 3TC, ABC,

TDF) and PIs (ritonavir) to inhibit mitochondrial DNA synthesis by inhibiting the human mitochondrial DNA polymerase-γ result in mitochondrial toxicity (Spengler et al., 2002). Depletion of mitochondrial DNA impairs the cellular respiratory chain and eventually inhibits pyruvate and fatty acid oxidation pathways. The main feature of the hepatic lesion is the accumulation of microvesicular steatosis in liver cells which may be associated with lactic acidosis and liver failure (Soriano et al., 2008). In addition, interruption of electron transfer in the mitochondrial respiratory chain results 41 in the release of reactive oxygen species that causes hepatic tissue damage by initiating lipid peroxidation of accumulated fatty acids and causes damage to mitochondrial and nuclear DNAs (Kontorinis and Dieterich, 2003; Nunez, 2006;

Wambani et al., 2015). The release of cytokines that result in inflammation and injury of hepatocytes may further induce necrotic cell death that will aggravate the liver injury (Jaeschke et al., 2002; Grattagliano et al., 2009). Ultimately the loss of mitochondrial integrity results in the releases of cytochrome C into the cytosol, which activates caspases and thus triggers apoptosis in hepatocytes (Spengler et al., 2002;

Pandit et al., 2012).

2.7.2.4 Metabolic abnormalities

HAART may cause certain metabolic abnormalities in the metabolism of both lipids and glucose, such as lipodystrophy syndrome, insulin resistance which leads to steatosis that may cause hyper transaminasemia that will later contribute to the development of liver toxicity (Spengler et al., 2002; Nunez, 2006).

2.7.3 Diagnosis of hepatotoxicity

Hepatotoxicity can be confirmed by the liver enzymes in the serum. The liver uses enzymes to get rid of the waste generated in the body and to break down drugs, alcohol, and medications (www.nlm.nih.gov). When the liver is stressed or damaged by various infections it produces an increased level of these enzymes. The liver enzyme level is often assessed to validate its functionality (Wondemagegn et al.,

2013). These enzymes include aspartate aminotransferase [AST], alanine aminotransferase [ALT], alkaline phosphatase [ALP], Gamma-glutamyltransferase

(GGT), L-lactate dehydrogenase (LD) test among others. The level of liver deformity 42 determines the types of liver disease and helps to decide whether the disease is acute or chronic and whether cirrhosis and hepatic failure are present (Hyder et al., 2012).

2.7.3.1 Alanine aminotransferase (serum glutamic pyruvic transaminase)

This is an enzyme found primarily in the liver which is released into the blood as a result of liver damage. The enzyme catalyzes the transfer of an amino group from alanine to α-ketoglutarate forming glutamate and pyruvate. The pyruvate produced is reduced to lactate by lactate dehydrogenase (LDH) and reduced nicotinamide adenine dinucleotide (NADH)

L-Alanine + α ketoglutarate ALT L- Glutamate + Pyruvate

Pyruvate + NADH+H LDH Lactate + NAD (www.spinreact.com )

The rate of decrease in the concentration of NADH, measured photometrically, is proportional to the concentration of ALT present in the sample. The serum ALT has been regarded as a reliable and sensitive marker of liver disease because ALT is primarily localized in the liver (Thapa and Walia, 2007).

2.7.3.2 Aspartate aminotransferase (serum glutamic oxalacetic transaminase)

This is an enzyme present in body tissues like the heart, skeletal muscle, kidney, brain, and liver (Thapa and Walia, 2007). The enzyme is released into the blood when either of these organs is damaged. This enzyme catalyzes the reversible transfer of an amino group from aspartate to α ketoglutarate forming glutamate and oxalacetate. The oxalacetate produced is reduced to malate by malate dehydrogenase (MDH) and

NADH in the following equation:

L-Aspartate + α-ketoglutarate AST L- Glutamate and oxalacetate

Oxalacetate + NADH+H MAD L-Malate + NAD (www.spinreact.com )

43

The rate of decrease in the concentration of NADH, measured photometrically, is proportional to the concentration of AST present in the sample.

2.7.3.3 Alkaline phosphatase

It is an enzyme found principally in the liver and bones. ALP catalyzes the hydrolysis of p-nitrophenyl phosphate (pNPP), liberating p-nitrophenol and phosphate, according to the following reaction

ALP pNPP + H20  p-Nitrophenol + Phosphate

The rate of p-nitrophenol formation, measured photometrically, is proportional to the concentration of ALP present in the sample (www.spinreact.com).

When liver cells are damaged or bone is rapidly growing (either normal or abnormal growth), large amounts of ALP are often released into the blood (Thapa and Walia,

2007). A rise in ALP levels can lead to liver damage if gamma-glutamyl transpeptidase levels are also elevated. Since the chemical structure of the enzyme differs depending upon its origin, high levels of ALP requires that further tests be done to identify the subfractions or isoenzymes in other to determine if the elevation could be due to the liver or bone damage (Patil et al., 2013).

2.8 Cytokines in response to HIV infection

The principal damage caused by HIV infection is the weakening of the cellular immune system which causes severe immunodepression which leads to opportunistic infections in the infected individual (Tasca et al., 2012). Several studies have uncovered relationships between cytokine levels and the severity of the disease. The interaction between cytokines and HIV expression is multifaceted. A number of 44 studies conducted indicate that HIV infection causes dysregulation of the cytokine profile both in vivo and in vitro (Spear et al., 2005; Tasca et al., 2012). HIV infection is associated with a switch from a predominantly Th1 to Th2 which is indicative of

HIV disease progression and replication that leads to HIV-associated immune deficiency (Vishwanath et al., 2011; Keating et al., 2011).

It has been shown that tumor necrosis factor alpha (TNF- α) plays a critical role in the origin and progression of HIV disease as such there is a positive correlation between

HIV-1 viremia and TNF-α levels (Vishwanath et al., 2011). Thus regulating its release serves as a potential means of therapy for HIV. TNF- α induce other pro- inflammatory cytokines such as IL-6 and IL-8, which aid in the up-regulation of viral replication (Tudela et al., 2014) and stimulate the production of anti-inflammatory cytokine IL-10, which prevents further inflammation by TNF- α inhibition (Keating et al., 2011). As such IL-10 increases significantly as HIV-1 patient‟s progress to the advanced stages of the disease thus reducing immune activation by inhibiting virus replication (Deng et al., 2015). In addition IL-10 regulates the immune response by inhibiting the proliferation of certain immune cells and promoting the proliferation of others by reducing the production of inflammatory cytokines; and promoting the secretion of antibodies.

On the other hand interferon gamma (IFN-γ) is capable of inhibiting viral replication and cell proliferation in a non-specific manner. IFN-ɤ secretion correlates positively with the patient‟s T cells count and negatively with HIV-1 plasma viral load

(Kedzierska and Crowe, 2001). Interleukin–6 is usually associated with disease progression as such are elevated in HIV infection (De Medeiros et al.,

2016).Interleukin 2 leads to immunosuppressive effects that lead to the development 45 of opportunistic infections. IL-2 production is related to CD4+ T cells count and clinical status of the patients. Thus IL-2 is significantly decreased in patients with

CD4+ T cells count of <200 cells/mm3 compared to those with higher CD4+ T cells count (Kedzierska and Crowe, 2001).

IL-17 production plays a key role in inflammatory responses that may lead to the serious tissue damage, as such IL-17 production is associated with the pathogenesis of several autoimmune and chronic inflammatory diseases (Falivene et al., 2015;

Lyadovaand Panteleev, 2015). However, Th17 cells that characterize the production of IL-17 are highly susceptible to HIV and are depleted with the use of HAART. The use of HAART prevents HIV replication and thus inhibites the production of Th17 cells (Ndhlovu et al., 2008; Hammerich et al., 2010).

2.8.1 Cytokines and hepatotoxicity

Plasma cytokine levels have been postulated to change dramatically over the course of HIV (De Medeiros et al., 2016). The liver consists of several cell types that usually produce minimal levels of cytokines under normal circumstances. However, when the liver cells (predominantly Kupffer cells) become activated cytokine production increases dramatically (Tilg, 2001; Crane et al., 2012).

Cytokines are known to coordinate a complex array of numerous processes and biochemical reactions that lead to liver damage (Neuman, 2003). An imbalance in cytokine production when these cells are activated by the presence of disease-causing microorganisms or substances plays a vital role in the development of liver damage

(Crane et al., 2012). 46

Research data from both animal models and patients with hepatitis B and C suggest that pro-inflammatory and anti-inflammatory cytokines are involved in the development of liver injury (hepatotoxicity) through the activation of the necrotic and apoptosis pathways (Tilg, 2001; Zhang and Wang, 2006; Liu, 2009; Neuman et al.,

2015). The apoptosis pathway is apparently the major mechanism contributing to acute and chronic liver injury (Guicciardi and Gores 2005).

Although different cytokines can cause hepatocyte injury, many studies in patients and animal models have strongly suggested that TNF-α and IL-6 are involved in the induction of apoptosis which triggers the destruction of the liver. This has lead to the pathogenesis of many chronic liver diseases such as viral hepatitis, alcoholic liver disease, fulminant liver failure among others (Tilg, 2001; Cosgrove et al., 2009;

Maiuri et al., 2015; Seki and Schwabe 2015). These cytokines have shown to be higher among individuals with more advanced liver disease (Neuman et al., 2015). 47

CHAPTER THREE: MATERIALS AND METHODS

3.1 Study sites

This study was carried out in the Northwest region (NWR) of Cameroon which ranks

2nd (6.3%) in HIV prevalence in Cameroon and first in the Anglophone regions (INS,

2012). Patients were recruited from 5 HIV treatment clinics of; Bafut District

Hospital, Santa District Hospital, Bali District Hospital, Ndop District Hospital, and the Bamenda Regional Hospital (Figure 3.1). The sampled sites better represent the different backgrounds of individuals from the entire NWR of Cameroon. Bafut, Santa,

Bali, and Ndop are in rural areas while Bamenda is from urban settings.

48

Study sites Map of Cameroon showing the NWR Map of the Northwest Region (NWR)

Scale: 0 100 200km

0 100 200mi Figure 3.1: Map of the Northwest region (Bamenda) showing the study sites (RTG, 2013 unpublished) 49

3.2 Study design

This study was a longitudinal study involving newly diagnosed HIV positive individuals visiting any of the five HIV treatment clinics in the NWR (Bafut, Santa,

Bali, and Ndop District Hospital, and the Bamenda Regional Hospital). Ethical clearance was obtained from the Cameroon National Ethics Committee

(NO2016/01/685/CF/CNERSH/SP; Appendix III). Before executing the study, the aim, procedure, benefits, and risk of the study (Appendix IV and V) were explained in a language (Pidgin English, English or French) best understood by the participants before signing of the informed consent (Appendix VI and VII). Samples were collected at baseline prior to ART initiation (D0) and again after one (D30) and six months (D180) intervals of follow up after treatment (Figure 3.2).

Figure 3.2: Schematic representation of the study design 50

3.3 Sampling technique

The region was first stratified into urban and rural and random picking of sites from each group was done using a random number generation method.

3.4 Sample population and size determination

The minimum acceptable sample size was calculated using the Lorenz formula as stated below (Fokunang et al., 2010).

2 (Z1   )P1 P N= i 2

Where, Z1 -  = the normal distribution value = 1.96

P =Relative prevalence of HIV in the region= 6.3% (INS, 2012)

ί = precision (sampling error) = 0.05

1.962 x0.0631 0.063 N  2  91. 0.05

Considering an attrition rate of 17% (Rougemont et al., 2009) by the 6th month a total of 120 subjects were recruited for the study. Based on the total population of

1.921.229 of the NWR; Bamenda, Ndop, Bali, Bafut and Santa make up 18.4%,

10.9%, 2.9%, 3.2% and 3.7% of this population respectively (RTG, 2013 unpublished), as such 57, 33, 9, 10 and 11 patients were recruited respectively from

Bamenda, Ndop, Bali, Bafut, and Santa.

3.5 Inclusion and exclusion criteria

Inclusion criteria:

1. Confirmed HIV newly- infected patients and not yet on treatment,

2. Acceptance to participate in the study after having signed an informed consent

form, 51

3. Male or female ≥ 18 years and residing within the study areas.

Exclusion criteria:

1. Refusal to participate in the study

2. HIV infected but already on treatment

3. Patients with signs of toxicity like hepatitis B and C positive patients

4. Looking severely sick

3.6 Demographic data

A structured questionnaire (Appendix VIII) was administered to consenting participants in order to collect demographic data (weight, age, sex, level of education, income), personal daily habit (alcohol consumption, cigarette smoking), ART status

(history of ARV use before enrolment, date of drug initiation and type of ARV), pregnancy state (for females), information on compounding situations like (use of other drugs such as anti TB, paracetamol, herbal concoction, previous pregnancies for females) and the name of ARV to be initiated. The WHO stage classification was obtained from CD4+ T cells counts at baseline. Alcohol intake was classified following WHO operational definitions as no alcohol intake: for those patients who never had a habit of drinking alcohol, mild intake: those who have stopped drinking within the past 6 months, moderate alcohol intake: drinking weekly and less than 5 drinks per occasion and heavy alcohol intake: drinking weekly and >5 drinks per occasion (Wondemagegn et al., 2013). Smoking histories were classified based on the number of cigarette sticks consumed. Participants were asked about the mean number of cigarette sticks smoked per day over the previous 6 months and were classified into none, mild (<10 sticks/day), moderate (10-20sticks /day), and heavy (daily smokers with >20 sticks /day) (Jang et al., 2012). 52

3.7 Sample collection

Eight ml of venous blood was collected in uniquely coded tubes. Of this 3ml and 5ml were transferred into dry and ethylene diamine tetraacetic acid (EDTA) tubes respectively. Blood was separated and serum transported in an ice-box to Santa district hospital for liver enzymes determination while plasma was stored at -800C and later transferred in an ice-box to “Centre International de Reference Chantal Biya”

(CIRCB) Yaounde where it was kept at -200C for subsequent analysis of cytokine profile, genetic diversity and drug resistance. For the transaminases and cytokine profile, the same procedure was repeated at months one and six.

3.8 Hepatitis B and hepatitis C screening

Serological status on Hepatitis B and C of the samples was performed using rapid

HBV and HCV Diaspot strips respectively (Jakarta, Indonesia) according to the manufacturer‟s procedure. In brief, the test strip was removed from the pouch and immesed in plasma for about 10-15 seconds. The trip was then placed on a non- aborbent surface for 15 minutes (mins). A negative result was recored when only the control band (C) shows a red line, a positive result when there were two distinct read lines on the C and test (T) regions and an invalid test when the C line fails to appear

(http://sam-techdiagnostics.com/pdfs/HCV/HIV.pdf).

3. 9 Measurement of liver function enzymes (ALT, AST, and ALP)

Measurement of ALT, AST, and ALP was done using the SPINREACT commercial kits (Ctra Santa Coloma, Spain) as described by manufactures‟ manual and guided by the controls (www.spinreact.com) using the Urit 3300 machine (Diamond

Diagnostics, USA).

53

3.9.1 Alanine aminotransferase (ALT)

The ALT reagent (Appendix IX: A) was used to measure ALT by an enzymatic rate method. ALT catalyzes the reversible transfer of an amino group from L-alanine to α- ketoglutarate forming glutamate and pyruvate. The pyruvate formed is reduced by

NADH to form L-lactate and NAD+. The rate of NADH oxidation is directly proportional to the ALT catalytic activity which is determined by measuring the absorbance at 340 nm. The value was recorded as calculated by the machine and expressed in U/L. The normal reference value was up to 32U/L for female and up to

40U/L for male (www.spinreact.com).

3.9.2 Aspartate aminotransferase (AST)

AST reagent (Appendix IX: B) was used to measure AST activity enzymatically. AST present in the sample catalyzed the reversible transfer of an amino group from L- aspartate to α-ketoglutarate forming glutamate and oxalacetate. The oxalacetate reacts with NADH and is reduced to malate by malate dehydrogenase. The rate of the

NADH oxidation is directly proportional to the AST and absorbance measured at 340 nm. The machine calculates and expresses the AST activity in U/L. The normal reference value was up to 31U/L for female and up to 38U/L for male

(www.spinreact.com).

3.9.3 Alkaline phosphatase (ALP)

The ALP reagent (Appendix IX: C) was used to measure ALP activity by a standardized kinetic method. ALP catalyzes the hydrolysis of p-nitrophenyl phosphate into phosphate and p-nitrophenol. The p-nitrophenol released is directly proportional to the catalytic activity of ALP and is determined by measuring the absorbance at 405 54 nm. The machine calculated and expressed the activity in U/L. The normal reference value was 98 - 279 U/L (www.spinreact.com).

Hepatotoxicity was graded based on sex and age according to the criteria set by the

AIDS Clinical Trials Group (ACTG) as follows: grade 1 (1.25–2.5 × ULN), grade 2

(2.51–5.0 × ULN), grade 3(5.1–10 × ULN), and grade 4 (>10 × ULN). Severe hepatotoxicity was defined as grade 3 or 4 hepatotoxicity. If the AST and ALT grades were discordant, the higher of the two grades was used for classification (Sulkowski et al., 2000; Fokunang et al., 2010; Mugusi et al., 2012).

3.10 Cytokine measurement

Cytokines were measured by the Cytometric Bead Array (CBA) flow cytometry using the Human Th1/Th2/Th17 CBA kit (BD Biosciences, California) as described by

Williams et al., (2013). This allowed for the detection of IL-2, IL-6, IL-10, IL-17A,

TNF-α, and IFN-γ. Briefly, the samples were thawed, diluted with assay diluents (1:2 v/v) and added to the prepared cytokine standards, capture beads and the phycoerythrin detection reagent. The CBA analysis was then performed according to the manufacturer‟s instruction with the FCAP Array software using the BD FACS

Canto™ II flow cytometer (BD Biosciences, USA).

3.11 HIV subtyping and drug resistance determination

3.11.1 Viral RNA Extraction

Viral RNA was extracted using QIAamp® Viral RNA Mini Kit (QIAGEN, USA) according to the manufacturers‟ instructions and immediately stored at –20°C for subsequent cDNA synthesis (www.qiagen.com/resources/download). 55

3.11.2 Reverse Transcription- Polymerase Chain Reaction (RT-PCR) The extracted viral RNA was then transcribed to cDNA using in-house RT- polymerase chain reaction (RT-PCR) protocol using a one-step kit (SuperScriptTM

One-Step RT-PCR System, Invitrogen, USA) in a reaction tube containing for each

2+ sample; 25 µl 2X reaction mix (Mg buffer and dNTPs), 8 µl MgSO4 (5 mM), 3 µl

DNAse- and RNAse-free water, 0.75 µl sense primer (10 µM stock; BS: 5‟GAC AGG

CTA ATT TTT TAG GG 3‟ located at 2075-2094gag), 0.75 µl antisense primer (10

µM stock; GIO2: 5‟ TTT CCC CAT ATT ACT ATG CTT 3‟located at 3683-3703 pol ), 1 µl RNAse OUT (40 U/ µl; Invitrogen, USA), 1.5 µl RT-Taq (SuperScript

One-Step RT-PCR reverse transcriptase and Platinum Taq DNA polymerase; Life

Technologies, USA) and 10 µl of viral RNA. The RT-PCR was run under the following thermal cycling conditions; Initial step or cDNA synthesis: (1 cycle; 50°C for 30mins), denaturation: (1 cycle, 94°C for 2mins), amplification: 40 cycles

(consisting of denaturation: 95°C for 30s, annealing: 52°C for 30s, extension: 72°C for 1min), final elongation: 1 cycle 72°C for 10mins and 1 cycle 40C for 30 mins. For each PCR reaction, positive and negative controls were used to ensure the effectiveness of the reaction and the absence of cross-contamination respectively. The reaction was run in the AB 2720 thermocycler (Applied Biosystems, USA)

3.11.3 Agarose gel electrophoresis

It was used to verify the amplified amplicon obtained from RT- PCR reaction. A 1% agarose (Merck, Germany) was prepared and 1.5 μl ethidium bromide added to it.

Three μl of low DNA mass ladder was loaded into the first wells. Five l amplicons from each PCR reaction (cDNA) were added to 1.5l of loading buffer and loaded into subsequent wells. The samples were electrophoresed at 90 volts for 45 minutes. 56

The gel was viewed for the presence of the amplified product under UV light with the help of a UVP transilluminator (Analytik Jena, Germany) (Figure 3.3).

N° Sample ID Gel Picture

01 +ve Control MW 1 2 3 4 5 6 7 02 B001 7

03 B003 04 B004 05 B005 06 B006 07 -ve Control

Legend: MW- Molecular weight marker, 01- positive control, 07-negative control

Figure 3.3: Verification of amplified RT-PCR product on 1% agarose gel

3.11.4 Semi-nested PCR

This was done with 2 µl amplicons from the RT-PCR in a reaction containing; 45 µl

Platinum™ PCR supermix high fidelity (H2O, Buffer TAQ [10X], MgCl2 [25 mM], dNTPs [12.5 mM], TAQ Gold) (Invitrogen, USA), 1.5 µl sense primer (10 µM stock;

BS {5‟GAC AGG CTA ATT TTT TAG GG }3‟ located at 2075-2094gag), 1.5 µl antisense primer (10 µM stock; TAK 3{5‟ GGC TCT TGA TAA ATT TGA TAT GT

3‟} located at 3561-3583 pol). The Nested PCR was run under the following conditions; Initial denaturation (1 cycle, 93°C for 12 mins), amplification: 40 cycles

(denaturation: 94°C for 30s, annealing: 53°C for 45s, extension: 72°C for 2 mins), final elongation: 1 cycle 72°C for 10mins, 1 cycle 40C for 30 mins and 100C for infinity. The expected cDNA is about 1510 bp (position 2075 [gag] to 3583 [pol]) in 57 length. For each reaction, positive and negative controls were used to ensure the effectiveness of the reaction and the absence of contamination respectively. The reaction was run in the AB 2720 thermocycler (Applied Biosystems, USA).

Amplification of the amplicon product was verified using 1% agarose gel electrophoresis (Figure 3.4).

N° Sample ID Gel Picture 01 +ve Control MW 1 2 3 4 5 6 7 02 B001 03 B003 04 B004 05 B005 06 B006 07 -ve Control

1200 bp Amplified products

Legend: MW- Molecular weight marker, 01- positive control, 07-negative control

Figure 3.4: Verification of amplified semi-nested PCR product on 1% agarose gel

3.11.5 Purification of PCR products

Semi-nested PCR products were purified using labeled Amicon 100 ® Microcon

Ultra Pure 0.5 ml filters (Centrifugal Filters Devices, Millipore, USA) to eliminate all elements (dNTPs, primers, salts) that might have a negative influence during sequencing. Each filter was hydrated with 250 μl RNase-DNase free water and 50 μl of water added to each amplification product. All the amplification products were then transferred into the corresponding filter and the tubes centrifuged for 12 mins at

14000g. New Eppendorf tubes were labeled and the filters transferred into them.

Approximately 5-15 μl of DNase-free and RNase-free water was added (depending on 58 the concentration of the cDNA) and allowed for 2 to 3 mins at room temperature. The filters were then inverted, centrifuged for 2mins at 1000g and the purified product was stored at -20°C.

3.11.6 Sequence PCR

The purified products were sequenced in sense and antisense orientations in an automated sequencer (Applied Biosystems, Japan) using eight different overlapping sequence-specific primers (B, F, SEQ1, SEQ2, SEQ3, SEQ4, SEQ5 and TAK 3). The used primers nucleotide bases were; 5‟ AGC AGA CCA GAG CCA ACA GC 3‟

(2140-2159 gag), 5‟ CCA TCC ATT CCT GGC TTT AAT 3‟ (2582-2602 pol), 5‟

CAG GAA TGG ATG GCC CAA AA3‟ (2590-2609 pol), 5‟ TTG TAC AGA AAT

GGA AAA GGA AGG 3‟ (2660-2683 pol), 5‟ CCC TGT GGA AAG CAC ATT

GTA 3‟ (2985-3004 pol with an insertion) 5‟ GCT TCC ACA GGG ATG GAA A 3‟

(2993-3011 pol), 5‟ CTA TTA AGT CTT TTG ATG GGT CA 3‟ (3506-3528 pol), and 5‟ GGC TCT TGA TAA ATT TGA TAT GT 3‟(3561-3583 pol). The primers for the sequencing reaction were prepared based on the number of samples. Each sample contained 8 different primers-mix (3.2 µl of each primer [1 pmol], 4.8 µl H2O, 3µl of

Big Dye Terminator and 5 µl Big Dye Buffer [Applied Biosystems, USA]). For each primer, 4µl of purified cDNA was added for a total volume of 20 µl. The sequencing reaction conditions were as follows: 35 cycles (96°C for 10s; 55°C for 10s; 60°C for

4mins), 1 cycle (4°C for 30 mins). The reaction was run in the AB 2720 thermocycler

(Applied Biosystems, USA).

3.11.7 Sequence products purification

The sequencing product was purified using Sephadex-50 resin (Merck, Germany) through gel filtration chromatography in order to eliminate unincorporated 59 dideoxynucleotides (ddNTPs), excess primers and salts. Dry Sephadex G-50 Resin was loaded in a 96-well Multiscreen HV plate (Merck, Germany) and transferred to a

96-well microtitre plate. Each well was hydrated with 300 μl of DNAase and RNAase free water and incubated at room temperature for 3 hours. The plate was centrifuged at 12000g for 8 mins. The samples were transferred to the 96-well microtiter plate. A new 96 wells plate to collect the purified sample was then used as support to the 96- well microtiter plate. The plates were centrifuged at 12000g for 8 mins

3.11.8 Preparation of the optical plate for sequencing

An aliquot of formamide (Sigma-Aldrich, USA) was thawed and 13 μl pipetted into the labeled optical plate column (every 8 wells) to be used. In the case of odd number samples, formamide was used to fill the last column. Six μl of the purified sequence reaction was added into the corresponding optical plate. The mixture was denatured in the AB2720 thermocycler (Applied Biosystems, USA) under the following condition:

95° C for 2 mins followed by 4°C for 2 mins.

3.11.9 Reading the sequences on the genetic analyzer

The plate was then transferred to the Abbott Applied Biosystem (ABI) Prism 3130 genetic analyzer (Applied Biosystems, USA) and the result read. The device also allows the reading and correction of the sequences obtained by comparison with a wild-type sequence. The sequence obtained was copied and transferred to the database as a FASTA file and the results analyzed.

3.12 Data analysis

The clinical assessment and laboratory results were recorded and double-checked using Microsoft Excel. Hepatotoxicity, HIV subtypes and drug resistance mutation were analyzed using the Statistical Package for Social Sciences (SPSS) version 23 60

(Armonk, USA.) while cytokine data was done using Graph pad prism 6 software

(San Diego, USA) version 16.0. The data were summarised and presented in the form of tables, histograms, and graphs. Data were categorized and classified into different categories of age groups, sex, body mass index (BMI), level of education, baseline

CD4+ T cells count, monthly income, alcohol consumption, cigarette or tobacco intake, WHO stages, year of diagnosis and type of HAART being administered.

Categorical variables were expressed as frequencies and proportions and compared using Chi-square test while continuous variables (age, BMI, CD4, ALT, AST, and

ALP) were expressed as means ± SEM and compared to the different treatment durations using the analysis of covariance (ANCOVA). The fixed covariates considered to be possible risk factors for the liver elevated enzyme (LEE) at baseline parameters were explored using univariate logistic regression with unadjusted odds ratios and adjusted odds ratios for multivariate analyses to identify risk factors associated with severe hepatotoxicity. The variables included in the multivariate model were those with a p-value, < 0.1 in the univariable logistic regression. Mean cytokine differences between the two groups were determined using Mann-Whitney

(U) unpaired t-test. Regression analysis to determine the relationship between disease progression (CD4+ T cell count) and liver function tests were carried out using SPSS.

HIV-1 pol gene subtyping was done by phylogeny and the Stanford HIV-1 Drug resistance database (Stanford University, USA), rapid subtyping tools available at http://hivdb.stanford.edu/. Any discrepancies in HIV-1 subtype and CRF identification between the two methods was confirmed using recombinant identification program (RIP 3.0) available at (http://www.hiv.lanl.gov/content/sequence/RIP/RIP.html, 2017). 61

The Phylogeny was analyzed using MEGA vs. 7. The sequences were aligned using

ClustalW, and phylogenetic analysis performed using the neighbor-joining method of

MEGA.vs.7 software with a Bootstrap value of 1000 replicates. The reference sequences were obtained from the Los Alamos database and aligned with test sequences.

The level of transmitted drug resistance and patient-specific resistance-associated mutations (RAMs) were identified using the Stanford HIVDR Interpretation Program.

The level of significance was set at p<0.05.

62

CHAPTER FOUR: RESULTS

4.1 Study population

Of the 120 clients recruited, 20 (16.7%) were excluded. Of this, 7 (5.8%) patients died from HIV associated complications, 5 (4.2%) patients took other drugs, 3 (2.5%) relocated to another area, 2 (1.7%) promised to come but did not show up (Figure

4.1).

• At Day(D) 0: Sample size= 120(100%) 120 • At D30: Sample size= 111(92.5%) • 3 (2.5%) died, • 2(1.7%) relocated • 1(0.8%) promised to come but did not 111 • 2(1.7%) took other drugs • 1(0.8%) refused to continue

• At D180: Sample size= 102(85%) • 4(3.6%) died, 102 • 1(0.9%) relocated • 1(0.9%) promised to come but did not • 3(2.7%) took other drugs

• Data analysis: Sample size= 100(83.33%) 100 • 2(1.9%) tested positive for HBV at D180

Figure 4.1: Flow chart showing the study population

4.2 Socio-demographic and clinical characteristics of the study population

Of the 100 HIV-1 infected patients participating in this study, the mean (age range) of the patients was 36.53(18-61) years. The patients were predominantly within the age range of 30-40 years; 43(43.0%). There were females; 53(53.0%), came from the urban area; 55(55%) had attained primary education; 51(51%), with a monthly 63 income of

57(57.0%), WHO clinical stage 2; 45(45%) and 64 (64.0%) of them placed on

TDF+3TC+EFV regimen (Table 4.1).

Table 4.1: Socio-demographic and clinical characteristics of the study population by drug type

Legend: 3TC; Lamivudine, AZT; Zidovudine, EFV; Efavirenz, NVP; Nevirapine, TDF; Tenofovir 64

At baseline, the mean CD4+ T cells counts (cells/mm3) was 191.7 cells/mm3 while mean ALT, AST and ALP were 25.8(U/L), 26.7(U/L) and 90.8(U/L) respectively

(Table 4.2).

Table 4.2: Clinical and hepatic markers at baseline

Factors Range Mean SEM

BMI (kg/m2) 11.5-48.3 27.1 1.3

CD4+ counts(cells/mm3) 8-498 197.1 13.6

ALT (U/L) 2.7-40.0 25.8 1.1

AST (U/L) 6.9-37.8 26.7 1.6

ALP (U/L) 74.-187.6 90.8 3.4

Legend: ALP: Alkaline phosphatase, ALT: alanine aminotransferase; AST: aspartate aminotransferase; BMI: Body mass index, SEM: standard error of the mean.

4.3: Variation of liver biochemical markers

4.3.1 Variation of mean ALT, AST and ALP with respect to duration of

treatment

In table 4.3, mean ALT, AST and ALP increased significantly with increase in treatment duration at D30 and D180; ALT (F=16.8; p= 0.001), AST (F=11.3; p=

0.001) and ALP (F=7.8; p= 0.001). Mean ALT values were lower than mean AST values with a significant positive correlation between ALT and AST (r=0.76, p=

0.000) and ALT and ALP (r=0.53, p= 0.000) and an insignificant positive correlation between AST and ALP (r=0.12, p= 0. 26).

65

Table 4.3: Variation of ALT, AST and ALP during the study duration

Indicator (U/L) time Mean SEM F value P value ALT D 0 24.47 13.01 16.83 0.001 D 30 69.65 13.01 D180 130.79 13.01 AST D 0 27.066 17.58 11.29 0.001 D 30 75.126 17.58 D180 144.55 17.58 ALP D 0 92.37 20.535 7.83 0.001 D 30 134.39 20.535 D180 206.04 20.535

Legend: ALT; alanine aminotransferase, AST; aspartate aminotransferase, ALP; alkaline phosphatase, D; day, SEM; Standard error of mean

4.3.2 Variation of mean ALT, AST and ALP with respect to drug type

Mean values of ALT, AST and ALP were highest in patients who took

AZT+3TC+NVP regimen compared to TDF+3TC+EFV and AZT +3TC+EFV at D30 and D180 (Table 4.4). However, no significant interaction was seen between treatment duration and type of the drug. ALT (F=2.27; p= 0.06), AST (F=0.98; p=

0.42) and ALP (F=0.23; p= 0.92).

66

Table 4.4: Variation of ALT (U/L), AST (U/L), and ALP (U/L) with drug type and duration Indicator Time HAART taken Mean SEM F value P value (U/L) ALT D 0 TDF+3TC+ EFV 27.12 13.4 2.27 0.06 AZT+3TC+EFV 25.12 22.86 AZT+3TC+ NVP 21.17 28.65 D 30 TDF+3TC+ EFV 74.14 13.4 AZT+3TC+EFV 51.22 22.86 AZT+3TC+ NVP 83.62 28.65 D 180 TDF+3TC+ EFV 116.93 13.4 AZT+3TC+EFV 65.76 22.86 AZT+3TC+ NVP 209.69 28.65 AST D 0 TDF+3TC+ EFV 26.51 18.11 0.98 0.42 AZT+3TC+EFV 26.89 30.89 AZT+3TC+ NVP 27.79 38.72 D 30 TDF+3TC+ EFV 101.4 18.11 AZT+3TC+EFV 62.31 30.89 AZT+3TC+ NVP 121.67 38.72 D 180 TDF+3TC+ EFV 143.67 18.11 AZT+3TC+EFV 92.72 30.89 AZT+3TC+ NVP 197.25 38.72 ALP D 0 TDF+3TC+ EFV 87.03 21.16 0.23 0.92 AZT+3TC+EFV 105.97 36.08 AZT+3TC+ NVP 84.11 45.23 D 30 TDF+3TC+ EFV 134.74 21.16 AZT+3TC+EFV 130.99 36.08 AZT+3TC+ NVP 137.43 45.23 D 180 TDF+3TC+ EFV 190.28 21.16 AZT+3TC+EFV 189.01 36.08 AZT+3TC+ NVP 238.82 45.23

Legend: 3TC; Lamivudine, ALP; alkaline phosphatase, ALT; alanine aminotransferase, AST; aspartate aminotransferase, AZT; Zidovudine, EFV; Efavirenz, NVP; Nevirapine, SEM; Standard error of mean, TDF; Tenofovir 67

4.4 Risk factors associated with severe hepatotoxicity

4.4.1 Prevalence of hepatotoxicity

At baseline Day (D) 0, all the patients 100(100%) did not present with hepatotoxicity

(grade 0) as classified using ALT, AST and ALP values. Elevated ALT was seen in

30(30%) and 46(46%) patients at D30 and D180 respectively. Majority of the patients presented with grade 1 followed by grade 2 hepatotoxicity compared to grade 3 and 4 at D30 and D180 (Figure 4.2).

120.0 100.0

100.0

80.0 70.0

60.0 54.0 Day 0 Day 30 40.0

Prevalence (%) Prevalence 20.0 Day 180 20.0 12.0 10.0 9.0 7.0 6.0 5.0 7.0 - - - - - Grade 0 Grade 1 Grade 2 Grade 3 Grade 4 Hepatotoxicity Grade

χ2 = 61.48 P=0.000

Figure 4.2: Prevalence (%) of hepatotoxicity by ALT relating to treatment duration

A similar trend was seen with AST during which the prevalence of hepatotoxicity increased significantly (p= 0.0001) with an increase in treatment duration. A total of

34 (34%) and 43(43%) patients presented with elevated AST at D30 and D180 with the majority of patients also presented with grade 1 and 2 hepatotoxicity (Figure 4.3). 68

120

100 100

80 66 57 60 Day 0 40 Day 30

Prevalence (%) Prevalence 12 11 Day 180 20 11 10 14 7 0 0 0 0 5 7 0 Grade 0 Grade 1 Grade 2 Grade 3 Grade 4 Hepatotoxicity Grade

χ2 = 55.24 P=0.000

Figure 4.3: Prevalence (%) of hepatotoxicity by AST with regard to treatment duration

As concerns ALP, 11(11%) and 19(19%) patients presented with hepatotoxicity at

D30 and D180 respectively. This difference was statistically significant (p=0.002)

Most of the patients presented with grade 1 hepatotoxicity followed by grade 2 hepatotoxicity with 1 patient presenting with grade 3 hepatotoxicity and none with grade 4 hepatotoxicity (Figure 4.4).

