Fig. S2 for Genomic Jackson Immuno Research), and DAPI Nuclear Counter Stain Targeting Diagram, Confirmation of Insertion Locus by Southern Blot (1:10,000, Roche)

Supporting Information

Rose et al. 10.1073/pnas.0911579106 Supporting Information Methods stage labeled by a single dose varied slightly between hindbrain Generation of an Inducible Math1Cre*PR Line. The second-generation segments, likely due to slight differences in developmental progres- Cre-progesterone receptor fusion protein (Cre*PR) shows 50-fold sion between segments (5). improvement in resolution over previous CrePR alleles due to elimination of cryptic splice sites (1) and sequence optimization for Mouse Strains, Staging, and Genotyping. For staging, noon on the mammalian expression (2). An frt-bounded PGK-Neo selectable day that the vaginal plug was observed was counted as embryonic marker (3) and an additional EcoRI restriction site for Southern day 0.5 (E0.5). Yolk sacs or tails were collected before fixation for genotyping were inserted immediately 3Ј to the Cre*PR ORF in a PCR genotyping as described previously (6). All animals were pBlueScript II KSϩ plasmid with ampicillin selection housed in a pathogen-free mouse colony in compliance with the (pMath1Cre*PR_Neo). The construct was electroporated into guidelines of the Center of Comparative Medicine of Baylor AB2.2 ES cells and selected under G418 (Gibco, Gaithersburg, College of Medicine. MD) for 10 days. Two resistant clones with correct recombination, Ј Ј Immunohistochemistry and X-gal Staining. The antibodies and their as analyzed by Southern blot by using internal 5 and external 3 ␤ probes after EcoRI digestion, were then injected into blastocysts to dilutions used in this study were as follows: rabbit anti- -gal (1:2,000, Rockland), GFP (1:1,000, Abcam), Sst-28 (1:1,000, Im- generate chimeras. Mice heterozygous for Math1Cre*PR_Neo were munoStar), Lhx2/9 [1:1,500, gift from J. Dodd (Columbia Univer- crossed to ROSAFLPe mice (FLPeR) (4) to remove PGK-Neo and sity, New York, NY)], Barhl1 (1:1,000, Sigma), CRH (1:1,500, generate the final Math1Cre*PR/ϩ line, as confirmed by Southern Millipore); chicken anti- GFP (1:2,000, Abcam), tyrosine hydrox- blot. Further genotyping was performed by PCR with Math1 ylase (1:1,000, Abcam); goat anti- ␤-gal (1:1,000, Serotec); guinea forward primer (AGCGATGATGGCACAGAAG), Math1 re- pig anti- Vglut2 (1:2,000, Chemicon); sheep anti-Nos1 (1:2,000, verse primer (GAAGTCAAGTCGTTGCTAAC), and Cre*PR Millipore); and secondaries goat and donkey Alexa Fluor 488 and primer (ACTAAATGAACAGCGGATGAA), for a WT band of 555 (1:2,000, Molecular Probes), donkey Cy 3 and Cy5 (1:2,000, 288 bp and a Cre*PR band of 629bp. (See Fig. S2 for genomic Jackson Immuno Research), and DAPI nuclear counter stain targeting diagram, confirmation of insertion locus by Southern blot (1:10,000, Roche). Primary labeling was performed for 12 h at 4° C, and genetic complementation studies, and characterization of the Cre*PR followed by secondary labeling for6hat4°C.Slidesweremounted background activity and inducibility of the Math1 allele.) in Prolong Gold (Molecular Probes), and fluorescent staining was examined by confocal microscopy (Zeiss Axiovert LSM 510 and Solutions for Induction of Cre*PR Activity in Math1Cre*PR Mice. RU486 Leica TCS SP5 systems). was dissolved in 100% ethanol to 100 mg/mL and then in sesame oil For X-gal studies, multiple Math1LacZ embryos were collected at ϫ Ϫ as a carrier to a 15 stock (20 mg/mL) and stored at 20° C. E10.5, E11.5, E12.5, E13.5, E14.5, and E16.5, and multiple Progesterone was dissolved in sesame oil (20 mg/mL, 1ϫ stock) and Math1Cre*PR/ϩ;ROSALacZ/ϩ mice were collected between E18.5 and stored at room temperature. RU486 was thawed immediately P0 and as adults. For each time point, hindbrains were examined as before use, warmed to redissolve, and diluted to 1ϫ into the whole-mounts and with serial sections in coronal and sagittal progesterone/oil mix for injection (160 ␮L total volume). To planes. ␤-galactosidase (␤-gal) activity was assayed by staining with prevent abortions, progesterone was administered on the following X-gal (1 mg/mL) followed by paraffin embedding, as previously regimen: 3 mg given on preceding evening, 3 mg with RU486 on day described (7). The brain was isolated from E14.5 and older em- of induction, and continued daily afterward, tapering to 1 mg on bryos, whereas the whole embryo was stained for younger ages. E17.5, and none on E18.5. The Math1Cre*PR allele displayed tight Ten-␮m paraffin sections were counterstained with nuclear fast red regulation and good induction, requiring just a single dose of (8). Specimens were examined on a Zeiss Axioplan light micro- RU486 to label the expected populations on a given day (Fig. S2 scope and images were collected with a Zeiss AxioCam. D–F). Labeled cells were visible within 6–12 h of RU486 admin- istration, and the fraction of each population that was labeled Identification of Neuroanatomical Structures. Anatomical structures depended on the dose of RU486 administered. The developmental were determined by cross-referencing four atlases (9–12).

