The Role of Hud in Alternative Splicing and Alternative Polyadenylation in the Brain

University of New Mexico UNM Digital Repository

Biomedical Sciences ETDs Electronic Theses and Dissertations

Fall 11-3-2020

The Role of HuD in Alternative Splicing and Alternative Polyadenylation in the Brain

Rebecca M. Sena University of New Mexico

Follow this and additional works at: https://digitalrepository.unm.edu/biom_etds

Part of the Medicine and Health Sciences Commons

Recommended Citation Sena, Rebecca M.. "The Role of HuD in Alternative Splicing and Alternative Polyadenylation in the Brain." (2020). https://digitalrepository.unm.edu/biom_etds/216

This Thesis is brought to you for free and open access by the Electronic Theses and Dissertations at UNM Digital Repository. It has been accepted for inclusion in Biomedical Sciences ETDs by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected], [email protected], [email protected].

Rebecca Sena Candidate

Department of Neurosciences Department

This thesis is approved, and it is acceptable in quality and form for publication:

Approved by the Thesis Committee:

Nora Perrone-Bizzozero, Ph.D., Chairperson

David N. Linsenbardt, Ph.D.

Fernando Valenzuela, M.D., Ph.D.

Amy Gardiner, Ph.D.

THE ROLE OF HUD IN ALTERNATIVE SPLICING AND ALTERNATIVE POLYADENYLATION IN THE BRAIN

REBECCA SENA

B.S. BIOLOGY NEW MEXICO HIGHLANDS UNIVERSITY, 2018

THESIS

Submitted in Partial Fulfillment of the Requirements for the Degree of

Master of Science Biomedical Sciences

The University of New Mexico Albuquerque, New Mexico

December 2020

THE ROLE OF HUD IN ALTERNATIVE SPLICING AND ALTERNATIVE

POLYADENYLATION IN THE BRAIN

Rebecca Sena

B.S. Biology, New Mexico Highlands University, 2018 M.S., Biomedical Sciences, The University of New Mexico, 2020

ABSTRACT

RNA binding proteins (RBPs) regulate several processes in the cell, including alternative splicing and alternative polyadenylation. Hu proteins, a class of ELAV- like RBPs, are crucial for proper development and maintenance of the nervous system. Several Hu proteins, including HuD, have been shown to regulate alternative splicing and alternative polyadenylation of neuronal transcripts. However, previous studies have relied on molecular techniques to analyze individual transcripts, which do not provide a global overview of the transcriptome. The purpose of this study was to develop a bioinformatics pipeline to analyze splicing and polyadenylation using

RNA-sequencing data. Once the pipeline was developed, it was utilized to analyze the effect of HuD KO on cortical transcripts. HuD KO was found to impact both alternative splicing and polyadenylation of genes that have been implicated in several nervous system and neuropsychiatric disorders.

