The History of Life Through Evolutionary Computation

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Prior to our understanding of DNA and yeast. This publication provided a offered to solve the phylogenetic recon- molecular sequence information, paleon- tremendous opportunity for the use of struction problem, some using evolution- tologists inferred the history of life on biological sequence information as “mol- ary algorithms. Earth by comparing morphological charac- ecular fossils” of information that could teristics (preserved phenotypic traits) be compared between extant organisms Challenges in phylogenetics found in fossils. Accurate estimation of this to determine their evolution. Seemingly The phylogenetics problem can be history of life or “phylogeny” was general- all that was required was additional loosely defined as the search for a tree- ly only possible for those organisms that sequence information and better comput- like structure that defines ancestral rela- had “hard parts” capable of preservation, ers and algorithms for their interpreta- tionships between related objects over died in a “fossilization-friendly” context, tion. Assessing the reliability of phyloge- time. The related objects can be any- and were unearthed over time only to be nies involves difficult statistical and com- thing from biological sequence informa- discovered by a very fortunate paleontolo- putational problems, including the NP- tion to morphological characters. The gist. According to Newton and Laporte, complete problems of sequence align- divergence over evolutionary time rep- paleontologists are the first to recognize ment and discovering the best phyloge- resented is captured in a treelike struc- the incompleteness of the fossil record and netic tree that fits the data. ture termed a “phylogeny” (Fig. 1). The the resulting difficulty of formulating evo- Given modern databases filled with number of unrooted, birfurcating tree lutionary relationships between extant sequence information, interest has turned topologies T for n taxa is given by organisms. It is a shame that many of from one of generating sequence to Earth’s organisms have very likely left no rapid interpretation and discovery of (2n − 5)! trace of their existence. “true” phylogenies for their application in T = .(1) ( − ) n−3 Our ability to infer evolutionary histo- not only the resolution of the history of n 3 !2 ries changed significantly following the life but also for epidemiology as it relates discovery of the genetic code. Fitch and to human disease. Three developments In general, three possible methods Margoliash were the first to offer a com- have been essential in this progression: are used to search for the best topolo- puter process for the construction of 1) the development of criteria and algo- gy from this set of possible trees: 1) phylogenetic trees from protein sequence rithms for discriminating among potential exhaustive methods, 2) branch and information, specifically for 20 phylogenies, 2) increased computational bound methods, and 3) heuristic meth- cytochrome C protein sequences (the power over time, and 3) the rapid ods. In analogy to the traveling sales- most for any protein to that date) that increase in sequence data availability. An man problem (TSP), exhaustive meth- had been elucidated from humans to assortment of algorithms has been ods are useful when the number of The History of Life Gary B. Fogel Through Evolutionary Computation ©CORBIS, RUBBERBALL AUGUST/SEPTEMBER 2005 0278-6648/05/$20.00 © 2005 IEEE 29 possible tree topologies (TSP routes) is efficiently search large numbers of char- is the one that groups taxa together with low. This is possible when the number acter states and infer “reasonable” his- similar characteristics and minimizes the of n taxa being compared is low (on torical relationships between organisms. number of observed overall changes in the order of ≤12) but rapidly becomes Additional confidence in a proposed the tree. There are several statistical infeasible with larger numbers of taxa. phylogeny results from overlap of “best” inconsistencies with this approach, most Branch and bound methods exclude trees generated from different sequence notably long-branch attraction and trees that do not meet specific criteria, or character sets. unequal rates of evolution. reducing the search space to a more It should be noted that one key dis- Distance methods are a second com- reasonable size and increasing the covery of 20th century evolutionary biol- mon method to infer phylogeny. These probability of an exact solution of ogy was the determination of a “tree of methods use pairwise distance calcula- merit. However, there are still limita- life” based purely on molecular tions for characters (e.g., a pairwise cal- tions on the upper number of taxa that sequences for a set of genes (ribosomal culation of