1. Wunderlich FT, Wildner H, Rajewsky K, Edenhofer F (2001) New variants of inducible Cre 8. Bermingham NA, et al. (2001) Proprioceptor pathway development is dependent on recombinase: a novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an Math1. Neuron 30:411–422. expanded range of inducibility. Nucleic Acids Res 29:E47. 9. Jacobowitz DM, Abbott LC (1997) Chemoarchitectonic Atlas of the Developing Mouse 2. Shimshek DR, et al. (2002) Codon-improved Cre recombinase (iCre) expression in the Brain (CRC Press, Boca Raton, Florida). mouse. Genesis 32:19–26. 10. Paxinos G, Ashwell KWS, Tork I (1994) Atlas of the Developing Rat Nervous System. 3. Meyers EN, Lewandoski M, Martin GR (1998) An Fgf8 mutant allelic series generated by (Academic, San Diego), 2nd Ed. Cre- and Flp-mediated recombination. Nat Genet 18:136–141. 11. Paxinos G, Carrive P, Wang H, Wang P (1999) Chemoarchitectonic Atlas of the Rat 4. Farley FW, Soriano P, Steffen LS, Dymecki SM (2000) Widespread recombinase expression Brainstem (Academic, San Diego, California). using FLPeR (ﬂipper) mice. Genesis 28:106–110. 12. Paxinos G (2007) Atlas of the Developing Mouse Brain: At E17.5, PO, and P6 (Elsevier 5. Gray PA (2008) Transcription factors and the genetic organization of brain stem respira- Academic, London) p 1. tory neurons. J Appl Physiol 104:1513–1521. 6. Wang VY, Rose MF, Zoghbi HY (2005) Math1 expression redeﬁnes the rhombic lip deriv- 13. Machold R, Fishell G (2005) Math1 is expressed in temporally discrete pools of cerebellar atives and reveals novel lineages within the brainstem and cerebellum. Neuron 48:31–43. rhombic-lip neural progenitors. Neuron 48:17–24. 7. Ben-Arie N, et al. (2000) Functional conservation of atonal and Math1 in the CNS and PNS. Development 127:1039–1048.