120.0 100.0 100.0

89.0 80.0 81.0 60.0 Day 0 Day 30 40.0

Prevalence (%) Prevalence Day 180 20.0 13.0 8.0 5.0 - - 3.0 - - 1.0 - - - - Grade 0 Grade 1 Grade 2 Grade 3 Grade 4 Hepatotoxicity Grade

χ2 = 21.0 P=0.002

Figure 4.4: Prevalence (%) of hepatotoxicity by ALP regarding treatment duration 69

Using a higher grade of either ALT, AST or ALP, 37(37%) and 49(49%) patients presented with hepatotoxicity at D30 and D180 respectively. Of this, 22(22%) and

21(21%) patients had mild-to-moderate (grades 1 and 2) hepatotoxicity at D30 and

D180 while 15(15%) and 28(28%) patients had severe hepatotoxicity (grades 3 and 4) at D30 and D180 respectively (Figure 4.5). Thus, hepatotoxicity increases with an increase in treatment duration.

120.0 100.0

100.0

80.0 63.0 60.0 51.0 Day 0 Day 30 40.0

Prevalence (%) Prevalence Day 180

20.0 12.0 10.0 16.0 9.0 12.0 7.0 12.0 - - 8.0 - - - Grade 0 Grade 1 Grade 2 Grade 3 Grade 4 Hepatotoxicity Grade

χ2 = 68.18 P=0.000

Figure 4.5: Prevalence (%) of hepatotoxicity within the study duration

4.4.2 Risk factors associated with severe hepatotoxicity at D180

Assessing risk ratios of severe hepatotoxicity occurrence at 95% confidence interval

(CI) showed that all levels of hepatotoxicity severity occurred with respect to ALT and AST elevations, whereas grade 4 was not observed with ALP. In the univariate analyses, severe hepatotoxicity was significantly (p< 0.05) high in the age group <30 years 5(22.7%), in males 19(40.4%), patients with low monthly 26 (33.8%) and in patients with low BMI (<18.5kg/m2) 18(38.3%). Furthermore, HAART treatment 70 showed a significant differentiating characteristic (p=0.01) between those presenting with severe hepatotoxicity. Patients on AZT + 3TC + NVP drugs were 8(53.4%) more likely to have severe hepatotoxicity at 95% CI (2.86; 0.90-9.04, P=0.01). The mean

(SEM) CD4+ T cells count of those with severe hepatotoxicity was 168.0 (25.3) cells/mm3, 20(35.1%) patients with CD4+ T cells count of >200 cells/μl presented with a high level of severe hepatotoxicity. Nevertheless, the difference was not significant (p=0.06). Even though the prevalence of severe hepatotoxicity was high in those who consumed alcohol 17(30.4%) and cigarette or tobacco smoking 11(40.7%), the association only showed a trend (p=0.07) and (p=0.09) respectively. Level of education (p=0.89), the year of diagnosis (p=0.91) and WHO clinical stages (p=0.27) were not predictive for the development of severe hepatotoxicity in the univariate analyses. However, patients with a tertiary level of education 2(33.3%), patients who were diagnosed >3 years before drug initiation 4(33.3%), and patients presenting with

WHO stage 4; 2(50.0%), had a higher prevalence of severe hepatotoxicity (Table 4.5).

71

Table 4.5: Cox proportional univariate analysis for baseline characteristics of patients

Legend: 3TC; Lamivudine, AZT; Zidovudine, EFV; Efavirenz, NVP; Nevirapine, TDF; Tenofovir

All socio-demographic variables that showed significance (p<0.05) or a trend (p=

0.05-0.09) in the univariate analysis were used for the multivariate analysis. Patients

<30 years old were at risk of developing severe hepatotoxicity, the risk became higher 72

0.16(0.04-0.72) after controlling for the other variables. Low BMI at baseline was also found to be a significant predictor of severe hepatotoxicity in this study. At the multivariate analysis, the risk of developing severe hepatotoxicity in patients with low

BMI decreased to 0.33 (10%) (AOR=0.33, 95% CI=0.11-.99) after controlling for the other variables. Furthermore, patients with a monthly income of

CI=0.90-9.04). After adjusting for the rest of the variables in the multivariate model, the risk became lower (OR=2.44, 95% CI=0.58-10.26). Even though alcohol intake, cigarette or tobacco intake and CD4+ T cells count showed a trend in univariate analysis indicating an insignificant higher risk for developing severe hepatotoxicity, these factors were not predictors of severe hepatotoxicity. However, the risk to develop hepatotoxicity was higher in those who consumed alcohol and had low CD4+

T cells count (Table 4.6).

73

Table 4.6: Cox proportional multivariate analysis for baseline characteristics of patients with or without severe hepatotoxicity

Legend: 3TC; Lamivudine, AZT; Zidovudine, EFV; Efavirenz, NVP; Nevirapine, TDF; Tenofovir

4.5 Inflammatory markers and hepatotoxicity

4.5. 1 Correlation of CD4 T-cell counts with ALT and AST at D0

In figure 4.6, CD4+ T cells count varies with levels of ALT and AST. A significantly inverse regression was observed between CD4+ T cells count and ALT (R=-0.27, p=

0.001) and AST (R=-0.25, p=0.001). 74

Legend: ALT; alanine aminotransferase, AST; aspartate aminotransferase

Figure 4.6: Relationship between CD4+ T-cell counts with ALT and AST at D0

4.5.2 Comparison of mean cytokines between patients with and without hepatotoxicity

Mean plasma concentrations of TNF-α (p =0.95), IFN-γ (p =0.54), IL-17A (p =0.04),

IL-6 (p =0.02), and IL-2 (p =0.42), were higher in HIV-1 patients presenting with hepatotoxicity compared to those without hepatotoxicity at D30 with a significant difference was seen in mean IL-17A and IL 6 cytokines (Figure 4.7). 75

U=473.5 p=0.541

U=489 p=0.952

Yes No Yes No Hepatotoxicity Hepatotoxicity

U=456.5 p=0.566 U=381 p=0.037

Yes No Yes No Hepatotoxicity Hepatotoxicity

U=299 p=0.002 U=525 p=0.423

Yes No Yes No Hepatotoxicity Hepatotoxicity

Figure 4.7: Mean cytokine variation between patients presented with and without hepatotoxicity at D30

On the other hand, mean plasma concentrations of TNF-α (p =0.09), IL-17A (p

=0.03), IL-10 (p =0.36), IL-6 (p =0.03), and IL-2 (p =0.11) cytokines increased in

HIV-1 patients presenting with hepatotoxicity compared to those without hepatotoxicity at D180 (Figure 4.8). However a significant difference was seen in mean IL-17A and IL 6 cytokines. Yes No Hepatotoxocity Yes No Hepatotoxocity

Yes No Yes No Hepatotoxocity Hepatotoxocity

Yes No Yes No Hepatotoxocity Hepatotoxocity

76

U=473.5 p=0.541 U=475 p=0.094

Yes No Yes No Hepatotoxicity Hepatotoxicity

U=425 p=0.029 U=493.5 p=0.351

Yes No Yes No Hepatotoxicity Hepatotoxicity

U=348 p=0.033 U=390 p=0.110

Yes No Yes No Hepatotoxicity Hepatotoxicity

Figure 4.8: Mean cytokine variation between patients presented with and without hepatotoxicity at D180

4.6 HIV-1 genetic diversity

4.6.1 Demographic of patients

Of the 100 patients enrolled in the study, 94 samples were sequenced. Of these 62

(62%) were sequenced in the required protease and reverse transcriptase coding 77 regions while 19 (19%) were sequenced in required reverse transcriptase coding regions giving a successfully sequencing performance of 81%. The DNA sequences of the HIV-1 protease-reverse transcriptase sequences were submitted to GenBank under the following accession numbers: MK061035-MK061115 (Appendix X). The participants were aged between 18-61 years, with a median age of 36.9 years and

55.5% (45) were female. The mean (range) of CD4+ T cells count was 194.3(8–498) cells/mm3 and a greater part 59.3 % (48) of the participants had CD4+ T cells count of

<200 cells/mm3. The majority of the patients were residents in an Urban setting

54.3% (44). WHO clinical stages varied from stage 1 to stage 4 with the majority of patients 48.1% (39) classified as WHO clinical stage 2 (Table 4.7).

78

Table 4.7: Descriptive characteristics of study participants (n=81)

Indicator Variable (n) Female (%) Male (%) n=45 n=36 Site Rural (37) 24( 53.3) 13 (36.1) Urban (44) 21(46.7) 23 (63.9) Age in years Mean ± SEM 36.31±1.41 37.39±1.51 Range 18-56 20-61 <30 (17) 12 (70.6) 5 (29.4) 30-40 (37) 18 (48.8) 19( 51.2) >40 (27) 15 (55.6) 12(44.4) CD4 Classification Mean ± SEM 207.36±21.27 177.97±20.84 cells/ μL Range 8-489 31-498 <200 (48) 23 (49.9) 25 (52.1) 200-350 (19) 13 (68.4 ) 6 (31.6) 350-500 (14) 9 (64.3) 5 (35.7) WHO stage 1 (10) 5 (50.0) 5 (50.0) 2 (39) 18 (46.2) 21 (53.8) 3 (28) 19 (67.9) 9 (32.1) 4 (4) 3 (75) 1 (25)

4.6.2 Phylogenetic analysis

Phylogenetic analysis of the 81 sequences revealed a high HIV-1 group M isolates genetic diversity with four subtypes and five CRFs. The subtypes were F2 (6: 7.4%),

G (4: 4.9%), D (3: 3.7%), and A1 (2: 2.4%), and the circulating recombinant forms were CRF02_AG (61: 75.3%), CRF22_01A1(2: 2.4%), CRF06_cpx(1: 1.2%),

CRF09_cpx(1: 1.2%) and CRF11_cpx(1: 1.2%) as shown in figure 4.9. This tree also revealed 3 groups of closely related clusters (B045 and B077, B007 and B101, B062 and B0119). 79

D

F2

G CRF02_AG CRF09_cpx

CRF06_cpx CRF22_01A1

A1

NB: Sample sequences have black shapes. The reference sequences are not colored and were taken from the Los Alamos HIV database. Some references were omitted to enable better visualization of the sample sequences. 19 Figure 4.9: A phylogenetic tree of HIV-1 pol gene 80

4.6.3 HIV-1 genotypes and hepatotoxicity

After data nominalization using the natural log, the prevalence of hepatotoxicity did not show any significant difference among HIV subtypes (p= 0.35). The prevalence of hepatotoxicity was insignificantly (p=0.6) high 70.3% (26/37) among individuals harboring CRF02_AG virus (Figure 4.10).

80 70.3 70

60 50 40 Hepatotoxicity 30

Prevalence(%) 20 7.9 5.3 5.3 10 2.6 2.6 2.6 2.6 0 0

HIV subtypes

Figure 4.10: Prevalence (%) of hepatotoxicity by HIV subtypes

However, when comparing non-CRF02_AG and CRF02_AG subtypes, non-

CRF02_AG infected subjects recorded a higher prevalence of 55.0% (11/20) compared to CRF02_AG with a prevalence of 4 2.6% (26/61). This difference was however not significant (p= 0.40).

4.7 Prevalence of transmitted drug resistance

The prevalence of transmitted drug resistance was 11.1% (9/81). Of the resistance mutations observed, 8.6% (7/81) confers resistance to NRTI, 4.9% (4/81) to NNRTI 81 and 1.2% (1/81) to PI. The distribution of NRTI resistance-associated mutations also included the thymidine analog mutations (TAMs): M41L, D67N, K70R, T215F, and

K219Q that occurred in 6.2% (5/81) patients. In this study, the most common mutations were K219Q (2.5%; 2/81) and E138A (2.5%; 2/81) which confers resistance to NRTIs and NNRTIs respectively. Singleton mutations that were associated with NRTI included: T215TA, M184MV, M184V, I54IFV, D67N, K70R,

K70T, and M41ML; while that of, NNRTI was K103N, V108I, V179E, and Y181C and for PI was I54IFV. Dual-class DRM involving both NRTI and NNRTI was observed in three patients (3.7%). One patient was detected with HIV-1 variant harboring multi RAMs in both NRTI (D67N, K70R, M184V, T215F, K219Q) and

NNRTI (V108I, V179E, Y181C) (Table 4.6).

The RAMs linked to ARV drug susceptibility and the mutation net drug score, showed four resistant phenotypes, namely high level, intermediate level, low level, and potential low-level resistance. Majority of the RAMs were associated with low- level resistance 36.9% (17/46) followed by potential low-level resistance 30.4 %

(14/46). NRTIs resistance rate was highest for D4T (8/10; 80%) while for NNRTI it was same and highest for EFV and NVP (4/5; 80%) (Table 4.8). 82

Table 4.8: Demographic and immunologic characteristics of patients with TDR and predicted ARV drug resistance

GenBank Site Gender WHO HIV sub Drug class resistance mutation *Resistance-associated ID stage type Mutation predicted ARV

drug resistance NRTI NNRTI PI MK061058 Urban Male 4 CRF02_AG K219Q None None AZTa, D4Ta MK061064 Rural Male 2 CRF02_AG T215TA None None AZTb, D4Tb, DDIa MK061100 Rural Female 3 CRF02_AG M41ML None None AZTb, DDIa, D4Tb MK061051 Rural Female 2 CRF02_AG K65E None None ABCa, DDIa, TDFa, D4Ta MK061069 Urban Male 2 CRF02_AG None E138A None ETRa, RPVb MK061076 Urban Male 2 CRF02_AG K70T E138A None ABCb, D4Tb, DDIb, FTCa, TDFb, 3TCa/ ETRa, RPVb MK061065 Urban Male 2 CRF02_AG M184MV K103N None ABCb, DDI b, FTCd, 3TCd / EFVd, NVPd ETRa, RPVd MK061090 Urban Female 4 CRF02_AG D67N, K70R, V108I, None AZTd, TDFc, 3TCd, ABCd, M184V, T215F, V179E, FTCd, D4Td,DDId/ EFVd, K219Q Y181C NVPd, ETRc, RPVd MK061080 Rural Female 3 CRF22_01A1 None None I54IFV ATV/rb, LPV/rb NFVb, FPR/rb IDV/ra, SQV/rb TPV/rb NB: The bold and underlined are drugs used in this study 83

Legend: 3TC; Lamivudine, ABC; Abacavir, ATV/r; Atazanavir/r, AZT; Zidovudine, D4T; Stavudine, DDI; Didanosine, EFV; Efavirenz, ETR; Etravirine, FPV/r; Fosamprenavir/r, FTC; Emtricitabine, IDV/r ; Indinavir/r, LPV/r; Lopinavir/r, NFV; nelfinavir, NNRTI; Non-nucleoside reverse transcriptase inhibitor, NRTI; Nucleoside reverse transcriptase inhibitor, NVP; Nevirapine, PI; protease inhibitors, RPV; Rilpivirine, SQV/r; Saquinavir/r, TDF; Tenofovir, TPV/r; Tipranavir/r a = Potential low-level resistance (mutation net drug score (10–14). b = Low-level resistance (mutation net drug score of 15–30). c = Intermediate resistance (mutation net drug score of 31–59). d = High-level resistance (mutation net drug score of ≥60).

4.7.2 Assessing the presence of TDR and prevalence of hepatotoxicity at end of

D180

A total of 37 (45.7%) patients presented with hepatotoxicity at Day 180 (Table 4.9).

Of this, 18.9% (7/37) had TDR. The hepatotoxicity grades of the patients with TDR were as follows; grade 1(n=1), grade 2 (n=2), grade 3 (n=2) and grade 4 (n=2). This difference was significant P=0.04.

Table 4.9: Assessing the presence of TDR and prevalence of hepatotoxicity at end of D180

Hepatotoxicity Drug-resistance mutation

No (%) Yes (%) No 42(58.3) 2(22.2) Yes 30(41.7) 7(77.8)

ᵡ2 = 3.87 p= 0.040 84

CHAPTER FIVE: DISCUSSION, CONCLUSIONS, AND

RECOMMENDATIONS

5.1 Discussion

Hepatotoxicity linked to HAART is expressed by elevation of liver-associated enzymes such as ALT, AST, and ALP (Ngala et al., 2015). These liver associated enzymes are measures of liver homeostasis and abnormal levels of these enzymes can be classified as either hepatocellular (increase in AST and ALT), cholestatic (increase in ALP), or mixed with hepatocellular hepatotoxicity being the most common type

(Mata-Marín et al., 2009; Fokunang et al., 2010). Elevations of these enzymes have been associated with all classes of ART (NRTI, NNRTI, and PI). However, not all drugs within each class have similar effects on the liver thus the extent to which each drug of HAART contributes to hepatotoxicity varies (Lucien et al., 2010;

Wondemagegn et al., 2013; Wu et al., 2015; Abongwa et al., 2017).

5.1.1a Variation of liver biochemical markers in relation to the duration of treatment

Data from this study showed a significant positive linear relationship between elevated ALT, AST and ALP levels with an increase in the duration of treatment irrespective of the type of drugs. Similar results have been reported elsewhere

(Ayelagbe et al., 2014; Bello et al., 2014; Ngala et al., 2015). These liver enzymes elevation could be as a result of mitochondrial damage, direct drug toxicity or hypersensitivity reactions (Ofotokun et al., 2007; Navarro et al., 2014; Shiferaw et al., 2016). Nevertheless, it may also be associated with other variety of factors such as alcohol, opportunistic infections and concomitant medications (Nagu et al., 2012;

Ayelagbe et al., 2014) since in the course of interaction with these patients, some of 85 them confirmed the use of traditional or herbal concoctions as alternative sources of therapies. As indicated in the treatment guideline all these patients took

Trimethoprim-sulfamethoxazole for the prevention of opportunistic infections (MPH,

2015). Trimethoprim-sulfamethoxazole has shown to cause hepatotoxicity by idiosyncratic liver injury or hypersensitivity reaction (Lucien et al., 2010; Navarro et al., 2014; Ngala et al., 2015; Abongwa et al., 2017).

A higher AST value seen compared to ALT value is similar to previous studies in the same country (Lucien et al., 2010; Abongwa et al., 2017). This is probably because

ALT is an enzyme present only in liver cells while AST is a mitochondrial enzyme that is also present in liver and other body organs like brain, pancreas, heart, kidneys, lungs, and skeletal muscles (www.verywellhealth.com/liver-enzymes) as such if any of these tissues are damaged, AST will be released into the bloodstream. Considering that the AST/ALT ratio is useful in differentiating between causes of hepatotoxicity, the ratio of AST and ALT in this study was less than 2 indicating that hepatotoxicity in these patients was induced by HAART and not alcohol (Nyblom et al., 2004;

Thapa and Walia, 2007).

5.1.1b Variation of liver biochemical markers in relation to drug type

In this study, mean levels of ALT and AST increased significantly in NVP-based

HAART compared to non-NVP-based HAART similar to previous studies (Soriano et al., 2008; Sterling et al., 2008). However, this is contrary to studies by Gisolf et al.,

(2000) and Wu et al., (2015) which state that the use of ritonavir and zidovudine respectively were found to be severely hepatotoxic. The mechanism of hepatic injury with Nevirapine is associated with hypersensitivity reactions (Sulkowski et al., 2002;

Chu et al., 2010). Furthermore, Nevirapine is a potent inducer of Cytochrome P450 86 isoenzymes CYP2B6 that favor the production of a toxic intermediate such as reactive oxygen species (ROS) that might cause hepatic therapeutic failure and injury (Hedrich et al., 2016).

5.1.2 Risk factors associated with severe hepatotoxicity

Results from this study like in previous studies in other parts of Cameroon (Fokunang et al., 2010; Lucien et al., 2010) and elsewhere (Wambani et al., 2015; Wenderlein et al., 2016) showed a high prevalence of hepatotoxicity in HIV patients on HAART

(13%-53%). The values from this study were higher than the 13% to 32% range in previous studies (Wondemagegn et al., 2013; Tseng et al., 2014; Wenderlein et al.,

2016) and lower compared to the 53% as reported by Lucien et al., (2010) in the

Littoral region of Cameroon. The difference in the rate of hepatotoxicity reported in these studies compared to other studies is probably due to differences in the population characteristics (patients with hepatitis B or C, patients on anti TB drugs among others), definitions of hepatotoxicity (use of baseline ALT or AST values with reference to the normal range), frequency of patient monitoring, type of HAART and other drugs, since HIV patients often ingest a cocktail of drugs in association with the HAART regimen to control other illnesses.

The high prevalence of hepatotoxicity 37(37%) recorded as early as one month during the course of treatment has also been reported in other studies (Mugusi et al., 2012;

Wenderlein et al., 2016). Of the 37 patients presenting with hepatotoxicity at D30,

17(44.7%) did not present with hepatotoxicity at D180. This is a clear indication that some liver diseases are often associated with HIV infection other than HAART.

Nevertheless, it has been reported that the hepatotoxic effects of HAART may resolve with time when the organ gets used to the drug in some patients (Bello et al., 2014). 87

As such, it is evident that hepatotoxicity in HIV patients is multifactorial (Ayelagbe et al., 2014) and can be attributed to mitochondrial toxicity, hypersensitivity reaction, or other AIDS-related opportunistic diseases caused by bacteria (Cryptosporidium parvum, Microsporidium, Mycobacterium avium complex), fungi (Candida albicans,

Aspergillus fumigates, Cryptococcus neoformans, Histoplasma capsulatum,

Coccidioides immitis), protozoa (Toxoplasma gondii, Leishmania species), Helminth

(Strongyloides stercoralis), viruses (Cytomegalovirus, Herpes simplex virus, Human herpesvirus 8, Varicella-zoster virus, Epstein-Barr virus, Adenovirus). These opportunistic infections stimulate an immunological response in the hepatic phagocytes which account for liver enzyme elevation (Price and Thio, 2010;

Ayelagbe et al., 2014). Thus, since HIV patients present with different ailments, there is high probability that mechanisms of hepatotoxicity from HAART may result from the interaction between HAART and non antiretroviral drugs (such as antibiotics, antifungal, antiviral and herbal concoctions) used as alternative therapies in combating the different diseases (Hamza et al., 2014; Wenderlein et al., 2016;

Abongwa et al., 2017). Thus the incidence rates of hepatotoxicity during HAART may vary across different populations and with different drug combinations (Navarro et al., 2014; Osakunor et al., 2015; Wambani et al., 2015). Moreover, the high prevalence of hepatotoxicity seen at D180 can also be attributed to the fact at D180 there is an increase in CD4+ T cells count with the continuous use of HAART. A gradual increase in CD4+ T cells count usually leads to weight gain from the baseline which increases the level of transaminases (Mugusi et al., 2012; Tseng et al., 2014).

It has been reported that mild-moderate (grade 1 and 2) hepatotoxicity is of limited clinical relevance and often ignored by most investigators since mild-moderate hepatotoxicity resolves whether HAART is continued or not (Bello et al., 2014; 88

Ayelagbe et al., 2014; Hamza et al., 2014). In this study, the high prevalence of severe hepatotoxicity at D30 (15%) and D180 (28%), is higher than the 6-12% reported elsewhere (Sulkowski et al., 2002; Wambani et al., 2015; Wenderlein et al.,

2016) and in Cameroon (Fokunang et al., 2010). However, this high prevalence of severe hepatotoxicity seen in this study ties with a previous retrospective review of adults living with AIDS in Boston, where researchers confirmed that long time use of

HAART is associated with a high rate of severe hepatotoxicity regardless of drug class or combination (Luma et al., 2012). As such it is necessary to assess the risk factors associated with severe hepatotoxicity after D180 of treatment.

Various conflicting risk factors for the development of severe hepatotoxicity have been described in other studies and include; HIV itself, age, gender, race, hepatitis B and C co-infection, increase in CD4+ T cells count after the start of ART, higher baseline levels of ALT and AST, opportunistic infections, cirrhosis, most antiretroviral, anti-tuberculosis, lipid-lowering drugs, alcohol, metabolic syndrome

(Chu et al., 2010; Nagu et al., 2012; Wondemagegn et al., 2013; Abongwa et al.,

2017).

Age was found to be a predictor of severe hepatotoxicity contrary to another study by

Wondemagegn et al., (2013). Findings from this study revealed that the prevalence of severe hepatotoxicity was significantly high in patients <30 years contrary to studies by Fokunang et al., (2010), Lucien et al., (2010), Luma et al., (2012), and Abongwa et al., (2017) who found that those patients >30 years were at risk of developing hepatotoxicity. These differences in age can be attributed to the difference in the study design (characteristics of the population, duration of treatment, and definitions of severe hepatotoxicity) in the different studies. The most probable reason for the high prevalence in this group can be attributed to their lifestyle. This group is an 89 active age group and constitute people with high social activities such as high alcohol intake and cigarette smoking that have shown to increase the level of liver enzymes

(Jang et al., 2012; Park et al., 2013). Secondly, there is a high probability that this group of individuals might also take other drugs as well as herbal concoctions to get healed faster to meet up with their economic and social demands.

Observations from this study demonstrate an important relation between BMI and serum activity rates of liver enzymes. This data suggest that body weight may be the major factor in determining the serum level of liver enzymes. Low BMI was found to be an independent predictor of severe hepatotoxicity. This finding confirms the findings of Wambani et al., (2015) and Wenderlein et al., (2016), that good nutritional status at the start of HAART is protective against early hepatotoxicity.

However, other studies show that BMI had no association with liver enzyme levels

(Adams et al., 2008; Park et al., 2013). Previous studies in Pakistani (Qureshi et al.,

2006) and India (Tasneem et al., 2015) indicated that increase in serum ALT and AST levels are associated with an increase in BMI as a result of an increase in dietary fat content (Tasneem et al., 2015). High level of dietary fat causes higher levels of oxidative stress and lipid peroxidation which lead to mitochondrial DNA damage and thus hepatocellular injury (Mattar et al., 2005; Wambani et al., 2015). Furthermore, it has been reported that there exists a positive association between alcohol consumption and BMI with liver enzymes (Adams et al., 2008; Tasneem et al., 2015). This reflects the high prevalence of hepatotoxicity seen at D180.

Monthly income has been shown to play an important role in the life of individuals. A positive correlation (r=0.69; p=0.05) seen between monthly income and BMI is a clear indication that people with low monthly income presented a high prevalence of 90 severe hepatotoxicity. In this study low monthly income was another significant predictor of severe hepatotoxicity in the multivariate model. Mostly, this group of persons also present with low BMI at baseline and an increase BMI at D180. Increase in BMI results to accumulation of dietary fat in the liver that leads to liver injury. In addition, lower monthly income is associated with poor quality of life as patients with low monthly income might go in for traditional or herbal and substandard drugs during treatment (Oguntibeju, 2012).

There was sampling bias in terms of drug administration as the majority of the patients (64%) were placed on TDF+3TC+EFV and the least (14%) on

AZT+3TC+NVP. Drugs were administered based on the patients CD4+T cells count, weight, hemoglobin values, and the WHO clinical stage. The development of hepatotoxicity is common with all classes of ART (Ofotokun et al., 2007; Soriano et al., 2008; Price and Thio, 2010; Wambani et al., 2015; Wenderlein et al., 2016) and is of great concern as it necessitates cessation or modification of treatment. However, the risk varies depending on the HAART combination and other patient-related factors such as alcohol and/or cigarette consumption, CD4+ T cells levels, BMI

(Wambani et al., 2015). In this study, the prevalence of severe hepatotoxicity was highest among patients who took the NVP-based regimen. It has been reported that

NVP causes elevated liver enzyme level by mitochondrial damage or hypersensitivity reaction (Chu et al., 2010; Tseng et al., 2014; Hamza et al., 2014; Hedrich et al.,

2016; Wenderlein et al., 2016 ). From this data, it was also realized that those who took AZT+3TC+ NVP presented with elevated ALP. This confirms the fact that the use of NVP is also associated with cholestatic liver enzyme elevations. 91

Although gender showed a trend in univariate analysis, no association was found in the multivariate analysis. Results from this study were similar to those of Nagu et al.,

(2012), Bello et al., (2014), and Abongwa et al., (2017) and contradict those of

Sulkowski et al., (2002), Chu et al., (2010), and Wondemagegn et al., (2013). The reason for this gender discrepancy is not clear given that the courses of HAART metabolism in humans are not sex-dependent (Wondemagegn et al., 2013). Thus, this high prevalence could be due to other social habits that are common in males than females. In this study, more males than females were found to consume alcohol

(59.4% vs. 41.6%) and cigarettes (92.9% vs. 7.1%). These two factors increase liver function enzymes Park et al., 2013; Wondemagegn et al., 2013; Alsalhen and

Abdalsalam, 2014). In addition, high alcohol consumption rate accounts for excess weight gain that leads to high BMI which has been associated with a greater risk of elevated transaminases (Tasneem et al., 2015). The high hepatotoxicity prevalence in male gender can also be due to hormonal effects on drug metabolism. These differences, however, warrant further study.

Alcohol consumption is a common practice in the adult populations and virtually constitutes a behavioral norm that cut across all boundaries of gender, race, age and economic strata (Priya and Venkatalakshmi, 2013). Alcohol consumption is one of the factors most frequently associated with elevated liver enzyme levels (Park et al.,

2013; Wondemagegn et al., 2013). Alcohol use and abuse occur frequently in those with HIV/AIDS (Barve et al., 2010) and has been linked to poor response to HIV treatment, as well as the rapid progression of HIV disease (McCance-Katz et al.,

2013). Thus, alcohol-HAART interactions are essential for the development of hepatotoxicity in HIV patients. Studies have shown that alcohol abuse is associated with severe hepatotoxicity in patients on HAART (Nunez 2006; Barve et al., 2010). 92

Although the prevalence of severe hepatotoxicity was higher in those who took alcohol, it‟s intake was not a significant risk factor of severe hepatotoxicity in this study similar to results reported by Wambani et al., (2015). However, alcohol intake has previously been reported as an independent risk factor for hepatotoxicity in HIV infected persons (Barve et al., 2010; Hamza et al., 2014; Subramaniyan and Middha,

2016) and non-HIV patients (Priya and Venkatalakshmi, 2013). Alcohol and

HAART-induced liver disease share similar mechanisms of hepatic injury. This includes altered metabolism cytokines, dysfunction of some cell components and mitochondria toxicity (Barve et al., 2010; Wondemagegn et al., 2013; Subramaniyan and Middha, 2016). This result is also apparent as more men and patients with overweight BMI presented with a higher prevalence of severe hepatotoxicity at D180.

Thus it is most likely that alcohol consumption may lead to liver enzyme elevation

(Suter, 2005; Adams et al., 2008). However, since the AST/ALT ratio at D180 was

<2 it is highly suggestive that HAART is the etiology of the liver injury and not alcohol (Salaspuro, 1987; Nyblom et al., 2004) in this study. Nevertheless, this result should be interpreted with caution since measurements of blood alcohol was not done and there were inconsistencies regarding the definitions of alcohol consumption taking into account the participants took different types of alcohol (imported and locally produced).

Smoking is a common addiction of present times (Alsalhen and Abdalsalam, 2014;

Kumar et al., 2015) and causes series of adverse effects on organs that have no direct contact with the smoke due to the over 4000 harmful toxic chemical substances

(nitrogen oxide, nicotine, tar, hydrogen cyanide, carbon monoxide and free radicals such as superoxide, hydrogen peroxide, among others) that it produces (Abdul-Razaq and Ahmed, 2013; Kumar et al., 2015). Thus, smoking is one of the basic causes of 93 many diseases such as cardiovascular diseases, respiratory disorders, cancer, peptic ulcers, gastroesophageal reflux disease, male impotence and infertility, blindness, hearing loss, bone matrix loss, and hepatotoxicity (El-Zayadi, 2006; Abdul-Razaq and

Ahmed, 2013; Alsalhen and Abdalsalam, 2014). In this study, an insignificant rise in serum ALT, AST and ALP activity was recorded in cigarette smokers when compared to nonsmokers. These results are consistent with known facts from other studies

(Abdul-Razaq and Ahmed, 2013; Elameen and Abdrabo, 2013; Alsalhen and

Abdalsalam, 2014; Kumar et al., 2015) while other studies contradict this effect (Jang et al., 2012; Dass et al., 2013).

Alteration in liver enzymes in smokers can either be direct or indirect immunological effects due to the toxic chemical substances produced by the cigarettes (El-Zayadi,

2006; Elameen and Abdrabo, 2013). These toxic chemical substances induce oxidative stress on hepatocytes that damage the biological cell membrane of the liver, thereby increasing the severity of hepatic lesions (Abdul-Razaq and Ahmed, 2013;

Alsalhen and Abdalsalam, 2014; Kumar et al., 2015). In addition, nicotine produced during smoking has shown to increased the production of pro-inflammatory cytokines

(IL-1, IL-6, TNF-α) that have been involved in liver cell injury (El-Zayadi, 2006; Liu,

2009; Wannamethee and Shaper, 2010; Abdul-Razaq and Ahmed, 2013; Elameen and

Abdrabo, 2013). Moreover, smoking has shown to further affect the metabolic effects of the liver in detoxifying alcohol and medications (Wannamethee and Shaper, 2010;

Jang et al., 2012; Elameen and Abdrabo, 2013; Hamza et al., 2014).

Evaluation of CD4+ T cells count level is a vital tool in the management of HIV-1 infection (Kang et al., 2012). Interestingly, in our study low CD4+ T cells count was a minor risk factor for liver toxicity since low CD4+ T cells count showed a trend with 94 hepatotoxicity only in the univariate analysis. Results from this data also revealed that the high CD4+ T cells count after D180 (470.57 cells/mm3) is associated with a higher risk of hepatotoxicity in the adjusted multivariate analysis though it was insignificant.

This is similar to a report by Wambani et al., (2015) which states that an increase in

CD4+ T cells count from baseline has a higher chance of hepatotoxicity in HIV and

HBV/HCV co-infection. Since the use of HAART has shown to increase CD4+ T cells count and BMI, therefore, there is a high probability that increases in CD4+ T cells count will lead to elevated ALT and AST (Nagu et al., 2012). This result attests to the fact that the use of NVP-based regimen associated with high CD4+ T cells count is a risk factor to the development of severe hepatotoxicity (Hamza et al., 2014; Wambani et al., 2015).

5.1.3 Inflammatory markers associated with hepatotoxicity

While infection of hepatocyte cell lines is thought to be CD4+ T-cell independent, as most primary hepatocyte cell lines do not express CD4+ (Denue et al., 2013), evaluation of CD4+ T cells count level is a vital tool in the management of HIV-1 infection. With the progressive loss of CD4+ T cells count in HIV infection, the dysfunction in the T cells compartment is reflected by cytokine expression (Deng et al., 2015). The negative correlation between CD4+ T cells count and transaminase levels is probably due to the fact that a reduction in CD4+ lymphocytes results in an increased protein (for example lipopolysaccharide) turnover which acts as a pro- inflammatory and pro-fibrotic substance on the liver resulting to a rise in the liver enzymes (Shiferaw et al., 2016).

Th17 cells are a subset of CD4+ T-helper cells characterized by the production of cytokine IL-17 (Hammerich et al., 2010). These Th17 cells are highly susceptible to 95

HIV and thus, are depleted with the use of HAART (Ndhlovu et al., 2008). On the contrary, higher mean IL-17 was recorded at the end of the study. Studies in human liver disease (chronic HBV and HCV infections) indicate a close correlation between liver inflammation and activation of Th17 cells in relation to liver damage

(Hammerich et al., 2010). It has been reported that IL-17 also up-regulates the production of TNF-α and IL-6, which stimulate hepatocytes signaling responses resulting in liver diseases and injuries (Galun and Axelrod, 2002; Cosgrove et al.,

2009; Deng et al., 2015). In addition, the high level of IL-17 seems to be potentially disadvantageous for the patient in terms of antiviral defense and liver disease progression, since higher levels of IL-17 are associated with higher viral plasma load and increased levels of serum transaminases (Rowan et al., 2008; Hammerich et al.,

2010). In addition, a review study by Njoku (2014) demonstrates that high levels of

IL-17 have been detected in the sera from patients with idiosyncratic liver injury.

