Role of the Glyoxylate Pathway in Acetic Acid Production by Acetobacter Aceti

Role of the glyoxylate pathway in acetic acid production by Acetobacter aceti

Kenta Sakurai, Shoko Yamazaki, Masaharu Ishii, Yasuo Igarashi, and Hiroyuki Arai*

Department of Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan

Received 7 June 2012; accepted 26 July 2012 Available online 16 August 2012

Wild-type Acetobacter aceti NBRC 14818 possesses genes encoding isocitrate lyase (aceA) and malate synthase (glcB), which constitute the glyoxylate pathway. In contrast, several acetic acid bacteria that are utilized for vinegar production lack these genes. Here, an aceAeglcB knockout mutant of NBRC 14818 was constructed and used for investigating the role of the glyoxylate pathway in acetate productivity. In medium containing ethanol as a carbon source, the mutant grew normally during ethanol oxidation to acetate, but exhibited slower growth than that of the wild-type strain as the accumulated acetate was oxidized. The mutant grew similarly to that of the wild-type strain in medium containing glucose as a carbon source, indicating that the glyoxylate pathway was not necessary for glucose utilization. However, in medium containing both ethanol and glucose, the mutant exhibited signiﬁcantly poorer growth and lower glucose consumption compared to the wild-type strain. Notably, the mutant oxidized ethanol nearly stoichiometrically to acetate, which was retained in the medium for a longer period of time than the acetate produced by wild-type strain. The features of the aceAeglcB knockout mutant revealed here indicate that the lack of the glyoxylate pathway is advantageous for industrial vinegar production by A. aceti. Ó 2012, The Society for Biotechnology, Japan. All rights reserved.

[Key words: Glyoxylate pathway; Acetate production; Ethanol; Incomplete oxidation; Knockout mutant; Acetobacter aceti]

Acetic acid bacteria are obligately aerobic a-proteobacteria pathway might have an important role in acetate overoxidation by that have the distinctive ability to produce organic acids by the acetic acid bacteria. incomplete oxidization of various alcohols and sugars (1). The Genome analyses of wild-type Acetobacter aceti NBRC 14818 and incomplete oxidation reactions, which are catalyzed by Gluconacetobacter diazotrophicus Pal5 have shown that they both membrane-bound pyrroloquinoline quinone (PQQ)-dependent possess genes encoding isocitrate lyase (aceA) and malate synthase dehydrogenases, are connected to the respiratory chain via (glcB) (5,6). In contrast, these genes are missing in several acetic quinones. The reduced quinones are reoxidized by terminal acid bacteria that are utilized for vinegar production, such as oxidases using molecular oxygen. Thus, acetic acid bacteria are Acetobacter pasteurianus NBRC 3283 and A. aceti 1023 (7,8), sug- able to produce energy by the incomplete oxidation of alcohols gesting a relationship exists between the glyoxylate pathway and and sugars. Acetobacter and most Gluconacetobacter species acetate productivity. produce acetate from ethanol and are predominantly utilized In the present work, we constructed an aceAeglcB knockout for vinegar production. However, after the consumption of mutant of A. aceti NBRC 14818 and examined the effect of the ethanol, the produced acetate is occasionally completely glyoxylate pathway deﬁciency on acetate production by A. aceti. oxidized. This phenomenon is termed acetate overoxidation and is unfavourable for vinegar production due to decreased MATERIALS AND METHODS yields. Evidence suggests that acetate overoxidation is caused by the Bacterial strains and growth media A. aceti NBRC 14818 (formerly IFO increased activities of tricarboxylic acid (TCA) cycle enzymes and 14818) and its isogenic aceAeglcB mutant, designated strain GP, were used in this acetyl-CoA synthetase (2,3). When carbon sources that are study. The strains were grown in basal medium (1% yeast extract) at 30�C with rotary shaking at 300 rpm. When necessary, the basal medium was supplemented with metabolized through acetyl-CoA as an obligate intermediate are 200 mM ethanol (ethanol medium), 200 mM glucose (glucose medium), or 200 mM utilized, the glyoxylate pathway, which consists of isocitrate lyase ethanol and 200 mM glucose (mixed medium). and malate synthase, generally functions as an anaplerotic shunt of Construction of an aceAeglcB knockout mutant of A. aceti NBRC the TCA cycle to supply oxaloacetate (4). Therefore, the glyoxylate 14818 The aceA and glcB genes, which are clustered in the genome of NBRC 14818 (5), were knocked out by homologous recombination using the plasmid pUC- aceAglcB, which was constructed as follows. Two 1.2-kb fragments carrying the * Corresponding author. Tel.: 81 3 5841 1741; fax: 81 3 5841 5272. upstream and downstream regions of aceA and glcB were ampliﬁed by PCR with þ þ E-mail address: [email protected] (H. Arai). the primer sets aceAglcB1 (ACCTCATGGTACCCTCCCTTCCATGTCG)-aceAglcB2 (ACCTT Abbreviations: ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; CGTCGACCCGGAAGAAGCCTTCC) and aceAglcB3 (ACCGGTCGACGTGATCGACGCCG CFE, cell-free extract; DCIP, 2,6-dichlorophenolindophenol; PMS, phenazine CGATCC)-aceAglcB4 (GAACGCTGCAGGCTGGTCATCACAGGG), respectively, and methosulfate; PQQ, pyrroloquinoline quinone. tandemly inserted into the KpnIeSalI and SalIePstI sites, respectively, of pUC18