iii

TABLE OF CONTENTS

CHAPTER 1 INTRODUCTION ...... 1

1.1. RNA Binding Proteins ...... 1

1.2. Alternative Splicing ...... 1

1.3. Alternative Polyadenylation ...... 4

1.4. Hu Proteins Regulate Alternative Splicing and Polyadenylation ...... 8

1.5. Goals of this Study ...... 10

CHAPTER 2 METHODOLOGY ...... 13

2.1. Selection and Explanation of Alternative Splicing Tools ...... 13

A. Estimating Alternative Splicing with PSI and PIR Metrics Using ASpli ..... 13

B. Estimating Alternative Splicing Using Replicate Multivariate Analysis of

RNA-seq Data (rMATS) ...... 16

2.2. Selection and Explanation of Alternative Polyadenylation Tools ...... 19

A. Estimation of Alternative Polyadenylation with InPAS ...... 19

B. Estimation of Alternative Polyadenylation Using DaPars ...... 19

2.3. RNA-sequencing ...... 21

2.4. Developing the Alternative Splicing and Polyadenylation Pipeline ...... 21

A. Initial Quality Check ...... 21

B. Removal of Adapter Sequences ...... 22

C. Alignment of Raw RNA-seq Data with STAR ...... 23

D. Final Quality Check ...... 24

E. Alternative Splicing Analysis ...... 24

F. Alternative Polyadenylation Analysis ...... 26

G. Pathway Analysis ...... 27

CHAPTER 3 RESULTS ...... 28

3.1. Alternative Splicing of Transcripts in HuD KO Cortex ...... 28

3.2. Alternative Polyadenylation of Transcripts in HuD KO Cortex ...... 44

CHAPTER 4 DISCUSSION ...... 52

APPENDICES ...... 64

APPENDIX A: Alternative Splicing and Polyadenylation Datasets ...... 65

APPENDIX B: Utilizing the Pipeline on a Robust Alcohol Dataset ...... 76

REFERENCES ...... 97

Chapter 1

Introduction

1.1. RNA Binding Proteins

RNA binding proteins (RBPs) serve important functions in the co- transcriptional and post-transcriptional control of several types of RNA, including messenger RNAs (mRNAs) 1,2. RBPs regulate several processes in the cell including alternative splicing and alternative polyadenylation, which occur in the nucleus, and mRNA stabilization, transport, and localization, which occur in the cytoplasm. These processes affect translation of mRNAs to proteins, ultimately regulating protein production and function. Many studies have focused on the role of RBPs in the cytoplasm, but much less is known about the role of RBPs in the nucleus.

1.2. Alternative Splicing

Alternative splicing is perhaps the most studied RBP mechanism in the nucleus. Splicing is a highly regulated process that produces mRNA from pre-mRNA molecules. Pre-mRNA molecules consist of both introns, which are non-coding sequences, and exons, which encode the amino acid sequence of the protein. The canonical splicing mechanism consists of the removal of an intron between two exons through the formation of a lariat structure, which is first formed by a nucleophilic attack at the 5’ splice site of an exon to the adenosine residue in the branch point 3.

Then, two exons are joined together through a second nucleophilic attack at the 3’ splice site of the second exon, and the lariat is released 3. This mechanism is summarized in Figure 1. After additional pre-mRNA processing, such as the addition of a 5’ cap and poly(A) tail, mRNA is exported to the cytoplasm where it can be translated into protein.

Figure 1. Canonical splicing mechanism in the cell. The splicing mechanism consists of the removal of an intron through the formation of a lariat structure, which is formed at the intron branch point. Two exons are then joined, and the lariat structure is released. Adapted from Baralle et. al., 2005.

In addition to the canonical splicing mechanism, there are several different forms of alternative splicing that may occur. These include exon skipping, mutually exclusive exons, alternative 5’ or 3’ splice sites, and intron retention. Exon skipping occurs when an exon is essentially left out of the final mRNA transcript. Mutually exclusive exons refer to a set of two exons where only one is retained and the other is not. Alternative 5’ or 3’ splice site usage can result in the boundaries of exons being either increased or decreased in the final transcript. Finally, intron retention occurs when introns are kept in the final mRNA transcript. Each of these events can result in mRNA isoforms with different exons from the same gene, or isoforms that include introns of the same gene.

Changes in isoform expression can have a dramatic impact on protein function or lead to loss of function. For example, alternative splicing of PSD-95, a scaffolding protein that is essential for maturation and plasticity of excitatory synapses, determines the functional properties of the protein. Exon skipping of exon 18 causes the transcript to contain a premature stop codon, which targets the transcript for degradation through nonsense mediated decay (NMD) 4. Inhibition of PSD-95 expression in differentiated neurons was shown to impair development of glutamatergic synapses 4. This mechanism is important at different time periods in brain development, with lower levels of PSD-95 occurring during embryonic development and higher levels occurring later 4–6. This is one of many examples

illustrating that alternative splicing can have a considerable impact on nervous system function.