mismatches measured across can be used with this approach. RNA genes) that are common to essen- all positions of a nucleotide sequence Heuristic searches commonly are tially all forms of extant life. According to alignment). A model of sequence evolu- used to build tree topologies either by Pace, the tree of life has reshaped our tion is then applied to the distance matrix changing the order in which the trees thinking of the evolution of life on Earth to correct for unobserved changes and are built or via branch swapping with and helped us identify the three major chance similarities. If the model of some metric of scoring (such as a parsi- kingdoms of life (eukarya, bacteria, and sequence evolution is accurate, then the mony) being used to determine which archaea). Phylogenetic methods are now correct tree can be recovered. These changes are more useful than others. It integral parts of almost every major area models may be specific to the characters is easy to envision how evolutionary of evolutionary biology and several parts that are being investigated. It is clear that computation can be applied in this of ecology. Those interested in learning models of sequence evolution do not regard as a method of global optimiza- more about recent discoveries in this work equally well over all character sets. tion where the best resulting tree topol- area are referred to Assembling the Tree Thus, this approach works maximally as ogy is estimated after searching only a of Life and the Tree of Life web project well as the model of sequence evolution. small fraction of the search space. An <http://tolweb.org/tree/phylogeny.html>. Maximum likelihood methods repre- unfortunate consequence of this approx- sent a third common method of phyloge- imation is that the resulting tree topolo- Phylogenetic methods netic inference. This approach is general- gy cannot be guaranteed to be optimal; Correct alignment of the sequence ly similar to maximum parsimony. How- however, it does allow the researcher to information is generally a critical first ever, maximum likelihood methods use a component of phyloge- specified model of sequence evolution to netic analysis and can assign a value of confidence to ancestral be difficult when there states. Maximum parsimony methods are large numbers of assume that a shared character between Human AATAATATTCTTTATGACAACTCATTTGATTT sequences to be com- two extant taxa must have also existed in Monkey AATAATATTCTTTATGACAATTCATTTGATTT pared, when the the ancestor of those two taxa. Maximum Mouse AATAATATTCTTTATCGCAACTCATTTGATTT sequences are long, and likelihood methods assign a confidence when the sequences to the existence of that ancestral charac- Kangaroo AATAAAATTCTTTATCGCAATTCATTTGAAAT have limited evolution- ter based on the distance (or length of ary conservation. time) that exists between the two extant Parsimony is a com- taxa. As a result, maximum likelihood mon method used to methods tend to be more computational- infer phylogenetic trees. ly intensive than parsimony methods. This method is based They also share the same requirements on the hypothesis that as distance methods for a model of Human the “best” tree in the sequence evolution specific to the char- space of all possible acter set under investigation. However, trees is the one that maximum likelihood approaches can Monkey explains the relation- improve tree inference when the ship between the extant sequences are not closely related. All taxa with the fewest three of the above approaches are the Mouse number of evolutionary subject of considerable investigation in changes throughout the the literature and are the subject of opti- tree. The principle of mization with simulated evolution. Kangaroo inheritance implies that Fig. 1 Phylogenetic reconstruction. The nucleotide sequences when a characteristic Applications of evolutionary for four organisms are aligned and in this simple example are state is modified in a computation to phylogenetics highly similar except for six positions noted as (“|”). At each of species, the descen- Evolutionary computation has been these informative positions (characters), change has occurred dents of that species applied to phylogenetic reconstruction over evolutionary time. All other nucleotide positions are invariant and not required for proper phylogenetic will have a high proba- for 10 years. Matsuda was the first to reconstruction. Combining key characters and resolving the bility of sharing that use evolutionary algorithms for phylo- true phylogeny is challenging when the number and type of characteristic. Thus the genetic reconstruction, doing so with characters/taxa increases. most parsimonious tree protein sequences. Since that time, 30 IEEE POTENTIALS these strategies have been extended for PAUP
Recommended publications
  • Completely Derandomized Self-Adaptation in Evolution Strategies