Reproduced from J. Biosci. Bioeng. 115: 32-36 (2013).

47 47 (9). A tetracycline-resistance gene cassette, which was obtained as a SalI fragment 2.5 from pPS854tet (10), was then cloned into the plasmid at the SalI site. The constructed plasmid, designated pUC-aceAglcB, was transformed into NBRC 14818 A by electroporation, and aceAeglcB knockout mutants were then isolated on 2.0 tetracycline-containing plates. One of the mutants was selected and designated strain GP. Mutation of the aceA and glcB genes was conﬁrmed by PCR (data not

600 1.5 shown) and by comparing the isocitrate lyase activities of strains NBRC 14818 and

GP grown in mixed medium, which were 94.4 and 0.9 nmol/min/mg protein, OD respectively. 1.0 Preparation of cell-free extract Strains NBRC 14818 and GP were grown aerobically in 100 ml ethanol medium or mixed medium in a 300-ml Erlenmeyer 0.5 flask at 30�C with rotary shaking at 150 rpm. When the optical density at 600 nm (OD600) of the culture reached 0.3e0.5, bacterial cells were harvested by centrifu- 0 gation at 10,200 g for 10 min at 4 C and then washed twice with ice-cold 50 mM � � potassium phosphate buffer (KPB; pH 7.5). The cell pellet was resuspended in KPB at 250 a rate of 1 g wet weight/4 ml buffer, and the cell suspension was then passed twice B through a French pressure cell (American Instruments Company) at 16,000 psi. After 200 removing intact cells by centrifugation at 5800 g for 15 min at 4 C, the resulting � � supernatant was collected as cell-free extract (CFE). 150 Enzyme activity assays The enzymatic activities of ethanol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) were determined spectrophoto- 100 metrically at 25�C, as described below (11e13). For the assay of membrane-bound PQQ-dependent dehydrogenases, phenazine methosulfate (PMS) coupled with Ethanol(mM) 2,6-dichlorophenolindophenol (DCIP) was used as an artificial electron acceptor. 50 The reaction mixture consisted of 16.67 mM TriseHCl buffer (pH 8.75), 0.02 mM DCIP, 0.67 mM PMS, 1 mM potassium cyanide, 33.33 mM ethanol or acetaldehyde, and CFE in a total volume of 1 ml. The reaction was started by the addition of 0 ethanol or acetaldehyde. Formation of reduced DCIP was measured by the 250 absorbance decline at 600 nm using a millimolar extinction coefficient of 15.1. fi C One unit of activity was de ned as the amount of enzyme that reduced 1 nmol of 200 DCIP per minute. For the assay of cytoplasmic NADþ or NADPþ-dependent dehydrogenases, the reaction mixture consisted of 100 mM glycineeNaOH (pH 8.5), 100 mM ethanol or 150 acetaldehyde, 0.1 mM NADþ or NADPþ, and CFE in a total volume of 1 ml. The reaction was started by the addition of CFE. Formation of NADH or NADPH was 100 measured by the absorbance increase at 340 nm using a millimolar extinction fi fi coef cient of 6.22. One unit of activity was de ned as the amount of enzyme that Acetate(mM) produced 1 nmol of NADH or NADPH per minute. The measurements were per- 50 formed in duplicate using the same CFE sample. The protein concentration of the CFE was determined by the Bradford method using a protein assay kit (Bio-Rad). 0 Bovine serum albumin was used as a standard. 