It has been estimated that 92-95% of human genes undergo alternative splicing to produce multiple protein isoforms from one gene 7,8. A bioinformatics study has also reported that tissue-specific alternative splicing events occur at the highest frequencies in the brain 9. In the nervous system, alternatively spliced proteins are involved in important processes such as synaptogenesis and synaptic function, neuronal development and maintenance, neuronal migration, and axon guidance, which have been linked to RBPs in the brain 10. Major nervous system disorders have also been linked to alternative splicing, including frontotemporal dementia with parkinsonism, spinal muscular atrophy, and amyotrophic lateral sclerosis 11. Emerging evidence also suggests that splicing may play a role in neuropsychiatric disorders.

Genome-wide association studies have revealed countless differentially spliced candidate genes in autism spectrum disorder (ASD), schizophrenia (SZ), and mood disorders, as well as substance abuse disorders such as alcohol, cocaine, or opiate dependence 12,13. Therefore, alternative splicing must be tightly regulated in the nervous system.

1.3. Alternative Polyadenylation

In addition to splicing, RBPs also play a role in the regulation of alternative polyadenylation in the nucleus. Polyadenylation refers to the addition of a poly(A)

tail, or long string of adenosines. The poly(A) tail is essential for several different aspects of mRNA metabolism, including mRNA stability, translational efficiency, and transport of processed mRNA from the nucleus to the cytoplasm 14–16. Generation of the poly(A) tail occurs through a two-step reaction that involves endonucleolytic cleavage of pre-mRNA, then synthesis of the adenosine tail through the activity of poly(A) polymerase (PAP) 14,15,17. Proteins involved in the process are known as the cleavage polyadenylation (CP) machinery. The CP machinery includes the cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), and cleavage factors I and II (CFI and CFII) 17. Assembly of the poly(A) tail occurs when the CPSF complex interacts with a polyadenylation site (PAS) in the 3’ untranslated region (3’ UTR) of a pre-mRNA molecule 15. The PAS contains a consensus

AAUAAA sequence that is recognized by the CPSF complex, then cleavage occurs

~25 bases downstream at the cleavage site (Figure 2). Furthermore, there are other cis-acting sequences surrounding the PAS that regulate polyadenylation: the auxiliary upstream elements (AUE) at nucleotides −100 to −40 of the PAS [-100, -40), core upstream elements (CUE) [−40, 0), core downstream elements (CDE) (0, 40], and auxiliary downstream elements (ADE) (40, 100] 18. Although the consensus sequences in these elements are diverse, U-rich motifs are found predominantly in the

AUE, CUE and CDE 18.

Figure 2. Cleavage and polyadenylation (CP) machinery. CPSF binds to the PAS in the 3’ UTR, then cleavage occurs downstream at the cleavage site. PAP will then synthesize an adenosine tail. Adapted from Miura et. al., 2014.

Many pre-mRNA transcripts have a proximal PAS and a distal PAS, which can influence the length of the 3’ UTR. A short 3’ UTR stems from the usage of the proximal PAS. However, the CP machinery can selectively bind to the distal PAS and generate a long 3’ UTR isoform. Distal site usage only occurs under certain circumstances, one of which is binding of an RBP to a site near to the first PAS.

RBPs, such as the neuronal ELAV-like proteins HuD and HuB, are known to bind to

U-rich elements in the AUE in the proximal site of the 3’ UTR, physically blocking the CP machinery from binding 19,20. If this occurs, the CP machinery will move downstream and initiate cleavage and polyadenylation at the distal site. This generates a transcript with a longer 3’UTR, producing a longer mRNA isoform overall.

mRNA function is greatly influenced by the length of the 3’ UTR. Several alternative polyadenylation events, and their subsequent consequences on both protein and gene expression, have been particularly well documented. Approximately

70% of known human genes have multiple polyA sites 21. In the brain, a large proportion of mRNA diversity is attributed to polyadenylation, and a large number of transcripts in the nervous system possess longer 3’ UTRs 22,23. These longer 3’ UTR isoforms have been shown to mediate RNA localization to dendrites and axons, and can also play a role in RBP and microRNA-mediated decay in the cell 23. For example, alternative polyadenylation of the Bdnf transcript regulates translation of the

BDNF protein in response to neuronal activity. Longer 3’ UTR isoforms mediate translational upregulation and localize the protein to dendrites 24. It has also been reported that short 3’ UTR isoforms are restricted to soma, while long 3’ UTR isoforms localize to dendrites 25. Thus, alternative polyadenylation is an important regulator of mRNA diversity and function in the nervous system.