    Completely Derandomized Self-Adaptation in Evolution Strategies

    Completely Derandomized Self-Adaptation in Evolution Strategies Nikolaus Hansen [email protected] Technische Universitat¨ Berlin, Fachgebiet fur¨ Bionik, Sekr. ACK 1, Ackerstr. 71–76, 13355 Berlin, Germany Andreas Ostermeier [email protected] Technische Universitat¨ Berlin, Fachgebiet fur¨ Bionik, Sekr. ACK 1, Ackerstr. 71–76, 13355 Berlin, Germany Abstract This paper puts forward two useful methods for self-adaptation of the mutation dis- tribution – the concepts of derandomization and cumulation. Principle shortcomings of the concept of mutative strategy parameter control and two levels of derandomization are reviewed. Basic demands on the self-adaptation of arbitrary (normal) mutation dis- tributions are developed. Applying arbitrary, normal mutation distributions is equiv- alent to applying a general, linear problem encoding. The underlying objective of mutative strategy parameter control is roughly to favor previously selected mutation steps in the future. If this objective is pursued rigor- ously, a completely derandomized self-adaptation scheme results, which adapts arbi- trary normal mutation distributions. This scheme, called covariance matrix adaptation (CMA), meets the previously stated demands. It can still be considerably improved by cumulation – utilizing an evolution path rather than single search steps. Simulations on various test functions reveal local and global search properties of the evolution strategy with and without covariance matrix adaptation. Their per- formances are comparable only on perfectly scaled functions. On badly scaled, non- separable functions usually a speed up factor of several orders of magnitude is ob- served. On moderately mis-scaled functions a speed up factor of three to ten can be expected. Keywords Evolution strategy, self-adaptation, strategy parameter control, step size control, de- randomization, derandomized self-adaptation, covariance matrix adaptation, evolu- tion path, cumulation, cumulative path length control.
  • A New Biogeography-Based Optimization Approach Based on Shannon-Wiener Diversity Index to Pid Tuning in Multivariable System

    A New Biogeography-Based Optimization Approach Based on Shannon-Wiener Diversity Index to Pid Tuning in Multivariable System

    ABCM Symposium Series in Mechatronics - Vol. 5 Section III – Emerging Technologies and AI Applications Copyright © 2012 by ABCM Page 592 A NEW BIOGEOGRAPHY-BASED OPTIMIZATION APPROACH BASED ON SHANNON-WIENER DIVERSITY INDEX TO PID TUNING IN MULTIVARIABLE SYSTEM Marsil de Athayde Costa e Silva, [email protected] Undergraduate course of Mechatronics Engineering Camila da Costa Silveira, [email protected] Leandro dos Santos Coelho, [email protected] Industrial and Systems Engineering Graduate Program, PPGEPS Pontifical Catholic University of Parana, PUCPR Imaculada Conceição, 1155, Zip code 80215-901, Curitiba, Parana, Brazil Abstract. Proportional-integral-derivative (PID) control is the most popular control architecture used in industrial problems. Many techniques have been proposed to tune the gains for the PID controller. Over the last few years, as an alternative to the conventional mathematical approaches, modern metaheuristics, such as evolutionary computation and swarm intelligence paradigms, have been given much attention by many researchers due to their ability to find good solutions in PID tuning. As a modern metaheuristic method, Biogeography-based optimization (BBO) is a generalization of biogeography to evolutionary algorithm inspired on the mathematical model of organism distribution in biological systems. BBO is an evolutionary process that achieves information sharing by biogeography-based migration operators. This paper proposes a modification for the BBO using a diversity index, called Shannon-wiener index (SW-BBO), for tune the gains of the PID controller in a multivariable system. Results show that the proposed SW-BBO approach is efficient to obtain high quality solutions in PID tuning. Keywords: PID control, biogeography-based optimization, Shannon-Wiener index, multivariable systems.
  • Genetic Algorithms for Applied Path Planning a Thesis Presented in Partial Ful Llment of the Honors Program Vincent R

    Genetic Algorithms for Applied Path Planning a Thesis Presented in Partial Ful Llment of the Honors Program Vincent R