Rose et al. www.pnas.org/cgi/content/short/0911579106 1of7 Fig. S1. Novel Math1 lineages seen in the Math1LacZ/ϩ hindbrain. All coronal hemisections are oriented with lateral to the left. (A) Brainstem schematic: lines 1–6 indicate levels of coronal hemisections pictured in (AЈ) de- picting nuclei that contain new (dark blue) and previously known (light blue) Math1 lineages. (B) Serial coronal sections from an E16.5 Math1LacZ/ϩ hindbrain at approximate levels 2–5 in A, showing newly identiﬁed Math1 lineages (yellow arrowheads) in rela- tion to previously known populations (black arrowheads). Black and green boxed regions are magniﬁed in corresponding panels to the right of each image. Novel LacZ cells were present in the Pr5, ITR, BN, SON, X, MVe, SpVe, Sp5I, preBo¨ tC (asterisk indicates nucleus ambiguus), Pr, and Cu nuclei. Abbrevi- ations: Barrington’s (BN), cuneate (Cu), deep cerebellar (DN), dorsal cochlear (DC), dorsal lateral lemniscal (DLL), external cuneate (ECu), external granule layer (EGL), gracilis (Gr), interpolar division of the spinal trigeminal nucleus (Sp5I), intertrigeminal region (ITR), lateral dorsal tegmental (LDT), lateral reticular (LRt), locus coeruleus (LC), medullary reticular (MdD), parabrachial/Kolliker- Fuse (PB/KF), pedunculopontine (PPTg), pon- tine (PN), prepositus (Pr), principal sensory trigeminal (Pr5), medial vestibular (MVe), microcellular tegmental (MiTg), pre-Bo¨ tzinger complex (preBo¨ tC), reticulotegmental (Rtgn), rostroventrolateral reticular (RVL), rostral ventral respiratory group (rVRG), spinal vestibular (SpVe), superior olive (SON), ventral cochlear (VC), ventral lateral lemniscal (VLL), and X vestibular (X) nuclei.

Rose et al. www.pnas.org/cgi/content/short/0911579106 2of7 Fig. S2. Generation of a targeted hormonally inducible Math1Cre*PR allele. (A) Targeting schematic. The Cre-progesterone receptor fusion protein (Cre*PR) coding sequence plus frt-bounded PGK-Neo cassette was placed between intact Math1 5Ј and 3Ј homology arms (thick lines) (pMath1Cre*PR_Neo). This construct was then targeted to the Math1 genomic locus and the PGK-Neo cassette was removed by using mice expressing Flp. (B) Southern blot analysis of Math1Cre*PR_Neo/ϩ mice by using the 3Јprobe before (9.1 kb) and after (7.3 kb) removal of the PGK-Neo cassette, alongside WT (13 kb) and Math1LacZ/ϩ (7.5 kb) mice. (C) Genetic complementation analysis between Math1Cre*PR and Math1LacZ alleles. Math1Cre*PR/LacZ mice reproduced the Math1-null LacZ staining pattern. (D–F) Schematics of the Math1Cre*PR and ROSALacZ Cre reporter alleles and the resulting labeling in the adult cerebellum (parasagittal sections) under three conditions: (D) no RU486 versus single doses of RU486 on either (E) E14.5 or (F) E18.5. (D) Without RU486, the ROSA Cre-reportor locus remained inactive in most cells, with only occasional clonal populations labeled. (E and F) RU486 treatment caused Cre-mediated excision of the STOP in the ROSA locus and LacZ transcription in cells that expressed Math1 on the day of injection, reproducing the expected pattern for inductions (13) at E14.5 (rostrally restricted staining of granule layer indicated by dotted line) and E18.5 (staining throughout rostral–caudal extent of granule layer). (Scale bar: C, 1,500 ␮m; D–F, 700 ␮m.)