Besides in a mice model, administration of recombinant IL-17 causes elevated plasma transaminases which lead to liver injury. This strongly indicates that IL-17 cells are involved in liver injury (Kobayashi et al., 2009). Thus, this result indicates that IL-

17A is associated with hepatotoxicity.

Other studies have also demonstrated the importance of IL-6 during the course of liver infection (Neuman, 2003; Liu, 2009; Neuman et al., 2015). In this study a significantly high level of IL-6 was seen in hepatotoxicity patients compared to non- hepatotoxicity patients at D30 and D180 similar to a study by Neuman et al., (2015).

In addition, decreased plasma levels of IL-6 at D30 and an increase by D180 can also be attributed to hepatotoxicity since the prevalence of hepatotoxicity was highest at

D180. It has been reported that IL-6 plays an important role in inflammatory signaling 96 in liver regeneration following liver injury (Galun and Axelrod, 2002; Knight et al.,

2005).

An insignificant increase in TNF-α values seen in participants with hepatotoxicity is similar to previous reports (Zhang and Wang, 2006; Liu, 2009; Neuman et al., 2015).

This is most probably because TNF-α which regulates viral replication is involved in the induction of apoptosis which triggers the destruction of the liver and thus hepatic failure (Liu, 2009). Secondly, TNF-α also regulates the secretion of IL-6 which is involved in liver regeneration and repair (Neuman, 2003; Liu, 2009). Although this study did not demonstrate any significant changes in TNF-α levels between participants with and without hepatotoxicity, the high levels of TNF-α in people with hepatotoxicity is supportive of the fact that TNF-α may also induce hepatotoxicity since TNF–α is a prominent known cytokine player in liver injury and regeneration

(Galun and Axelrod, 2002). Beside, TNF-α has induced liver injury in the rat model of alcoholic liver disease (Kawaratani et al., 2013). Further investigation is necessary to determine if TNF-α is expressed on hepatic cells considering that TNF-α is an inflammatory cytokine that triggers the production of IL-6 that has been shown to be significantly higher in patients with hepatotoxicity (Neuman, 2003; Hileman et al.,

2015).

Although the difference was not significant, increased levels of IL-10 in patients with hepatotoxicity is indicative that IL-10 plays a major role in chronic liver disease as the liver is the main source of IL-10 production (Zhang and Wang, 2006; Kawaratani et al., 2013). Furthermore, the positive correlation observed between IL-10 and AST in patients with chronic hepatitis B (CHB) is a clear indication that IL-10 can also be secreted in patients with HAART-induced hepatotoxicity (Lian et al., 2014). As such, 97 future studies using a larger population with longer treatment duration needs to be carried out to confirm these findings.

This study also reveals that IL-2 increases insignificantly in participants with hepatotoxicity compared to those without hepatotoxicity at D30 and D180. During treatment, viral replication is significantly inhibited (Meira et al., 2008; Tudela et al.,

2014) and thus subsequent reduction of IL-2. As such the high prevalence of hepatotoxicity at D180 might contribute to the observed high level of IL-2. Hence, there is a probability that IL-2 can affect hepatic cells implying that its detection might be useful in the management of HAART-induced hepatotoxicity.

5.1.4 HIV-1 genetic diversity

Periodic updating of HIV-1 reference sequences is fundamental in improving subtypes characterization in the context of effective epidemiological surveillance. The extreme variability and the high evolution rate of HIV-1 favor the development of

ARV resistant HIV (Santoro and Perno, 2013; Saber et al., 2016). Thus, HIV-1 diversity is one of the greatest challenges among the many challenges in achieving an effective and preventive vaccine development (Santoro and Perno, 2013; Saber et al.,

2016; Patino-Galindo et al., 2017). Data from this study showed a wide genetic diverse population among HIV-1 group M and these include 4 pure subtypes and 5

CRFs despite the low HIV prevalence (3.4%) in Cameroon

(www.cameroononline.org). Similar distributions of HIV-1 subtypes have also been described in other towns such as Douala, Yaounde and Bertoua in Cameroon

(Ragupathy et al., 2011; Ceccarelli et al., 2012; Agyingi et al., 2014; Courtney et al.,

2016; Teto et al., 2017) and other African countries like Nigeria (Chaplin et al., 2011) and Kenya (Onywera et al., 2017). This broad genetic diversity is most probably due 98 to the fact that this region is located around the central Cameroon, where almost all

HIV groups and subtypes have been found (Ndembi et al., 2008; Courtney et al.,

2016).

The recombinant CRF02_AG which predominates (75.3%) in this study falls within the 48.6-80% range of previous studies conducted in Cameroon and other countries in

West Africa, Central Africa and Europe (Powell et al., 2010; Ragupathy et al., 2011;

Veras et al., 2011; Ceccarelli et al., 2012; Negedu-Momoh et al., 2014; Teto et al.,

2017). The high prevalence of CRF02_AG suggests that this viral strain may be well adapted in the Cameroonian population due to a founder effect from the parent strains subtype A and G, or may have some biological advantages such as a higher replicative fitness relative to parental subtype A and G and modification of tropism over other co-circulating recombinants strains in our country (Ragupathy et al., 2011;

Veras et al., 2011; Agyingi et al., 2014). Thus, the high prevalence of CRF02_AG species is suggestive that CRF02_AG will certainly aid in the design of an effective vaccine.

Compared with other studies from different towns in Cameroon, the prevalent subtypes after CRF02_AG were F2, D, and G contrary to the G, F2, and D (Ndembi et al., 2008) and D, F2, G subtypes (Courtney et al., 2016). The difference in prevalence may be explained by the difference in the HIV-1 epidemic in different geographical regions and the migration of populations. Three complex strains;

CRF06_cpx, CRF09_cpx and CRF11_cpx were also found in this study. This complex mosaic virus has also been found in other continents like Europe and

Australia and likewise in some West African countries such as Ivory Coast, Niger,

Mali and Senegal (Peeters and Sharp, 2000; Negedu-Momoh et al., 2014). 99

In this study, HIV-1 subtypes that were closely related were also identified. Similar cluster phenomenon has been observed in previous studies carried out elsewhere

(Smith et al., 2009; Weng et al., 2014; Parczewski et al., 2015; Patino-Galindo et al.,

2017). These clusters suggested that these patients might have been infected recently with the HIV-1 virus. It is worth noting that Cameroon, as well as other countries, is currently implementing the test and treat policy where all patients tested positive for

HIV are placed on treatment irrespective of their CD4+ T cells count or WHO clinical stage. However, it could also be possible that the transmission of related viral sequences may correlate with shared social or risk-behaviour patterns such as scarification, intravenous drug use or HIV transmission between men having sex with men among others (Weng et al., 2014; Parczewski et al., 2015; Patino-Galindo et al.,

2017). Several studies have shown that resistance mutations with minimal impact on viral fitness may be transmitted serially (Weng et al., 2014; Steegen et al., 2016).

While having clinical implications, the potential benefit in identifying these clusters in public health requires further investigation to ascertain this fact. This will alleviate ongoing transmission originating from recently infected individuals or tracing back the potential index case (Smith et al., 2009; Weng et al., 2014). Identifying HIV clusters are important in helping public health officials to identify areas where interventions might be useful in preventing further spread of the infection. Thus, the presence of clustering is an important contribution to the spread of the resistant virus and requires further investigation with a wider population.

This study was the first to assess the impact of HIV subtypes on hepatotoxicity. HIV subtypes alongside other risk factors associated with hepatotoxicity can help curb the incidence of hepatotoxicity in our settings. The result of this study revealed that hepatotoxicity is more common in patients with CRF02_AG. This high prevalence 100 may be due to sampling bias in favor of CRF02_AG since CRF02_AG accounted for more than half of the total HIV-1 subtypes. In addition, categorizing the data as

CRF02_AG and non-CRF02_AG showed that hepatotoxicity was insignificantly higher in the non-CRF02_AG subtypes. As such it is required that such studies be carried with equal HIV-1 subtype populations.

5.1.5 Transmitted drug resistance

Cameroon like other poor resource-limited countries is moving towards reaching the

90-90-90 universal access to HIV prevention, care, and treatment for those in need and at high risk of infection (Konou et al., 2015; Sidibe et al., 2016). This has led to the widespread use of ART in Cameroon and other countries (Billong, et al., 2016;

Teto et al., 2017).

HIV isolates containing resistance mutations in drug-naïve individuals have been previously described in Cameroon. Our study revealed a moderate level (11.1%) of

TDR as classified by WHO (Steegen et al., 2016). This prevalence falls within the global TDR estimates range of 8–44% in developing countries ( Ragupathy et al.,

2011; Xiaobai et al., 2014; Ferreira et al., 2017; Onywera et al., 2017). In Cameroon, this value is higher compared to the 7.3-10.8% range (Ndembi et al., 2008; Teto et al.,

2017; Mbunkah et al., 2018; Tchouwa et al., 2018) and lower than the 13.9- 24% range (Burda et al., 2010; Agyingi et al., 2014; Zoufaly et al., 2014) as documented in previous studies. The moderate prevalence can be attributed to poor drug adherence, loss of follow-up, pharmacy stock-outs, lack of proper patient retention in care and the use of ARV drugs to prevent mother to child transmission or as pre and post- exposure prophylaxis (Billong et al., 2013; Fokam et al., 2015; Parczewski et al.,

2015; Steegen et al., 2016; Sallam et al., 2017; Teto et al., 2017). The use of HAART 101 in HIV prevention has led to a high rate of acquired drug resistance and possible onward transmission of the resistant strains to newly infected individuals. In addition, it can also be associated with mutations that occur within the HIV genome (Onywera et al., 2017; Teto et al., 2017). This moderate level of TDR in naïve patients suggests that drug resistance viruses are transmitted in this region and thus, might create a major threat to the success of HIV treatment programs by limiting the selection of effective first-line therapeutic options. In addition, it may further decrease the efficacy of pre-exposure prophylaxis (PrEP) and post-exposure prophylaxis (PEP) as well as facilitate the onward transmission of DRM in the viral population. This, therefore, highlights the need for drug resistance testing before drug initiation in HIV-1 infected patients.

The overall prevalence of mutations associated with NRTIs, NNRTIs, and PIs was

8.6%, 4.9%, and 1.2% respectively. This result is contrary to results from other towns of Cameroon and elsewhere which state that resistance is more frequent with NNRTI mutations (De Luca et al., 2017; Fokam et al., 2018; Tchouwa et al., 2018) but similar to studies carried out by Vergne et al., (2006) and Mbunkah et al., (2018) in

Cameroon. However, the high prevalence of NRTIs seen in this study could be associated with the shift from monotherapy NNRTI to HAART for all pregnant and breastfeeding women living with HIV-1 regardless of CD4+ T cells count or WHO clinical stage (Abdissa et al., 2014; MPH, 2015; Machnowska et al., 2017). In addition, it might be due to the fact that NRTI has been in use for quite a long time

(Vergne et al., 2006; MPH, 2015).

The most common NRTIs DRM recorded was K219Q and this confers resistance to

AZT and D4T (Chaplin et al., 2011; Wensing et al., 2017). Previous studies in 102

Cameroon and elsewhere have recorded M184V as the most prevalent mutation

(Burda et al., 2010; Negedu-Momoh et al., 2014; Zoufaly et al., 2014; Teto et al.,

2017; Wensing et al., 2017). In drug-experienced patients, K219Q mutation usually develops in patients receiving incompletely suppressive AZT, and D4T regimens

(Elmi Abar et al., 2012; Teto et al., 2017; Wensing et al., 2017) and this will lead to onward transmission. As such the high prevalence of this RAM is most probably because of the use of AZT and D4T since 2002 in our setting.

In addition, a prevalence of 6.2% (5/81) patients with 5 of the 6 known TAMs

(M41ML, D67N, K70T/R, T215TA/F, and K219Q) was recorded in this study. The high prevalence of TAMs among drug naïve patients may be explained by the extensive use of thymidine analogs (AZT and D4T) since 2002 (WHO, 2002). TAMs induce resistance by excision of the drug incorporated into viral DNA (Wensing et al., 2017). This recorded high prevalence of TAMs, is a public health concern as this might lead to cross-resistance between all NRTI analogs (Elmi Abar et al., 2012; Negedu-Momoh et al., 2014; Teto et al., 2017; Wensing et al., 2017). However, the level of resistance observed depends on the types and number of TAMs in the infected individual.

The 4.9% prevalence of NNRTIs was lower than the >10% prevalence in a survey carried out in Africa (De Luca et al., 2017). Four (K103N, V108I, V179E, Y181C) of the 5 NNRTI resistance-associated mutations confer resistance to EFV and NVP by reducing the binding affinity of these drugs to the viral target (Chaplin et al., 2011;

De Luca et al., 2017; Wensing et al., 2017). It is worth mentioning that these drugs are the only two drugs currently being used in Cameroon (MPH, 2015). The data from this study showed that E138A (2.5%; 2/81) was the most common NNRTI mutation. 103

Similar results have recently been reported in Cameroon (Tchouwa et al., 2018) and elsewhere (Kleyn et al., 2014; Parczewski et al., 2015; Theys et al., 2016). E138A is a polymorphic mutation which usually occurs in <5% of ARV-naive patients (Theys et al., 2016; Tchouwa et al., 2018). E138A mutation is weakly selected in patients receiving second-generation NNRTIs (ETR and RPV) which are drugs not being used in Cameroon and other countries in Sub Saharan Africa (Kleyn et al., 2014; MPH,

2015; Tchouwa et al., 2018). However, this high prevalence of E138A may limit the use of RPV or ETR-based ART in patients who develop resistance to first-generation

NNRTIs (Kleyn et al., 2014; Wensing et al., 2017). In other words, the increasing frequency of E138A mutation makes the use of RPV or ETR not appropriate as salvage therapy in Cameroon considering that 4 of the 5 RAMs cause resistance to

EFV and NVP.

In this study, a low prevalence of PI mutations recorded is similar with reports from other countries in Central and West Africa ( Ndembi et al., 2008; MPH, 2015,

National AIDS control committee, 2018). It, however, contradicts the high prevalence in developed countries, where PI regimens are readily available (Ndembi et al., 2008).

In comparison to previous studies carried out in other regions of Cameroon, this prevalence is lower than the 1.3-2.9% range (Vergne et al., 2006; Ndembi et al.,

2008; Agyingi et al., 2014; Mbunkah et al., 2018) and higher than the 0.2-1.04% recorded (Vessiere et al., 2006; Wittkop et al., 2011) The low prevalence of PI mutations seen in this study reflects the limited use of PIs in Cameroon as only 4.3% of infected persons are on second and third line treat (National AIDS control committee, 2018). Secondly, studies have shown that PI mutations do not exist as natural polymorphisms (that is. have a high genetic barrier to resistance) and this class 104 of ARVs is not easily transmitted as compared to NNRTIs and NRTIs (Ndembi et al.,

2008; Parczewski et al., 2015; Onywera et al., 2017).

The presence of dual-class resistance against NRTIs and NNRTIs (3.7%; 3/81), confer resistance to most of the ARVs recommended as first-line therapy in most countries including Cameroon (Elmi Abar et al., 2012; Agyingi et al., 2014; MPH,

2015; Wensing et al., 2017). This value is lower than 3.2% reported by Agyingi et al.,

(2014) and higher than the 9.5% prevalence reported by Burda et al., (2010) in studies carried out in other regions in Cameroon. This multi-class resistance will lead to increased risk of treatment failure to the first-line drugs that are currently being used in our setting (Wensing et al., 2017). Since their contribution to virological failure could be assessed, all patients with dual-class resistance were switched to second-line treatment.

Overall, 10 major mutations which could confer resistance to NRTIs, 5 major mutations to NNRTIs and one major mutation associated with PIs (Table 4.8) were identified. The mutation patterns observed in this study were similar to those obtained in other studies with most patients (6/9) presenting with singleton mutations (Ndembi et al., 2008; Agyingi et al., 2014; Andrade et al., 2017). The antiretroviral drug susceptibility with mutation net drug score showed five phenotypes, namely; high, intermediate, low, potential low-level resistance or susceptible.

Majority of the resistance associated mutations (RAM) were associated with potential low-level resistance followed by low-level resistance. In this study, most of the TDR mutations were associated with predicted resistance level to DDI followed by D4T.

This accounts for the reason why these drugs are no longer recommended for use in our setting (http://hivdb.stanford.edu; MPH, 2015). The likely explanation for the 105 high spread of D4T and DDI mutants is due to the suboptimal use of D4T and DDI based therapy at the beginning of ART scale up.

Three of the 9 patients with TDR were switched to second-line treatment, indicating that the current first-line protocol used in Cameroon is still effective. These patients were found to harbor multi-drug class (NRTI and NNRTI) mutations. In addition, the high prevalence of 77.8% (7/9) of hepatotoxicity seen in patients with RAM, therefore, indicates that the current treatment guideline for first-line treatment is still effective.

Although the prevalence of TDR is moderate (5-15%) in this study, the use of ARV in the prevention of mother to child transmission (PMTCT) and the prevention of new

HIV-1 infections depicts a public health problem. As such, the threat of drug resistance deserves careful attention from clinicians and public health officials advocating for ARV use to control HIV epidemic.

Since 2012, most countries including Cameroon have been implementing the WHO‟s

PMTCT antiretroviral guidelines which recommend the initiation of lifelong combination ART for all pregnant and breastfeeding women living with HIV-1 regardless of CD4+ T cells count or WHO clinical stage (MPH, 2015; Machnowska et al., 2017). This has improved maternal health by reducing the morbidity and mortality of HIV-1 positive women and has also reduced the rate of MTCT to about <2%

(Caceres et al., 2015a; Machnowska et al., 2017; Ruperez et al., 2018). However, the use of ARV for the PMTCT can also lead to increased risk of the emergence of HIV-1 drug resistance due to suboptimal adherence, poor retention to care, inadequate monitoring and loss of follow-up seen among these women after the lactation period

(Billong et al., 2016; Andrade et al., 2017; Machnowska et al., 2017). In line with 106 this, the mutations identified in this study could confer possible resistance to pediatric

HAART options (AZT, 3TC, ABC/ EFV, NVP /LPV/r). Therefore, policies need to be put in place to prevent the spread of the drug-resistant virus in order to minimize the rate of treatment failure and mortality.

The use of TDF plus FTC as PrEP/PEP has been demonstrated to be efficacious for the prevention of HIV acquisition (Caceres et al., 2015a; Andrade et al., 2017;

Dimitrov et al., 2018). However there is a high probability that PrEP/PEP does not eliminate HIV risk completely and this might lead to the development of DRM

(Parikh and Mellors, 2016; Dimitrov et al., 2018; Ruperez et al., 2018). Resistance associated with PrEP/PEP usually occurs when the person concerned acquires HIV during implementation since PrEP/PEP were not designed for treatment (Caceres et al., 2015b; Ruperez et al., 2018). Development of resistance to PrEP/PEP can potentially limit the use of first-line treatment. Transmission of HIV during implementation can also occur when PrEP/PEP is administered during the acute HIV syndrome phase (window period) or as a result of poor drug adherence (Caceres et al.,

2015b). As such it is of prime importance to build delivery systems that will reliably check the HIV status within a shorter window period, and a thorough assessment of acute seroconversion symptoms, for those eligible for PrEP/PEP. This can be attained by the use of rapid HIV antibody test followed by an HIV RNA test to identify HIV infection in the window phase. Taking into consideration that some of the mutations seen in this study can also affect the current PrEP/PEP protocol (MPH, 2015), the use of these drugs on a larger scale will decrease the effectiveness of these regimens for both prevention and treatment. As such DRM genotyping is necessary before drug initiation.

107

5.1.6 Study limitations

The present study is limited by a number of factors.

i. The short period of follow up only provides data on possible hepatotoxicity

within the six months of treatment. In addition, the protocol did not allow us

to establish the treatment type balance ratio at recruitment. Likewise,

information on the number of non-HAART regimens used by participants

could not be determined.

ii. No information on the possible means of HIV transmission was obtained

during the recruitment of participants.

iii. The HIV-RNA viral load could not be determined at baseline and D180 after

treatment.

iv. Lastly, patients with TDR were not followed up to assess the outcome of their

response to treatment to determine if the resistance mutations present will be

observed later in the course of treatment.

5.2 Conclusions

i. Mean ALT, AST, and ALP increased significantly with an increase in

treatment duration and with the highest level seen among patients who took

AZT+3TC+NVP.

ii. The findings indicate a prevalence of hepatotoxicity to be 37(37%) and 49

(49%) with 15% and 28% patients presenting with severe hepatotoxicity at

D30 and D180 respectively. This study revealed significant findings that age

group < 30years, low baseline BMI, low monthly income and use of

AZT+3TC+ NVP regimens are independent risk factors for developing severe

hepatotoxicity. 108

iii. Mean IL-6 and IL-17A play a significant role in the pathophysiology of

hepatotoxicity.

iv. This study confirmed previous findings that CRF02_AG subtype is still the

most predominant subtype and patients harboring CRF02_AG subtype

recorded the highest prevalence of hepatotoxicity.

v. The study revealed moderate levels (11.1%) of transmitted drug resistance

mutation. Of this, 77.9% (7/9) patients presented with hepatotoxicity.

5.3 Recommendations

i. Given the relatively high prevalence of HAART-related hepatotoxicity,

frequent monitoring of transaminases is important during HAART follow-up.

ii. The use of NVP based regimen should not be recommended for patients <30

years and with low baseline BMI 18 kg/m2.

iii. We suggest that IL-6 and IL-17 measurement should be incorporated as a

valuable tool during HAART initiation and follow up.

iv. Continuous assessment is needed to monitor the evolving HIV diverse strains

and its potential impact of drug resistance on ART programs.

v. There is a need for routine HIVDR surveillance in Cameroon.

5.3.1 Areas for further research

i. Further research on hepatotoxicity should be carried out using another set of

cytokines.

ii. Looking at the closeness of some species further investigations are needed to

elucidate the presence of these clusters by using full genome sequencing.

iii. The presence of dual class mutations accentuates the need to study the

evolution of mutation patterns in the context of newer antiretroviral regimens. 109

REFERENCES

Abdissa, A., Yilma, D., Fonager, J., Audelin, A. M., Christensen, L. H., Olsen, M. F., Tesfaye, M., Kaestel, P., Girma, T., Aseffa, A. and Andersen, A.B. (2014). Drug resistance in HIV patients with virological failure or slow virological response to antiretroviral therapy in Ethiopia. BMC Infectious Diseases, 14(1): 181

Abdul-Razaq, S. and Ahmed, B. (2013). Effect of cigarette smoking on liver function test and some other related parameters. Zanco Journal of Medical Sciences, 17(3): 556-562

Abongwa, L., Nyamache, A., Akono, N., Sunjo, S., Nange, V., Balan, H., Fokunang, C., Torimiro, J. and Okemo, P. (2017). Hepatotoxicity and anemia co-morbidity in treated HIV patients in Fundong subdivision in the Northwest region of Cameroon. Microbiology Research Journal International, 18(5): 1-10

Adams, L.A., Knuiman, M.W., Divitini, M.L. and Olynyk, J.K. (2008). Body mass index is a stronger predictor of alanine aminotransaminase levels than alcohol consumption. Journal of Gastroenterology and Hepatology, 23(7pt1): 1089–1093

Aghokeng, A.F., Kouanfack, C., Sabrina, E., Butel, C., Ginette, E., Laurent, C., Koulla-Shiro, S., Delaporte, E., Mpoudi-Ngole, E. and Peeters, M. (2013). Virological outcome and patterns of HIV-1 drug resistance in patients with 36 months of antiretroviral therapy experience in Cameroon. Journal of the International AIDS Society, 16(1): 18004

Agyingi, L., Mayr, L., M. Kinge, T., Orock, G., Enow, N.J., Ngai, J., Asaah, B., Mpoame, B., Hewlett, I. and Nyambi, P. (2014). The Evolution of HIV-1 group M genetic variability in Southern Cameroon is characterized by several emerging recombinant forms of CRF02_AG and viruses with drug resistance mutations. Journal of Medical Virology, 86(3): 385–393

AIDSinfo (2015). Guidelines for the use of antiretroviral agents in HIV-infected. https://aidsinfo.nih.gov/contentfiles/lvguidelines/adultandadolescentgl.pdf.Accessed on 9th November 2016. Accessed on 9th November 2016

Akase, I.E., Musa, B.O.P., Obiako, R.O., Elfulatiy, A.A. and Mohammed, A.A. (2017). Immune dysfunction in HIV: A possible role for pro-and anti-inflammatory cytokines in HIV staging. Journal of Immunological Research, 2017

Alsalhen, K. and Abdalsalam, R. (2014). Effect of cigarette smoking on liver functions, a comparative study conducted among smokers and non-smokers male in El-beida City, Libya. Zanco Journal of Medical Sciences, 3(7), 291-295

Andrade, S.D., Sabido, M., Monteiro, W.M., Benzaken, A.S. and Tanuri, A. (2017). Drug resistance in antiretroviral-naive children newly diagnosed with HIV-1 in Manaus, Amazonas. The Journal of Antimicrobial Chemotherapy, 72(6): 1774-1783 Arts, E.J. and Hazuda, D.J. (2012). HIV-1 antiretroviral drug therapy. Cold Spring Harbor Perspective in Medicine, 2(4): a007161 110

Ayelagbe, O.G., Akerele, O.P., Onuegbu, A.J. and Oparinde, D.P. (2014). Drug hepatotoxicity in HIV patients on highly active antiretroviral therapy [HAART] in Southwest Nigeria, Journal of Dental and Medical Sciences, 13(5): 67-70

Barennes, H., Guillet, S., Limsreng, S., Him, S., Nouhin, J., Hak, C., Srun, C., Viretto, G., Ouk, V., Delfraissy, J.F. and Segeral, O. (2014). Virological failure and HIV-1 drug resistance mutations among naive and antiretroviral pre-treated patients entering the ESTHER program of Calmette Hospital in Cambodia. PLoS One, 9(8): e105736

Barve, S., Kapoor, R., Moghe, A., Julio, A.R., Eaton, J.W., Gobejishvili, L., Swati, J.B. and McClain, C.J. (2010). Focus on the liver, alcohol use, highly active antiretroviral therapyand liver disease in HIV-infected patients. Alcohol Research and Health, 33(3): 229-236

Bello, S., Onunu, A., and Erah, P. (2014). Long-term effect of HAART on biochemical profiles of HIV/AIDS patients in a tertiary health facility in Benin City, Nigeria. Tropical Journal of Pharmaceutical Research, 13(11): 1941-1946

Berns, J.S. and Kasbekar, N. (2006). Highly active antiretroviral therapy and the kidney. An update on antiretroviral medications for nephrologists diagnostic and therapeutic corner. Clinical Journal of the American Society Nephrology, 1(1): 117– 129

Billong, S.C., Fokam, J., Aghokeng, A.F., Milenge, P., Kembou, E., Ibile, A., Meva‟a-Onglene, F.B., Zoung-Kanyi, A.C., Colizzi, V., Mpoudi, E.N., Elat, J.N. and Shiro, K.S. (2013). Population-based monitoring of emerging HIV-1 drug resistance on antiretroviral therapy and associated factors in a sentinel site in Cameroon: Low levels of resistance but poor programmatic performance. Plos One, 8(8): e72680

Billong, S.C., Fokam, J., Penda, C.I., Amadou, S., Kob, D.S., Billong, E.J., Colizzi, V., Ndjolo A., Bisseck, A.Z. and Elat, J.N. (2016). Predictors of poor retention on antiretroviral therapy as a major HIV drug resistance early warning indicator in Cameroon: Results from a nationwide systematic random sampling. BMC Infectious Diseases, 16(1): 678

Burda, S.T., Viswanath, R., Zhao, J., Kinge, T., Anyangwe, C., Tinyami, E.T., Haldar, B., Powell, R.L., Jarido, V., Hewlett, I. K. and Nyambi, P.N. (2010). HIV-1 reverse transcriptase drug-resistance mutations in chronically infected individuals receiving or naive to HAART in Cameroon. Journal of Medical Virology, 82(2): 187-196

Caceres, C.F., Koechlin, F., Goicochea, P., Sow, P.S., O'Reilly, K.R., Mayer, K.H. and Godfrey-Faussett, P. (2015b). The promises and challenges of pre-exposure prophylaxis as part of the emerging paradigm of combination HIV prevention. Journal of the International AIDS Society, 18: 19949

Caceres, C.F., Mayer, K.H., Baggaley, R. and O'Reilly, K.R. (2015a). PrEP implementation science: State-of-the-ART and research agenda. Journal of the International AIDS Society, 18(4Supplement 3) 111

CAMPHIA (2018). Cameroon population-based HIV impact assessment available at https://phia.icap.columbia.edu/wp-content/uploads/2018/07/3471camphia_cameroon- ss_a4_v13_requests_7.25.18.pdf. Accessed on 12th may 2019

Ceccarelli, L., Salpini, R., Moudourou, S., Cento, V., Santoro, M.M., Fokam, J., Takou, D., Nanfack, A., Dori, L., Torimiro, J.N. and Cappelli, G. (2012). Characterization of drug resistance mutations in naive and ART-treated patients infected with HIV-1 in Yaounde, Cameroon. Journal of Medical Virology, 84(5): 721-727

Chan, D.C. and Kim, P.S. (1998). HIV entry and its inhibition. Cell, 93(5): 681-684

Chaplin, B., Eisen, G., Idoko, J., Onwujekwe, D., Idigbe, E.I., Adewole, I., Gashau, W., Meloni, S., Sarr, A.D., Sankale, J.L., Ekong, E., Murphy, R.L. and Kanki, P. (2011). Impact of HIV Type 1 subtype on drug resistance mutations in Nigerian patients failing first-line therapy. AIDS Research and Human Retroviruses, 27(1): 71- 80

Chu, K., Boulle, A., Ford, N., Goemaere, E., Asselman, V. and Van Cutsem, G. (2010). Nevirapine-associated early hepatotoxicity: Incidence, risk factorsand associated mortality in a primary care art programme in South Africa. PLoS One, 5(2): e9183

Cosgrove, B.D., King, B.M., Hasan, M.A., Alexopoulos, L.G., Farazi, P.A., Hendriks, B.S., Griffith L.G., Sorger, P.K., Tidor, B., Xu, J.J. and Lauffenburger, D.A. (2009). Synergistic drug-cytokine induction of hepatocellular death as an in vitro approach for the study of inflammation-associated idiosyncratic drug hepatotoxicity. Toxicology Applications in Pharmacology, 237(3): 317-330

Courtney, C.R., Agyingi, L., Fokou, A., Christie, S., Asaah, B., Meli, J., Hewlett, I. and Nyambi, P.N. (2016). Monitoring HIV-1 group M subtypes in Yaounde, Cameroon reveals broad genetic diversity and a novel CRF02_AG/F2 infection. AIDS Research on Human Retroviruses, 32(4): 381-385

Crane, M., Iser, D. and Lewin, S.R. (2012). Human immunodeficiency virus infection and the liver. World Journal of Hepatology, 4(3): 91-98

Dass, B.P., Jaganmohan, P. and Sravanakumar, P. (2013). Changes in hematological and biochemical parameters in smokeless tobacco (ST) chewers in Coastal Belt of Andhra Pradesh, India. European Journal of Biological Sciences, 5(1): 29-33

De Luca, A., Sidumo, Z.J., Zanelli, G., Magid, N.A., Luhanga, R., Brambilla, D., Liotta, G., Mancinelli, S., Marazzi, M.C., Palombi, L. and Ceffa, S. (2017). Accumulation of HIV-1 drug resistance in patients on a standard thymidine analog- based first-line antiretroviral therapy after virological failure: Implications for the activity of next-line regimens from a longitudinal study in Mozambique. BMC Infectious Diseases, 7(1): 605

De Medeiros, R.M., Valverde-Villegas, J.M., Junqueira, D.M., Graf, T., Lindenau, J.D., de Mello, M.G., Vianna, P., Almeida, S.E.M. and Chies, J.R.B. (2016). Rapid 112 and slow progressors show increased IL-6 and IL-10 levels in the pre-AIDS stage of HIV infection. PLoS One, 11(15): e0156163

De Oliveira, F., Mourez, T., Vessiere, A., Ngoupo, P.A., Alessandri-Gradt, E., Simon, F., Rousset D. and Plantier, J.C. (2017). Multiple HIV-1/M + HIV-1/O dual infections and new HIV-1/MO inter-group recombinant forms detected in Cameroon. Retrovirology 14(1): 1

Debes, J.D., Bohjanen, P.R. and Boonstra, A. (2016). Mechanisms of accelerated liver fibrosis progression during HIV infection. Journal of clinical and translational hepatolog, 4(4): 32.