0 50 100 150 200 250 RNA extraction Strains NBRC 14818 and GP were grown aerobically in 100 ml mixed medium in a 300-ml Erlenmeyer flask at 30�C with rotary shaking at Time (h) 150 rpm. When the OD600 of the culture reached 0.3, a 30-ml aliquot of the culture was collected and used for RNA extraction, as described previously (5). The RNA FIG. 1. Growth of A. aceti strains NBRC 14818 and GP in ethanol medium. (A) Growth extraction procedure was performed in biological duplicate using independent profiles of the two strains. (B, C) Concentrations of ethanol (B) and acetate (C) in the cultures. culture medium. Data are representative of three independent experiments. Open and Microarray experiments and data analysis A customized gene expression closed circles indicate strains NBRC 14818 and GP, respectively. array with a 4 72 K format for A. aceti NBRC 14818 was designed and manufactured � by Roche NimbleGen based on the draft genome sequence of the strain (5). Each quadrant of the array contained 2 replicates of 3643 probe sets. Biological ethanol oxidation and acetate overoxidation phases was clearly replicate RNA samples isolated from cells grown in mixed medium were used for longer for strain GP compared to NBRC 14818. the microarray experiments and data analysis, as described previously (5). All During the initial growth phase of both strains, ethanol was microarray data associated with this publication are available at the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/) under nearly stoichiometrically oxidized to acetate (Fig. 1B), indicating accession number GSE38524. that most ethanol was utilized as a respiratory substrate for energy Quantitative analysis of ethanol, acetic acid, glucose, and gluconate The production and that the major carbon source was the yeast extract concentrations of ethanol, acetate, D-glucose, and D-gluconate in culture media were components in the medium. Although the growth rate of strain measured enzymatically using F-kits (Roche) according to the manufacturer’s GP during the acetate overoxidation phase was lower than that of instructions. the wild-type strain, the two strains exhibited comparable acetate consumption rates (Fig.1C), suggesting that the efficiency of acetate RESULTS anabolism was adversely affected by the lack of the glyoxylate pathway. Effect of glyoxylate pathway deficiency on growth and In the glucose medium, disruption of the glyoxylate pathway acetate productivity A knockout mutant of A. aceti NBRC genes had no effect on cell growth, glucose oxidation, or gluconate 14818 lacking the aceA and glcB genes, encoding the glyoxylate accumulation (Fig. 2). This result indicates that the glyoxylate pathway enzymes isocitrate lyase and malate synthase, respec- pathway is unnecessary under these conditions, because TCA cycle tively, was constructed and designated strain GP. The growth intermediates could be provided through glycolysis via pyruvate or profiles and changes in the concentrations of ethanol, acetate, phosphoenolpyruvate. This finding is consistent with our previous glucose, and gluconate when strains NBRC 14818 and GP were report demonstrating that the aceA and glcB genes are expressed at cultivated in medium containing ethanol, glucose, or both ethanol low levels when NBRC 14818 is grown in glucose medium (5). and glucose as carbon sources were investigated (Fig. 1). In the In the mixed medium containing ethanol and glucose, strain GP ethanol medium, strain GP initially grew at the same rate as the exhibited drastically poorer growth than that of wild-type strain wild-type strain, but the growth was slower as the accumulated (Fig. 3). Notably, the growth impairment of the mutant was more acetate was oxidized (Fig. 1A). The transition phase between the severe than that observed in the medium containing only ethanol