Rose et al. www.pnas.org/cgi/content/short/0911579106 3of7 Fig. S3. Temporally distinct lineage labeling within the adult hindbrain. (A and B) Coronal hindbrain slices arranged from rostral to caudal (top to bottom) from adult Math1Cre*PR/ϩ;ROSALacZ/ϩ mice induced either daily from E9.5-E11.5 (A) or with a single dose on E12.5 (B), labeling both previously known Math1-dependent populations (black arrowheads) and novel populations (yellow arrowheads). Abbreviations: Barrington’s (BN), cochlear (CN), cuneate (Cu), deep cerebellar (DN), dorsal cochlear (DC), external cuneate (ECu), interpolar division of the spinal trigeminal nucleus (Sp5I), lateral dorsal tegmental (LDT), lateral reticular (LRt), medial vestibular (MVe), microcellular tegmental (MiTg), parabrachial (PB), nucleus X (X), pedunculopontine (PPTg), prepositus (Pr), pre-Bo¨ tzinger complex (preBo¨ tC), principal sensory trigeminal (Pr5), reticulotegmental (Rtgn), rostroventrolateral reticular (RVL), superior olive (SON), and ventral cochlear (VC) nuclei. (Scale bar: A and B, 450 ␮m.)

Rose et al. www.pnas.org/cgi/content/short/0911579106 4of7 Fig. S4. Quantiﬁcation of Vglut2 expression in WT and Math1-null hindbrain nuclei. (A) Example pseudocolored images at the level of the Cu/Gr dorsal column nuclei in the medulla show cells with strong (red), medium (blue), and weak (yellow) expression of Vglut2 in the WT and Math1-null medulla. (B) A graph showing the quantiﬁcation of relative numbers of strong (red) and medium (blue) Vglut2 expressing neurons in select hindbrain nuclei in the Math1-null compared to WT. Abbreviations: Barrington’s (BN), cuneate (Cu), dorsal lateral lemniscal (Dll), external cuneate (ECu), gracilis (Gr), interpolar division of the spinal trigeminal nucleus (Sp5I), lateral dorsal tegmental (LDT), lateral reticular (LRt), locus coeruleus (LC), medullary reticular (MdD), parabrachial/Kolliker-Fuse (PB/KF), pedunculopontine (PPTg), microcellular tegmental (MiTg), pre-Bo¨ tzinger complex (preBo¨ tC), rostroventrolateral reticular (RVL), rostral ventral respiratory group (rVRG), and superior olive (SON) nuclei.

Rose et al. www.pnas.org/cgi/content/short/0911579106 5of7 Fig. S5. Neurotransmitters that persist in the Math1-null hindbrain. (A) Schematics of coronal hemisections from rostral to caudal positions (top to bottom), with nuclei containing Math1 lineages in blue. (B–E) Magniﬁcations from boxed regions in A beside each row from the corresponding positions on coronal sections of E18.5 WT and Math1Ϫ/Ϫ hindbrains stained with in situ hybridization probes for markers of GABA (Gad1, glutamic acid decarboxylase 1), norepinephrine (Dbh, dopamine beta hydroxylase), serotonin (Tph2, tryptophan hydroxylase 2), and substance P (Tac1, tachykinin 1) neurons. Small rearrangements of staining were seen near the locations of Math1 lineages in some cases, but no large increases or decreases in staining were observed for any of these markers. Abbreviations: Barrington’s (BN), cuneate (Cu), dorsal lateral lemniscal (Dll), external cuneate (ECu), gracilis (Gr), interpolar division of the spinal trigeminal nucleus (Sp5I), lateral dorsal tegmental (LDT), lateral reticular (LRt), locus coeruleus (LC), medullary reticular (MdD), parabrachial/Kolliker-Fuse (PB/KF), pedunculopontine (PPTg), microcellular tegmental (MiTg), pre-Bo¨ tzinger complex (preBo¨ tC), rostroventrolateral reticular (RVL), rostral ventral respiratory group (rVRG), and superior olive (SON) nuclei. (Scale bar: B–E, 500 ␮m.)