Deng, Y.Q., Zhao, H., Ma, A.L., Zhou, J.Y., Xie, S.B., Zhang, X.Q., Zhang, D.Z., Xie, Q., Zhang, G., Shang, J., Cheng, J., Zhao, W.F., Zou, Z.Q., Zhang, M.X., Wang G.M.D. and China Hep B. Related fibrosis assessment research group (2015). Selected cytokines serve as potential biomarkers for predicting liver inflammation and fibrosis in chronic Hepatitis B patients with normal to mildly elevated aminotransferases. Medicine, 94, e2003

Denue, B.A., Yusuf, I., Bello, H.S. and Mshelia, H.H. (2013). Correlation between HIV viral load and alanine aminotransferase (ALT) as markers of liver damage in HIV infected naive patients in North-Eastern Nigeria. Journal of AIDS and HIV Research, 5(8): 306-310

Dimitrov, D.T., Boily, M.C., Hallett, T.B., Albert, J., Boucher, C., Mellors, J.W., Pillay, D. and van de Vijver, D.A. (2016). How much do we know about drug resistance due to PrEP use? analysis of experts' opinion and its influence on the projected public health impact. PloS One, 11(7): e0158620

Elameen, M.K. and Abdrabo, A.A. (2013). Comparative study of liver enzymes activities in smokers and diabetic Sudanese patients. Asian Journal of Biomedical and Pharmaceutical Sciences, 3(27): 39-41

Elmi Abar, A., Jlizi, A., Darar, H.Y., Kacem, M. A. and Slim, A. (2012). HIV-1 drug resistance genotyping from antiretroviral therapy (ART) naive and first-line treatment failures in Djiboutian patients. Diagnostic Pathology, 7(1): 138

El-Zayadi, A. (2006). Heavy smoking and liver. World Journal of Hepatology, 12(38), 6098

Engelman, A. and Cherepanov, P. (2012). The structural biology of HIV-1, mechanistic and therapeutic insights. Natural Review Microbiology, 10(4): 279

Ferreira, A.C., Coelho, L.E., Grinsztejn, E., Jesus, C.A., Guimarães, M.M., Veloso, V.G., Grinsztejn, B. and Cardoso, S.W. (2017). Transmitted drug resistance in patients with acute/recent HIV infection in Brazil. The Brazilian journal of infectious diseases, 21(4): 396-401

Falivene, J., Ghiglione, Y., Laufer, N., Socías, M. E., Holgado, M. P., Ruiz, M. J, Maeto, C., Figueroa, M.I., Giavedoni, L.D., Cahn, P. and Salomón, H. (2015). Th17 113 and Th17/Treg ratio at early HIV infection associate with protective HIV-specific CD8+ T-cell responses and disease progression. Scientific reports, 5: 11511

Fokam, J., Bellocchi, M.C., Armenia, D., Nanfack, A.J., Carioti, L., Continenza, F., Takou, D., Temgoua, E.S., Tangimpundu, C., Torimiro, J.N., Koki, P.N., Fokunang, C.N, Cappelli, G., Ndjolo, A, Colizzi, V., Ceccherini-Silberstein, F., Perno, C. and Santoro, M.M. (2018). Next-generation sequencing provides an added value in determining drug resistance and viral tropism in Cameroonian HIV-1 vertically infected children. Medicine, 97(13): e0176

Fokam, J., Elat, J.B., Billong, S.C., Kembou, E., Nkwescheu, A.S., Obam, N. M., Essiane, A. and Bissek, A.C. (2015). Monitoring HIV drug resistance early warning indicators in Cameroon: A study following the revised World Health Organization recommendations. PLoS One, 10(6): e0129210

Fokunang, C.N., Banin, A.N., Kouanfack, C. and Ngogang, J.Y. (2010). Evaluation of hepatotoxicity and nephrotoxicity in HIV patients on highly active antiretroviral therapy. Journal of AIDS and HIV Research, 2(3): 048-057

Galun, E. and Axelrod, J.H. (2002). The role of cytokines in liver failure and regeneration: Potential new molecular therapies. Biochimica et Biophysica Acta, 1592(3): 345-358

Gil, A.C.M., Lorenzetti, R., Morcillo, G.B., Dalbo, A.A. and Vilela, M.T.N. (2007). Hepatotoxicity in HIV-infected children and adolescents on antiretroviral therapy. Sao Paulo Medical Journal, 125(4): 205-209

Gisolf, E. H. Dreezen, C. Danner, S. A., Weel, J. L. F. and Weverling, G. J.(2000). Risk Factors for Hepatotoxicity in HIV-1–Infected Patients Receiving Ritonavir and Saquinavir with or without Stavudine. HIV/AIDS Major Article. 31: 1234-1239

Grattagliano, I., Bonfrate, L., Diogo, C.V., Wang, H.H., Wang, D.Q.H. and Portincasa, P. (2009). Biochemical mechanisms in drug-induced liver injury, certaintiesand doubts. World Journal Gastroenterology, 15(39): 4865-4876

Guicciardi, M.E. and Gores, G.J. (2005). Apoptosis, a mechanism of acute and chronic liver injury. Gut, 54(7): 1024–1033

Gupta, R.K., Jordan, M.R., Sultan, B.J., Hill, A., Davis, D.H.J., Gregson, J., Sawyer, A.W., Hamers, R.L., Ndembi, N., Pillay, D. and Bertagnolio, S. (2012). Global trends in antiretroviral resistance in treatment-naive individuals with HIV after the rollout of antiretroviral treatment in resource-limited settings: A global collaborative study and meta-regression analysis. Lancet London England, 380(9849): 1250–1258

Hamers, R.L., Sigaloff, K.C., Kityo, C., Mugyenyi, P. and de Wit, T.F. (2013). Emerging HIV-1 drug resistance after the roll-out of antiretroviral therapy in sub- Saharan Africa. Current Opinion in HIV AIDS, 8(1): 19-26

Hammerich, L., Heymann, F. and Tacke, F. (2010). Role of IL-17 and Th17 cells in liver diseases. Clinical and Developmental Immunology, 2011 114

Hamza, M., Maifada, Y., Mijinyawa, M., Muhammad, B., Musa, B., Nalado, A., Mijinyawa, M., Muhammad, B. and Garba, H. (2014). Prevalence and risk factors for hepatotoxicity among patients with HIV/AIDS on highly active antiretroviral therapy in North-Western Nigeria. Sub-Saharan African Journal for Medicine, 1(4): 175 Hedrich, W. D., Hassan, H. E. and Wang, H. (2016). Insights into CYP2B6-mediated drug-drug interactions. Acta Pharmaceutica Sinica, B, 6(5): 413-425 Hemelaar, J., Gouws, E., Ghys, P.D. and Osmanov, S. (2006). Global and regional distribution of HIV-1 genetic subtypes and recombinants in 2004. AIDS, 20(16): W13–W23

Hileman, C.O., Kinley B., Scharen-Guivel, V., Melbourne, K., Szwarcberg, J., Robinson, J., Lederman, M.M. and Mccomsey, G.A. (2015). Differential reduction in monocyte activation and vascular inflammation with integrase inhibitor-based initial antiretroviral therapy among HIV-infected. Individuals Journal of Infectious Disease, 212(3): 345–354 http://www.algimed.by/download/EN-QIAamp-RNA-Blood-Mini-Handbook.pdf 9th January 2016 http://www.anrs.fr/content/download/2242/12805/file/ANRS-GradeEI-V1-En- 2008.pdf Accessed on 11th January 2017 https://www.cameroononline.org/cameroon-hiv-aids-prevalence-at-3-4-percent- survey. Accessed on 28th August 2018 http://www.cdc.gov/hiv/risk/idu.html. Accessed on 9th May 2016 https://www hivdb.stanford.edu/hivdb/by-sequences. Accessed on 6th February 2018 https://www.hiv.lanl.gov/content/sequence/HIV/MAP/landmark.html. Accessed on 9th May 2016 http://www.hiv.lanl.gov/content/sequence/RIP/RIP.html. Accessed on 19th June 2017 https://www.niaid.nih.gov/diseases-conditions/hiv-replication-cycle. Accessed on 18th February 2019 https:// www.nhs.uk. Accessed on 11th January 2016 https:// www.nlm.nih.gov. Accessed on 11th January 2016 http://www.sam-techdiagnostics.com/pdfs/HCV/HIV.pdf. Accessed on 24th August 2015 https,//www.spinreact.com/files/Inserts/. Accessed on 11th January 2016 http://www.unaids.org/en/resources/fact-sheet. Accessed on 18th February 2019 https://www.verywellhealth.com/liver-enzymes-1759916. Accessed on 28th May 2018 https://www.webmd.com/hiv-aids/aids-hiv-medication. Accessed 6th March 2018 115 http://www.who.int/mediacentre/factsheets/fs360/en/. Accessed on 13th January 2017 https://www.who.int/mediacentre/news/releases/2015/hiv-treat-all- recommendation/en/ Accessed on 26th March 2016

Hyder, M. A., Hasan, M. and Mohieldein, A. H. (2013). Comparative levels of ALT, AST, ALP and GGT in liver associated diseases. European journal of experimental biology, 3(2): 280-284

Ikomey, G.M., Assoumou, M., Gichana, J.O., Njenda, D., Mikasi, S.G., Mesembe, M., Lyonga, E. and Jacobs, G.B. (2017). Observed HIV drug resistance-associated mutations amongst naïve immunocompetent children in Yaoundé, Cameroon. Germs, 7(4): 178-185

Institute National de la Statistique (2011). The 2011 Cameroon demographic and health survey and multiple indicators cluster survey. http://www.statistics- cameroon.org/downloads/EDS-MICS11/DHSMICS_2011_preliminary_report.pdf. Accessed on 11thOctober 2015

Iyidogan, P. and Anderson, K.S. (2014). Current perspectives on HIV-1 antiretroviral drug resistance. Viruses, 6(10): 4095-4139

Jaeschke, H., Gregory, J. Arthur, I. Cederbaum, Jack, A.H., Dominique, P. and Lemasters, J. J. (2002). Mechanisms of hepatotoxicity. Toxicological Sciences, 65(2): 166–176

Jang, E., Jeong, S., Hwang, S., Kim, H., Ahn, S., Lee, J., Lee, S.H., Park, Y.S., Hwang, J.H., Kim, J.W., Kim, N. and Lee, D.H. (2012). Effects of coffee, smokingand alcohol on liver function tests: A comprehensive cross-sectional study. BMC Gastroenterology, 12(145)

Kan, W., Teng, T., Liang, S., Ma, Y., Tang, H., Zuohela, T., Sun, G., He, C., Wall, K.M., Marconi, V.C., Liao, L., Leng, X., Liu, P., Ruan, Y., Xing, H. and Shao, Y. (2017). Predictors of HIV virological failure and drug resistance in Chinese patients after 48 months of antiretroviral treatment, 2008-2012: A prospective cohort study. British Medical Journal, 7(9): e016012

Kang, W., Li Y., Zhuang, Y., Zhao, K., Zhao, K., Huang, D. and Sun, Y. (2012). Dynamic analysis of Th1/Th2 cytokine concentration during antiretroviral therapy. BMC Infectious Disease, 12(1): 102

Kannangai, R., David, S. and Sridharan, G. (2012). Human immunodeficiency virus type-2A milder, kinder virus, an update. Indian Journal Medical Microbiology, 30(1): 6-15

Kantor, R., Katzenstein, D.A., Efron, B., Carvalho, A.P., Wynhoven, B., Cane, P., Clarke, J., Sunee, S.I., Marcelo, A.S., Snoeck, J., Pillay, C., Rudich, H., Rosangela, 116

R., Holguin, A., Bouzas, M.B., Pedro, C., Sugiura, W., Soriano, V., Luis, F.B., Zehava, G., Lynn, M., Vandamme, M., Tanuri, A., Phanuphak, P., Weber, J.N., Pillay, D., Harrigan, P.H., Camacho, H., Schapiro, J. and Shafer, R.W. (2005). Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: Results of a global collaboration. PLoS Medicine, 2 (4): e112, 325 -337

Kawaratani, H., Tsujimoto, T., Douhara, A., Takaya, H., Moriya, K., Namisaki, T., Noguchi, R., Yoshiji, H., Fujimoto, M. and Fukui, H. (2013). The effect of inflammatory cytokines in alcoholic liver disease. Mediators Inflammation, 2013

Keating, S. M., Golub, E. T., Nowicki, M., Young, M., Anastos, K., Crystal, H., Cohen, M.H., Zhang, J., Greenblatt, R.M., Desai, S. and Wu, S. (2011). The effect of HIV infection and HAART on inflammatory biomarkers in a population-based cohort of US women. AIDS (London, England), 25(15):1823

Kedzierska, K. and Crowe, S.M. (2004). Cytokines and HIV-1, interactions and clinical implications. Antiviral Chemistry and Chemotherapy, 12(3): 133–150

Kleyn, T.J., Liedtke, M.D., Harrison, D.L., Lockhart, S.M., Salvaggio, M.R., Ripley, T.L. and Rathbun, R.C. (2014). Incidence of transmitted antiretroviral drug resistance in treatment-naive HIV-1-infected persons in a large South Central United States clinic. Annals of Pharmacotherapy, 48(4): 470-475

Knight, B., Matthews, V., Klinken, E., Yeoh, G., Akhurst, B., Croager, E.J., Abraham, L. and Olynyk, J. (2005). Liver inflammation and cytokine production, but not acute phase protein synthesis, accompany the adult liver progenitor (oval) cell response to chronic liver injury. Immunology and Cell Biology, 83(4): 364-374

Kobayashi, E., Kobayashi, M., Tsuneyama, K., Fukami, T., Nakajima, M. and Yokoi, T. (2009). “Halothane-induced liver injury is mediated by interleukin-17 in mice”. Toxicological Sciences, 111 (2): 302–310

Konou, A. A., Dagnra, A. Y., Vidal, N., Salou, M., Adam, Z., Singo-Tokofai, A., Delaporte, E., Prince-David M. and Peeters, M. (2015). Alarming rates of virological failure and drug resistance in patients on long-term antiretroviral treatment in routine HIV clinics in Togo. AIDS, 29(18): 2527-2530

Kontorinis, N. and Dieterich, D. (2003). Hepatotoxicity of antiretroviral therapy. AIDS Review. 5(1): 36-43

Kress, K. D. (2005). Antiretroviral-associated hepatotoxicity. Current Infectious Disease Reports, 7(2): 103-107

Kuhn, L., Hunt, G., Technau, K.G., Coovadia, A., Ledwaba, J., Pickerill, S., Penazzato, M., Bertagnolio, S., Mellins, C.A., Black, V., Morris, L. and Abrams, E.J. (2014). Drug resistance among newly diagnosed HIV-infected children in the era of more efficacious antiretroviral prophylaxis. AIDS (London, England), 28(11): 1673

Kumar, S., Mahat, R. and Batra, J. (2015). Evaluation of lipid parameters, liver function test, CRP and MDA (as a marker of lipid peroxidation) in chronic cigarette smokers. International Journal of Bar, 6(2): 115 117

Laurent, C., Meilo, H., Guiard-Schmid, J.B., Mapoure, Y., Noel, J.M., M'Bangue, M., Joko, A., Rozenbaum, W., Ntone, F.N. and Delaporte, E. (2005). Antiretroviral therapy in public and private routine health care clinics in Cameroon: Lessons from the Douala antiretroviral (DARVIR) initiative. Clinical Infectious Disease, 41(1): 108–111

Li, G., Piampongsant, S., Faria, N.R., Voet, A., Pineda-Peña, A.C., Khouri, R., Lemey, P., Vandamme, A.M. and Theys, K. (2015). An integrated map of HIV genome-wide variation from a population perspective. Retrovirology, 12(1): 18

Li, L., Sun, G., Liang, S., Li, J., Li, T., Wang, Z., Liu, W., Yang, S., Liu, Y., Wang, X. and Li, J. (2013). Different distribution of HIV-1 subtype and drug resistance were found among treatment naïve individuals in Henan, Guangxiand Yunnan province of China. PLoS One, 8(10): e75777

Lian, J.Q., Yang, X.F., Zhao, R.R., Zhao, Y.Y. and Li, Y. (2014). Expression profiles of circulating cytokines, chemokines and immune cells in patients with hepatitis B virus infection. Hepatitis Monthly, 14: e18892 Lihana, R.W., Semwanga, D., Abimiku, A. and Ndembi, N. (2012). Update on HIV-1 diversity in Africa: A decade in review. AIDS Reviews, 14(2): 83-100

Liu, Q. (2009). Role of cytokines in the pathophysiology of acute-on-chronic liver failure. Blood Purification. 28(4): 331-341

Liver Diseases: MedlinePlus". www.nlm.nih.gov. Accessed 20th -November-2015

Lobritz, M. A., Ratcliff, A.N. and Arts, E.J. (2010). HIV-1 entry, inhibitorsand resistance. Viruses, 2(5): 1069-1105

Lucien, K.F., Clement, A.N., Fon, N., Weledji, P. and Ndikvu, C. (2010). The effects of antiretroviral treatment on liver function enzymes among HIV infected out patients attending the central hospital of Yaoundé. Cameroon. Africa Journal of Clinical Experimental Microbiology, 11(3): 174-178

Luma, H. L., Doualla, M.S., Choukem, S-P., Temfack, E., Ashuntantang, G., Joko, H.A, Koulla-Shiro, S. (2012). Adverse drug reactions of Highly Active Antiretroviral Therapy (HAART) in HIV infected patients at the general hospital, Douala, Cameroon: A cross-sectional study. Pan African Medical Journal, 12(1)

Lyadova, I. V. and Panteleev, A. V. (2015). Th1 and Th17 cells in tuberculosis: protection, pathologyand biomarkers. Mediators of inflammation, 2015.

Machnowska, P., Hauser, A., Meixenberger, K., Altmann, B., Bannert, N., Rempis, E., Schnack, A., Decker, S., Braun, V., Busingye, P., Rubaihayo, J., Harms, G., Theuring, S. (2017). Decreased emergence of HIV-1 drug resistance mutations in a cohort of Ugandan women initiating option B+ for PMTCT. PloS One, 12(97): e0178297

Maiuri, A.R., Breier, A.B., Gora, L.F., Parkins, R.V., Ganey, P.E. and Roth, R.A. (2015). Cytotoxic synergy between cytokines and NSAIDs associated with 118 idiosyncratic hepatotoxicity is driven by mitogen-activated protein kinases. Toxicological Sciences, 146(2): 265-280

Mata-Marín, J.A., Gaytán-Martínez, J., Grados-Chavarría, B.H., Fuentes-Allen, J.L., Arroyo- Anduiza, C.I. and Alfaro-Mejía, A. (2009). Correlation between HIV viral load and aminotransferases as liver damage markers in HIV infected naive patients, a concordance cross-sectional study. Virology Journal, 6(1): 181

Mattar, S.G., Velcu, L., Rabinovitz, M., Demetris, A., Krasinskas, A., Barinas- Mitchell, E., George, M.E., Ramanathan, R., Taylor, D.S. and Schauer, P.R. (2005). Surgically-induced weight loss significantly improves nonalcoholic fatty liver disease and metabolic syndrome. Annals of Surgery, 242(4): 610

Mbunkah, H.A., Marzel, A., Schmutz, S., Kok, Y.L., Zagordi, O., Shilaih, M., Nsanwe, N.N., Mbu, E.T., Besong, L.M., Sama, B.A., Orock, E., Kouyos, R.D., Gunthard, H.F., Metzner, K.J., 2018. Low prevalence of transmitted HIV-1 drug resistance detected by a dried blood spot (DBS)-based next-generation sequencing (NGS) method in newly diagnosed individuals in Cameroon in the years 2015-16. The Journal of antimicrobial chemotherapy, 73(7): 1917–1929

McBurney, R.N., Hines, W.M., VonTungeln, L.S., Schnackenberg, L.K., Beger, R.D., Moland, C.L., Han, T., Fuscoe, J.C., Chang, C.W., Chen, J.J., Su, Z., Fan, X.H., Tong, W., Booth, S.A., Balasubramanian, R., Courchesne, P.L., Campbell, J.M., Graber, A., Guo, Y., Juhasz, P., Li T.Y., Lynch, M.D., Morel, N.M., Plasterer, T.N., Takach, E.J., Zeng, C. and Beland, F.A. (2012). The liver toxicity biomarker study phase I: Markers for the effects of tolcapone or entacapone. Toxicologic Pathology, 40(6): 951-964

McCance-Katz, E.F., Gruber, V.A., Beatty, G., Lum, P.J. and Rainey, P.M. (2013). Interactions between alcohol and the antiretroviral medications Ritonavir or Efavirenz. Journal of Addiction. Medicine, 7(4): 264–270

McGovern, S., Caselli, E., Grigorieff, N. and Shoichet, B. (2002). A common mechanism underlying promiscuous inhibitors from virtual and high-throughput screening. Journal of Medical Chemistry, 45 (8): 1712–1722

Meira, D.A., Almeida, R.A., Barbosa, A.N., de Souza, L.R., Olivo, T., Henriques, R.M.S., Golim, M.A., Araújo, Jr J.P., Nagoshi, L.R., Orikaza, C.M. and Calvi, S.A. (2008). Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active antiretroviral therapy (HAART). Journal of Venom Animal Toxins Including Tropical Disease, 14(4): 685-702

Minister of Public Health (2015). National Guidelines for the Management of HIV/AIDS in Cameroon. https://aidsfree.usaid.gov/sites/default/files/cameroon_art_2015.pdf. Accessed on 23rd January 2016 Miller, M.D. and Hazuda, D.J. (2004). HIV resistance to the fusion inhibitor enfuvirtide: mechanisms and clinical implications. Drug Resistance Update 2004; 7: 89-95 119

Mugusi, S., Ngaimisi, E., Janabi, M., Minzi, O., Bakari, M., Riedel, K., Burhenne, J., Lindquist, L. and Mugusi, F. (2012). Liver enzyme abnormalities and associated risk factors in HIV patients on efavirenz-based HAART with or without tuberculosis co- infection in Tanzania. PLoS One, 7(7): e40180

Naeger, L.K., Margot, N.A. and Miller, M.D. (2002). ATP-dependent removal of nucleoside reverse transcriptase inhibitors by human immunodeficiency virus type 1 reverse transcriptase. Antimicrobial Agents Chemotherapy, 46(7): 2179–2184

Nagu, T.J., Kanyangarara, M., Hawkins, C., Hertmark, E., Chalamila, G., Spiegelman, D., Mugusi, F. and Fawzi, W. (2012). Elevated alanine aminotransferase in antiretroviral-naïve HIV-infected African patients: Magnitude and risk factors. HIV Medications, 13(9): 541-548

National AIDS Control Committee (2010). The impact of HIV and AIDS in Cameroon through 2020. https://hivhealthclearinghouse.unesco.org/library/documents/impact- hiv-and-aids Cameroon -through-2020. Accessed on 24th August 2016

National AIDS control committee (2018). Number of HIV-infected individuals on antiretroviral therapy. Yaounde, October 2018. Accessed on 14th January 2019 Navarro, V.J., Barnhart, H., Bonkovsky, H.L., Davern, T., Fontana, R.J., Grant, L., Reddy, K.R., Seeff, L.B., Serrano, J., Sherker, A.H., Stolz, A., Talwalkar, J., Vega, M. and Vuppalanchi, R. (2014). Liver injury from herbals and dietary supplement meets in the U.S. drug-induced liver injury network. Hepatology, 60(4): 1399-1408

Ndembi, N., Abraha, A., Pilch, H., Ichimura, H., Mbanya, D., Kaptue, L., Salata, R. and Arts, E.J. (2008). Molecular characterization of human immunodeficiency virus type 1 (HIV-1) and HIV-2 in Yaounde, Cameroon: Evidence of major drug resistance mutations in newly diagnosed patients infected with subtypes other than subtype B. Journal of Clinical Microbiology, 46(1): 177-184

Ndhlovu, L.C., Chapman, J.M., Jha, A.R., Snyder-Cappione, J.E., Pagan, M., Leal, F.E., Boland, B.S., Norris, P.J., Rosenberg, M.G. and Nixon, D.F. (2008). Suppression of HIV-1 plasma viral load below detection preserves IL-17 producing T cells in HIV-1 infection. AIDS (London, England), 22(8): 990

Negedu-Momoh, O.R., Olonitola, O.S., Odama, L.E., Inabo, H.I., Mbah, H.A., Kasembeli, A.N., Inzaule, S.C., Oladele, E.A., Titilope, B. and Agwale, S.M. (2014). Antiretroviral-drug resistant mutations and genetic diversity in HIV-1 infected individuals in Nigeria. World Journal of AIDS, 4(2): 187-197

Neuman, M.G. (2003). Cytokines-central factors in alcoholic liver disease. Alcohol Research on Health, 27(4): 307-317

Neuman, M.G., Maor, Y., Nanau, R.M., Melzer, E., Mell, H., Opris, M., Cohen, C. and Malnick S. (2015). Alcoholic liver disease: Role of Cytokines. Biomolecules, 5: 2023-2034

Ngala, R.A., Opoku, D. and Asare, G. (2015). Effects of HIV infection and HAART on the liver of HIV patients. Trends in medical research, 10(1): 1-11 120

Niemela O. and Alatalo, P. (2010). Biomarkers of alcohol consumption and related liver disease. Scandivanian Journal of Clinical Laboratory Invest, 70(5): 305-312

Njoku, D.B. (2014). Drug-induced hepatotoxicity, metabolic, genetic and immunological basis. International Journal of Molecular Sciences, 15(4): 6990-7003

Nunez, M. (2006). Hepatotoxicity of antiretrovirals, incidence mechanismsand management. Journal of Hepatology, 44: S132-S139

Nyamache, A.K (2012). HIV-1 drug resistance among untreated patients in Kenya, Current status. Journal of Applied Biosciences, 43: 2958–2966

Nyamweya, S., Hegedus, A., Jaye, A., Rowland-Jones, S., Flanagan, K.L. and Macallan, D.C. (2013). Comparing HIV-1 and HIV-2 infection, Lessons for viral immunopathogenesis. Review of Medical Virology, 23(4): 221-40 Nyblom, H., Berggren, U., Balldin, J. and Olsson, R. (2004). High AST/ALT ratio may indicate advanced alcoholic liver disease than heavy drinking. Alcohol and Alcoholism, 39(4): 336-339

Ofotokun, I., Lennox, J., Smithson, S., Lu, C. and Easley, K. (2007). Liver enzymes elevation and immune reconstitution among treatment-naïve HIV-infected patients instituting antiretroviral therapy. American Journal of Medical Sciences, 334(5), 334- 341

Oguntibeju, O. (2012). Quality of life of people living with HIV and AIDS and antiretroviral therapy. HIV/AIDS (Auckland, NZ), 4:117

Onywera, H., Maman, D., Inzaule, S., Auma, E., Were, K., Fredrick, H., Owiti, P., Opollo, V., Etard, J.F., Mukui, I., Kim, A.A. and Zeh, C. (2017). Surveillance of HIV-1 pol transmitted drug resistance in acutely and recently infected antiretroviral drug-naive persons in rural western Kenya. PLoS One, 12(2): e0171124

Osakunor, D., Obirikorang, C., Fianu, V., Asare, I. and Dakorah, M. (2015). Hepatic enzyme alterations in HIV patients on antiretroviral therapy: A case-control study in a hospital setting in Ghana. PLOS One, 10(8): e0134449

Pandit, A., Sachdeva, T. and Bafna, P. (2012). Drug-induced hepatotoxicity: A review. Journal of Applied Pharmaceutical Science, 2(5): 233-243

Parczewski, M., Leszczyszyn-Pynka, M., Witak-Jedram, M., Maciejewska, K., Rymer, W., Szymczak, A., Szetela, B., Gasiorowski, J., Bociaga, J, M., Skwara, P., Garlicki, A., Grzeszczuk, A., Rogalska, M., Jankowska, M., Lemanska, M., Hlebowicz, M., Barałkiewicz, G., Mozer-Lisewska, I., Mazurek, R., Łojewski, W, Grabczewska, E., Olczak, A., Jabłonowska, E., Clark, J. and Urbanska, A. (2015). Transmitted HIV drug resistance in antiretroviral treatment naïve patients from Poland differs by transmission category and subtypes. Journal of Antimicrobial Chemotherapy, 70(1): 233–242 121

Parikh, U.M. and Mellors, J.W. (2016). Should we fear resistance from tenofovir/emtricitabine preexposure prophylaxis? Current Opinion in HIV and AIDS, 11(1): 49

Park, E., Lim, M., Oh, J., Cho, H., Bae, M., Yun, E.H., Kim, D. and Shin, H.R. (2013). Independent and supra-additive effects of alcohol consumption, cigarette smokingand metabolic syndrome on the elevation of serum liver enzyme levels. PLoS One, 8(5); e63439

Patil, R., Kamble, P., & Raghuwanshi, U. (2013). Serum ALP and GGT Levels in HIV Positive patients. Iinternational journal of recent trends in science & technology, 5(3): 155-157.

Patiño-Galindo, J.A., Torres-Puente, M., Bracho, M.A., Alastrué, I., Juan, A., Navarro, D., Galindo, M., Ocete, D., Ortega, E., Concepción, D., Gimeno, C., Belda, J., Domínguez, V., Moreno, R. and González-Candelas, F. (2017). The molecular epidemiology of HIV-1 in the Comunidad Valenciana (Spain): Analysis of transmission clusters. Scientific Reports 7(1): 11584

Peeters, M. and Sharp, P.M. (2000). Genetic Diversity of HIV-1. The Moving Target. AIDS. 14 (Suppl. 3): S129-S140

Pennings, P.S. (2013). HIV drug resistance: Problems and perspectives. Infectious disease reports 5 (Suppl 1)

Powell, R.L., Zhao, J., Konings, F.A., Tang, S., Nanfack, A., Burda, S. Urbanski, M.M. Saa, D.R., Hewlett, I. and Nyambi, P.N. (2007). Identification of a novel circulating recombinant form (CRF) 36_cpx in Cameroon that combines two CRFs (01_AE and 02_AG) with ancestral lineages of subtypes A and G. AIDS Research on Human Retroviruses, 23(8):1008-1019

Price, J.C. and Thio, C.L. (2010). Liver disease in the HIV-infected individual. Clinical Gastroenterology Hepatology, 8(12): 1002–1012

Priya, N. and Venkatalakshmi, P. (2013). The impact of heavy alcohol consumption and cigarette smoking on liver function– a clinical survey. International Journal of Pharmaceutical Sciences, 5(4): 82-85 Priyanka S. and Ezhilarasan D. (2015).HIV Infections and Highly Active Anti- Retroviral Therapy. Journal of Pharmaceutical Sciences and Research, 7: 557-559

QIAamp Viral RNA Mini Handbook (2014). Fourth edition December 2014. www.qiagen.com/resources/download. Accessed on 1st November 2016

Qureshi, I.Z., Shabana, A. and Fareeha, A. (2006). Effect of overweight and obesity on liver function in a sample from Pakistani population. Pakistan Journal of Zoology, 38(1): 49-54

Ragupathy, V., Jiangqin, Z., Owen, W., Shixing, T., Sherwin, L., Nyambi, P. and Hewlett, I. (2011). Identification of new emerging HIV-1 unique recombinant forms and drug-resistant viruses circulating in Cameroon. Virology Journal, 8(1): 185 122

Rajarapu, G. (2014). Genes and genome of HIV-1. Phylogenetics and Evolutionary Biology, 2(1): 126

Recordon-Pinson, P., Alves, B.M., Tumiotto, C., Bellecave, P., Bonnet, F., Neau, D., Soares, E.A., Soares, M.A. and Fleury, H. (2018). A new HIV-1 circulating recombinant form (CRF98_cpx) between CRF06_cpx and subtype B identified in Southwestern France. AIDS Research and Human Retroviruses, 34(11): 1005-1009

Ren, J. and Stammers, D.K. (2008). Structural basis for drug resistance mechanisms for non-nucleoside inhibitors of HIV reverse transcriptase. Virus Research, 134(1-2): 157–170

Reuter, M.A., Pombo, C. and Betts, M.B. (2012). Cytokine production and dysregulation in HIV pathogenesis: Lessons for development of therapeutics and vaccines cytokine. Growth Factor Reviews, 23(4-5): 181–191

Rougemont, M., Stoll, B.E., Elia, N. and Ngang, P. (2009). Antiretroviral treatment adherence and its determinants in Sub-Saharan Africa, a prospective study at Yaounde Central Hospital, Cameroon. AIDS Research and Therapy, 6(1): 21 Rowan, A.G., Fletcher, J.M., Ryan, E.J. Moran, B., Hegarty, J.E., O'Farrelly, C., Mills, K.H. (2008). Hepatitis C virus-specific Th17 cells are suppressed by virus- induced TGF-β. Journal of Immunology, 181(7): 4485–4494

Ruperez, M., Noguera-Julian, M., Gonzalez, R., Maculuve, S., Bellido, R., Vala, A., Rodriguez, C., Sevene, E., Paredes, R. and Menendez, C. (2018). HIV drug resistance patterns in pregnant women using next-generation sequence in Mozambique. PloS One, 13: e0196451

Saber, B.J., Torimiro, J.N., Barbara, A.T., Laure, T.A., Fokam, J., Takou, D. and Mbacham, W.F. (2016). Performance of rapid subtyping tools used for the classification of HIV type 1 recombinants isolated from selected countries in west and central Africa. African Journal of Biotechnology, 15(50): 2744-2750

Salaspuro, M. (1987). Use of enzymes for the diagnosis of alcohol-related organ damage. Enzyme, 37: 87-107

Sallam, M., Şahin, G.O., Indrioason, H., Esbjörnsson, J., Love, A., Widell, A., Gottfreosson, M. and Medstrand, P.(2017). Decreasing prevalence of transmitted drug resistance among ART-naive HIV-1-infected patients in Iceland, 1996-2012. Infections Ecology and Epidemiology, 7(1): 1328964

Santiago, M.L., Range, F., Keele, B.F., Li, Y., Bailes, E., Bibollet-Ruche, F., Fruteau, C., Noë R., Peeters, M., Brookfield, J.F.Y., Shaw, G.M., Sharp, P.M. and Hahn, B.H. (2005). "Simian Immunodeficiency virus infection in free-ranging Sooty Mangabeys (Cercocebus atys atys) from the Taï Forest in Côte d'Ivoire: Implications for the origin of epidemic human immunodeficiency Virus Type 2". Journal of Virology, 79(19), 12515–12527 123

Santoro, M.M. and Perno, C.F. (2013). HIV-1 Genetic variability and clinical implications. ISRN Microbiology, 2013

Schneider, A., Corona, A., Spöring, I., Jordan, M., Buchholz, B., Maccioni, E., Di, S.R., Bodem, J., Tramontano, E. and Wohrl, B.M. (2016). Biochemical characterization of a multi-drug resistant HIV-1 subtype AG reverse transcriptase: Antagonism of AZT discrimination and excision pathways and sensitivity to RNase H inhibitors. Nucleic Acids Research, 44(5): 2310–2322

Seki, E. and Schwabe, R.F. (2015). Hepatic inflammation and fibrosis, functional links and key pathways. Hepatology, 61(3): 1066-1079

Sherri, T.B., Konings, F.A.J., Williams, C.A.U., Anyangwe, C. and Nyambi, P.N. (2004). HIV-1 CRF09_cpx circulates in the Northwest province of Cameroon Where CRF02_AG infections predominate and recombinant strains are common. AIDS Research and Human Retroviruses, 20(12): 1358-1363

Shiferaw, M.B., Tulu, K.T., Zegeye, A.M. and Wubante, A.A. (2016). Liver enzymes abnormalities among highly active antiretroviral therapy-experienced and HAART naive HIV-1 infected patients at Debre Tabor Hospital, North West Ethiopia: A comparative cross-sectional study. AIDS Research and Treatment, 2016

Sidibé, M., Loures, L. and Samb B. (2016). The UNAIDS 90–90–90 target, a clear choice for ending AIDS and for sustainable health and development. Journal of the International AIDS Society, 19(1)

Siemieniuk, R.A.C., Beckthold, B. and Gill, M.J. (2013). Increasing HIV subtype diversity and its clinical implications in a sentinel North American population. Canadian Journal of Infectious Disease and Medical Microbiology, 24 (2): 69-73 Simon, V., Ho, D.D. and Karim, Q.A. (2006). HIV/AIDS epidemiology, pathogenesis, preventionand treatment. The Lancet, 368(9534): 489-504.

Smith, D.M., May, S.J., Tweeten, S., Drumright, L., Pacold, M.E., Kosakovsky, P.S.L., Pesano, R.L., Lie, Y.S., Richman, D.D., Frost, S.D.W., Woelk, C.H. and Little, J.L. (2009). A public health model for the molecular surveillance of HIV transmission in San Diego, California. AIDS, 14; 23(2): 225-232

Soriano, V., Massimo, P., Pilar, J. K., Benhamou, Y. R., Pablo, B. and McGovern, B. (2008). Antiretroviral drugs and liver injury. AIDS, 22(1): 1-13

Spear, G.T., Alves, M., Cohen, M.H., Bremer, J. and Landay, A.L. (2005). Relationship of HIV RNA and cytokines in saliva from HIV-infected individuals. FEMS. Immunology and Medical Microbiology, 45(2):129-136

Spengler, U., Lichterfeld, M. and Rockstroh, J.K. (2002). Antiretroviral drug toxicity a challenge for the hepatologist? Journal of Hepatology, 36(2): 283 -294 Steegen, K., Carmona, S., Bronze, M., Papathanasopoulos, M.A., van Zyl, G., Goedhals, D., MacLeod, W., Sanne, I. and Stevens, W.S. (2016). Moderate levels of pre-treatment HIV-1 antiretroviral drug resistance detected in the first South African national survey. PLoS One, 11(12): e0166305 124 terling, R.K., Chiu, S., Snider, K. and Nixon, D. (2008). The prevalence and risk factors for abnormal liver enzymes in HIV-positive patients without hepatitis B or C coinfections. Digestive Diseases Sciences, 53(5): 1375-1382

Subramaniyan, V. and Middha, A. (2016). Chronic ethanol consumption–induced hepatotoxicity and protective effect of Boswellia serrata. National Journal of Physiology and Pharmaceutical Pharmacology, 6(2): 170

Sulkowski, M., Thomas, D.L., Chaisson, R.E. and Moore, R.D. (2000). Hepatotoxicity associated with antiretroviral therapy in adults infected with human immunodeficiency virus and the role of hepatitis C or B virus infection. Journal of American Medical Association, 283(1): 74-80

Sulkowski, M.S., Нomas, D.L., Mehta, S.H., Chaisson, R.E. and Moore, R.D. (2002). Hepatotoxicity associated with Nevirapine or Efavirenz-containing antiretroviral therapy: Role of hepatitis C and B infections. Hepatology, 35(1): 182-189 Sumida, Y., Nakajima, A. and Itoh, Y. (2014). Limitations of liver biopsy and non- invasive diagnostic tests for the diagnosis of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World journal of gastroenterology, 20(2): 475

Suraj, N.M. and Prasanna, M.S. (2015). HIV drug resistance, an overview. International Journal of Research Methodology, 1(1):72-82

Suter, P. and Tremblay, A. (2005). Is alcohol consumption a risk factor for weight gain and obesity? Critical Review of Clinical Laboratory Sciences, 42(3): 197-227

Tasca, K. I., Calvi, S. A. and Souza, L. D. R. D. (2012). Immunovirological parameters and cytokines in HIV infection. Revista da Sociedade Brasileira de Medicina Tropical, 45(6): 663-669.