    Genetic Algorithms for Applied Path Planning A Thesis Presented in Partial Ful llment of the Honors Program Vincent R. Ragusa Abstract Path planning is the computational task of choosing a path through an environment. As a task humans do hundreds of times a day, it may seem that path planning is an easy task, and perhaps naturally suited for a computer to solve. This is not the case however. There are many ways in which NP-Hard problems like path planning can be made easier for computers to solve, but the most signi cant of these is the use of approximation algorithms. One such approximation algorithm is called a genetic algorithm. Genetic algorithms belong to a an area of computer science called evolutionary computation. The techniques used in evolutionary computation algorithms are modeled after the principles of Darwinian evolution by natural selection. Solutions to the problem are literally bred for their problem solving ability through many generations of selective breeding. The goal of the research presented is to examine the viability of genetic algorithms as a practical solution to the path planning problem. Various modi cations to a well known genetic algorithm (NSGA-II) were implemented and tested experimentally to determine if the modi cation had an e ect on the operational eciency of the algorithm. Two new forms of crossover were implemented with positive results. The notion of mass extinction driving evolution was tested with inconclusive results. A path correction algorithm called make valid was created which has proven to be extremely powerful. Finally several additional objective functions were tested including a path smoothness measure and an obstacle intrusion measure, the latter showing an enormous positive result.
  • The Roles of Evolutionary Computation, Fitness Landscape, Constructive Methods and Local Searches in the Development of Adaptive Systems for Infrastructure Planning

    The Roles of Evolutionary Computation, Fitness Landscape, Constructive Methods and Local Searches in the Development of Adaptive Systems for Infrastructure Planning

    International Symposium for Next Generation Infrastructure October 1-4, 2013, Wollongong, Australia The roles of evolutionary computation, fitness landscape, constructive methods and local searches in the development of adaptive systems for infrastructure planning Mehrdad Amirghasemi a* Reza Zamani a Abstract: Modelling and systems simulation for improving city planning, and traffic equilibrium are involved with the development of adaptive systems that can learn and respond to the environment intelligently. By employing sophisticated techniques which highly support infrastructure planning and design, evolutionary computation can play a key role in the development of such systems. The key to presenting solution strategies for these systems is fitness landscape which makes some problems hard and some problems easy to tackle. Moreover, constructive methods and local searches can assist evolutionary searches to improve their performance. In this paper, in the context of infrastructure, in general, and city planning, and traffic equilibrium, in particular, the integration of these four concepts is briefly discussed. Key words: Evolutionary computation; Local search; Infrastructure; City planning; Traffic equilibrium. I. Introduction Infrastructure is a term used to indicate both organizational and physical structures a society or an enterprise needs to function. In effect, all facilities and services needed for the operation of an economy is gathered under the umbrella term of “Infrastructure”. Each Infrastructure includes connected elements which are structurally related and each element can affect the other elements. It is through this interconnection that these elements collectively provide a basis for structural development of a society or an enterprise. Viewed in an operative level, infrastructure makes the production of goods and services required in the society more straightforward and the distribution of finished products to market easier.
  • Sustainable Growth and Synchronization in Protocell Models

    Sustainable Growth and Synchronization in Protocell Models

    life Article Sustainable Growth and Synchronization in Protocell Models Roberto Serra 1,2,3 and Marco Villani 1,2,* 1 Department of Physics, Informatics and Mathematics, Modena and Reggio Emilia University, Via Campi 213/A, 41125 Modena, Italy 2 European Centre for Living Technology, Ca’ Bottacin, Dorsoduro 3911, Calle Crosera, 30123 Venice, Italy 3 Institute for Advanced Study, University of Amsterdam, Oude Turfmarkt 147, 1012 GC Amsterdam, The Netherlands * Correspondence: [email protected] Received: 19 July 2019; Accepted: 14 August 2019; Published: 21 August 2019 Abstract: The growth of a population of protocells requires that the two key processes of replication of the protogenetic material and reproduction of the whole protocell take place at the same rate. While in many ODE-based models such synchronization spontaneously develops, this does not happen in the important case of quadratic growth terms. Here we show that spontaneous synchronization can be recovered (i) by requiring that the transmembrane diffusion of precursors takes place at a finite rate, or (ii) by introducing a finite lifetime of the molecular complexes. We then consider reaction networks that grow by the addition of newly synthesized chemicals in a binary polymer model, and analyze their behaviors in growing and dividing protocells, thereby confirming the importance of (i) and (ii) for synchronization. We describe some interesting phenomena (like long-term oscillations of duplication times) and show that the presence of food-generated autocatalytic cycles is not sufficient to guarantee synchronization: in the case of cycles with a complex structure, it is often observed that only some subcycles survive and synchronize, while others die out.
  • Arxiv:1803.03453V4 [Cs.NE] 21 Nov 2019