Rose et al. www.pnas.org/cgi/content/short/0911579106 6of7 Movies S1–S48. In situ marker analysis in hindbrains of WT and Math1-null mice. Serial coronal sections (25-␮m thick) from littermate-matched WT and Math1-null E18.5 hindbrains were stained for 24 distinct in situ hybridization probes, imaged, and compiled into image stacks presented here as movies progressing from the caudal to rostral extent of each hindbrain (medulla to cerebellum/pons to midbrain). Movies consist of every third section. Dorsal is up. Staining intensity and contrast were equalized for images by using Adobe Photoshop. See Methods for more details on the tissue preparation and in situ hybridization processing. These online image sets are meant to provide a resource of perinatal hindbrain transcription factor and neurotransmitter expression for the research community. Results from the following genes are shown.

Movies S1–S10. Transcription Factors. Npy (neuropeptide Y).

Barhl1 (barH-like 1). Movie S25 (AVI) WT. Movie S26 (AVI) Null. Movie S1 (AVI) WT. Movie S2 (AVI) Null. Penk1 (preproenkephalin, enkephalin marker).

Barhl2 (barH-like 2). Movie S27 (AVI) WT. Movie S28 (AVI) Null. Movie S3 (AVI) WT. Movie S4 (AVI) Null. Sst (somatostatin)

Lhx2 (lim homeobox protein 2). Movie S29 (AVI) WT. Movie S5 (AVI) WT. Movie S30 (AVI) Null. Movie S6 (AVI) Null. Sstr2 (somatostatin receptor 2). Lhx9 (lim homeobox protein 9). Movie S31 (AVI) WT. Movie S7 (AVI) WT. Movie S32 (AVI) Null. Movie S8 (AVI) Null. SubP (Tac1, substance P). Phox2b (paired-like homeobox 2b). Movie S33 (AVI) WT. Movie S9 (AVI) WT. Movie S34 (AVI) Null. Movie S10 (AVI) Null.

Movies S11–S48. Neurotransmitter and Receptor Markers. Th (tyrosine hydroxylase, levodopa/dopamine/norepinephrine marker). Movie S35 (AVI) WT. Crh (corticotropin releasing hormone). Movie S36 (AVI) Null. Movie S11 (AVI) WT. Movie S12 (AVI) Null. Tph2 (tryptophan hydroxylase 2, serotonin marker).

Dbh (dopamine beta hydroxylase, norepinephrine marker). Movie S37 (AVI) WT. Movie S38 (AVI) Null. Movie S13 (AVI) WT. Movie S14 (AVI) Null. Trh (thyrotropin releasing hormone).

Ddc (dopa decarboxylase, dopamine/norepinephrine marker). Movie S39 (AVI) WT. Movie S40 (AVI) Null. Movie S15 (AVI) WT. Movie S16 (AVI) Null. Vacht (Slc18a3, acetylcholine marker). Gad1 (glutamic acid decarboxylase 1, GABA marker). Movie S41 (AVI) WT. Movie S17 (AVI) WT. Movie S42 (AVI) Null. Movie S18 (AVI) Null. Vglut1 (Slc17a7, glutamate marker). Glyt2 (Slc6a5, glycine marker). Movie S43 (AVI) WT. Movie S19 (AVI) WT. Movie S44 (AVI) Null. Movie S20 (AVI) Null. Vglut2 (Slc17a6, glutamate marker). Htr1a (serotonin receptor 1a). Movie S45 (AVI) WT. Movie S21 (AVI) WT. Movie S22 (AVI) Null. Movie S46 (AVI) Null.

Nos1 (nitric oxide synthase 1, nitric oxide marker). Vglut3 (Slc17a8).

Movie S23 (AVI) WT. Movie S47 (AVI) WT. Movie S24 (AVI) Null. Movie S48 (AVI) Null.

Rose et al. www.pnas.org/cgi/content/short/0911579106 7of7