48 49 2.0 4.0 A A 1.5 3.0 600 600 1.0 2.0 OD OD 0.5 1.0

0 0 250 250 B B 200 200 150 150 100

100 Ethanol(mM) 50

Glucose (mM) Glucose 50 0 150 0 C 250 C 100 200

150

Acetate(mM) 50 100 0 50 Gluconate (mM) 300 0 D 0 50 100 150 200 250 Time (h) 200

FIG. 2. Growth of A. aceti strains NBRC 14818 and GP in glucose medium. (A) Growth proﬁles of the two strains. (B, C) Concentrations of glucose (B) and gluconate (C) in the 100 culture medium. Data are representative of three independent experiments. Open and (mM) Glucose closed circles indicate strains NBRC 14818 and GP, respectively. 0 300 or glucose (Figs. 1 and 2). As reported previously (5), NBRC 14818 E initially oxidized ethanol and glucose was oxidized after ethanol was consumed (Fig. 3B and D). Strain GP temporarily accumulated acetate in the medium nearly stoichiometrically with the 200 consumption of ethanol (Fig. 3B and C). Although GP cells displayed poor growth, the accumulated acetate reached a maximum concentration that was comparable to that of the wild-type strain 100

and remained higher for a longer period of time. In contrast, the (mM) Gluconate consumption of glucose and corresponding accumulation of gluconate were markedly low in strain GP (Fig. 3D and E). 0 The reason was not certain as the expression level of the gene 0 50 100 150 200 250 encoding PQQ-dependent glucose dehydrogenase, which is Time (h) responsible for accumulation of gluconate from glucose, in strain GP was comparable to that in NBRC 14818 in the microarray FIG. 3. Growth of A. aceti strains NBRC 14818 and GP in mixed medium containing experiment (data not shown). ethanol and glucose. (A) Growth proﬁles of the two strains. (BeE) Concentrations of Effect of glyoxylate pathway deﬁciency on the enzymatic ethanol (B), acetate (C), glucose (D), and gluconate (E) in the culture medium. Data are representative of three independent experiments. Open and closed circles indicate activities for ethanol oxidation In A. aceti, acetate is produced strains NBRC 14818 and GP, respectively. from ethanol via acetaldehyde through the sequential reactions of ADH and ALDH. Membrane-bound PQQ-dependent ADH and ALDH acetate in the cytoplasm, where acetate may be further metabo- are involved in periplasmic ethanol oxidation and lead to the lized via acetyl-CoA. The activities of these enzymes in strains NBRC accumulation of acetate in the medium, whereas soluble NADþ- or 14818 and GP grown in the mixed medium are shown in Table 1. NADPþ-dependent ADH and ALDH mediate ethanol oxidation to Compared to wild type, the PQQ-dependent dehydrogenase

48 49 TABLE 1. Ethanol dehydrogenase and acetaldehyde dehydrogenase activities in cells grown in medium containing ethanol and glucose.