    Arxiv:1803.03453V4 [Cs.NE] 21 Nov 2019

    The Surprising Creativity of Digital Evolution: A Collection of Anecdotes from the Evolutionary Computation and Artificial Life Research Communities Joel Lehman1†, Jeff Clune1, 2†, Dusan Misevic3†, Christoph Adami4, Lee Altenberg5, Julie Beaulieu6, Peter J Bentley7, Samuel Bernard8, Guillaume Beslon9, David M Bryson4, Patryk Chrabaszcz11, Nick Cheney2, Antoine Cully12, Stephane Doncieux13, Fred C Dyer4, Kai Olav Ellefsen14, Robert Feldt15, Stephan Fischer16, Stephanie Forrest17, Antoine Fr´enoy18, Christian Gagn´e6 Leni Le Goff13, Laura M Grabowski19, Babak Hodjat20, Frank Hutter11, Laurent Keller21, Carole Knibbe9, Peter Krcah22, Richard E Lenski4, Hod Lipson23, Robert MacCurdy24, Carlos Maestre13, Risto Miikkulainen26, Sara Mitri21, David E Moriarty27, Jean-Baptiste Mouret28, Anh Nguyen2, Charles Ofria4, Marc Parizeau 6, David Parsons9, Robert T Pennock4, William F Punch4, Thomas S Ray29, Marc Schoenauer30, Eric Schulte17, Karl Sims, Kenneth O Stanley1,31, Fran¸coisTaddei3, Danesh Tarapore32, Simon Thibault6, Westley Weimer33, Richard Watson34, Jason Yosinski1 †Organizing lead authors 1 Uber AI Labs, San Francisco, CA, USA 2 University of Wyoming, Laramie, WY, USA 3 Center for Research and Interdisciplinarity, Paris, France 4 Michigan State University, East Lansing, MI, USA 5 Univeristy of Hawai‘i at Manoa, HI, USA 6 Universit´eLaval, Quebec City, Quebec, Canada 7 University College London, London, UK 8 INRIA, Institut Camille Jordan, CNRS, UMR5208, 69622 Villeurbanne, France 9 Universit´ede Lyon, INRIA, CNRS, LIRIS UMR5205, INSA, UCBL,
  • A Note on Evolutionary Algorithms and Its Applications

    A Note on Evolutionary Algorithms and Its Applications

    Bhargava, S. (2013). A Note on Evolutionary Algorithms and Its Applications. Adults Learning Mathematics: An International Journal, 8(1), 31-45 A Note on Evolutionary Algorithms and Its Applications Shifali Bhargava Dept. of Mathematics, B.S.A. College, Mathura (U.P)- India. <[email protected]> Abstract This paper introduces evolutionary algorithms with its applications in multi-objective optimization. Here elitist and non-elitist multiobjective evolutionary algorithms are discussed with their advantages and disadvantages. We also discuss constrained multiobjective evolutionary algorithms and their applications in various areas. Key words: evolutionary algorithms, multi-objective optimization, pareto-optimality, elitist. Introduction The term evolutionary algorithm (EA) stands for a class of stochastic optimization methods that simulate the process of natural evolution. The origins of EAs can be traced back to the late 1950s, and since the 1970’s several evolutionary methodologies have been proposed, mainly genetic algorithms, evolutionary programming, and evolution strategies. All of these approaches operate on a set of candidate solutions. Using strong simplifications, this set is subsequently modified by the two basic principles of evolution: selection and variation. Selection represents the competition for resources among living beings. Some are better than others and more likely to survive and to reproduce their genetic information. In evolutionary algorithms, natural selection is simulated by a stochastic selection process. Each solution is given a chance to reproduce a certain number of times, dependent on their quality. Thereby, quality is assessed by evaluating the individuals and assigning them scalar fitness values. The other principle, variation, imitates natural capability of creating “new” living beings by means of recombination and mutation.
  • Analysis of Evolutionary Algorithms