Tasneem, R., Angoorbala, B., Maheshwari, R.S., Shweta, A. and Rai, B.A. (2015). Effect of increasing BMI on enzymes used for assessment of liver function. European Journal of Pharmaceutical and Medical Research 2(6): 207-209

Taylor, B.S., Sobieszczyk, M.E., McCutchan, F.E. and Hammer, S.M. (2008). The challenge of HIV-1 subtype diversity. National England Journal of Medicine, 358(15), 1590-1602

Tchouwa, G.F., Eymard-Duvernay, S., Courni, A., Lamare, N., Serrano, L., Butel, C., Bertagnolio, S., Mpoudi-Ngole, E., Raizes, E., Aghokeng, A.F. and Members of the EHRICA Study Group (2018). Prevalence of pretreatment HIV drug resistance in Cameroon following a nationally representative WHO surveys. The Journal of Antimicrobial Chemotherapy, 73(9): 2468–2474 Tebit, D.M., Zekeng, L., Kaptué, L., Salminen, M., Kräusslich, H.G., Herchenröder, O. (2002). Genotypic and Phenotypic Analysis of HIV Type 1 Primary Isolates from Western Cameroon. AIDS Research and Human Retroviruses, 18(1): 39-48 125

Teklay, G., Legesse, B. and Legesse, M. (2013). Adverse effects and regimen switch among patients on antiretroviral treatment in a resource-limited setting in Ethiopia. Journal of Pharmacovigilance, 1(4): 115

Teto, G., Tagny, C.T., Mbanya, D., Fonsah, J.Y., Fokam, J., Nchindap, E., Kenmogne, L., Njamnshi, A K. and Kanmogne, G.D. (2017). Gag P2/NC and pol genetic diversity, polymorphismand drug resistance mutations in HIV-1 CRF02_AG and non-CRF02_AG infected patients in Yaounde, Cameroon. Science Reports, 7(1): 14136

Thapa, B.R. and Walia, A. (2007). Liver Function Tests and Interpretation. Indian Journal of Pediatrics, 74: 667- 671

Theys, K., Van Laethem, K., Gomes, P., Baele, G., Pineda-Pena, A. C., Vandamme, A. M., Camacho, R.J., Abecasis, A.B. and Portuguese HIV-1 Resistance Study Group. (2016). Sub-epidemics explain localized high prevalence of reduced susceptibility to rilpivirine in treatment-naive HIV-1-infected patients: subtype and geographic compartmentalization of baseline resistance mutations. AIDS research and human retroviruses, 32(5): 427-433

Tilg, H. (2001). Cytokines and liver diseases. Canadian Journal of Gastroenterology: 15(10): 661-8

Tseng, Y. T., Yang, C. J., Chang, S. Y., Lin, S. W., Tsai, M. S., Liu, W. C., Wu, P.Y., Su, Y.C., Luo, Y.Z., Yang, S.P. and Hung, C.C., (2014). Incidence and risk factors of skin rashes and hepatotoxicity in HIV-infected patients receiving nevirapine- containing combination antiretroviral therapy in Taiwan. International Journal of Infectious Diseases, 29: 12-17

Tudela, E.V., Singh, M.K., Lagman, M., Ly, J., Patel, N., Ochoa, C. and Venketaraman, V. (2014). Cytokine levels in plasma samples of individuals with HIV infection. Austin Journal of Clinical Immunology, 1(1): 5

UNAIDS (2018). Global HIV and AIDS statistics 2018 fact sheet. Accessed on 11th January 2019 Vergne, L., Diagbouga, S., Kouanfack, C., Aghokeng, A., Butel, C., Laurent, C., Noumssi, N., Tardy, M., Sawadogo, A., Drabo, J., Hien, H, Zekeng, L, Delaporte, Eand Peeters, M. (2006). HIV-1 drug-resistance mutations among newly diagnosed patients before scaling-up programmes in Burkina Faso and Cameroon. Antiviral therapy, 11(5): 575

Vessiere, A., Nerrienet, E., Kfutwah, A., Menu, E., Tejiokem, M., Pinson-Recordon, P., Barre-Sinoussi, F., Fleury, H. and Ayouba, A. (2006). HIV-1 pol gene polymorphism and antiretroviral resistance mutations in drug-naive pregnant women in Yaounde, Cameroon. Journal of Acquired Immune Deficiency Syndromes, 42(2): 256-258 Vishwanath, V., Devin, M., Clare, D. andrea, S., Steven, K., Hyoung, O.H., Mesharee, F., Murad, J.P., Khasawneh, F.T., Saviola, B., Guilford, T. and Donahue, C. (2011). Role of cytokines and chemokines in HIV infection. HIV and AIDS - Updates on biology immunology epidemiology and treatment strategies. IntechOpen 126 http://www.intechopen.com/books/hiv-and-aids-updates-on-biology-immunology- epidemiology-andtreatment-strategies/role-of-cytokines-and-chemokines-in-hiv- infection 281-300. Accessed on 12th May 2015

Wambani, J.R., Kiboi, N.G., Makori, W.M., Ogola, P.E. and Rachuonyo, H.O. (2016). Immunological profiles in HIV positive patients with or without opportunistic infections and the influence of highly active antiretroviral therapy: A Systematic Review and Update. Journal of Clinical Cell Immunology, 7(1): 429

Wambani, J.R., Ogola, P.E., Arika, W.M., Rachuonyo, H.O., Kemboi, N.G., Lihana, R. and Burugu, M.W. (2015). Anti-retroviral drug hepatotoxicity and risk factors in HIV patients with or without hepatitis B and C: A review. Journal of Infectious Diseases Therapy, 3(258): 2332-0877

Wang, W., De Feo, C. J., Zhuang, M., Vassell, R. and Weiss, C. D. (2011). Selection with a peptide fusion inhibitor corresponding to the first heptad repeat of HIV-1 gp41 identifies two genetic pathways conferring cross-resistance to peptide fusion inhibitors corresponding to the first and second heptad repeats (HR1 and HR2) of gp41. Journal of virology, 85(24): 12929-12938

Wannamethee, S. and Shaper, A. (2010). Cigarette smoking and serum liver enzymes, the role of alcohol and inflammation. Annual Clinical Biochemistry, 47(4): 321-326

Watts, C.H., Foss, A.M., Hossain, M., Zimmerman, C., von Simson, R. and Klot, J. (2010). Sexual violence and conflict in Africa: Prevalence and potential impact on HIV incidence. Sexually Transmissible Infections, 86(Suppl 3): iii93-iii99.

Wenderlein, D., Scarcella, P., Zimba, I., Luhanga, R., Mancinelli, S., Marazzi, M.C., Buonomo, E., Orlando, S., Palombi, L. and Giuseppe L. (2016). Antiretroviral treatment-associated hepatotoxicity and anemia in patients receiving stavudine or zidovudine-containing regimens in Sub-Saharan African Settings. Journal of AIDS and Clinical Research, 7(1)

Weng, Y., Tsai, H., Lee, S.J., Wu, K., Sy, C., Chen, J. and Chen, Y. (2014). Prevalence and associated factors for HIV-1 transmitted drug resistance involuntary clients for counseling and testing in Southern Taiwan. Journal of Microbiology, Immunology and Infection, 49(4): 487-493

Wensing, A.M., Calvez, V., Günthard, H.F., Johnson, V.A., Paredes, R., Pillay, D., Shafer, RW. and Richman, D. D. (2017). 2017 Update of the drug resistance mutations in HIV-1. Topics in Antiviral Medicine, 24(4): 132 Wensing, A.M.J., van Maarseveen, N.M. and Nijhuis, M. (2010). Fifteen years of HIV protease inhibitors, raising the barrier to resistance. Antiviral Research, 85(1): 59-74 WHO, (2001). Drug resistance, Part 1. HIV/AIDS antiretroviral Newsletter. Issue 6 WHO, (2002). Scaling up antiretroviral therapy in resource-limited settings: guidelines for a public health approach: executive summary (No. WHO/HIV/2002.01). Geneva: World Health Organization. 127

WHO, (2017). HIV drug resistance report 2017. Geneva. License, CC BY-NC-SA 3.0 IGO. WHO, (2018). HIV/AIDS Data and statistics. https,//www.who.int/hiv/data/en/ Accessed on 18th February 2019

Williams, A., Steffens, F., Reinecke, C., Meyer, D. (2013). The Th1/Th2/Th17 cytokine profile of HIV-infected individuals: a multivariate cytokinomics approach. Cytokine, 61(2): 521-526

Wittkop, L., Günthard, H.F., de Wolf, F., Dunn, D., Cozzi-Lepri, A., de Luca, A., Kücherer, C., Obel, N., von Wyl, V., Masquelier, B., Stephan C., Torti C., Antinori A., García, F., Judd, A., Porter, K., Thiébaut, R., Castro, H., Colin C., Kjaer J., Lundgren, J.D., Paredes, R., Pozniak, A., Clotet, B., Phillips, A., Pillay, D., Chêne, G. and EuroCoord-CHAIN study group (2011). Effect of transmitted drug resistance on virological and immunological response to initial combination antiretroviral therapy for HIV (EuroCoord-CHAIN joint project), a European multicohort study. Lancet Infectious Diseases, 11(5): 363-371 Wondemagegn, M., Bokretsion, G., Ambahun, C., Genetu, A. and Bayeh, A. (2013). Hepatotoxicity and associated risk factors in HIV-infected patients receiving antiretroviral therapy at Felegehiwot referral hospital. Bahirdar. Ethiopia. Ethiopia Journal of Health Sciences, 23(3): 217-226

Wu, L., Jin, C., Bai, S., Davies, H., Rao, H., Liang, Y. and Wu, N. (2015). The effect of highly active antiretroviral therapy on liver function in human immunodeficiency virus-infected pediatric patients with or without hepatitis virus co-infection. Journal of Research in Medical Sciences, 20(2), 127–132

Xiaobai, Z., Xi, C., Tian, H., Williams, A.B., Wang, H., He, J., Zhen, J., Chiarella, J., Blake, L.A., Turenchalk, G. and Kozal, M.J. (2014). Prevalence of WHO transmitted drug resistance mutations by deep sequencing in antiretroviral-naive subjects in Hunan province, China. PLoS One, 9(6), e98740

Xing, Z., Gauldie, J., Cox, G., Baumann, H., Jordana, M., Lei, X. F. and Achong, M. K. (1998). IL-6 Is an anti-inflammatory cytokine required for controlling local or systemic acute inflammatory responses. The Journal of clinical investigation, 101(2): 311-320

Zhang, F., Liu, L., Sun, M., Sun, J. and Lu, H. (2017). An analysis of drug resistance among people living with HIV/AIDS in Shanghai, China. PLoS One 12(2): e0165110

Zhang, L. and Wang, X. (2006). Interleukin-10 and chronic liver disease. World Journal of Gastroenterology, 21, 12(11): 1681-1685

Zoufaly, A., Jochum, J., Hammer, R., Nassimi, N., Raymond, Y., Burchard, G. D., Schmiedel, S., Drexler, J.F., Kay, C.N., Taka, N., Awasom, C, Metzner, K, Jan, V. and Feldt, T. (2014). Determinants of HIV-1 drug resistance in treatment-naive patients and its clinical implications in an antiretroviral treatment program in Cameroon. Journal of International AIDS Society, 17(14): 19615 128

APPENDICES

Appendix I: First and second lines HIV treatments currently recommended in Cameroon

(Ministry of Public Health, 2015)

First-line regimen Zidovudine + Lamivudine + Efavirenz

(2NRTI+1NNRTI) Zidovudine + Lamivudine + Nevirapine

Tenofovir + lamivudine + Efavirenz

Tenofovir + Emtricitabine + Efavirenz

Special cases Abacavir + Lamivudine + Nevirapine

Abacavir + Lamivudine + Efavirenz

Zidovudine/Abacavir + Lamivudine + Lopinavir/r or

Atazanavir/r

Second-lineregimen Zidovudine + Lamivudine + Atazanavir/r*

(2NRTI+1PI) Zidovudine + Lamivudine + Lopinavir/r

Tenofovir + Lamivudine + Atazanavir/r*

Tenofovir + Lamivudine + Lopinavir/r

Abacavir + Didanosine + Lopinavir/r

*Atazanavir is the preferred choice because it is easy to take (one tablet), better

digestive tolerance and better preservation of 2nd generation PI 129

Appendix II: List of amino acids

3 Letter Code Amino Acid Name 1 Letter Code

Ala Alanine A

Arg Arginine R

Asn Asparagine N

Asp Aspartic acid D

Cys Cysteine C

Glu Glutamic acid E

Gln Glutamine Q

Gly Glycine G

His Histidine H

Ile Isoleucine I

Leu Leucine L

Lys Lysine K

Met Methionine M

Phe Phenylalanine F

Pro Proline P

Ser Serine S

Thr Threonine T

Trp Tryptophane W

Tyr Tyrosine Y

Val Valine V 130

Appendix III: Ethical clearance

131

Appendix IV: Information sheet (in English)

Title: Evaluation of genetic diversity, drug resistance mutational and cytokine patterns on hepatotoxicity markers among HIV patients in Northwest region Cameroon

Investigator: Lem Edith Abongwa, Ph.D. student

Introduction: This consent form explains the research study you are being asked to voluntarily participate. Please listen carefully and ask any question about the study before you agree to take part. You may ask questions at any time after joining the study.

We are doing a voluntary research study to know whether when a patient is on HAART that is taking medication to treat the HIV, the drug can cause some damage at the level of the liver, kidney and other organ particles like mitochondria. We will be testing your blood for these effects and we are doing this study because it is not known whether patients taking the medication will have these effects mentioned in our Cameroon population since we are different from other population in some countries where this test has also been done before.

The procedure of research project: If you agree to join this study, we will ask you information about your background and the type of antiretroviral that you are taking. It will take about 3-5 minutes to ask you these questions. You can skip any question that you do not want to answer. You can also stop answering the questions at any time.

We will also take about 8ml (about 1.5 teaspoons) of blood from you. Blood will be taken directly from your arm and sent to the laboratory within 24 hours. The blood will be analyzed for ARV toxic effects, genetic diversity, drug resistance, and cytokine profiles. Blood samples will be collected at initiation before you start taking ARV and also at one and six months following initiation to therapy.

Risks /Discomforts: if you join this study, there are some things that may cause you discomfort. You may feel a slight sting or pinch in your arm when the blood is collected. You may also get a small bruise where the needle went in. Some people may faint, but this is rare. 132

Benefit from this study: there no direct benefit in financial reward however by participating in this study you will support research on the effect of taking this medication on the life of the patient, patient care and follow-up. You are also going to contribute to scientific knowledge for the promotion of health. Nevertheless, we may contact you and your health care provider if the research results carried out prove to be useful for your immediate medical follow-up.

Confidentiality: the fact learned in this study will be kept private to the extent allowed by law. Your answers and blood samples will only be labeled with the study code number. Any results from this study that are important to science will be published in magazines and only reported in general terms.

Voluntariness: your joining this research study is completely voluntary. You have the right to withdraw from the study at any time. You have the right to refuse any more blood test and to refuse to answer any more questions at any time.

Persons to Contact: if you have any questions concerning this study you may ask the following:

1. Research Student: Lem Edith Abongwa at 677951677, or email her at [email protected] 2. Research Director: Prof. Fokunang Charles at 670902446 or email him at [email protected] 3. National Ethics Committee for human health research at 243674339, or email at [email protected]

133

Appendix V: Information sheet (in French)

Fiche de renseignements

Titre: Évaluation de la diversité génétique, la résistance aux médicaments contre le VIH- 1 et le profil des cytokines, et les effect sur l'hépatotoxicité chez les patients VIH dans la région Nord-Ouest Cameroun.

Chercheur principal: Lem Edith Abongwa; étudiante en doctorat/PhD,

Introduction: Chers participants, dans le cadre de mes activités de recherches en doctorales, il sera egalement question de savoir si la prise de médicament pour le VIH, en particularité la thérapie HAART, peut entraîner des dommages au niveau des organes comme le foie et les reins. Bien que des études de ce genre ont été réalisées dans d'autres pays, il sera important de le faire au Cameroun étant donné des différents genetiques et metaboliques qui peuvent avoir d‟un pays a l‟autre ou dans les groupes de la population.

Procédure De Projet De Recherche: Si vous acceptez d'adhérer à cette étude, nous vous demanderons des informations sur vos antécédents et le type d'antirétroviraux (ARV) que vous prenez. L‟entretien pourra prendra environ 3-5 minutes et la reponse a une question est absolument volontaire a votre aise Vous pouvez également arrêter de répondre aux questions à tout moment.

Nous allons également prendre environ 8 ml (environ 1,5 cuilleres à café) de votre sang. Ce sang sera pris directement à partir de votre bras et envoyé au laboratoire dans les 24 heures. Le sang sera analysé pour des marqueurs de toxicite des ARV, résistance aux médicaments pour le VIH-1, la diversité génétique et le profil des cytokines. Des échantillons de sang seront prélevés au debut de l'enquête (avant le debut de la prise des ARV), un mois après et au sixième mois après l'initiation de la thérapie.

Risques /malaises: Si vous participez à cette étude, il y a certains inconforts comme sentir un léger picotement ou pincer dans votre bras lorsque le sang y est prélevé. Vous pouvez également obtenir une petite contusion a l‟endroit où l'aiguille est passeé. Certaines personnes peuvent s'évanouir, mais ceci est rare. 134

Bénéfices de cette etude: Il n'y a pas de bénéfice direct sous forme de récompense financière. Votre participation aidera à mieux comprendre la maladie étudiée pour l'élaboration de meilleures stratégies thérapeutiques pour améliorer les soins aux patients et leur suivi. Vous allez également contribuer à la connaissance scientifique et la promotion de la santé. Né anmoins, nous pouvons vous contacter si les résultats de la recherche effectuée s'avéreraient utile pour votre suivi médical immediate.

La Confidentialité: Toute information dans cette étude sera maintenue privée conformement à la réglémentation en vigueur. Vos réponses et vos échantillons de sang seront étiquetés uniquement avec le numéro de code de l'étude. Les résultats de cette étude qui sont importantes à la science seront publiés dans des revues scientifiques et en des termes anonymés.

Volontariat: votre adhésion à cette étude est entièrement volontaire. Vous avez le droit de vous retirer de l'étude à tout moment. Vous avez le droit de refuser tout test sanguin et reponse aux questions suppléinentaires à tout moment

Les personnes à contacter: si vous avez des questions concernant cette étude, vous pouvez demander les personnes suivantes:

1. Étudiante porteuse de la recherché: Lem Edith Abongwa à 677951677, e-mail: [email protected] 2. Directeur de la recherché: le Prof. Charles Fokunang à 670902446, e-mail: [email protected]

3. Comité national d'éthique de la research pour la santé humaine at 243 674 339, or email: [email protected]

135

Appendix VI: Informed consent form (in English)

I (name) ------have been invited to participate in the study entitled; “Evaluation of genetic diversity, drug resistance mutational and cytokine patterns on hepatotoxicity markers among HIV patients in Northwest region Cameroon” to be carried out by LEM EDITH

ABONGWA a PhD student in Kenyatta University, teaching in the University of

Bamenda with Pr. Fokunang Charles and Dr. kebira Anthony as her research directors.

 I have read (it has been read to me) and understood the above the research information;  I understood the objectives of the study;  I have had the opportunity to ask questions about it and any questions that I have asked have been answered to my satisfaction;  I understood the risks and the benefits in partaking in this study;  I understand that I have the right to refuse to take part in the research activities at any time

I consent voluntarily to participate as a participant in this research and I will

 Answer all the questions to the best of my knowledge;  Keep to the medical advice with respect to this study;  Will give 8ml of blood as required three times;

I, patient with code number …………………………….. accept to participate in this study for the period that need be.

Signature of subject...... Place...... Date …………………

Signature of investigator...... Place...... Date ………………..

136

Appendix VII: Informed consent form (in French)

Formulaire de consentement éclairé

Je soussigné(e) ------atteste avoir été invité(e) à participer à l'étude intitulée, Évaluation de la diversité génétique, la résistance aux médicaments contre le VIH-1 et le profil des cytokines, et les effect sur l'hépatotoxicité chez les patients VIH dans la région Nord-Ouest Cameroun faite par LEM EDITH ABONGWA, étudiante en Doctorat/PhD à „Kenyatta University‟ sous l‟encadrement de Pr. Fokunang Charles et Dr. Kebira Anthony. Elle est aussi une enseignante à l'Université de Bamenda.

• J'ai lu (il a été lu pour moi) et compris l'information de la recherche ci-dessus;

• J'ai bien compris les objectifs de l'étude;

• J'ai eu l'occasion de poser des questions à ce sujet et des questions que j'ai posées ont été répondues à ma satisfaction;

• J'ai bien compris les risques et les avantages de participation à cette etude;

• Je comprends que j'ai le droit de refuser de prendre part aux activités de recherche à tout moment;

Je consens volontairement à participer en tant que participant à cette recherche et je vais

 répondre à toutes les questions au meilleur de mes connaissances;  tenir à l'avis médical à l'égard de cette etude;  vais donner 8ml du sang trois fois comme exigé.

Moi, le patient avec le numéro de code …………………………….. accepte de participer à cette étude pour la période qu'il faudra.

Signature du participant...... Lieu ...... Date …………

Signature de l‟investigateur...... Lieu ...... Date…………

137

Appendix VIII: Questionnaire

TITLE: Evaluation of genetic diversity, drug resistance mutational and cytokine patterns on hepatotoxicity markers among HIV patients in the Northwest region Cameroon

Investigator: Lem Edith Abongwa; Ph.D. student

Patients number………………………… Sex, Male Female If Female

Are you pregnant? Yes No If yes Parity------Gestation age------

Age ………………………… Height …………………… Weight …………………

Level of education, None Primary Secondary Tertiary

Monthly income, <50,000frs 50,000-100,000frs 100,001-150,000frs >150000frs

Do you drink alcohol (wine, beer, etc) Yes No

If yes, how many bottles do you drink a day per week? ≤1 1-7 > 7

Have you ever smoke Cigarette or Tobacco? Yes No If yes

How many sticks do you take a day? Not smoking presently 1- 20 >20

Have you done any of the following tests?

1. Hepatitis B: Yes No If yes, the year the test was

done……………

Result of test: Positive Negative I do not know

2. Hepatitis C: Yes No If yes, the year the test was done…………

Result: Positive Negative I do not know 138

If negative, have you ever been vaccinated for Hepatitis B or C? Yes No

In which year were you diagnosed positive for HIV? < 1 year 1-3 years > 4 years

Have you ever taken ARV Before? Yes No if yes, which type?

Herbal Synthetic drug Year of initiation………………

Name of ARV taken...... I do not know

Do you know the value of the following tests at the time you were diagnosed positive for

HIV? If yes (ask to see)

CD4+ T cells count: Yes No If yes (value)......

WBC: Yes No If yes (value)......

ALT: Yes No If yes (value)......

AST: Yes No If yes (value)......

Serum creatinine: Yes No If yes (value)......

Viral load: Yes No If yes (value)......

Are you currently on any drug? Yes No If yes tick all that is applicable

TB drugs Paracetamol

Orders (Specify for example herbal drugs) ______

WHO stage: I II III IV

Name of ARV given...... 139

Appendix IX: Composition of reagents (R) used for ALT, AST, and ALP measurement

A Alanine aminotransferase

R1: TRIS-Buffer (pH 7.5) 100 mmol/l L-Alanine 500 mmol/l Lactatdehydrogenase (LDH) ≥ 1200 U/l R2: α ketoglutarate 15 mmol/l NADH 0.18 mmol/l

B Aspartate aminotransferase

R1: TRIS-Puffer (pH 7.8) 80 mmol/l L-Aspartate 200 mmol/l Lactate dehydrogenase (LDH) 800 U/L Malate dehydrogenase (MDH) 600 U/L

R2: α ketoglutarate 12 mmol/l NADH 0.18 mmol/l

C Alkaline phosphatase (ALP)

R1: Diethanolamine (pH 10.4) 1.00 mol/l Magnesium chloride 0.50 mmol/l R2: p-Nitrophenylphosphate 10.0 mmol/l

140

Appendix X: Sequences and accession numbers in GenBank

A: Sequences of HIV-1 reverse transcriptase region

Accession Number: MK061035 Sample ID : > CM-NWR-B003 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGGCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTGCAGAAATGGAGAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAAGAAAAAAGATAGTACTA AATGGAGAAAATYAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTGAAAAAGAAAAA ATCAGTAACAGTACTAGATGTAGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAAACA CCGGGGATTAGGTATCAGTACAATGTGCTGCCACAAGGATGGAAAGGGTCACCAGCAATATTTCAGGCTAGCATGACAAAAATCTTAGAGCCCTTTAGAACAAA AAATCCAGAGGTGGTAATTTACCAATATATGGATGATCTATATGTAGGATCTGACTTGGAGATAGGGCAGCACAGAGAAAAAATACAGGAACTGAGAGATCATT TACTGAAATGGGGGTTCACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACAGTTCAACCTA TACAGCTACCAGAAAAAGACAGTTGGACTGTCAATGATATACAGAAATTAGTGGGAAAATTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAGCAA CTGTGTAAACTCCTCAGAGGAGCCAAAGCACTAACAGAGGTAGTGACACTGACTGAGGAAGCAGAATTAGAATTGGCAGAAAACAGAGAAATACTAAAAGAAC CAGTACARGGGGTATATTATGACCCAGCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAGGACCAATGGACATATCAGATTTATCAAGAGCCATTTAAA AATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061036 Sample ID : >CM-NWR-B007 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAA AGAAATTTGTGCAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCWATATTTGCCATAARGAAAAAGGACAGTACT AAATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAGCTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAA ATCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCTTTRGACAAAGATTTTAGAAAGTATACTGCATTCACCATACCTAGTATAAATAATGAAACA CCGGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATTTTTCAGGCTAGCATGACAAAAATCTTAGAGCCCTTTAGAACAAAA AATCCAGACATAGTGATCTACCAATACATGGATGATTTATACGTAGGATCAGACTTAGAGATAGGGCAGCATAGATCAAAGATAGAGGAGTTGAGAGAACATCT ACTGARGTGGGGRTTTACCACACCAGACAAAAAGCATCAGAAGGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAGATGGACAGTCCAGCMTAT ASAGTTGCCAGAAAAGGACAGCTGGACTGTCAATGAKRTACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATGGAGGAATTAAAGTAAAGCAAC TGTGTAAACTCCTCAGGGGAGCTAAAGCACTAACAGATGTAGTGACACTGACTGAGGAAGCAGAATTAGAATTGGCAGAAAACAGAGAAATTCTAAGAGAACCT GTACATGGGGTATATTATGACCCAACAAAAGACTTAGTAGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTGTCAAGAGCCATTTAAAAA TCTAAAAACAGGAAAATATGCAAAAAaGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061037 Sample ID : >CM-NWR-B025 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAAC AGACATTTGTTTAGAAATGGAAAAGGAAGGAAAAATCTCAAAAATTGGGCCTGAAAATCCATACAATACTCCWGTATTTGCCATAAAGAAAAAAGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCAGCAGGATTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAGAATTTAGAAAGTACACYGCATTCACTATACCTAGTATAAATAATGAAACA CCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAGGGATCACCWGCAATATTTCAGGCAAGTATGACAAAGATTTTAGAGCCCTTCAGAACAAA AAATCCAGAGATGGTGATCTACCAATATATGGATGATTTATATGTAGGATCAGACTTAGAGATAGGGCAACATAGAGCAAAAATAGAAGAGTTGAGAGAACATC TAKTGAARTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTA TACAGYTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTAAAGCAA YTGTGTARACTCCTCAGGGGGACCAAATCGCTAACAGAAATAGTAACAYTAACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAAGAAC CTGTACATGGAGTATATTATGACCCAACAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAGGACCAATGGACATATCAAATTTATCAAGAGCCATTTAAA AATCTAAAAACAGGAAAATATGCAAAAAAGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGGCTCTAGAAAGCATA

Accession Number: MK061038 Sample ID : >CM-NWR-B029 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAGATTTGTACAGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAGAAAGATAGTACTA AATGGAGAAAATTAGTAGACTTCAGAGAACTCAATAAGAGAACTCAAGACTTYTGGGAGGTCCAATTAGGAATACCTCATCCAGCGGGACTAAAAAAGAAAAR ATCAGTAACAGTGCTAGATGTAGGGGATGCATATTTTTCAGTTCCATTAGATGAAGAGTTTAGAAAGTACACTGCATTCACTATACCCAGTGTAAATAATGAGAC ACCAGGGATCAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCARTATTTCAGGCAAGTATGACAAAAATCTTAGAGCCCTTTAGAGCAG AAAATCCAGAGATAGTGATCTACCAATATATGGATGATCTATATGTAGGATCAGACTTAGAGATAGGACAGCATAGAGCAAAAGTAGAGGAGTTAAGAGGACAT CTACTGAAGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTCCAGCCT ATACAGCTGCCAGAAAAAGACAGTTGGACTGTCAATGATGTACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATCTATCCAGGAATCAGAGTAAGGGA ACTGTGTAAACTCCTCAGGGGAGCCAAAGCACTCACAGATATAGTAACACTGACTAAGGAAGCAGAGTTAGAATTGGCAGAGAACAGAGAAATTCTAAAAGAA CCTGTACATGGAATCTATTATGATCCAACAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAGATTTACCAAGAGCCATTAAA AAATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061039 Sample ID : >CM-NWR-B035 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAAC AGAAATTTGTACAGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGACCTGACAATCCATATAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATTCCTCATCCCGCGGGATTAAAAAAGAAAAAG TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCCTGGATAWAGAATTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAGACA CCAGGAATCAGATAYCAGTACAATGTGCTTCCWCAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATGACAAAAATTTTAGAGCCCTTTAGAAAAGR AAATCCAGARATAGTGATCTACCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAGCAAAAATAGAGSAGTTAAGAGAACATC TACTGAGATGGGGGTTTACTACACCAGACAAAAAACAYCAGAAAGAGCCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTA TAMWACTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTGGGAAAACTAAACTGGGCAAGTCAGATTTATGCAGGAATCAAGGTAAGACA ACTGTGTAAACTCCTCAGGGGAGCCAAAGCATTAACAGATATAGTAACACTGACTGAGGAAGCAGAACTAGAATTAGCRGAGAACAGGGARATTCTGAAAGAAC CTGTACATGGAGTATATTATGACCCAACAAAAGACTTAATAGCAGAAATACAGAAGCAAGGGCAAGATCAATGGACATATCAAATTTATCAGGAGCCATTTAAA AATCTAAAAACAGGAAAATATGCAAAAAAGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAAGTGGCTTTGGAATGCATA

Accession Number: MK061040 Sample ID : >CM-NWR-B040 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAGAGCACTAAC AGAAATTTGTACAGAGATGGAAAAGGAGGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAGGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCACCCMGCAGGATTAAAAAAGAAAAA ATCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGAATTTAGAAAGTATACAGCATTCACTATACCTAGTTTAAATAATGAAAC ACCAGGGATTAGGTATCAGTACAATGTGCTGCCACAGGGATGGAAAGGATCACCAGCAATCTTTCAGGCAAGCATGACAAAAATCTTAGAGCCCTTTAGAGCAA AAAATCCAGARATGGTGATCTACCAATATATGGATGATTTATATGTAGGATCAGACTTAGAGATAGGRCAGCATAGAGAAAARATAGAARAGTTAAGAGAGCAC TTACTGAGCTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTTCAGCCT ATACAGCTGCCAGACAAAGACAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAARCTAAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTAAAGCA ACTGTGTAAACTCATCAGGGGAACCAAAGCACTAACAGACATAGTAACACTGACTGAAGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAAGAA CCTGTACATGGGGTATATTATGACCCGGCAAAAGACTTAGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAGGAGCCATTTAA AAATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAGCAATTAACAGAGGTAGTGCAAAAAGTGGCTTTGGAATGCATA

Accession Number: MK061041 Sample ID : >CM-NWR-B055 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGGCCCAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAAC AGAMATTTGTGCAGAGATGGAAAAGGAAGGAAAGATTTCAAAAATTGGGCCTGAAAATCCATACAATAYTCCAGTATTTGCAATTARGAAAAAAGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAAGTCCAATTAGGAATACCACATCCCGCGGGATTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGAATTTAGAAAGTACACTGCATTCACTATACCTAGTGTAAATAATGAGACA CCAGGRATCAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAGCAAGCATGACTAAAATCTTAGAGCCCTTTAGAACAAA GAATCCAGAGATGGTGATCTATCAATATATGGATGATTTATATGTAGGATCAGACTTARARATRGGSCAGCATAGAGCAAAAATAGAGGAGTTGAGAGGACATCT 141

ACTGAAATGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTCCAGCCTAT ACAGCTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTGGGAAAATTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAGCAAC TATGTAAACTCCTCAGGGGAGCTAAAGCACTAACAGATATAGTAACACTGACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAGGGAGATTCTAAAAGAACCT GKACATGGAGTATATTATGATCCAACAAAAGGCTTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATACCAAATATATCAAGAGCCATTTAAAA ATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061042 Sample ID : >CM-NWR-B062 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTATGGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGATGGTACTA AATGGAGAAAATTGGTAGATTTTAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGAGGTTCAATTAGGAATACCTCATCCCGCAGGWTTAAAAGAAAAGAAA TCAGTAACAGTTTTAGATGTGGGGGACGCCTATTTTTCAGTTCCCTTAGATGAAGACTTTAGAAAATATACTGCATTTACCATACCTAGTGTAAATAATGAGACAC CGGGGATTAGATATCARTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGTATAGCATGACAAAAATCTTAGAGCCTTTTAGAAGAAAA AATCCAGAAATAGTGATCTACCAATACATGGATGATTTATATGTAGGATCTGACTTAGAAATAGGGCAACATAGAGCAAAAATAGAGGAGCTAAGAGGACAYTT GTTGAAATGGGGATTTACCACACCAGATAAAAAGCATCAGAAAGAACCCCCATTTCTGTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTAT ACAGCTGCCAGACAAAGACAGCTGGACTGTCAATGATATACAAAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATCTATCCAGGGATTAGGGTAAAGAATC TATGTAAACTTCTTAGGGGAACCAAAGCACTAACAGACATAGTACCACTGACTGATGAAGCAGAATTAGAATTAGCAGAAAACAGGGAGATTCTTAAAGACCCT GTGCATGGGGTATATTATGACCCATCAAAAGAATTAKTGGCAGAAATACAGAAACAAGGRCAAGACCAGTGGACATATCAAATCTATCAAGAGCCATTTAAGAA TCTGAAAACAGGAAAATATGCAAGAAAAAGATCTGCCCACACTAATGATGTAAGACAGCTAGTAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061043 Sample ID : >CM-NWR-B070 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAAC AGAAATTTGTACAGACATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAGGATAGCACTA AATGGAGGAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTCCCCTTAGATAAAGACTTTAGAAAGTACACTGCATTCACTATACCTAGTGTAAATAATGAGACA CCAGGGATTAGATATCAGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATGACAAAAATATTAAATCCYTTTAGAGCAAA AAATCCAGAGATAGTGATCTACCAATATATGGATGATTTATATGTAGGATCAGAYTTAGAGATAGGRCAACATAGAGCAAAAATAGAGGARTTGAGAGAACATC TACTRAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCGGACAAATGGACAGTCCAGCCTA TACAGTTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAATTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAACAA CTGTGTAARCTCCTCAGGGGAGCCAAAGCACTAACAGATATAGTACCACTGACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAAGGAAATTCTAAAAGAACC TGTACATGGAGTATATTATGACCCAACAAAAGACTTGGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATACCAAATTTATCAAGAGCCATTTAAAA ATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCATACTAATGATGTAAAACAATTAACAGATGTAGTGCAAAAAATAGCTGTAGAAAGCATA