Dehydrogenase activity (nmol substrate oxidized/min/mg protein)a

PQQ NADþ NADPþ

Strain Ethanol Acetaldehyde Ethanol Acetaldehyde Ethanol Acetaldehyde

NBRC 14818 106.0 0.0 827.8 9.4 13.5 0.0 28.9 0.0 35.3 0.8 82.8 1.1 � � � � � � GP 76.0 9.0 635.8 94.5 13.8 0.0 44.2 1.1 42.0 0.0 87.6 1.1 � � � � � � The values are presented as the mean standard deviation from a duplicate series of measurements. a � PMS/DCIP was used as an electron acceptor for the pyrroloquinoline quinone (PQQ)-dependent dehydrogenases. NADþ or NADPþ was used as an electron acceptor for the soluble dehydrogenases.

activities in strain GP were slightly lowered, while the soluble Several stress-responsive genes, including uvrB, clpB, hspA, and dehydrogenases had similar or slightly higher activities. These kat, were significantly upregulated in strain GP when cultured in differences in enzyme activities do not appear to have critically the mixed medium (Table S1). The uvrB gene product is involved in affected the efficiency of acetate accumulation, because the DNA repair in the SOS system, while the clpB and hspA gene amount of accumulated acetate was comparable between the products function as molecular chaperones. These results suggest strains (Fig. 3C). The low ethanol consumption and acetate that the mutant strain was subjected to stress. accumulation rates of strain GP might be due to its slower growth rate. Effect of glyoxylate pathway deficiency on transcriptome DISCUSSION profile DNA microarray analysis was used to examine the effects of disrupting the glyoxylate pathway on the gene expression Both published and unpublished observations have demon- profile of A. aceti. For the analysis, two biological replicates of strated that the acetic acid bacteria utilized for vinegar production strains NBRC 14818 and GP grown in the mixed medium were used. often lack glyoxylate pathway genes (7,8). In the present work, we Although the growth rates of the two strains differed, their tran- have shown that the disruption of aceA and glcB in A. aceti NBRC scriptome profiles were similar, with only 2% of the total genes 14818 impairs cell growth in the mixed medium containing ethanol showing a two-fold or greater difference in expression with 95% and glucose. In addition, the aceAeglcB mutant strain GP displayed confidence (Table S1). Among the central carbon metabolism markedly reduced glucose consumption and gluconate accumula- genes, those encoding malic enzyme (maeA), fumarase (fumC), tion in the medium in spite that the expression level of the NAD(P)þ-ALDH, and acetyl-CoA synthetase (acs1) were PQQ-dependent glucose dehydrogenase gene was not changed by upregulated in strain GP (Figs. 4 and 5). Malic enzyme is an the mutation. Although acetate accumulation by the mutant was anaplerotic shunt of the TCA cycle as it can supply malate from slower than that of the wild-type strain, acetate productivity pyruvate (4). As fumarase also generates malate as a reaction was unaffected, indicating that acetate production per bacterial cell product, these two enzymes may be responsible for malate was greater in the culture medium of the mutant. Moreover, the deficiency resulting from the disruption of the glyoxylate accumulated acetate was retained for a longer period of time in pathway (Fig. 5). The upregulation of the gene encoding one of the mutant culture. Together, the features of the glyoxylate the NAD(P)þ-ALDH enzymes in strain GP was consistent with the pathway-deficient mutant are desirable when considering the elevated NADþ-ALDH activity of the strain (Table 1). utilization of the strain as a biocatalyst for acetate production from

A Malic enzyme (maeA) B Fumarase (fumC)

NBRC 14818

0 2000 4000 6000 8000 0 300 600 900 1200

C NAD(P)+-ALDH D Acetyl-CoA synthetase (acs1)

NBRC 14818

0 200 400 600 0 1000 2000 3000 Mean signal value Mean signal value

FIG. 4. Microarray expression proﬁles of the genes for malic enzyme (A), fumarase (B), NAD(P)þ-ALDH (C), and acetyl-CoA synthetase (D) in A. aceti NBRC 14818 and GP cells grown in mixed medium containing ethanol and glucose. The mean expression signal values of each gene obtained from duplicate experiments are shown.