    Analysis of Evolutionary Algorithms

    Why We Do Not Evolve Software? Analysis of Evolutionary Algorithms Roman V. Yampolskiy Computer Engineering and Computer Science University of Louisville [email protected] Abstract In this paper, we review the state-of-the-art results in evolutionary computation and observe that we don’t evolve non-trivial software from scratch and with no human intervention. A number of possible explanations are considered, but we conclude that computational complexity of the problem prevents it from being solved as currently attempted. A detailed analysis of necessary and available computational resources is provided to support our findings. Keywords: Darwinian Algorithm, Genetic Algorithm, Genetic Programming, Optimization. “We point out a curious philosophical implication of the algorithmic perspective: if the origin of life is identified with the transition from trivial to non-trivial information processing – e.g. from something akin to a Turing machine capable of a single (or limited set of) computation(s) to a universal Turing machine capable of constructing any computable object (within a universality class) – then a precise point of transition from non-life to life may actually be undecidable in the logical sense. This would likely have very important philosophical implications, particularly in our interpretation of life as a predictable outcome of physical law.” [1]. 1. Introduction On April 1, 2016 Dr. Yampolskiy posted the following to his social media accounts: “Google just announced major layoffs of programmers. Future software development and updates will be done mostly via recursive self-improvement by evolving deep neural networks”. The joke got a number of “likes” but also, interestingly, a few requests from journalists for interviews on this “developing story”.
  • Genetic Algorithms and Evolutionary Computation

    Genetic Algorithms and Evolutionary Computation

    126 IJCSNS International Journal of Computer Science and Network Security, VOL.10 No.12, December 2010 Genetic Algorithms and Evolutionary Computation Ms.Nagori Meghna, Faculty of EngineeringGovernment EnggCollege Aurangabad, -431432, India Ms. KaleJyoti Faculty of Engineering MGM’c Engg College Nanded, -411402, India Abstract from the wild type), and dairy cows (with immense udders Generally speaking, genetic algorithms are simulations of far larger than would be required just for nourishing evolution, of what kind ever. In most cases, however, genetic offspring).Critics might charge that creationists can algorithms are nothing else than probabilistic optimization explain these things without recourse to evolution. For methods which are based on the principles of evolution. Using example, creationists often explain the development of simulation and Genetic Algorithms to improve cluster tool resistance to antibiotic agents in bacteria, or the changes performance, Mooring Pattern Optimization using Genetic wrought in domesticated animals by artificial selection, by Algorithms. This paper is designed to cover a few important application aspects of genetic algorithm under a single umbrella. presuming that God decided to create organisms in fixed Key words: groups, called "kinds" or baramin. Though natural Genetic Algorithm microevolution or human-guided artificial selection can bring about different varieties within the originally created "dog-kind," or "cow-kind," or "bacteria-kind" (!), Introduction no amount of time or genetic change can transform one "kind" into another. However, exactly how the creationists determine what a "kind" is, or what mechanism prevents Creationists occasionally charge that evolution is useless living things from evolving beyond its boundaries, is as a scientific theory because it produces no practical invariably never explained.
  • Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems

    Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems

    Cleveland State University EngagedScholarship@CSU Electrical Engineering & Computer Science Electrical Engineering & Computer Science Faculty Publications Department 7-2010 Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems Haiping Ma Shaoxing University, Shaoxing, China, [email protected] Daniel J. Simon Cleveland State University, [email protected] Follow this and additional works at: https://engagedscholarship.csuohio.edu/enece_facpub Part of the Electrical and Computer Engineering Commons How does access to this work benefit ou?y Let us know! Publisher's Statement ACM New York, NY, USA ©2010 Original Citation H. Ma and D. Simon. (2010). Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems. Genetic and Evolutionary Computation Conference, 417-418. Repository Citation Ma, Haiping and Simon, Daniel J., "Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems" (2010). Electrical Engineering & Computer Science Faculty Publications. 184. https://engagedscholarship.csuohio.edu/enece_facpub/184 This Conference Proceeding is brought to you for free and open access by the Electrical Engineering & Computer Science Department at EngagedScholarship@CSU. It has been accepted for inclusion in Electrical Engineering & Computer Science Faculty Publications by an authorized administrator of EngagedScholarship@CSU. For more information, please contact [email protected]. Biogeography-Based Optimization with Blended Migration for Constrained Optimization Problems Haiping Ma Dan Simon Shaoxing University Cleveland State University Shaoxing, Zhejiang, 312000, China Cleveland, Ohio [email protected] [email protected] ABSTRACT and which is motivated by blended crossover in GAs [6]. Blended Biogeography-based optimization (BBO) is a new evolutionary migration is defined as algorithm based on the science of biogeography.
  • A Short Introduction to Evolutionary Computation (In 50 Minutes)

    A Short Introduction to Evolutionary Computation (In 50 Minutes)

    A Short Introduction to Evolutionary Computation (in 50 minutes) Fernando Lobo University of Algarve Outline • Why EC in 50 minutes? • The basic idea of a Genetic Algorithm • Application example Why EC in 50 minutes? • If I only had 50 minutes to talk to someone about Evolutionary Computation, this is what I would show them. • Two purposes: – to show you the basic idea quickly, without getting involved in too much details and theory. – to get you very motivated to study this topic. Many variations on EC • There’s a variety of classes of Evolutionary Algorithms – Genetic Algorithms (GAs) – Evolution Strategies (ES) – Evolutionary Programming (EP) – Genetic Programming (GP) – … • In this lecture, we will only look at the so-called Simple Genetic Algorithm. What is a Genetic Algorithm (GA)? • It is a search procedure based on the mechanics of natural selection and genetics. • Often used to solve difficult optimization problems. Evolution • Evolution can be seen as an optimization process where living creatures constantly adapt to their environment. – the stronger survive and propagate their traits to future generations – the weaker die and their traits tend to disappear. • Darwin’s survival of the fittest. How do GAs differ from other techniques? • Work with a population of solutions, rather than a single solution. • Use probabilistic rather than deterministic mechanisms. Two essential components – Selection – Variation • recombination (or crossover) • mutation When should we use a GA? • When other simpler methods are not good enough. • When we don’t have much knowledge about the problem that we are trying to solve. • … and when the search space is very large (making complete enumeration unfeasible).
  • A Model of Protocell Based on the Introduction of a Semi-Permeable Membrane in a Stochastic Model of Catalytic Reaction Networks

    A Model of Protocell Based on the Introduction of a Semi-Permeable Membrane in a Stochastic Model of Catalytic Reaction Networks

    A model of protocell based on the introduction of a semi-permeable membrane in a stochastic model of catalytic reaction networks Roberto Serra Marco Villani Department of Physics, Informatics and Mathematics Modena and Reggio Emilia University ECLT European Centre for Living Technology S. Marco 2940, University of Ca’ Foscari, Venice (IT) [email protected] [email protected] Alessandro Filisetti ECLT European Centre for Living Technology S. Marco 2940, University of Ca’ Foscari, Venice (IT) [email protected] Alex Graudenzi Chiara Damiani Department of Informatics Systems and Communication, University of Milan Bicocca [email protected] [email protected] Abstract The theoretical characterization of the self-organizing molecular structures emerging from ensembles of distinct interacting chemicals turns to be very important in revealing those dynamics that led to the transition from the non-living to the living matter as well as in the design of artificial protocells [12, 13, 14]. In this work we aim at studying the role of a semi-permeable membrane, i.e. a very simple protocell description, in the dynamics of a stochastic model describing randomly generated catalytic reaction sets (CRSs) of molecules. Catalytic reaction sets are networks composed of different molecules interacting together leading to the formation of several reaction pathways. In particular, molecules are representation of molecular species formed by a concatenation of letters (bricks) from a finite alphabet. Reaction pathways are formed by two kinds of reaction only, namely condensation, where two molecular species are glued together in order to create a longer species and cleavage where a molecular species is divided in two shorter species, Figure 1, Filisetti et al.