Accession Number: MK061044 Sample ID : >CM-NWR-B075 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTAAAGAAATGGAAAAGGAAGGAAGAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGAYTTCTGGGAGGTCCARTTAGGAATACCTCATCCTGCGGGGTTAAARAAGAAAARA TCAGTRACAGTACTAGATGTGGGAGATGCATACTTTTCAGTTCCCTTAYATGAAGAYTTTAGAAAGTAYACTGCATTCACTATACCTAGTATAAATAATGAGACA CCAGGAATTAGATATCAGTACAATGTACTCCCGCAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAYAAA AAATCCAGAAATAGTGATTTACCAATACATGGATGATTTATATGTAGGATCTGACTTAGAAATAGGGCAGCATAGARCAAAAATAGARGAGTTAAGAAAACATC TMCTGGAATGGGGCTTYACCACACCAGATAAAAAGCATCAGAAAGAGCCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCC ATACAGCTGCCAAACAAGGACAGCTGGACTGTCAATGATATACAAAAGTTAGTKGGAAAACTAAAYTGGGCAAGTCAGATTTATCCAGGGATTAAGGTAAAGCA CTTATGTAGGCTCCTTAGGGGGGCCAAAGCACTAACAGACATAGTACCCCTGACAGCAGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTAAAAGAA CCAGTACATGGGGTATATTATGACCCGGCAAAAGACTTAGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAACCATTTAA AAATCTAATAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061045 Sample ID : >CM-NWR-B077 CCAATTAGCCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACARAAGAAAAAATAAAAGCACTAAC AGAAATTTGTATAGAGATGGAAAAAGAAGGAAAAATTTCAAAAATTGGGCCAGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTA AATGGAGGAAATTAGTAGATTTCAGAGAACTTAATAAAAGAACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCTGGTTTAAAAAAGAAGAAA TCAGTAACAGTACTGGATGTGGGGGATGCATATTTTTCAGTACCCTTAGATGAGGGGTTTAGGAAATACACTGCATTCACCATACCTAGTATTAACAATGAGACA CCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAAGCAGYATGACAAAAATCTTAGAGCCCTTTAGAGMAAA GAATCCAGAAATAGTTATTTACCAGTACATGGATGATTTGTATGTAGGRTCTGACTTAGAAATAGGACAGCATAGGGCAAAAATAGAGGAGTTAAGAGAACATC TATTGAAATGGGGATTTACTACACCAGACAAAAAACATCAGAAGGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTACAGGCTA TACAATTGCCAGACAAGAGCAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAACTAAATTGGGCAAGTCAAATTTATCCAGGGATTAGAGTAAAGCAC TTGTGTAAACTCCTTAGGGGAACCAAAGCACTAACAGACGTAGTGCCACTGACTCCAGARGCAGAGCTAGAAATGGCAGAGAACAGGGAAATTCTAAAAGAACC AGTACATGGGGTATATTATGACCCATCAAAAGATTTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTTAAAA ATCTCAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061046 Sample ID : >CM-NWR-B082 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGCAATGAAATGGAAAAAGARGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAGGAAAAAAGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTYTGGGAAGTTCAATTAGGAATACCTCATCCCGCRGGATTAAAAAARAAAAAA TCAGTAACAGTACTGGATGTAGGGGATGCATATTTTTCMGTCCCYCTAGATGAAGGATTCAGGAAGTACACTGCATTCMCCATACCCAGTACAAACAATGARTCA CCAGGAATTAGGTATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGTGTAGTATGACAAAAATYTTAGAGCCTTTTAAAAAGAA AAATCCAGAACTGATTATCTATTCATATATGGATGATCTGTATGTAGGATYTGACTTAGAAATAGAGCAGCATAGAGCAAAAATAGAACAGCTAAGAGARCATCT AKTGAAATGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGARCTCCATCCTGATAAATGGRCAGTACAGCCAAT AACASTGCCAGAAAAAGATGACTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAACTGGGCGAGCCAGATTTATCCAGGAATTAAAGTGAGACAAT TATGCAAATGCATTAGGGGAACCAAAGCACTGACAGAAGTAGTACCACTGACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAGAGAACC AGTACATGGAGTGTATTATGACCCATCAAAAGATTTAATAGCAGAAATACAGAAACAAGGACAAGATCAATGGACATATCAAATTTATCAAGAACAATATAAAA ATCTGAAAACAGGAAAGTATGCAAAAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTACAAAAAATAACCCAAGAATGTATA

Accession Number: MK061047 Sample ID : >CM-NWR-B088 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAGATTTGTACAGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTYAATAARAGAACTCAAGAYTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGAGATGCATATTTTTCAGTCCCTTTAGATAAGGAATTTAGAAAGTACACAGCATTCACTATACCTAGTGTAAATAATGAAACA CCAGGGATCAGGTATCAGTACAATGTGTTGCCACAGGGATGGAAAGGATCACCATCAATATTTCAGGCAAGCATGACAAAAATCTTAGAGCCCTTTAGGACAGA AAATCCAGAAATAGTGATCTACCAATATATGGATGATTTATATGTAGGATCAGACTTAGAGATAGGGCAACATAGAGCAAAAATAGAGGAGTTAAGAGGACATC TACTGAAGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGATAAATGGACAGTCCAGCCTA TACAGCTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTGGTGGGAAAACTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAGCAG CTATGTARACTCCTTAGGGGAACCAAAGCACTAACAGATRTAGTAACACTGACTGAGGAAGCAGAATTAGAACTGGCAGAGAACAGGGAAATTCTAAAAGAACC TGTACATGGAGTATATTATGATCCARCAAAAGACTTAGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTTAAAA ATCTAAAAACAGGGAAATATGCAAAAAAGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAAGTGTCTACAGAAAGCATA

Accession Number: MK061048 Sample ID : >CM-NWR-B091 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTGCAGAAATGGAAAAGGAAGGAARAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAARGAAAAAGGACAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAGCTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCTTTRGACAAAGATTTTAGAAAGTATACTGCATTCACCATACCTAGTATAAATAATGAAACAC CGGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATTTTTCAGGCTAGCATGACAAAAATCTTAGAGCCCTTTAGAACAAAA AATCCAGACATAGTGATCTACCAATACATGGATGATTTATACGTAGGATCAGACTTAGAGATAGGGCAGCATAGAGCAAARATAGAGGAGTTGAGAGAACATCT ACTGARGTGGGGGTTTACCACACCAGACAAAAAGCATCAGAAGGAACCTCCATTTCTTTGGATGGGATATGAAATCCATCCTGACAAATGGACAGTCCAGCCTAT ACAGCTGCCCGAAAAGGATAGCTGGACTGTCAATGATATACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAATAAGAAATC TGTGTAAACTCATTAGGGGAGCCAAAGCACTAACAGAAGTAGTAGCACTGACTGAGGAAGCAGAGTTAGAATTAGCAGAGAACAGGGARATTCTAAAAGAACC 142

TGTACATGGGGTATATTATGACCCAACAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTTAAAA ATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAAGTGGCTTTGGAATGCATA

Accession Number: MK061049 Sample ID : >CM-NWR-B092 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAGATTTGTGCAGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTGTTTGCCATAAAGAAAAAAGATAGTAMT AAATGGAGAAAATTAGTMGATTTTAGAGARCTCAATAAGAGAACTCAAGAMTTMTGGGARGTCCAATTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAA AATCAGTAACAGTAYTAGATGTGGGGGATGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGRAAGTACACTGCATTCACTATACCTAGTGTAAATAATGAGAC ACCAGGGGTTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATGATAAAAATCTTAGATCCCTTTAGARCAAA AAATCCAGAGATAGTGATCTACCAATATATGGATGATTTATATGTAGGATCAGATTTRGARATAGGGCAGCATAGAGCAAAAATAGAGGAGTTAAGAGAACATC TACTGAAGTGGGGATTTACCACACCAGACAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTA TAACACTGCCAGAAAAAGAGAACTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAGGTAAAGCAA TTATGTARACTCCTTAGGGGAGCTAAAGCATTAACAGARRTAGTACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAGATCCTCAAAGAACC AGTRCATGGAGTCTATTATGACCCAGCAAAAGACCTAATAGCAGAAATACAGAAACAAGGACAAGATCAATGGACATATCAAATTTATCAGGAGCCATTTAAAA ATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061050 Sample ID : >CM-NWR-B101 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAA AGAAATTTGTGCAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCWATATTTGCCATAARGAAAAAGGACAGTACT AAATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAGCTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAA ATCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCTTTRGACAAAGATTTTAGAAAGTATACTGCATTCACCATACCTAGTATAAATAATGAAACA CCGGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATTTTTCAGGCTAGCATGACAAAAATCTTAGAGCCCTTTAGAACAAAA AATCCAGACATAGTGATCTACCAATACATGGATGATTTATACGTAGGATCAGACTTAGAGATAGGGCAGCATAGATCAAAGATAGAGGAGTTGAGAGAACATCT ACTGARGTGGGGRTTTACCACACCAGACAAAAAGCATCAGAAGGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAGATGGACAGTCCAGCMTAT ASAGTTGCCAGAAAAGGACAGCTGGACTGTCAATGAKRTACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATGGAGGAATTAAAGTAAAGCAAC TGTGTAAACTCCTCAGGGGAGCTAAAGCACTAACAGATGTAGTGACACTGACTGAGGAAGCAGAATTAGAATTGGCAGAAAACAGAGAAATTCTAAGAGAACCT GTACATGGAGTATATTATGACCCAACAAAAGACTTAATAGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAA TCTAAAAACAGGAAAATATGCAAAAAGGAAGTTTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061051 Sample ID : >CM-NWR-B111 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTAAAGAAATGGAAAAGGAAGGAAGAATTTCAAAAATTGGGCCTGATAATCCATATTATACTCCAATATTTGCTATAAAGGAAAAAGACAGTACTA AGTGGAGAAAATTAGTAGACTTCAGAGAACTTAATAAGAGAACCCAAGATTTCTGGGAGGTTCAGTTAGGAATACCKCWTCCTGCAGGGCTAAAAAAGAAAAA ATCARTAACAGTACTGGATGTAGGTGATGCATATTTTTCAGTTCCTTTAGATAAAGAGTTTAGGAAGTACACTGCATTCACCATACCTAGYACAAACAATGAGAC ACCAGGGATTAGATATCAGTACAATGTGCTGCCACAGGGATGGAAAGGATCACCAGCRATATTCCAATGTAGYATGACAAAAATTTTGGATCCTTTTAGAAAACA AAATCCAGAACTGGTTATCTATCAATATATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAGCAAAAATAGAAAAATTAAGAGAACATCT ATTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGCTATGAACTCCATCCTGATAAATGGACAGTACARCCTAT AACACTGCCAGAAAAAGATAGCTGGACTGTAAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAARGTAAGGCAAT TATGTARACTCCTTAGGGGAGCTAAAGCATTAACAGAGGTAGTACCACTAACAGCAGAAGCAGAACTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAACCT GTACATGGGGTATATTATGACCCAGCAAAAGAATTAATAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAA TCTAAAAACAGGAAAATATGCAAAAAAGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAAGTAGTGCAAAAAGTGGCTGTAGAAAGCATA

Accession Number: MK061052 Sample ID : >CM-NWR-B117 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAC AGAAATTTGTAAAGAGATGGAAAAGGAAGGAAAAATATCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAAGAAAAAAGACAGCACT AAATGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAAAGAACTCAGGATTTCTGGGAAGTACAATTAGGAATACCACATCCAGCGGGYTTAAAAAAGAAAAA GTCAGTAACTGTACTGGATGTGGGGGATGCATACTTCTCAGTGCCTTTAGATGAAAGCTTTAGAAAATATACTGCATTCACAATCCCTAGTGTAAATAATGAGAC ACCAGGAATCAGATATCAGTATAATGTACTTCCACAGGGATGGAAGGGATCACCAGCAATATTTCAGGCAAGCATGACAAAAATCTTAGAGCCCTTTAGAACAA AAAATCCAGAGATGGTAATCTACCAATATATGGATGATTTATATGTAGGATCAGACTTAGAGATAGAGCAACATAGAACAAAAATAGAGGAGTTRAGAGCTCAT CTATTGAGCTGGGGGTTTACTACACCAGACAAAAAGCATCAAAAGGAACCTCCATTCCTCTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTCCAGCCT ATACAGCTGCCAGAAAAAGAAATCTGGACTGTCAATGACATACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTAAAGCA ACTGTGTAAACTCCTTAGGGGAGCCAAAGCAYTAACAGAGATAGTRRCACTGACTGAGGAAGCAGAATTAGAATTGGCAGAAAACAGAGAAATTCTAAAAGAA CCTGTACATGGAGTATATTATGACCCAGCAAAAGATCTAGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTTAA AAATCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

Accession Number: MK061053 Sample ID : >CM-NWR-B123 CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAAC AGACATTTGTACAGAGATGGAAAGGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTA AATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCAGGCTTAAAAAAGAAAAAA TCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAATATACTGCATTCACTATACCTAGTGTRAATAATGAGACAC CAGGAGTTAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTTCAGAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAACAAAA AACCCAGAGATAGTGATTTACCAATATATGGATGATTTATATGTAGGRTCTGACTTAGAGATAGAACAGCATAGAGCAAAAATAGAGGAGTTAAGAGAACATCT ATTGAGRTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGACAAATGGACAGTCCAGCCCAT ACAGCTGCCAGAAAAAGACAGCTGGACTGTCAATGATATACAAAAATTAGTGGGAAAACTAAACTGGGCAAGTCAAATTTATCCAGGAATTAAAGTAAAGCAGC TRTGTAAACTCCTCAGGGGAGCYAAAGCACTGACAGATRTAGTACCRCTGACTGAGGAGGCAGAATTAGAATTGGCAGAAAACAGGGARATTTTAAAAGAGCCT GTACATGGAGTCTATTATGACCCAGCAAAGGACTTAATAGCAGAAATCCMKAAACAAGGAKCTGRCCAATGGACATATCAAATCTATCAAGAGCCATTTAAAAA TCTAAAAACAGGAAAATATGCAAAAAGGAGGTCTGCCCACACTAATGATGTAAAACAATTAACAGAGGTAGTGCAAAAGGTGTCTACTGAAAGCATA

B: Sequences of HIV-1 protease and reverse transcriptase region

Accession Number: MK061054 Sample ID: >CM-NWR-B001 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAATAGGGGAACAGCTAATAGAAGCCCTATTAGATACAGGRGCAGATGATACAGTATTGGAAGA CATARATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTTATAGAAATTTGTGGGAAAA GGGCTATAGGTACAGTGTTAGTAGGCCCTACACCTGTCAACATAATTGGGCGAAATATGTTRACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCAGATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACWATACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTA GATGTRGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTRTAAATAATGAAACACCGGGGATTAGRTATC AGTACAATGTGCTGCCACAAGGATGGAAAGGGTCACCAGCAATATTTCAGGCTAGCTTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAGGTGRTTAT TTACCAATATATGGATGATCTATATGTAGGATCTGACTTGGAGATACGGCAGCACAGAGAAAAAATACAGGAATTTAGAGATCATTTACTTARATGGGGGTTTAC CACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCATCCTGACAAATGGACAGTCCARCCTATACAGCTACCAGAAAAAGA CAGTTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATKCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAGAGG AGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATACTTAAAGAACCAGTACATGGGGTATATTACG ACCCAGCAAAAGAATTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAATAT GCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061055 Sample ID : >CM-NWR-B005 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAATAGAGGGACAGCTAATAGAAGCCCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGGAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATCAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAGCAATGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAGAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT 143

AGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTCCCCTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAAACACCAGGGATTAGATATC AGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTCCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGGACAGAAAATCCAGAAATGGTT ATTTACCAATATATGGATGATCTATATGTAGGATCTGATCTGGAGATACGGCAGCATAGAGAAAAAATACAGGAGTTTAGAGATCATCTATTTAGGTGGGGGTTT ACCACACCAGACAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAACTGCCAGAAAA AGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAGGCAATTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGAGATACTGGCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAAAAATTCTTAAAGAACCTGTACATGGGGTATATT ACGACCCAACAAAAGACTTTGTGGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTGTCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061056 Sample ID : >CM-NWR-B006 CCTCAAATCACTCTTTGGCAACGACCCTTAGTTACAGTAAGAGTAGGGGGACAGTTAATAGAAGCCCTWTTAGACACAGGGGCAGATGATACAGTATTAGAAAA CATAGATTTACCAGGCAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGACCAGATACTTATARAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGTCGGAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCTATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCCAAGGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAARGAAAAAAGATAGTACTAAATGGAGAAAATTAKT AGATTTTAGAGAACTYAATAAAAGGACTCAAGACTTCTGGGAAATACAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTAGGGGATGCATATTTTTCAGTTCCTTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCGGGGATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTTCAGGCTAGCATTACAAAGATCTTGGAGCCCTTTAGAGCAAAAAATCCAGARATGGTTAT TTACCAATATATGGATGATTTGTATGTAGGATCTGACTTGGAAATARGGCAACATAGAGAAAAAATARAAGAGTTTAGAMAWCATYTACTRAAATGGGGATTCA CCACACCAGACAAAAAACATCAGAARGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACTGCTGCCAGAAAAA GATAGTTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAACAACTGTGCAAACTCCTCAGG GGAGCCAAAGCACTTACAGAGATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACCTGTTCATGGAGTATATTA TGATCCATCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAAGTCTGCCCACACTGT

Accession Number: MK061057 Sample ID : >CM-NWR-B008 CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAARCCYTGTTAGATACAGGAGCAGATGACACAGTATTAGAAGA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTAGTGGAAAAA AGGCTATAGGGACAGTATTAGTAGGACCTACACCTATCAACATAATTGGRAGAAATATGTTGACCCAGATTGGATGYACTYTAAATTTTCCAATAAGTCCTATTG AAACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGYCCAAGGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGYAAYGA SATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGAYTTCTGGGAGGTCCARTTAGGAATACCTCATCCTGCGGGGTTAAARAAGAAAARATCAGTRACAGTACTA GATGTGGGAGATGCATACTTTTCAGTTCCCTTAYATGAAGAYTTTAGAAAGTAYACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATAT CAGTACAATGTACTCCCGCAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATTACAAAAATCTTGGAGCCCTTTAGAAYAAAAAATCCAGAAATGGT TATTTACCAATACATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGARCAAAAATACARGAGTTTAGAAAACATCTMCTTGAATGGGGCTT YACCACACCAGATAAAAAGCATCAGAAAGAGCCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCCATACAGCTGCCAAACA AGGACAGCTGGACTGTCAATGATATACAAAAGTTAGTAGGAAAACTTAAYTGGGCAAGTCAGATTTATCCAGGGATTAAGGTTAAGCACTTATGCAGGCTCCTCA GGGGGGCCAAAGCACTTACAGACATACTACCCCTTACAGCAGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGAGTCTAT TACGACCCATCAAAAGACTTTATGGCAGAAATACAAAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGGAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061058 Sample ID : >CM-NWR-B010 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAAAATAGAGGGACAGCTAGTAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAAA CATAAATTTACCAGGAAATTGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAARACAATATGATCAGATACTTATAGAAATTTGTGGGAAAA AGGCTATAGGTACAGTGYTAATAGGACCTACSCCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGCACTTTAAATTTTCCAATTAGTCCTATTGA GACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAARGTTAAACARTGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGACATTTGTGCAGAGA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGATCCAACTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAAAATCAGTAACAGTGCTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAGAACTTTAGAAAATATACTGCATTCACTATACCTAGTGTAAATAATGAGACACCAGGAATTAGATATCAG TACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCGATATTTCAGGCTAGCATTACAAAAATTTTGGAGCCTTTCAGAAYAAAAAATCCAGAGWTGGTTAT TTATCAATATATGGATGATTTATATGTGGGATCTGACTTGGAGATACGACAGCATAGAGCAAAAATACAGGAGTTTAGAGRACATTTACTRAAATGGGGATTTAC TACACCAGACCAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACGGTCCAGCCTATACAGCTGCCAGAAAARG ACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAAATTTATGCAGGAATTAAAGTTAAACAATTGTGCAGACTTCTCAGGG GAACYAAAGCACTTACAGATATACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTCTATTAC GACCCAGCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061059 Sample ID : >CM-NWR-B011 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGCAAAAATAGGGGGACAGTTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAATATGATCAGATACTTATAGAAATTTGTGGRAAAA AGGCKATAGGTACAGTATTGGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATAAGTCCWATCG AAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAATTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCTTTAACAGAAATTTGTACAGA GATGGAAAAGGAAGGAAAAATTTCACGAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAGGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTRCTA GATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAGGTTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAACAATGAGACACCAGGGATTAGATATC AGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAGATGGTT ATTTACCAATACATGGATGATTTATATGTTGGATCTGACTTGGAAATACGACAGCATAGAGCAAAAATACAGGAGTTTAGAGACCACCTGTTTAAATGGGGATTT ACCACACCAGACAAAAAACATCAGAAGGAACCYCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAACTGCCAGAAAA GGCCAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTCAAGCAATTGTGCAAACTCCTCA GGGGAGCCAAAGCACTTACAGATGTACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAGGAACCTGTACATGGAGTTTAT TACGACCCAACAAAAGACCTTATGGCAGAAATACAGAAACAAGGACAYGACCAGTGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAA AATATGCAAAAAGGAAGTCTGCYCACACTGT

Accession Number: MK061060 Sample ID : >CM-NWR-B013 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAARAATAGGGGAACAGCTAATAGARGCYCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGGAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAAATACATATAGAAATTTGKGGAAAAA AGGCTATAGGTACAGTRTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAACAGAGATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCYATAAAAAAGAAAGATAGTACTAAATGGAGAAARTTAGT AGATTTTAGAGAACTCAACAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTRGGGGATGCATATTTCTCAGTTCCCTTAGATAAARAMTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAAACACCGGGGATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTYAGAAYAAAAAATCCAGAGATRGTT ATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGAGAAAAAATACAGGAGTTTAGAGACCATCTACTTAAGTGGGGATTT ACTACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACTGTCCAGCCTATACARCTGCCARACAAA GACAGCTGGACTGTCAATGATATACAGAAAYTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTTAGACAGCTGTGCAAACTCMTCAG GGGAGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAATCTATT ACGATCCAACAAAAGACTTTATGGCAGAAATACAGAAACAGGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAAGTCGGCCCATACTGT

Accession Number: MK061061 Sample ID : >CM-NWR-B014 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAATAGGGGAACAGCTAATAGARGCYCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGGAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAAATACATATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTRTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAACAGAGATTTGTACAGAA 144

ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCYATAAAAAAGAAAGATAGTACTAAATGGAGAAAGTTAGT AGATTTTAGAGAACTCAACAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTRGGGGATGCATATTTCTCAGTTCCCTTAGATAAARAMTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAAACACCGGGGATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTYAGARYAAAMAATCCAGAGATRGTT ATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGAGAAAAAATACAGGAGTTTAGAGACCATCTACTTAAGTGGGGATTT ACTACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACTGTCCAGCCTATACARCTGCCARACAAA GACAGCTGGACTGTCAATGATATACAGAAAYTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTTAGACAGCTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAATCTATT ACGATCCAACAAAAGACTTTATGGCAGAAATACAGAAACAGGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAAGTCTGCCCACACTGT

Accession Number: MK061062 Sample ID : >CM-NWR-B015 CCTCAAATCACTCTTTGGCAGCGACCCTTAGTCACAGTAAGAATAGAGGGACAGCTAATAGARGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGGAAATGGAGACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGRAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACMCCTGTCAATATAATTGGAMGAAATATGTTGACTCAGATTGGYTGYACTTTAAATTTTCCAATTAGTCCTATTG AAACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGTCCAAAAGTTAGACAATGGCCATTGACAGAAGAAAAAATAAARGCAYTAACAGAAATTTGTACAGA AATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAAYACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTA GTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCTCAGGATTAAAAAAGAAAAAATCAGTAACAGTACT AGATGTAGGGGATGCATATTTTTCAGTTCCTTTAGATGAGAACTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAAACACCAGGGATTAGRTAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGTT ATTTATCAATATATGGATGATTTATATGTAGGATCTGATTTGGAGATACGRCAGCATAGAGAAAAAATACAGGAACTTAGAGACCACCTRCTTAAATGGGGATTC ACCACACCAGATAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAA AGACAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCARATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGAGATACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATATT ACGACCCAACAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061063 Sample ID : >CM-NWR-B016 CCTCAAATCACTCTTTGGCARCGACCCTTAGTCACAGTAARAATAGAGGGACAGCTAATAGARGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGRAAATGGAGACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGRAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACMCCTGTCAATATAATTGGACGAAATATGTTGACTCAGATTGGYTGYACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGTCCAAAAGTTARACAATGGCCATTGACAGAAGAAAAAATAAARGCATTAACAGAAATTTGTACAGAAA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAAYACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCTCAGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGA TGTAGGGGATGCATATTTTTCAGTTCCTTTAGATGAGRACTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAAACACCAGGGATTAGRTATCAG TACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGARATGGTTATT TATCAATATATGGATGATTTATATGTAGGATCTGATTTGGAGATACGGCAGCATAGAGAAAAAATACAGGAAYTTAGAGACCACCTACTTAAATGGGGATTYACC ACACCAGACAAAAAGCATCARAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAAGA CAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAAATTTATGCAGGAATYAAAGTTAARCAACTGTGCAAACTCCTCAGGG GAGCCAAAGCACTTACAGAKATACTRACAYTTACTGCGGAAGCAGAAATGGAATTGGCAGARAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATATTAC GACCCAGCAAAAGATTTTATGGCAGAAATACAGAAACAAGGGCAAGGCCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061064 Sample ID : >CM-NWR-B017 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAAGCTCTGTTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAATAATCTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAA AAAAGGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAATATAATTGGACGAAATATGTTGACTCAGATTGGYTGTACTTTAAATTTTCCAATTAGTCCTAT TGAAACTGTRCCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAAAAGAGATTTGTACA GAGATGGAAAATGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAGTT AGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCTCAGGATTAAAAAAGAAGAAATCAGTAACAGTAC TAGATGTGGGGGATGCATATTTTTCAGTTCCTTTATATGAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGGATTAGATA TCAGTACAATGTGCTTCCACAGGGATGGAAGGGATCACCAKCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAGCACAAAATCCAGAAATGGT TATATACCAATACATGGATGATTTATATGTGGGATCTGACTTGGAGATACGGCAACATAGAGCAAAAATACAGGAATTTAGAGATCATYTATTTAAGTGGGGATT TRCCACWCCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTTCATCCTGACAAATGGACAGTACAGCCTATACAGTTGCCAGACA AGGAAATCTGGACTGTCAATGATATACAAAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAAATCTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTC AGGGGAGCCAAAGCACTTACAGATATACTACCACTTACTACGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAGATTTTTAAAGAACCTGTACATGGAGTATA TTACGACCCAACGAAAGACTTTATGGCAGAGATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAA AGTATGCAAAAAGGAGATCTGCCCACACTGT

Accession Number: MK061065 Sample ID : >CM-NWR-B018 CCTCAAATCACTCTTTGGCAACGACCCTTAGTTACAGTAAGAATAGGGGGACAGCTAATAGAAGCTYTATTAGATACAGGAGCAGATGATACAGTATTAGARGA AATAAGTTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGRCAATATGATCAGATACTTATGGAAATYTGTGGAAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGRCGAAATATGTTGACTCAGATTGGWTGTACTTTAAATTTTCCAATTAGTCCTATAGA RACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAARGTTAAACAATGGCCATTGACARAAGAAAAAATAAARGCATTAACAGAAATTTGTACAGAAA TGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCMATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTTAGGGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAAYTAGGAATACCTCATCCCGCAGGATTAAAAAAGAACAAATCAGTAACAGTACTAG ATGTRGGGGATGCATATTTTTCAGTGCCCTTAGATGAAAACTTTAGAAAATATACTGCATTCACTATACCTAGYATGAATAATGAGACACCAGGAATTAGATATC AATACAATGTGCTTCCACAGGGATGGAAAGGCTCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGTTA TTTACCAATAYRTGGATGATTTATATGTAGGATCTGACTTGGAAATAGGGAAACATAGAGCAAAAATACAGGAATTTAGAGAACATCTACTTAGGTGGGGATTTA CCACACCAGACAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGYTGCCAGATAAA GACAGCTGGACTGTCAATGACATACAAAAATTAGTAGGRAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATCAAAGTTAAGCAACTGTGCAAACTCCTCAG GGGAGCCAAATCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAGATTCTTAAAGAACCTGTACATGGAGTCTATT ACGAYCCAGCAAAAGACCTTATGGCAGAAATACAGAAACAAGGACMMGACCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061066 Sample ID : >CM-NWR-B019 CCTCAAATCACTCTTTGGCAACGACCAGTAGTCACAGTAAGAATAGAGGGACAGTYAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTAGTAGGAGA AATRAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTCAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAG AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTRACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAGTAGAAATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGCACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTTTGGGAGGTCCAACTAGGAATACCTCATCCYGCAGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAACAATGAAACACCGGGGATTAGGTATC AGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGTT ATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGGCAGCATAGAGAAAAAATACAGGAGTTTAGAGACCATCTACTTARGTGGGGATTT ACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAA AGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAGCTTAATTGGGCAAGCCAGATTTATGCAGGAATTAGAGTTAARGAAYTATGCAAACTCCTCA GGGGAGCCAAAGCACTTACAGAGATACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACCTGTACRKGGAGTATAT TACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAGCAAGGGCAAGATCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061067 Sample ID : >CM-NWR-B020 CCTCAAATCACTCTTTGGCAACGACCMTTAGTCRCAGTAAGAATAGGRGGACAGCTAATAGAAGCCSTATTAGAYACAGGAGCAGATGATACAGTAGTAGAAGA AAWAAATTTACCAGGRAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTMAGACARTATGATCAGATACTTATAGAAATTTGTGRAAAA AAGGCCATAGGTACAGTRTTAGTAGGACCTACCCCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTRTTG 145

AAACTGTRCCAGTAAAATTGAAGCCAGGAATGGATGGTCCAARGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTARCAGAWATTTGTTYAGA AATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGYACTAAATGGAGAAAATTA GTAGATTTCAGAGAACTCAATAARAGAACTCAAGACTTYTGGGAGGTCCAAYTAGGAATACCTCATCCCGCRGGATTAAAAAAGAAAAAATCAGTAACAGTACT AGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTACACTGCATTCACTATACCTAGTATAAAYAATGAAACACCRGGGATTAGRTA TCAGTACAATGTGCTKCCACARGGATGGAAAGGATCACCARCAATATTTCAGGCWAGCATTACAAAAATCTTGGAGCCCTTTAGARCAAAAAATCCAGAGATGG TTATCTACCAATAYATGGATGATTTATATGTAGGATCWGACTTGGAGATACGGCAGCATAGAGMAAAAATASARGARTTRAGAGRMCATCTACTTARGTGGGGA TTYACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACAGTCCAACCTATACAGYTGCCAGAA AARGAYAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAGCTTAATTGGGCAAGTCAGATWTATCCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCT CAGGGGAGCCAAAGCACTTACAGAGATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTAT ATTACGACCCAGCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGA AAATATGCAAAAAAGAAGTCTGCCCACACTGT

Accession Number: MK061068 Sample ID : >CM-NWR-B021 CCTCAAATCACTCTTTGGCAGCGACCCTTAGTTACAGTAAGAATAGAGGGACAGCTAATAGAAGCCCTACTAGACACAGGGGCAGATGATACAGTGTTAGAAGA AATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGKGGGAAAA GGGCTGTAGGTACAGTATTAGTAGGACCTACMCCTGTCAACATAATTGGGCGAAACATGTTGACCCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTGCCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGATTAAACAATGGCCATTGACAGARGAGAAAATAAAAGCATTAACAGAAATTTGTAATGACA TGGAGAAAGAAGGAAAAATTTCAAAGATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTTAATAAAAGAACTCAAGACTTTTGGGAAGTCCAGTTAGGAATACCACATCCTGCTGGATTGAAAAAGAAGAAATCAGTAACAGTATTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAAACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGGGTGAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAAGAATACTGGAGCCCTTTAGAAAAGAAAATCCAGAAATGGTTA TCTACCAATACATGGATGATTTATATGTGGGTTCTGATTTGGAAATAGGGCAACATAGAGCAAAAATACAGGAGTTTAGACAGCATCTATTTAAATGGGGATTTA CCACACCAGATAAAAAGCATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTGCAGACTATACAACTGCCAGAAAAG GAGAGCTGGACTGTCAATGATATACAAAAATTGGTAGGAAAACTTAATTGGGCCAGTCAGATTTATTCAGGGATTAAAGTTAGGCAATTATGCAAACTCCTCAGG GGGGCAAAAGCACTTACAGAAATACTACCATTTACTGCAGAGGCAGAAATGGAACTGGCAGAAAACAGGGAGATTCTTAAAGAGCCAGTGCATGGGGTATACTA CGACCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAACCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAGGTCTGCTCATACTGT

Accession Number: MK061069 Sample ID : >CM-NWR-B022 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGCAAKAATAGGGGGACAGCCAATAGAGGYCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAGTCTACCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGGGGTTTTATTAAAGTAAGACAGTATGATCAGATACCCATAGAAATTTGTGGGAAAC AAGCCATAGGCACGGTATTAATAGGACCTACACCTGTCAACATAATTGGACGAAATATATTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA CACCGTGCCGGTAAAAYTGAAACCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGACATTTGTTTAGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCGGGACTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGATTTTAGAAAGTACACTGCATTCACCATACCTAGTGTAAACAATGCAACACCAGGAATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAMAAATCCTGGAGCCCTTTAGARCAAAAAATCCAGAGATGGTT ATCTACCAATATATGGATGATTTATATGTAGGATCAGATTTGGAGATAGCGCAGCATAGAGCAAAAATACAGGAGTTTAGAGCACATCTACTTAGATGGGGGTTT ACCACACCAGAYAAAAAACATCAGAAGGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGACAGTACAAYTGCCAGAAAA AGACAGCTGGACTGTCAATGACATACAGAAATTAGTAGGAAAGCTTAATTGGGCATCTCAGATTTATGCAGGAATTAAAGTTAAACAACTGTGCAAACTCCTCAG GGGAGCCAAGGCACTTACAGAGGTACTACCCTTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGGGTATATT ACGACCCAACAAAAGACTTTGTGGCAGAAATACAAAAACAAGGACAAGGCCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTAT

Accession Number: MK061070 Sample ID : >CM-NWR-B023 CCTCAAATCACTCTTTGGCAACGACCAATAGTTACAGTAAAAATAGGGGGACAGCCAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACYCATAGAAATTTATGGGAAAA RGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA GACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTARACAATGGCCATTAACAGCAGAAAAAATAAAGGCATTAACAGACATTTGTGCAGACA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTTAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTACAAATAATGAGACACCAGGRRTTAGATATCAG TACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAAAAGAAAATCCAGAGATGRTTATT TACCAGTATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGGCAGCATAGAGCAAAAATACAAGAATTTAGRGAACATCTACTTAAATGGGGATTTACC ACACCAGACAAGAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAARTGGACAGTCCAGCCTATACAGCTACCAGAAAAGGA CAGCTGGACTGTCAATGATATACARAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATYAAAGTTAGGCAACTGTGCAAACTCMTCAGGG GAACCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTCTATTAC GACCCAGCAAAAGACTTTATGGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTGTCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061071 Sample ID : >CM-NWR-B024 CCTCAAATCACTCTTTGGCAACGACCCGTAGTCACAGTAAAAATAGAGGGACAGCCAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAGATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATAMTTATAGAAATWTGKGGAAAA AGGGCTATAGGTACAGTGTTAGTAGGACCCACMCCTGTTAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTCTAAATTTTCCAATTAGTCCTATTG AAACTGTACCGGTAAAATTAAAGCCRGGAATGGATGGCCCAAAGGTAAAACAGTGGCCATTGACARAARAAAAAATAAAAGCATTAACAGACATTTGTACAGA GATGGAAAAAGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAAAATCAGTAACAGTTTTA GATGTAGGGGATGCATATTTTTCAGTTCCCCTAGATGAAAACTTTAGAAAATATACTGCATTCACTATACCTAGTGTAAATAATGAAACACCAGGGATTAGATAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAGAAATCCAGAAATGGTT ATCTATCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGGCACCATAGAGCAAAAATACAAGAGTTTAGAGAACATCTATTTAAATGGGGATTT ACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCCATACAGCTGCCAGACAA AGACAGCTGGACTGTCAATGATATACAGAAATTGGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAGGCAACTATGCAGGCTCCTCA GGGGAGCCAAAAAACTTACAGATATACTACCAATTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAGCCTGTACAKGGGGTATAT TACGACCCAGCAAAAGAATTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAA AATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061072 Sample ID : >CM-NWR-B026 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAATAGGGGAACAGCTAATAGAAGCCCTATTAGATACAGGRGCAGATGATACAGTATTGGAAGA CATARATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTTATAGAAATTTGTGGGAAAA GGGCTATAGGTACAGTGTTAGTAGGCCCTACACCTGTCAACATAATTGGGCGAAATATGTTRACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCAGATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACWATACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTA GATGTRGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTRTAAATAATGAAACACCGGGGATTAGRTATC AGTACAATGTGCTGCCACAAGGATGGAAAGGGTCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAGGTGRTT ATTTACCAATATATGGATGATCTATATGTAGGATCTGACTTGGAGATACGGCAGCACAGAGAAAAAATACAGGAACTTAGAGATCATTTACTTARATGGGGGTTT ACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACAGTYCARCCTATACAGCTACCAGAAAA AGACAGTTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATKCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAG AGGAGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATACTTAAAGAACCAGTACATGGGGTATATT ACGACCCAACAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061073 Sample ID : >CM-NWR-B028 CCTCAAATCACTCTTTGGCARCGACCCTTAGTCACAGTAAARATAGGGGGACAGCTAATAGAAGCTCTATTAGAYACAGGAGCAGATGATACAGTATTACAAGA AATAAMTATATCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGGAAAG 146

AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCTTTAACAGAAATTTGTACAGACA TGGAAAAGGAAGGGAAAATTTCAAGRATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAGAAAGATRGTACTAAATGGAGAAAATTAGTA GATTTTAGGGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCACCCCGCGGGGTTAAAGAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGATTTTAGAAAGTATACTGCMTTCACTATACCTAGTACMAATAATGAARCMCCRGGGAYTAGATATCA ATACAATGTGCTTCCACARGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAACAAGCAAYCCAGACATGGTTAT TTACCAGTATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGGCAGCATAGAGARAAAATACAGGAGTTTAGAGACCACCTACTTAGATGGGGATTCAC CACACCAGACAAAAAACATCAGAAAGAACCYCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCARCCTATACAAYTGCCAGAAAAAG ACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAGG GGAGCCAAAGCACTTACAGAAGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGRGAAATTCTTAAGGAACCGGTACATGGAGTCTATTA CGACCCAGCAAAAGACCTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAACCTTAAAACAGGGAAA TATGCAAAAAGGAGGACTGCCCACACTGT

Accession Number: MK061074 Sample ID : >CM-NWR-B030 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAGTAGGAGGRCAGCTMATAGAAGCCCTATTAGATACAGGAGCAGATGAYACAGTATTAGAAGA CATAAATTTACCAGGGAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACCTATAGAAATTTGTGGRAAAG AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAAYATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAARCCAGGAATGGATGGCCCAAARGTTAAACAATGGCCATTGACMGAAGAAAAAATWAARGCATTAACAGAAATTTGTAAAGAA ATGGAAGAAGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCYATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAAGAATTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATRAAGATTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAAACACCCGGRATTAGATATCA GTACAATGTGCTWCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGARCCTTTTAGAAAAAACAATCCAGAGATGGTTA TTTACCAATACATGGATGATTTATATGTAGGATCTGAYTTGGAGATACGRCAGCATAGAGAAAAAATACAGGAGTTTAGAGATCATCTACTTARATGGGGATTTA CCACACCAGACAAAAAACATCAGAAAGARCCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAR GACAGCTGGACTGTCAATGATATACARAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATYAAAGTTAAGCAACTATGCAAACTCCTCAG RGGAGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACCTGTACATGGAGTATATT ACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGGAA ATATGCAAAAAAGAGGTCTGCCCATACTGT

Accession Number: MK061075 Sample ID : >CM-NWR-B031 CCTCAAATCACTCTTTGGCAGCGACCCTTAGTCACAGTAAGAATAGGGGAACAGCTAATAGAAGCTCTATTAGACACAGGAGCAGATGATACAGTATTAGTAGA AATGAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTTATAGAAATTTGTGGAAAAA GGGCCATAGGTACGGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATAAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAGATAAAAGCATTAACTGAAATTTGTACAGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCAGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGGGAACTTAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTAGGGGATGCATATTTTTCAGTGCCCTTAGATRAAGACTTTAGAAAATACACTGCATTCACAATACCTAGTGTAAATAATGAGACACCAGGGGTTAGATATC AGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCGAGCATTACAAAAATCTTGGAGCCCTTTAGAACAGAAAATCCAAATATGGTTA TCTACCAATATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGACAGCACAGAGCAAAAATACAGGAGTTTAGAAGCCATCTATTTARGTGGGGATTTA CCACACCAGACAAAAAACATCAGAAAGAGCCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGACTGTACAGCTGCCAGAAAAA GACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAGATGGAATTGGCAGAGAACAGGGAAATTTTTAAAGAACCTGTACATGGAGTATATT ACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061076 Sample ID : >CM-NWR-B032 CCTCAAATCACTCTTTGGCAACGACCCTTAATCACAGTAAGAATAGAGGGACAGCAAATAGAAGCCCTAYTAGACACAGGRGCAGATGATACAGTATTAGAARA CATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATMCTTATAGAAATTTGTGGAAAAA GGGCCATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAACATGTTGACTCARATTGGTTGTACTTTAAATTTTCCAATCAGTTCTATTGA AACCGTGCCAGTAAAATTGAAACCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTGCAGAC ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGACCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAMATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAGAAAACTCAAGATTTCGGGGAGGTCCAATTAGGAATACCTCATCCTGCAGGATTACAGAAGAAAAAATCAGTAACAGTAYTA GATGKGGGGGATGCATACTTTTCAGTTCCCTTAGATAAAGAATTTAGAAAGTACACTGCATTCACTATACCCAGTATAAATAATGCAACACCAGGGATTAGATAT CAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGT TATCTACCAATATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGACAGCATAGAGCAAAAATACAGGAATTTAGAAATCATCTACTTARGTGGGGATT TACCACACCAGATAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCACCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAA AAGAAAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAGACTCCTC AGGGGAGCCAAAGCACTTACAGATATACTACCCTTTACTGCGGAAGCAGAAATGGAATTGGCRGAAAACAGGGAAATTCTTAAAGACCCTGTACATGGRGTATA TTACGATCCAGCAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAA AATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061077 Sample ID : >CM-NWR-B033 CCTCAAATCACTCTTTGGCAACGMCCCTTAGTTACAGTAAGRATAGAGGGACAGCTGATAGAAGCCCTATTAGACACAGGGGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAATAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTCCCAATTAGYCCTATTGA AACTGTMCCAGTAAAACTAAAGCCRGGAAKGGAKGGCCCAAAAKTTAAACAAKGGCCWTTGACARAARAAAAAATAAAGGCNTTAARAGAYATTTGTACAGA GATGGAGAAGGAAGGAAAAATTWCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAARTTA GTAGATTTCAGAGAACTCAATAAAAGAACTCAAGATTTCTGGGAGATCCARTTAGGAATACCTCATCCCGCAGGATTAAAGAAGAAAAAATCAGTRACAGTACT AGATGTAGGGGATGCATATTTTTCAGTTCCCTTAGATGAAAGCTTTARAAAATACACTGCATTTACTATACCTAGTATMAATAATGAGACACCAGGAATTAGATA TCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAACCCTACAGAGCAAAAAATCCAGAGATGG TTATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACRACAGCATAGGGCAAAAATACAGGAGTTTAGAGAACATCTCTTTACATGGGGAT TTACCACACCAGACAAGAAACAYCAAAARGAGCCTCCMTTTCTTTGGATGGGATATGAACTCCATCCAGACAAATGGACAGTCCAGCCCATACAGCTGCCAGAA AAAGAARACTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTMAAGTTAAGCAACTGTGCAAACTCCT CAGGGGAGCCAAAGCACTTACAGATATACTACCWCTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCYGTCCATGGAGTC TACTACGACCCAGCAAAAGACCTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAACCATTCAAAAATCTTAAAACAGG AAAATATGCAAAAAAGAGGTCTGCTCATACTGT

Accession Number: MK061078 Sample ID : >CM-NWR-B036 CCTCAAATCACTCTTTGGCAACGACCTCTTGTCACAGTAAAAATAGAAGGACAGTTAAGAGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAGA CATAGATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAGGTAAGACAATATGATCAAATACTCATAGAAATTTGTGGAAAAA GGGCTGTAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGCTGACTCAGATTGGCTGTACCTTAAATTTCCCAATAAGTCCTATTGA AACTGTGCCAGTAGCATTAAAGCCAGGAATGGATGGACCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCTTTAACAGAAATTTGTAAAGAG ATGGAAAAAGAAGGAAAAATTTCAAAAATTGGACCTGAAAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAAGACAGCACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAGGACTTCTGGGAAGTTCAATTAGGAATACCACACCCAGCAGGCTTAAAAAAGAAAAAATCAGTAACAGTGCTGG ATGTGGGGGATGCATACTTTTCAGTCCCTCTATATGAGGGCTTTAGAAAGTATACTGCATTCACCATACCAAGTACAAATAATGAGACACCAGGAATCAGGTATC AGTATAATGTGCTTCCACAGGGATGGAAAGGGTCACCGGCAATATTCCAGTGTAGCATTACAAAAATATTGGAACCCTTTAGAGCAAAGAATCCAGACATGGTTA TCTATCAATACATGGATGACTTGTATGTAGGATCTGATCTGGAAATACAGCAGCATAGAACAAAAATACAGGAGTTTAGAGTTCATCTATTTAGCTGGGGGTTTA CTACACCAGACAAAAAGCATCAAAAGGAACCTCCATTTCTCTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAACTGCCAGACAAA GCCAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAGCTTAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTTAAGCAGCTATGCAAACTACTCAG GGGAACCAAAGCACTTACAGATGTACTGCCATTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACCGGGAAATTCTTAAAGACCCGGTGCATGGAGTCTATT ACGACCCATCAAAAGATTTTATGGCAGAAATACAGAAACAAGGGCAGGACCAATGGACATATCAGATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAA TATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061079 Sample ID : >CM-NWR-B039 147

CCTCAAATCACTCTTTGGCAACGACCCTTAGTTACAGTAAGAGTAGGGGGACAGTTAATAGAAGCCCTWTTAGACACAGGGGCAGATGATACAGTATTAGAAAA CATAGATTTACCAGGCAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGACCAGATACTTATARAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGTCGGAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCTATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCCAAGGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAARGAAAAAAGATAGTACTAAATGGAGAAAATTAKT AGATTTTAGAGAACTYAATAAAAGGACTCAAGACTTCTGGGAAATACAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTAGGGGATGCATATTTTTCAGTTCCTTTAGATAAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCGGGGATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTTCAGGCTAGCATTACAAAGATCTTGGAGCCCTTTAGAGCAAAAAATCCAGARATGGTTAT TTACCAATATATGGATGATTTGTATGTAGGATCTGACTTGGAAATARGGCAACATAGAGAAAAAATARAAGAGTTTAGAMAWCATYTACTTAAATGGGGATTCA CCACACCAGACAAAAAACATCAGAARGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACTGCTGCCAGAAAAA GACAGTTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAACAACTGTGCAAACTCCTCAGG GGAGCCAAAGCACTTACAGAGATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACCTGTTCATGGAGTATATTA CGATCCATCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAAGTCTGCCCACACTGT

Accession Number: MK061080 Sample ID : >CM-NWR-B041 CCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAATAAAAATAGGAGGACAGCCAAGAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGA CATAGATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTDTCAAAGTAAGACAATATGATCAAATACTTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATAAGTCCTATTGA AACTGTACCAGTAACATTAAAGCCAGGAATGGATGGGCCAAAGATTAAACAATGGCCATTGACAAAAGAAAAAATAGAAGCATTAACAGAAATTTGTAAAGAA ATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAAGAAAAAAGACAGCACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACCCAGGACTTCTGGGAAGTTCAATTAGGGATACCGCATCCAGCGGGTTTAAAAAAGAAAAAGTCAGTAACAGTATTGG ATGTGGGGGATGCATATTTTTCAGTTCCTTTATATGAAGATTTTAGAAAGTATACTGCATTCACCATACCTAGTACAAACAATGAGACACCAGGAATCAGGTACTG CTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAGTGTAGCATTACAAAAATCTTGGATCCCTTTAGAGCAAAAAATCCAGAAATGGTTAT CTATCAATACATGGATGACTTGTATGTAGGATCTGATTTGGAAATACGACAGCACAGAGCAAAAATACAGGAGTTTAGAGCTCATCTATTTAGCTGGGGGTTTAC TACACCAGACAAAAAGCATCAAAAAGAACCTCCATTTCTCTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAAG ACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGGATCAAAGTTAAGCAGTTGTGCAAACTACTCAGG GGAGCCAAGGCACTTACAGAAGTACTACCATTTACTGCAGAAGCAGAAATGGAACTGGCAGAGAACAGGGAGATTCTTAAAGAACCTGTGCATGGAGTCTATTA CGACCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGRCCAATGGACATATCAAATCTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAGT ATGCAAAAAGGAGATCTGCCCACACTGT

Accession Number: MK061081 Sample ID : >CM-NWR-B043 CCTCAAATCACTCTTTGGCAGCGACCCTTAGTTACAGTAAAAGTAGAGGGACAGCTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAAA CATAAATTTATCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGGTTTATCAAAGTAAGACAATATGAGCAGATACCTATAGAAATTTGTGGRAAAA GGGCTGTAGGTACAGTGCTAATAGGACCTACSCCTGTCAACATAATTGGACGAAATATGTTGACYCAGATTGGTTGTACTTTAAATTTTCCAATTAGCCCTATTGA AACTGTACCGGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCACTGACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAG ATGGAAAAGGAGGGAAAAATTGMAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACGGTACTAAATGGAGAAAACTAG TAGATTTCAGAGAACTYAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGTATACCTCATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTA GATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTTAGRAAGTATACTGCATTCACCATACCTAGTGTAAATAATGAGACACCAGGRATAAGATAT CAGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATTTTGGAGCCCTATAGAAGAAAAAATCCAGATATGGT TATCTACCAATATATGGATGATTTATATGTAGGATCTGAYTTGGAGATACGGCAACACAGGGCAAAAATACAGGAGTTRAGAGCACATCTACTTGAATGGGGATT TACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTATGTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAGA AAGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAGGCAATTGTGCAAACTCCTCA GGGGGGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGACCCTKTACATGGAGTATAC TACGACCCAACAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAGGAGCCATACAAAAATCTTAAAACAGGAA AATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061082 Sample ID : >CM-NWR-B045 CCTCAAATCACTCTTTGGCAACGACCCATTGTCACAGTAAGAATAGGAGGACAGCTAAAAGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAGA CATAGATTTGCCAGGAAAATGGAGACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAGGTAAGACAATATGATCAAATACCTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTATTAATAGGACCTACMCCTGTCAACATAATTGGACGAAATATGTTGACTCAAATTGGGTGCACTTTAAATTTTCCAATTAGCCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACARAARAAAAAATAAAAGCACTAACAGAAATTTGTCTAGAGA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCAGAAAATCCATACAAKACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGGAAATTAGT AGATTTCAGAGAACTTAATAAAAGAACTCAAGACTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCTGGTTTAAAAAAGAAGAAATCAGTAACAGTATTGG ATGTGGGGGATGCATATTTTTCAGTACCCTTAGATGAGGGGTTTAGGAAATACACTGCATTCACCATACCTAGTATTAACAATGAGACACCAGGAATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAAGCAGYATTACAAAAATCTTGGAGCCCTTTAGATCAAAGAATCCAGAAATGGTT ATTTACCAGTACATGGATGATTTGTATGTAGGRTCTGACTTGGAAATACGACAGCATAGGGCAAAAATACAGGAGTTTAGAGAACATCTATTTAAATGGGGATTT ACTACACCAGACAAAAAACATCAGAAGGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTACAGGCTATACAATTGCCAGACAA GAGCAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAAATTTATCCAGGGAATAAAGTTAAGCACTTGTGCAAACTCCTCAG GGGAACCAAAGCACTTACAGACGTACTGCCACTTACTGCAGAAGCAGAGATGGAAATGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGGGTATATT ACGACCCATCAAAAGATTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAA TATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061083 Sample ID : >CM-NWR-B051 CCTCAAATCACTCTTTGGCAACGACCAGTAGTCACMATAGAAATRGGGGGRCAACAAAGGGAGGCTCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGA TATAAATTTGCCAGGAAAATGGAAACCAARAATGATAGGGGGAATTGGAGGGTTTATCAAAGTAAGACAGTATGARCAAGTACCAATARAAATTTGTGGACAAA AGGCTATAGGTACAGTGCTAGTAGGGCCTACGCCTGTCAACATAATTGGAAGRAATYTGTTGACTCAAATTGGTTGYACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAGTTAAARCCAGGAATGGATGGGCCAAAGGTTAAACAATGGCCACTGACAGAAGAAAAAATAAAAGCATTAACAGAAATYTGTACAGAR ATGGAAAAGGAAGGAAAGATAACAAAAATTGGGCCAGAAAATCCATACAATACTCCAATATTTGCYATAAAGAAAAAGGACAGYACKAAATGGAGAAAATTAG TAGACTTCAGAGAACTTAATAAAAGAACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTG GATGTGGGGGATGCATATTTCTCMGTCCCCTTAGATAAAGAATTCAGGAAGTACACTGCATTCACCATACCTAGTRTCAACAATGAGACACCAGGAATTAGATAT CAGTACAATGTRCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAYATAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGARTTGGTT ATATACCAATACATGGATGATTTGTATGTAGGGTCTGACTTGGAAATACGGCAGCATAGGACAAAAATACAAGAKTTTAGRGAACATTTRTTTRSATGGGGATTT ACKACACCAGATAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGAYAAATGGACAGTACAGGCTATACAATTGCCAGACAA GGACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATTAGARTTAAGCACTTATGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGATGTACTGCCACTTACTACAGAAGCAGAGATGGAACTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGGGTATATT ACGACCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCACGAGCAATGGACATATCAAATCTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA GTATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061084 Sample ID : >CM-NWR-B052 CCTCAAATCACTCTTTGGCAACGACCAGTAGTCACMATAGAAATAGGGGGRCAACAAAGGGAGGCTCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGA TATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGGTTTATCAAAGTAAGACAGTATGARCAAGTACCAATARAAATTTGTGGACAAA ARGCTATAGGTACAGTGCTAGTAGGGCCTACGCCTGTCAACATAATTGGAAGAAATCTGTTGACTCAAATTGGTTGCACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAGTTAAARCCAGGAATGGATGGGCCAAAGGTTAAACAATGGCCACTGACAGAAGAAAAAATAAAAGCATTRACAGAAATYTGTACAGAR ATGGAAAAGGAAGGAAAGATAACAAAAATTGGRCCAGAAAATCCATACAATACTCCAATATTTGCYATAAAGAAAAAGGACAGYACKAAATGGAGAAAATTAG TAGACTTCAGAGAACTTAATAAAAGAACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCAGGKTTAAAAAAGAAAAAATCAGTAACAGTACTG GATGTGGGGGATGCATATTTCTCMGTCCCCTTAGATAAAGAATTCAGGAAGTACACTGCATTCACCATACCTAGTRTCAACAATGAGACACCAGGAATTAGATAT CAGTACAATGTRCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAYATAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAATTRGTT ATATACCAATACATGGATGATTTGTATGTAGGGTCTGACTTGGAAATACGGCAGCATAGGACAAAAATACAAGAGTTTAGAGAACATYTATTTRTATGGGGATTT ACCACACCAGACAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTACAGGCTATACAATTGCCAGACAA GGACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATTAGARTTARGCACTTATGCARACTCCTCAG GGGAGCCAAAGCACTTACAGATGTACTGCCACTTACTACAGAAGCAGARATGGAACTGGCAGAGAACAGGGAAATTCTTAAAAGACCAGTACATGGGGCATATT 148

ACGACCCAGCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAGGGGCAATGGACATATCAAATTTATCAAGAGACATACAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061085 Sample ID : >CM-NWR-B053 CCTCAAATCACTCTTTGGCAACGACCAGTAGTCACAGTAAAAATAGAGGGACAGCTAATAGAAGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAAA AATAGATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAARACAGTATGATCAGATACTTATAGAAATTTGTGGGAAGA AAGCCATAGGTACAGTATTAGTAGGACCTACCCCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTGCCAGTAAAATTGAAACCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAGATAAAGGCATTAACAGACATTTGTTTAGAGA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTACAATTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAAAAATCAGTAACAGTRCTAGA TGTGGGAGATGCATATTTTTCAGTCCCTTTAGATAAAGAATTTARAAAGTACACAGCATTCMCTATACCTAGTGTAAATAATGAAACACCAGGGATTAGGTATCA GTACAATGTGTTGCCACAGGGATGGAAAGGATCACCATCMATATTTCAGGCAAGCATTACAAAAATCTTGGAGCCCTTTAGGACAGAAAATCCAGAAATGGTTA TCTACCAATATATGGATGATTTATATGTWGGATCAGACTTGGAGATACGGCAACATAGAGCAAAAATACAGGAGTTTAGAGGACWTCTRCTTAAGTGGGGATTT ACCACACCARACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAA AGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTGATTGGGCAAGTCAGATTTTTGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAG GGGAGCCAAAGCCCTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGAGTATATT ACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061086 Sample ID : >CM-NWR-B054 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAGTAGGAGGRCAGCTMATAGAAGCCCTATTAGATACAGGAGCAGATGAYACAGTATTAGAAGA CATAAATTTACCAGGGAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACCTATAGAAATTTGTGGRAAAG AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAAYATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAARCCAGGAATGGATGGCCCAAARGTTAAACAATGGCCATTGACMGAAGAAAAAATWAARGCATTAACAGAAATTTGTAAAGAA ATGGAAGAAGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCYATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAAGAATTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATRAAGATTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAAACACCCGGRATTAGATATCA GTACAATGTGCTWCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGARCCTTTTAGAAAAAACAATCCAGAGATGGTTA TTTACCAATACATGGATGATTTATATGTAGGATCTGAYTTGGAGATACGRCAGCATAGAGAAAAAATACAGGAGTTTAGAGATCATCTATTTARATGGGGATTTA CCACACCAGACAAAAAACATCAGAAAGARCCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAR GACAGCTGGACTGTCAATGATATACARAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATYAAAGTTAAGCAACTATGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGAGATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACCTGTTCATGGAGTATATT ACGATCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAAGTCTGCCCACACTGT

Accession Number: MK061087 Sample ID : >CM-NWR-B056 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAAAATAGGGGGACAGCTAATGGAAGCCCTATTAGACACAGGAGCAGATGACACAGTATTAGAAAA MATAGATTTRCCAGGGARATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACARTATGATCAGATACTTATAGAAATTTGTGGGAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCYGTCAACATAATTGGACGAAAYATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATMAGTCCTATTG AAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAASAAAAAATAAAGGCATTAACAGAAATTTGTGCAGAA ATGGAAAAGGAGGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACMATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGKGAGGTCCAACTAGGAATACCTCATCCTGCGGGATTAAAAAAGAAAAAATCARTAACAGTACTA GATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGCAGACTTTAGAAAGTATACTGCATTTACCATACCTAGTGTAAATAATGAAACACCGGGRGTTAGATATC AGTACAATGTGCTTCCRCAGGGATGGAAAGGATCACCAGCAATATTCCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGARCAAGAAATCCAGAGMTGGTT ATTTACCAATATATGGATGATTTGTATGTAGGATCTGACTTGGAGATACGGCAACATAGAGAAAAAATACAGGAGTTTAGAGATCATCTATTTAAATGGGGACTT ACCACACCAGACAAAAAGCATCAGAAAGACCCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTYCARCCTATACAGTTGCCAGAAAA RGACAGCTGGACTGTCAATGATATMCAGAAACTAGTAGGAAAACTTAATTGGGCAAGTCARATTTATGCAGGRATTAAAGTTAAACARCTGTGCAAACTCCTCA GGGGAGCCAAAGCACTTACAGAGGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATAT TACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061088 Sample ID : >CM-NWR-B057 CCTCAAATCACTCTTTGGCAACGACCCTTAGTTRCAGTAAGAATAGGGGGACAGCTAATAGAAGCAYTACTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAGATTTACCAGGAAAATGGARGCCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTARGACAATATGATCAGATACTTATGGAAATTTSTGGAAAAA AGGCTATAGGWACWGTGTTAGTAGGACCTACRCCTGTCCCTATTGAAACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCA TTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAAYACACCAG TATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGRAAGTTAGTAGATTTCAGAGAACTCAATAAAAGAACACAAGACTTCTGGGAGATCCAACTAGGAATA CCTCATCCAGCGGGATTGAAAAAGAAAAAATCAGTAACAGTACTAGATGTAGGGGATGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAGTATACTGCA TTCACTATACCTAGTGTAAATAATGAGACACCAGGARTTAGATATCAGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATT ACAAAAATCTTGGAGCCTTTTAGAACAAAAAATCCAGGGATGGTRATTTACCAATATATGGATGACTTATATGTAGGATCTGACTTGGAGATACAGCAACATAGA GCAAAAATACAGGAATTTAGGGAACATYTATTTAGATGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACT CCATCCTGACAAATGGACAGTCCAGCCTATACTTCTGCCAGACAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCA RATTTATGCAGGAATTAAAGTTAAGCAGTTGTGCAGACTCCTCAGGGGAGCCAAAGCACTTACAGATGTACTACCWCTTACTACGGAAGCAGAAATGGAATTGG CAGAGAACAGGGAGATTTTTAAAGAACCTGTACATGGAGTATATTACGATCCAACAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGAC ATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACCGGAAAATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061089 Sample ID : >CM-NWR-B060 CCTCAAATCACTCTTTGGCAACGACCCATARTCACAGTAAACATAGAAGGRCAGCTAAAAGAAGCTCTGTTAGACACAGGAGCAGATGATACAGTATTAGAAGA TATAAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTGAAACAGTATGATCAGATACATATAGAAATTTGTGGACAAA AGGCTGTAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATATRTTGACTCAAATTGGCTGTACTTTAAACTTTCCAATTAGTCATATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGATTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAMCAGAAATTTGTACAGAA ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACYCCAGTWTTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGARCTCAATAAAAGAACTCARGATTTTTGGGAAGTTCAATTAGGAATACCTCACCCGGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTG GATGTGGGGGATGCATATTTTTCAGTTCCCTTRGATAAGGARTTTAGGAAGTACACTGCATTCACCATACCTAGTATCAACAATGAGACACCAGGAATTAGATAT CAGTACAATGTGCTACCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAACCCAGAAATGGT CATCTACCAATATATGGATGATTTGTATGTAGGGTCTGACTTGGAAATACAGCAGCATAGGGCAAAAATACAGGAGTTTAGAGAACATCTATTTAGATGGGGATT TACTACACCAGATAAAAARCATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTGCAGCCTATACAACTGCCAAACAA GGAAAGCTGGACTGTCAATGACATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGRATTAAAGTTAAGCAATTGTGCAAACTCCTCA GAGGRGCCAAAGCACTTACAGATGTACTARCACTTACTGCGGAGGCAGAAATGGAATTGGCAGAGAACAGGGAAATTTTTAAAGAGCCTGTGCATGGGGTATAT TACGACCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGACAAGACCAGTGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCCGCYCACACTGT

Accession Number: MK061090 Sample ID : >CM-NWR-B066 CCTCAAATCACTCTTTGGCAACGACCCTTAGTTACAGTAAGAATAGGGGAACAGCTAATAGAAGCCCTATTAGAYACAGGGGCAGATGATACAGTACTAGAAAA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCTATAGAAATTTGTGGAAAAA AGGCCATAGGTACAGTATTAGTAGGACCYACACCTGTCAACATAATTGGACGAAATATGTTAACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCRTTAACAGAAATTTGTTTAGAGA TGGAAAARGAAGGACAAATTTCAAGRATAGGGCCTGAAAACCCATACAATACTCCAATATTTGCCATAAAGAAAAAGAATAGTACTAGATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAGAGAACCCAAGATTTCTGGGAGATTCAATTAGGAATACCTCATCCAGGGGGATTAAAAAAGAAAAAATCAGTAACAATACTAGA TGTGGGGGATGCATATTTTTCAGTCCCCTTAGATAAAGAATTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAATAATGAAACACCAGGGATTAGATATCA GTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAGATGGAAA TCTGCCAATATATGGATGATTTATATGTAGGATCAGATTTGGAGATACGGCAACATAGGGCAAAAATACAGGAATTTAGAGAACATCTATTTAAGTGGGGATTTT TTACACCAGACCAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGRTATGAACTCCATCCTGACAAATGGACAGTCCAGCCAATACAGCTGCCAGAAAAA GACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAACAACTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGATATACTACCACTTACTGCAGAAGCAGAAATGGAGTTGGCAGAGAACAGAGAGATTTTTAAAGAACCTGTACATGGAGTATATT 149

ACGACCCAACAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061091 Sample ID : >CM-NWR-B068 CCTCAAATCACTCTTTGGCAACGACCAATAGTTACAGTAAAAATAGGGGGACAGCCAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACYCATAGAAATTTATGGGAAAA RGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA GACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTARACAATGGCCATTAACAGCAGAAAAAATAAAGGCATTAACAGACATTTGTGCAGACA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTTAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTACAAATAATGAGACACCAGGRRTTAGATATCAG TACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGAAAAGAAAATCCAGAAATGRTRATT TACCAGTATATGGATGATTTATATGTAGGRTCTGACTTGGAGATACGGCAGCATAGAGCAAAAATACAAGAATTTAGRGAACATCTACTTAAATGGGGATTTACC ACACCAGACAAGAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAARTGGACAGTCCAGCCTATACAGCTACCAGAAAAGGA CAGCTGGACTGTCAATGATATACARAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATYAAAGTTAGGCAACTGTGCAAACTCMTCAGGG GAACCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTCTATTAC GACCCAGCAAAAGACTTTATGGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAGGTCTACCCACACTGT

Accession Number: MK061092 Sample ID : >CM-NWR-B071 CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAARCCYTGTTAGATACAGGAGCAGATGACACAGTATTAGAAGA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTAGTGGAAAAA AGGCTATAGGGACAGTATTAGTAGGACCTACACCTATCAACATAATTGGRAGAAATATGTTGACCCAGATTGGATGYACTYTAAATTTTCCAATAAGTCCTATTG AAACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGYCCAAGGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGYAAYGA SATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGAYTTCTGGGAGGTCCARTTAGGAATACCTCATCCTGCGGGGTTAAARAAGAAAARATCAGTRACAGTACTA GATGTGGGAGATGCATACTTTTCAGTTCCCTTAYATGAAGAYTTTAGAAAGTAYACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATAT CAGTACAATGTACTCCCGCAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATTACAAAAATCTTGGAGCCCTTTAGAAYAAAAAATCCAGAAATGGT TATTTACCAATACATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGARCAAAAATACARGAGTTTAGAAAACATCTMCTTGAATGGGGCTT YACCACACCAGATAAAAAGCATCAGAAAGAGCCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCCATACAGCTGCCAAACA AGGACAGCTGGACTGTCAATGATATACAAAAGTTAGTAGGAAAACTTAAYTGGGCAAGTCAGATTTATCCAGGGATTAAGGTTAAGCACTTATGCAGGCTCCTCA GGGGGGCCAAAGCACTTACAGACATACTACCCCTTACGGCAGAGGCAGAAATGGAGTTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTCTAT TACGACCCATCAAAAGACTTTATGGCAGAAGTACAGAAACAAGGGCCAGACCAATGGACATATCAAATTTATCAAGAGCCATACAAAAATCTTAAAACAGGAAA ATTTGCAAAAAGGGGGTCTGCCCACACTGT

Accession Number: MK061093 Sample ID : >CM-NWR-B072 CCTCAAATCACTCTTTGGCAGCGACCCATAGTTAATGTAAAAATAGCAGGACAGSTGAGGGAAGCTTTATTAGATACAGGAGCAGATGATACAGTATTARAAGAA ATAAATTTGCCAGGAAGATGGAAACCAAAAATGATRGGGGGAATTGGAGGTTTTATTAAAGTAAAACAATATGAGGAAATAACCATAGACATTGAGGGGAAAA AGGCTATAGGTACAGTGTTGGTAGGACCTACACCTGTCAACATAATTGGAAGGAACATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCCTGTKGA CACTGTACCAGTAAAATTAAAGGMAGGAATGGATGGCCCAAAAGTGAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCATTAACAGAAATCTGTACAGAA ATGGAAAATGAAGGAAAGATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAGTGTTTGCCATAAAGAAAAAGGACAGCACTAAATGGAGAAAGTTAGT TGATTTTAGAGAACTCAATAAAAGGACACAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCAGCAGGATTAAAAAAGAAAAAATCAGTAACAGTACTGG ATGTGGGGGATGCATATTTTTCAATCCCTCTAGATAAAAACTTCAGGAAGTATACTGCATTCACTATACCTAGCATAAATAATGAAACACCAGGGATTAGATATC AGTACAAYGTGCTACCACAGGGATGGAAGGGATCACCAGCTATATTCCAGAGTAGCATTGCAAAAATCTTGGAACCATTTAGAACAAAAAATCCAGAAATGGTT ATCTATCARTACATGGATGACTTGTATGTGGGATCTGACTTGGAAATACGRCAGCATAGAGAAAAGGTACAAGAATTTAGAGAGCATCTATTRAGGTGGGGACTT ACCACACCRGATAAAAAACATCAGAAAGARCCCCCATTCCTCTGGATGGGATATGAGCTCCATCCTGACAARTGGACGGTGCAACCTATACAGCTGCCAGACAA AGATTGTTGGACCGTCAATGATATACAAAAACTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATTAAAGTTAAGCAACTATGCAAACTTCTCAG GGGGACCAAAGCACTTACAGACATACTRCCACTTACTGCAGAAGCAGAAATGGAGTTGGCAGAGAACAGGGARATTATTAAAGAACCAGTACATGGAGCATATT ACGACCCATCAAAAGACTTTATGGCAGAAGTACAGAAACAAGGGCAAGACCAGTGGACATATCAAATATATCAAGAGCCATTCAAAAACCTTAAAACAGGGAA GTATGCAAAAAGGAGGGCTGCCCACACTGT