50 51 Ethanol medium was likely attributable to the predominant ﬂow of carbon via acetyl-CoA, which would result in a shortage of oxaloacetate in Acetaldehyde the absence of the glyoxylate pathway. The retardation of acetate NAD(P)+-ALDH overoxidation could also be explained by the low metabolic ﬂow TCA cycle Acetate through the TCA cycle and the lack of the glyoxylate pathway. Pyruvate acs1 acs2 The microarray analysis also showed that strain GP was sub- decarboxylase Citrate Acetyl-CoA Isocitrate jected to stress in the mixed medium. It has been suggested that

CO2 acetaldehyde, which is known to induce DNA damage and protein aceA Oxaloacetate CO2 denaturation, induces the stress-responsive genes in A. aceti (5,15). CO2 Pyruvate Acetyl-CoA Thus, the cytoplasmic accumulation of toxic acetaldehyde as 2-Oxoglutarate Glyoxylate a result of the overﬂow metabolism of glucose might be another Phosphoenolpyruvate glcB maeA Malate Glyoxylate reason for the poor growth of strain GP in the mixed medium. fumA, pathway Supplementary data related to this article can be found online at Glycolysis/ fumC CO2 Gluconeogenesis Fumarate Succinyl-CoA http://dx.doi.org/10.1016/j.jbiosc.2012.07.017. sucCD Succinate Acetate aarC ACKNOWLEDGMENTS

Acetyl-CoA This work was supported in part by a Grant-in-Aid for Scientiﬁc FIG. 5. Central carbon metabolic pathway of strain GP. Thick arrows indicate genes Research from the Japan Society for the Promotion of Science. mediating reactions that were signiﬁcantly upregulated in GP cells compared to those of NBRC 14818. Dashed arrows indicate genes mediating reactions that are impaired in References GP cells.

1. Asai, T.: Acetic acid bacteria: classification and biochemical activities. Univer- sity of Tokyo Press, Tokyo (1968). ethanol, and may explain why the acetic acid bacteria utilized for 2. Kornberg, H. L.: Anaplerotic sequences in microbial metabolism, Angew. vinegar production tend to lack the glyoxylate pathway. Chem., 4, 558e565 (1965). The sever growth impairment of strain GP in the mixed medium 3. Saeki, A., Taniguchi, M., Matsushita, K., Toyama, H., Theeragool, G., was unexpected because the utilization of glucose does not require Lotong, N., and Adachi, O.: Microbiological aspects of acetate oxidation by the glyoxylate pathway and the initial growth rate in the ethanol acetic acid bacteria, unfavorable phenomena in vinegar fermentation, Biosci. Biotechnol. Biochem., 61, 317e323 (1997). medium was comparable to that of the wild-type strain. It is 4. Saeki, A., Matsushita, K., Takeno, S., Taniguchi, M., Toyama, H., possible that the presence of both ethanol and glucose had syner- Theeragool, G., Lotong, N., and Adachi, O.: Enzymes responsible for acetate gistic adverse effects on the growth of mutant strain. oxidation by acetic acid bacteria, Biosci. Biotechnol. Biochem., 63, 2102e2109 (1999). The microarray analysis showed that the NAD(P)þ-ALDH and fi 5. Sakurai, K., Arai, H., Ishii, M., and Igarashi, Y.: Transcriptome response to acetyl-CoA synthetase genes were signi cantly upregulated in different carbon sources in Acetobacter aceti, Microbiology, 157, 899e910 fl strain GP, suggesting that the metabolic ow from acetaldehyde to (2011). acetyl-CoA was affected by the lack of the glyoxylate pathway 6. Bertalan, M., Albano, R., de Padua, V., Rouws, L., Rojas, C., Hemerly, A., (Fig. 5). We previously reported that the genes encoding TCA cycle Teixeira, K., Schwab, S., Araujo, J., Oliveira, A., and other 52 authors: fi enzymes are downregulated in NBRC 14818 cultured in mixed Complete genome sequence of the sugarcane nitrogen- xing endophyte Gluconacetobacter diazotrophicus Pal5, BMC Genomics, 10, 450 (2009). medium when compared to glucose medium, whereas the glyox- 7. Azuma, Y., Hosoyama, A., Matsutani, M., Furuya, N., Horikawa, H., Harada, T., ylate pathway genes are significantly upregulated (5). This previous Hirakawa, H., Kuhara, S., Matsushita, K., Fujita, N., and Shirai, M.: Whole- finding, together with the present result that strain GP grew poorly genome analyses reveal genetic instability of Acetobacter pasteurianus, Nucleic in the mixed medium (Fig. 3A), indicates that the glyoxylate Acids Res., 37, 5768e5783 (2009). 8. Mullins, E. A., Francois, J. A., and Kappock, T. J.: A specialized citric acid cycle pathway is important for carbon metabolism in the presence of requiring succinyl-coenzyme A (CoA):acetate CoA-transferase (AarC) confers both ethanol and glucose. Escherichia coli is known to produce acetic acid resistance on the acidophile Acetobacter aceti, J. Bacteriol., 190, acetate from glucose when it grows aerobically, because the 4933e4940 (2008). metabolic flow through the glycolysis is faster than that through 9. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning. Cold Spring the TCA cycle and therefore pyruvate and acetyl-CoA become Harbor Laboratory, NY (1989). fl 10. Arai, H., Hayashi, M., Kuroi, A., Ishii, M., and Igarashi, Y.: Transcriptional excessive under the condition. The phenomenon is called over ow regulation of the flavohemoglobin gene for aerobic nitric oxide detoxification metabolism (14). The low expression levels of the genes encoding by second nitric oxide-responsive regulator of Pseudomonas aeruginosa, TCA cycle enzymes in NBRC 14818 when cultured in the mixed J. Bacteriol., 187, 3960e3968 (2005). medium indicate that acetaldehyde and acetate accumulated 11. Adachi, O., Matsushita, K., Shinagawa, E., and Ameyama, M.: Crystallization and properties of NADP-dependent aldehyde dehydrogenase from Glucono- intracellularly due to the overflow metabolism of glucose as in the bacter melanogenus, Agric. Biol. Chem., 44, 155e164 (1980). fl case of E. coli. Over ow metabolism has also been suggested to 12. Matsushita, K. and Ameyama, M.: D-Glucose dehydrogenase from Pseudo- result from the upregulation of the pyruvate decarboxylase gene monas fluorescens, membrane-bound, Methods Enzymol., 89, 149e154 (1982). when NBRC 14818 is grown in medium containing ethanol and 13. Chinnawirotpisan, P., Matsushita, K., Toyama, H., Adachi, O., Limtong, S., fi glucose (Fig. 5) (5). Therefore, a large proportion of glucose carbon and Theeragool, G.: Puri cation and characterization of two NAD-dependent alcohol dehydrogenases (ADHs) induced in the quinoprotein ADH-deficient is expected to enter the TCA cycle via acetyl-CoA under such growth mutant of Acetobacter pasteurianus SKU1108, Biosci. Biotechnol. Biochem., 67, conditions. The flow of carbon via acetyl-CoA was also likely 958e965 (2003). dominant in strain GP when cultured in the mixed medium, 14. el-Mansi, E. M. and Holms, W. H.: Control of carbon flux to acetate excretion because the genes for TCA cycle enzymes and pyruvate decarbox- during growth of Escherichia coli in batch and continuous cultures, J. Gen. Microbiol., 135, 2875e2883 (1989). ylase in strain GP were expressed at comparable levels to those in 15. Sakurai, K., Arai, H., Ishii, M., and Igarashi, Y.: Changes in the gene expression NBRC 14818 (data not shown). Thus, the impaired glucose profile of Acetobacter aceti during growth on ethanol, J. Biosci. Bioeng., 113, consumption and growth exhibited by strain GP in the mixed 343e348 (2012).

50 51