Accession Number: MK061094 Sample ID : >CM-NWR-B076 CCTCAAATCACTCTTTGGCAACGACCCTTAGTYACAGTAAGAATAGGGGGACAGCTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAGATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCTATAGAAATTTGTGRAAAAA ARGCCATAGGTACAGTATTAGTAGGACCTACMCCTGTTAATATAATTGGAAGAAATATGTTGACTCAGATTGGCTGCACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGGGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGACATTTGTTTAGAGA TGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAAYACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCAGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTCCCCTTAGATAAAGACTTTAGAAAGTACACTGCATTCACTATACCTAGTACAAATAATGAAACACCAGGAATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAGCAAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAGATGGTTA TCTATCAGTATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGGCAGCATAGAGCAAAGATACAGGAGTTTAGAAAACATCTACTTAGTTGGGGACTCA CGACACCAGACAAAAAACATCAGAAAGACCCTCCCTTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCAATACAGCTGCCAGAAAAR GACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGGAAACTTAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTTAAACAACTGTGCAAACTCCTCAGG GGAGCCAAAGTACTTACAGAGGTACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAGCCTGTACATGGAGTATATTA CGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGGAAA TATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061095 Sample ID : >CM-NWR-B078 CCTCAAATCACTCTTTGGCAACGACCCTTAGTTRCAGTAAGAATAGGGGGACAGCTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGG GATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGYTTTATCAAAGTAAGACAATATGATCAGATACCTATAGAAATTTGTGGRAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGRCGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCGTTAACAGACATTTGTATGGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAWTTAG TAGATTTCAGAGAACTCAATAAAARAACTCAAGACTTTTGGGAGGTCCAACTAGGAATACCTCATCCCGCCGGATTAAAAGAGAAAAAATCAGTAACAGTACTA GATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAAGTTTTAGAAAATATACTGCATTCACTATACCYAGTGTAAATAATGAGACACCAGGGATWAGATAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGATCCCTTTAGAAGAAAAAATCCMGAGATGGT TATTTACCAATATATGGATGATTTRTATGTAGGATCTGATTTGGAAATACGGGAGCATAGAGCAAAAATACAGGAGTTTAGAGCACATCTACTTAAATGGGGATT TACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGAYAAATGGACAGTCCAGCCTATACAGYTGCCAGAAA AAGACAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAGGCAACTGTGCAAACTCCTC AGGGGAGCCAAAGCACTTACAGATRTACTAMCACTTACTGCGGAGGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTCTA TTACGACCCAGCAAAAGACCTTGTGGCARAAATACAGAAACAAGGGCAAGACCAATGGACATACCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAA AATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061096 Sample ID : >CM-NWR-B079 CCTCAAATCACTCTTTGGCAACGACCYTTAGTCACAGTAAGAATAGGGGGACAGCTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAGATTTACAAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCTATAGAAATTTGTGGGAAAA GGGCCATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATACCAATTAGTCCTATTGAAACTGTGCCAGTAAAATTAAAGCCAGGAA TGGATGGCCCGAAGGTTAAACAATGGCCATTGACAGAAGAAAAGATAAAAGCATTAACAGAAATTTGTACAGAGATGGAACAGGAAGGAAAAATTTCAAAAAT TGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAGAGAACTC AAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCAGGACTAAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCCT TGGATGAAAACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCTCAGGGATGGAAAG GATCACCAGCAATATTTCAGGCAAGTATTACAAAAATCTTGGAGCCTTTTAGAACAAAAAATCCAGAGATGGTTATTTACCAATATATGGATGATCTATATGTAG GATCAGACTTGGAGATACGGCAGCATAGAGCAAAAATACAAGAGTTTAGAGAACATCTACTTAGATGGGGATTTACCACCCCAGACAAAAAACATCAGAAAGA ACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAGGATAGCTGGACTGTCAATGATATACAGAA ATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAGGCAACTGTGCAAACTCCTCAGGGGAGCCAAAGCACTTACAGAGATACTAC 150

CACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGAGAAATTCTTAAAGAACAGATTCATGGAGTATATTACGATCCATCAAAAGACCTTGTGGCAGAA ATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGGAAGTATGCAAAAAGGAGGGCTGCCCACACTGT

Accession Number: MK061097 Sample ID : >CM-NWR-B083 CCTCAAATCWCTCTTTGGCAACGACCAGTAGTCACMATAGAAATAGGGGGGCAACAAAGGGAGGCTCTATTAGAYACAGGGGCAGATGATACAGTATTAGAAG ATATAAATTTGCCAGGAAAATGGAAACCAARAATGATAGGGGGAATTGGAGGGTTTATCAAAGTAAGACAGTATGAACAAGTACCAATAGAAATTTGTGGACAA AARGCTATAGGTACWGTGCTAGTAGGGCCTACTCCTGTCAACATAATTGGAAGAAATCTGTTGACTCAAATTGGTTGCACTTTAAATTTTCCAATTAGTCCKATTG AAACTGTACCAGTAAAGTTAAAGCCAGGAATGGATGGGCCAAAGGTTAAACAATGGCCACTGACAGAAGAAAAAATAAAAGCATTAACAGAAATCTGTACAGA RATGGAAAAGGAAGGAAAGATAACAAAAATTGGGCCAGAAAATCCATACAATACTCCAATATTTGCYATAAAGAAAAAGGACAGCACTAAATGGAGAAAATTA GTAGACTTYAGAGAACTTAATAAAAGAACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCAGGKTTAAAAAAGAAAAAATCAGTAACAGTACT GGATGTGGGGGATGCRTATTTCTCMGTCCCCTTAGATAAAGAATTCAGGAAGTACACTGCATTYACCATACCTAGTRTCAACAATGAGACACCAGGAATTAGATA TCAGTACAATGTGCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAYATAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAATTRGT TATATACCAATACATGGATGATTTGTATGTAGGGTCTGACTTGGAAATACGGCAGCATAGGACAAAARTACAAGAGTTTAGRGRACATTTATTTARATGGGGATT TACKACACCAGATAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGAYAAATGGACAGTACAGGCTATACAATTGCCAGACA AGGACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCARATTTATCCAGGGATTAGAGTTAGGCACTTATGCARACTCCTCA GGGGAGCCAAAGCACTTACAGATGTACTGCCACTTACTACAGAAGCAGARATGGAACTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGGGTATAT TACGATCCATCAAAAGAGTTTATGGCAGAAATACAGAAACAAGGGCAAGATCAATGGACATATCAAATTTATCAAGAACCGCACAAAAATCTTAAAACAGGAAA GTATGCAAAAAGGAGGTCTGCCCACACTAT

Accession Number: MK061098 Sample ID : >CM-NWR-B084 CCTCAAATCACTYTTTGGCAACGACCCTTAGTTACAGTAAGAATAGGGGGDCAGCCAATARAAGCCCTATTAGACACAGGGGCAGATGATACAGTATTAGAGGA AATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGAGGGATTGGAGGTTTTATTAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACSCCTGTCAACATAATTGGACGAAACATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAG ATGGAAAAGGAAGGAAAAATTTCACGAATTGGGCCTGAAAATCCTTACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAGTTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCAGGATTAAAACAGAAAAAATCAGTAACAGTRTTAG ATGTAGGGGATGCATACTTTTCAGTTCCCTTAGATGAAAACTTTAGAAAGTATACTGCCTTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATATCA ATAYAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGTTAT TTACCAATATATGGATGATTTATATGTAGGATCTGATTTGGAAATACGGCAGCATAGAGCAAAAATACAGGAGTTTAGAGATCATCTACTTARGTGGGGATTTAC CACACCAGACAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACWGCTGCCAGAAAAAG ATAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAACTTAATTGGGCMAGTCAGATTTATGCAGGAATTAAAGTTAAGCAATTGTGCAGACTCCTCAGG GGAGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAGTTGGCAGAGAACAGAGAAATTCTTAAAGAATCTGTACATGGAGTCTATTA CGACCCAGCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAA TATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061099 Sample ID : >CM-NWR-B085 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAGTGGGGGGACAGCTAATAGAAGCCCTATTAGATACAGGAGCAGATGACACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGGTACTTTTAGAAATTGAAGGAAGAA AGGCTGTAGGATCAGTATTAGTAGGACCTACACCAATCAACATAATTGGGAGAAATATGACAGAAGAAAAAATAMAAGCATTAACAGACATTTGTACAGAGAT GGAAAAGGAAGGAAAGATTTCAAAAATTGGGCCTGAAAATCCATACAATACACCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGGAAATTAGTA GATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCAGGATTAAAAAAGAAGAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTTCCCYTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAACAATGAGACACCAGGGATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGGACAAAAAATCCAGAAATGGTTAT CTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGACAACATAGAGCAAAAATACAGGAGTTTAGAGAACATCTACTTAGATGGGGATTTAC CACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGAAAAAG ACAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGAATTAAAGTTAAGCAACTGTGCAAACTTCTCAGGG GAGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATATTAC GACCCAACAAAAGACTTTATGGCAGAAATACAAAAACAAGGGCAAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061100 Sample ID : >CM-NWR-B086 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAATAGGGGGACAGCCAATAGAAGCCSTATTAGACACAGGAGCAGATGATMCAGTATTAGAAGA AATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAA RGGCTATAGGTACAGTGCTAGTAGGACCTACACCKGTCAACATAATTGGGAGAAATATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGATTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAG MTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAGAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAAYAAAAGAACTCAGGACTTCTGGGAGGTCCAACTAGGAATACCYCATCCBGCAGGATTAAARAAGAAAAAATCAGTAACAGTACTGG ATGTGGGGGATGCATATTTTTCAGTTCCCTTACAYGAGAGCTTTAGAAAGTACACTGCATTCACTATACCCAGTATAAATAATGAGACACCAGGRATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAACCCTTTAGAACAAACAATCCAGARATGGTTA TWTACCAATATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGAGAGCATAGAACAAAAATACAGGAGTTTAGAGAACATCTGCTTARATGGGGGTTT ACCACACCAGACAAAAAACATCAGAAGGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACARTCCAGCCCATACAGCTRCCAACAAA GGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCRAGTCAGATTTATCCAGGAATTAAAGTTAGGCAACTGTGCAAACTCMTCA GRGGAGCCAAAGCACTTACAGATGTACTACCAATTACTGCRGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTTTTAAAGAACCTGTRCATGGAGTCTAT TACGACCCAGCAAAAGACTTTGTGGCAGAAATACAGAAACAAGGACKAGACCAATGGACATATCAAATATATCAAGAGCCATTCAAAAATCTTAAAACAGGGA AATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061101 Sample ID : >CM-NWR-B087 CCTCAAATCACTYTTTGGCAACGACCCTTAGTTACAGTAAGAATAGGGGGDCAGCCAATARAAGCCCTATTAGACACAGGGGCAGATGATACAGTATTAGAGGA AATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATTAAAGTAAGACAATATGATCAGATACTTATAGAAATYTGTGGAAAAA AGGCTATAGGTACAGTGTTAGTAGGACCTACSCCTGTCAACATAATTGGACGAAACATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAGGCATTAACAGAAATTTGTACAGAG ATGGAAAAGGAAGGAAAAATTTCACGAATTGGGCCTGAAAATCCTTACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAGTTAGT AGATTTCAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCATCCCGCAGGATTAAAACAGAAAAAATCAGTAACAGTRTTAG ATGTAGGGGATGCATACTTTTCAGTTCCCTTAGATGAAAACTTTAGAAAGTATACTGCCTTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATATCA ATAYAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGAGATGGTTAT TTACCAATATATGGATGATTTATATGTAGGATCTGATTTGGAAATACGGCAGCATAGAGCAAAAATACAGGAGTTTAGAGATCATCTACTTARGTGGGGATTTAC CACACCAGACAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACWGCTGCCAGAAAAAG ATAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAACTTAATTGGGCMAGTCAGATTTATGCAGGAATTAAAGTTAAGCAATTGTGCAGACTCCTCAGG GGAGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAGTTGGCAGAGAACAGAGAAATTCTTAAAGAATCTGTACATGGAGTCTATTA CGACCCAGCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTCAAAACAGGAAAA TATGCAAAAAAGAGATCTGCCCACACTGT

Accession Number: MK061102 Sample ID : >CM-NWR-B095 CCTCAAATCACTCTTTGGCAASGACCCCTTGTCACAGTAAAAATAGAGGGACAGCTAAAAGAAGCCSTATTAGAYACAGGGGCAGATGATACAGTATTAGAAGA CATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAGTACATATAGAAATYTGTGGACATA AGGCTGTAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAW ATGGAAAAGGAAGGAAARCTTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGT AGATTTTAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAACTAGGAATACCACATCCTGCAGGGCTAAAAAAGAAAAAATCAGTAACAGTACTGG ATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGARGACTTTAGAAAGTATACYGCATTCACCATACCTAGTATAAACAATGAGACACCAGGAATTAGGTATC AGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCGTCAATATTCCAAAGTAGCATTACAAGAATTTTGGAACCTTTTAGAAAACAAAATCCAGAAATGGTTA TCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTGGAAATACGGCAGCATAGAACAAAAATACAGGAATTTAGGGGGCACCTATTTAAGTGGGGATTTA CCACACCAGACAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTTCATCCTGACAAATGGACAGTACAGCCTATACATCTGCCAGAAAAAG ACAGCTGGACTGTTAATGATGTACAGAAGTTAGTAGGGAAACTTAATTGGGCAAGCCAGATCTATCCAGGAATTAAAGTTAGACAATTGTGCAAATGCCTCAGG GGAACCAAAGCACTTACAGAAGTACTACCACTTACAACAGAAGCAGAAATGGAACTGGCAGAAAACAGGGARATTCTCAAAGARCCAGTACATGGAGTGTATTA 151

CGACCCATCAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGATCAATGGACATATCAAATCTATCAAGAACAATACAAAAATCTTAAAACAGGAAAG TATGCAAAAAAGAGGGGTGCCCACACTGT

Accession Number: MK061103 Sample ID : >CM-NWR-B098 CCTCAAATCACTCTTTGGCAACGACCAGTAGTCACMATAGAAATRGGGGGRCAACAAAGGGAGGCTCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGA TATAAATTTGCCAGGAAAATGGAAACCAARAATGATAGGGGGAATTGGAGGGTTTATCAAAGTAAGACAGTATGARCAAGTACCAATARAAATTTGTGGACAAA AGGCTATAGGTACAGTGCTAGTAGGGCCTACGCCTGTCAACATAATTGGAAGRAATYTGTTGACTCAAATTGGTTGYACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAGTTAAARCCAGGAATGGATGGGCCAAAGGTTAAACAATGGCCACTGACAGAAGAAAAAATAAAAGCATTAACAGAAATYTGTACAGAR ATGGAAAAGGAAGGAAAGATAACAAAAATTGGGCCAGAAAATCCATACAATACTCCAATATTTGCYATAAAGAAAAAGGACAGYACKAAATGGAGAAAATTAG TAGACTTCAGAGAACTTAATAAAAGAACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCACACCCTGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTG GATGTGGGGGATGCATATTTCTCMGTCCCCTTAGATAAAGAATTCAGGAAGTACACTGCATTCACCATACCTAGTRTCAACAATGAGACACCAGGAATTAGATAT CAGTACAATGTRCTTCCACAGGGATGGAAAGGGTCACCAGCAATATTCCAAYATAGCATTACAAAAATCTTGGAGCCCTTTAGAGCAAAAAATCCAGARTTRGTT ATATACCAATACATGGATGATTTGTATGTAGGATCTGACTTGGAAATACGGCAGCATAGGACAAAAATACAAGAKTTTAGRGAACATTTRTTTRSATGGGGATTT ACKACACCAGATAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGAYAAATGGACAGTACAGGCTATACAATTGCCAGACAA GGACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATTAGARTTARGCACTTATGCARACTCCTCAG GGGAGCCAAAGCACTTACAGATGTACTGCCACTTACTACAGAAGCAGARATGGAACTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGAGTATATT ACGATCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061104 Sample ID : >CM-NWR-B099 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGCAAAAATAGGGGGACAGTTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAATATGATCAGATACTTATAGAAATTTGTGGRAAAA AGGCKATAGGTACAGTATTGGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATAAGTCCWATCG AAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAATTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCTTTAACAGAAATTTGTACAGA GATGGAAAAGGAAGGAAAAATTTCACGAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAGGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTRCTA GATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATGAAGGTTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAACAATGAGACACCAGGGATTAGATATC AGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAGCCCTTTAGACGAAAAAATCCAGAGATGGTT ATTTACCAATACATGGATGATTTATATGTTGGATCTGACTTGGAAATACGACAGCATAGAGCAAAAATACAGGAGTTTAGAGACCACCTGTTTAAATGGGGATTT ACCACACCAGACAAAAAACATCAGAAGGAACCYCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAACTGCCAGAAAA GGCCAGCTGGACTGTCAATGATATACAGAAACTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAATTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGATGTACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAGGAACCTGTACATGGAGTTTATT ACGACCCAACAAAAGACCTTATGGCAGAAATACAGAAACAAGGACAYGACCAGTGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAGGAAGTCTGCY CACACTGT

Accession Number: MK061105 Sample ID : >CM-NWR-B100 CCTCAAATCACTCTTTGGCARCGACCCTTAGTCACAGTAAARATAGGGGGACAGCTAATAGAAGCTCTATTAGAYACAGGAGCAGATGATACAGTATTACAAGA AATAAMTATATCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGGAAAG AGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAGGCTTTAACAGAAATTTGTACAGACA TGGAAAAGGAAGGGAAAATTTCAAGRATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAGAAAGATRGTACTAAATGGAGAAAATTAGTA GATTTTAGGGAACTCAATAAAAGAACTCAAGACTTCTGGGAGGTCCAACTAGGAATACCTCACCCCGCGGGGTTAAAGAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAAGATTTTAGAAAGTATACTGCMTTCACTATACCTAGTACMAATAATGAARCMCCRGGGAYTAGATATCA ATACAATGTGCTTCCACARGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGTATTACAAAAATCTTGGAGCCCTTTAGAACAAGCAAYCCAGACATGGTTAT TTACCAGTATATGGATGATTTATATGTAGGATCTGACTTGGAGATACGGCAGCATAGAGARAAAATACAGGAGTTTAGAGACCACCTACTTAGATGGGGATTCAC CACACCAGACAAAAAACATCAGAAAGAACCYCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCARCCTATACAAYTGCCAGAAAAAG ACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAGG GGAGCCAAAGCACTTACAGAAGTACTGCCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGRGAAATTCTTAAAGAACCTGTACATGGGGTATATTA CGACCCAGCAAAAGAATTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAA TATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061106 Sample ID : >CM-NWR-B106 CCTCAAATCACTCTTTGGCAASGACCYTTAGTCACAGTAAGAATAGGGGGACAGYTAATAGAAGCCCTATTAGACACAGGAGCAGATGATACAGTATTAGAAGA AATAGATTTACAAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCTATAGAAATTTGTGGGAAAA GGGCCATAGGTACAGTATTAGTAGGACCTACMCCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCMTATTG AAACTGTGCCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTARCAGARATTTGTACCGAR ATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGATAGTACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCATCCCGCAGGACTAAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGGGATGCATATTTTTCAGTTCCCTTGGATGAAAACTTTAGAAAGTATACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGGATTAGATATCA GTACAATGTGCTTCCTCAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGTATTACAAAAATCTTGGAGCCTTTTAGAACAAAAAATCCAGAGATGGTTAT TTACCAATATATGGATGATCTATATGTAGGATCAGACTTGGAGATACGGCAGCATAGAGCAAAAATACAAGAGTTTAGAGAACATCTACTTAGATGGGGATTTAC CACCCCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACCGYTGCCAGAAAAGG ATAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAGACTCCTCAGGG GAGCCAAAGCACTTACAGATATACTAMCAYTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGRGAGATTATTAAAGAACCKGTACATGGAGTATATTAC GATCCATCAAAAGACCTTGTGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGGAAGTA TGCAAAAAGGAGGGCTGCCCACACTGT

Accession Number: MK061107 Sample ID : >CM-NWR-B107 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAGTGGGGGGACAGCTAATAGAAGCCCTATTAGATACAGGAGCAGATGACACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGGTACTTTTAGAAATTGAAGGAAGAA AGGCTGTAGGATCAGTATTAGTAGGACCTACACCAATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTAG CACTATACCAGTAAAGTTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCAYTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGYAATGAG ATGGAAAAGGAAGGAAAAATTTCAAAAGTTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAAGATAGCACTAAATGGAGAAAATTAGT AGATTTCAGAGAGCTCAATAAAAGAACTCAGGATTTCTGGGAAGTTCAGTTAGGGATACCGCATCCAGCTGGTTTRAAAAAGAAAAAATCAGTAACAGTACTAG ATGTGGGAGATGCATATTTTTCAGTTCCATTAGATGAAAGCTTCAGAAAGTATACTGCATTCACCATACCTAGTATAAACAATGAGACACCAGGAATCAGGTATC AGTACAATGTGCTACCACAGGGATGGAAAGGATCACCATCAATATTCCAGAGTAGCATTACAAAAATCTTGGAGCCCTTTAGAGCACAAAATCCAGAAATGGTT ATCTATCAATACATGGATGACTTGTATGTAGGATCTGATTTGGAAATACAACAGCATAGRGCAAAAATACAAGAGTTTAGAGCTCATCTATTTAGCTGGGGGTTT ACTACACCAGACAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGACAA AGATAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATTAAAGTTAAACAACTGTGCAAACTCCTCAG GGGAGCCAAAGCACTTACAGATGTACTACCACTTACTACGGAAGCAGAAATGGAATTGGAAGAAAACAGGGAGATTTTTAAAGACCCTGTGCATGGGGTATACT ACGACCCATCAAAAGACTTTGTGGCAGAAATACAGAAACAAGGGCAGGACCAATGGACCTATCAAATTTTTCAGGAGCCATTCAAAAATCTTAAAACAGGAAAA TATGCAAGAAAGAAGTCTGCTCATACTGT

Accession Number: MK061108 Sample ID : >CM-NWR-B119 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGAGTGGGGGGACAGCTAATAGAAGCCCTATTAGATACAGGAGCAGATGACACAGTATTAGAAGA CATAAATTTACCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGGTACTTTTAGAAATTGAAGGAAGAA AGGCTGTAGGATCAGTATTAGTAGGACCTACACCAATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAMGAAAAAATWAAAGCATTAACAGAAATATGTATGGAA ATGGAACAGGAAGGAAAAATCTCAMAAATWGGACCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAG TAGATTTTAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGAGGTTCAATTAGGAATACCTCACCCTGCGGGATTAAAAGAAAAGAAATCAGTAACAGTTTTA GATGTGGGGGACGCATATTTTTCAGTTCCCTTAGATGAAGACTTTAGAAAATATACTGCATTTACTATACCTAGTGTAAATAATGAGACACCAGGGATTAGATATC AATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGTATAGCATTACAAAAATCTTGGAGCCCTTTAGAAGAAAATATCCAGAAATGGTTA 152

TCTACCAATACATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAACATAGAGCAAAAATACAGGAGCTTAGAGGACATCTGTTTAAATGGGGATTTA CCACACCAGACAAAAAGCATCAGAAGGAACCTCCATTTCTGTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTGCCAGACAAA GACAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATCTATCCAGGGATTAGAGTTAAGAATCTATGCAAACTTCTCAGG GGAACCAAAGCACTTACAGACATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAGATTCTTAAAGACCCTGTGCATGGGGTATACTA CGACCCATCAAAAGAATTTGTGGCAGAAATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGAAAAT ATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061109 Sample ID : >CM-NWR-B122 CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAARCCYTGTTAGATACAGGAGCAGATGACACAGTATTAGAAGA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTAGTGGAAAAA AGGCTATAGGGACAGTATTAGTAGGACCTACACCTATCAACATAATTGGRAGAAATATGTTGACCCAGATTGGATGYACTYTAAATTTTCCAATTAGTCCTATTA GaACTATACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAA ATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTGGT AGATTTTAGAGAGCTCAATAAAAGAACTCAAGATTTCTGGGAGGTCCAATTAGGCATACCTCACCCCGCGGGGTTAAAAAGGAAAAAATCAGTAACAGTACTAG ATGTGGGAGATGCATATTTTTCAGTTCCCTTAGATAAAGATTTTAGAAAGTATACAGCATTCACTATACCTAGCATAAATAATGAGACACCAGGGATTAGATATC AGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATTACAAAAATCTTGGAACCCTTTAGAGCAAGGAATCCAGAAATGGTT ATCTACCAGTACATGGATGATTTATATGTAGGATCTGACCTGGAAATACGGCAGCATAGAGCAAAAATACAGGAGTTTAGAGACCATCTACTTAAATGGGGATTT ACCACACCAGATAAAAAGCATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCCATACAGCTGCCAGAAAA AGAAAGCTGGACTGTCAATGATATACAAAAATTAGTAGGAAAGCTTAATTGGGCAAGTCAGATTTATCCAGGGATTAAAGTTAGGCAACTATGCAAACTTCTCAG GGGAGCCAAGGCACTTACAGAGATACTACCAATTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAGATTCTTAAAGAACCTGTACATGGAGTATATT ACGACCCAACAAAAGACTTTATGGCAGAAATACAGAAACAAGGGCAGGACCAATGGACATATCAAATTTATCAAGAGCCATTCAAAAATCTTAAAACAGGGAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061110 Sample ID : >CM-NWR-B125 CCTCAAATCACTCTTTGGCAACGACCACTTGTCACAGTAAAAATAGCAGGACAGYTAAAAGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAGA CATAGATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGYTTYATCAAAGTAAGACAATATGATCAAGTACCTATAGAAATTTGTGGAAAAA GGGCTATGGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGCTGTACTTTAAATTTTCCAATTAGTCCTATTGA AACAGTGCCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGAAATTTGTTTAGAG ATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAATATTTGCCATAAAGAAAAAAGAYAGCACTAAATGGAGAAAATTAGT AGATTTCAGAGAACTCAATAAAAGAACACAGGATTTCTGGGAAGTGCAATTAGGRATACCGCATCCAGCGGGTTTAAAAAAGAAAAAATCAGTAACAGTACTGG ATGTGGGGGATGCATACTTTTCAGTTCCTTTATATGAAGACTTTAGAAAGTATACTGCATTCACAATACCTAGTGTAAATAATGAGACACCAGGGATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAAAAATTTTGGAGCCCTTTAGAACAAARAATCCAGAGATGGTTAT CTACCAATATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGGCAACATAGAGCAAAAATACARGAGTTTAGAGCTCATCTGCTTAGATGGGGATTTAC CACACCAGATAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACAGTCCAGCCTATACAGCTACCAGAGAAAG ACAGCTGGACTGTCTATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGCCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGCAAACTCCTCAGGG GAGCCAAATCCCTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATATTAC GACCCAACAAAAGACTTTATGGCAGAAATACAGAAGCAAGGGCAAGATCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAAAATA TGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061111 Sample ID : >CM-NWR-B129 CCTCAAATCACTCTTTGGCAACGACCCTTAGTCACAGTAAGGGTAGGGGGACAGCTAATAGAAGCCCTATTAGATACAGGAGCAGATGATACAGTACTAGAAAA CATAGATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAAATACTTATAGAAATTTGTGGAAAAA GGGCTATAGGTACAGTATTAATAGGACCTACMCCTGTCAACATAATTGGAAGAAATATGTTGACTCAGATTGGATGTACTTTAAATTTTCCAATTAGTCCTATTAA aACTATACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGCAATGAAA TGGAAAAAGARGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCTATAAGGAAAAAAGATAGTACTAAATGGAGAAAATTAGTA GATTTCAGAGAACTCAATAAGAGAACTCAAGACTTYTGGGAAGTTCAATTAGGAATACCTCATCCCGCRGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGA TGTGGGGGACGCATACTTTTCAGTCCCTCTAGATAAAGACTTCAGRAAGTATACTGCATTCACTATACCTAGTACAAACAATGAGACACCAGGGATTAGATATCA GTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCAAGCATTACAAAAATCTTGGAGCCCTTTAGAACAAAAAATCCAGAAATGGTTA TCTACCAATATATGGATGATTTATATGTAGGATCAGACTTGGAGATACGACAGCATAGAGCAAAAATACAGGAGTTTAGAGCTCATCTATTTAGCTGGGGGTTTA CCACACCAGACAAAAAGCATCARAAGGARCCTCCATTTCTCTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTCCAGCCTATARTGTTGCCAGAAAAAG AAAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATCCAGGGATCAAAGTTAARCAACTRTGCAAACTCCTCAGGG GAGCCAAAGCACTTACAGATATACTACCACTTACTGCGGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCTGTACATGGAGTATATTAC GACCCARCAAAAGACTTTATGGCAGAAATACAGAAACAAGGRCAAGACCAATGGACATATCAGATATATCAAGAKCCATTCAAAAATCTTAGAACAGGAAAAT ATGCAAAAAGGAGGGCTGCCCACACTGT

Accession Number: MK061112 Sample ID : >CM-NWR-B130 CCTCAAATCACTCTTTGGCAACGMCCCTTAGTTACAGTAAGRATAGAGGGACAGCTGATAGAAGCCCTATTAGACACAGGGGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAATAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTCCCAATTAGYCCTATTGA AACTGTMCCAGTAAAACTAAAGCCRGGAAKGGAKGGCCCAAAAKTTAAACAAKGGCCWTTGACARAARAAAAAATAAAGGCNTTAARAGAYATTTGTACAGA GATGGAGAAGGAAGGAAAAATTWCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAARTTA GTAGATTTCAGAGAACTCAATAAAAGAACTCAAGATTTCTGGGAGATCCARTTAGGAATACCTCATCCCGCAGGATTAAAGAAGAAAAAATCAGTRACAGTACT AGATGTAGGGGATGCATATTTTTCAGTTCCCTTAGATGAAAGCTTTARAAAATACACTGCATTTACTATACCTAGTATMAATAATGAGACACCAGGAATTAGATA TCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAACCCTACAGAGCAAAAAATCCAGAGATGG TTATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACRACAGCATAGGGCAAAAATACAGGAGTTTAGAGAACATCTCTTTACATGGGGAT TTACCACACCAGACAAGAAACAYCAAAARGAGCCTCCMTTTCTTTGGATGGGATATGAACTCCATCCAGACAAATGGACAGTCCAGCCCATACAGCTGCCAGAA AAAGAARACTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTMAAGTTAAGCAACTGTGCAAACTCCT CAGGGGAGCCAAAGCACTTACAGATATACTACCWCTTACTGCGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCYGTCCATGGAGTC TACTACGACCCAGCAAAAGACCTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGG AAAATATGCAAAAAGGAGGTCTGCCCACACTGT

Accession Number: MK061113 Sample ID : >CM-NWR-B131 CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAARCCYTGTTAGATACAGGAGCAGATGACACAGTATTAGAAGA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTAGTGGAAAAA AGGCTATAGGGACAGTATTAGTAGGACCTACACCTATCAACATAATTGGRAGAAATATGTTGACCCAGATTGGATGYACTYTAAATTTTCCAATAAGTCCTATTG AAACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGYCCAAGGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGYAAYGA SATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGAYTTCTGGGAGGTCCARTTAGGAATACCTCATCCTGCGGGGTTAAARAAGAAAARATCAGTRACAGTACTA GATGTGGGAGATGCATACTTTTCAGTTCCCTTAYATGAAGAYTTTAGAAAGTAYACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATAT CAGTACAATGTACTCCCGCAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATTACAAAAATCTTGGAGCCCTTTAGAAYAAAAAATCCAGAAATGGT TATTTACCAATACATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGARCAAAAATACARGAGTTTAGAAAACATCTMCTTGAATGGGGCTT YACCACACCAGATAAAAAGCATCAGAAAGAGCCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCCATACAGCTGCCAAACA AGGACAGCTGGACTGTCAATGATATACAAAAGTTAGTAGGAAAACTTAAYTGGGCAAGTCAGATTTATCCAGGGATTAAGGTTAAGCACTTATGCAGGCTCCTCA GGGGGGCCAAAGCACTTACAGACATACTACCCCTTACAGCAGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGAGTCTAT TACGACCCATCAAAAGACTTTATGGCAGAAATACAGAAGCAAGGGCAAGATCAATGGACATATCAAATTTATCAGGAGCCATTCAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTGT

Accession Number: MK061114 Sample ID : >CM-NWR-B132 CCTCAAATCACTCTTTGGCAACGMCCCTTAGTTACAGTAAGRATAGAGGGACAGCTGATAGAAGCCCTATTAGACACAGGGGCAGATGATACAGTATTAGAAGA CATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAA AGGCTATAGGTACAGTGTTAATAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAGATTGGTTGTACTTTAAATTTCCCAATTAGYCCTATTGA AACTGTMCCAGTAAAACTAAAGCCRGGAAKGGAKGGCCCAAAAKTTAAACAAKGGCCWTTGACARAARAAAAAATAAAGGCNTTAARAGAYATTTGTACAGA GATGGAGAAGGAAGGAAAAATTWCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAARTTA GTAGATTTCAGAGAACTCAATAAAAGAACTCAAGATTTCTGGGAGATCCARTTAGGAATACCTCATCCCGCAGGATTAAAGAAGAAAAAATCAGTRACAGTACT AGATGTAGGGGATGCATATTTTTCAGTTCCCTTAGATGAAAGCTTTARAAAATACACTGCATTTACTATACCTAGTATMAATAATGAGACACCAGGAATTAGATA 153

TCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAGGCTAGCATTACAAAAATCTTGGAACCCTACAGAGCAAAAAATCCAGAGATGG TTATTTACCAATATATGGATGATTTATATGTAGGATCTGACTTGGAGATACRACAGCATAGGGCAAAAATACAGGAGTTTAGAGAACATCTCTTTACATGGGGAT TTACCACACCAGACAAGAAACAYCAAAARGAGCCTCCMTTTCTTTGGATGGGATATGAACTCCATCCAGACAAATGGACAGTCCAGCCCATACAGCTGCCAGAA AAAGAARACTGGACTGTCAATGATATACAAAAATTAGTAGGAAAACTTAATTGGGCAAGTCAGATTTATGCAGGAATTAAAGTTAAGCAACTGTGTAAACTCCTC AGGGGAGCTAAAGCACTTACAGATATACTACCWCTTACTGAGGAAGCAGAAATGGAATTGGCAGAAAACAGGGAAATTCTTAAAGAACCYGTCCATGGAGTCT ACTATGACCCAGCAAAAGACCTTATGGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATCAAATTTATCAGGAGCCATTTAAAAATCTTAAAACAGGA AAATATGCAAAAAGGAGGTCTGCCCACACTAA

Accession Number: MK061115 Sample ID : >CM-NWR-B135 CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAARCCYTGTTAGATACAGGAGCAGATGACACAGTATTAGAAGA TATAAATTTACCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTAGTGGAAAAA AGGCTATAGGGACAGTATTAGTAGGACCTACACCTATCAACATAATTGGRAGAAATATGTTGACCCAGATTGGATGYACTYTAAATTTTCCAATAAGTCCTATTG AAACTGTRCCAGTAAAATTAAAGCCAGGAATGGATGGYCCAAGGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGYAAYGA SATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAATGGAGAAAATTAG TAGATTTCAGAGAACTCAATAAAAGAACTCAAGAYTTCTGGGAGGTCCARTTAGGAATACCTCATCCTGCGGGGTTAAARAAGAAAARATCAGTRACAGTACTA GATGTGGGAGATGCATACTTTTCAGTTCCCTTAYATGAAGAYTTTAGAAAGTAYACTGCATTCACTATACCTAGTATAAATAATGAGACACCAGGAATTAGATAT CAGTACAATGTACTCCCGCAGGGATGGAAAGGATCACCAGCAATATTTCAGAGTAGCATTACAAAAATCTTGGAGCCCTTTAGAAYAAAAAATCCAGAAATGGT TATTTACCAATACATGGATGATTTATATGTAGGATCTGACTTGGAAATACGGCAGCATAGARCAAAAATACARGAGTTTAGAAAACATCTMCTTGAATGGGGCTT YACCACACCAGATAAAAAGCATCAGAAAGAGCCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCCATACAGCTGCCAAACA AGGACAGCTGGACTGTCAATGATATACAAAAGTTAGTAGGAAAACTTAAYTGGGCAAGTCAGATTTATCCAGGGATTAAGGTTAAGCACTTATGTAGGCTCCTTA GGGGGGCCAAAGCACTTACAGACATACTACCCCTTACTGCAGAAGCAGAAATGGAATTGGCAGAGAACAGGGAAATTCTTAAAGAACCAGTACATGGAGTCTAT TATGACCCATCAAAAGACTTTATGGCAGAAATACAGAAGCAAGGGCAAGATCAATGGACATATCAAATTTATCAGGAGCCATTTAAAAATCTTAAAACAGGAAA ATATGCAAAAAAGAGGTCTGCCCACACTAA