Nervous system disorders such as Parkinson’s disease, Alzheimer’s disease, and amyotrophic lateral sclerosis (ALS) have been linked to alternative polyadenylation 26. Additionally, alternative polyadenylation of huntingtin (HTT), the protein implicated in Huntington’s disorder (HD), produces three different isoforms of the protein 27,28. Short and mid-length 3’ UTR isoforms are found to be doubled in patients with HD or models of HD compared to controls 29,30. Furthermore, alternative polyadenylation has been linked to several neuropsychiatric disorders.

Longer 3’ UTR isoforms of the serotonin transporter have induced anxiety phenotypes 31,32. Lower levels of the short isoform of the reelin protein have also been correlated with bipolar disorder (BD) 33. Consequently, alternative polyadenylation can have a significant impact on human neuropsychiatric health and disease.

1.4. Hu Proteins Regulate Alternative Splicing and Polyadenylation

The Hu family proteins are human homologs of the Drosophila ELAV protein.

ELAV is encoded by the embryonic lethal abnormal visual system (Elav) gene.

ELAV is required for nervous system development in flies, with the deletion of the gene causing neuroblasts to differentiate inappropriately and produce a defective nervous system 34,35. There are four mammalian Hu proteins: HuR (HuA or

ELAVL1), HuB (ELAVL2), HuC (ELAVL3), and HuD (ELAVL4). HuR is known to be ubiquitously expressed, but HuB, HuC, and HuD are primarily expressed in neurons and are referred to as a group as nELAVs 36,37. HuR has numerous functions in the cell, including cell growth and proliferation and cellular response to damage 38.

HuB, HuC, and HuD play more important roles in the nervous system, functioning in processes such as neuronal development, differentiation, and synaptic plasticity 38.

Neurons in different regions of the brain can express one to several Hu proteins, indicating that neuronal Hu proteins are not only necessary in development, but in the function of mature neurons 39. Consequently, the Hu family proteins are crucial for both proper development and maintenance of the nervous system.

Many studies implicate Hu proteins in the co-regulation of alternative splicing and alternative polyadenylation. The earliest evidence of Hu involvement in splicing and polyadenylation was found in the calcitonin-related polypeptide-alpha (CALCA) gene. In 1982, CALCA was found to generate different proteins in specific tissues depending on how the transcript was processed. Proximal PAS usage and inclusion of the calcitonin-specific exon generates the calcitonin hormone, whereas distal PAS usage and exclusion of the calcitonin-specific exon will encode for calcitonin gene- related peptide 1 (CGRP) 40. These proteins are tissue dependent and have vastly different functions. The calcitonin hormone is involved in Ca2+ metabolism and predominates in thyroid tissue, while CGRP is found primarily in the brain and is involved in nociception and non-adrenergic, sympathetic outflow 40–44. In 2006, it was discovered that Hu proteins promote neuronal CGRP expression by binding to two target sequences in the transcript. The first target site blocks the binding site of T-cell intracellular antigen (TIA) proteins, which function to promote inclusion of the calcitonin exon 45. Hu proteins can also bind the proximal PAS to promote distal PAS usage 46.

Hu proteins are also known to control the production of short protein isoforms of neurofibromatosis type 1 (NF1). The NF1 gene is involved in the formation of tumors in the peripheral and central nervous system and has also been linked with cognitive deficits 47. Hu proteins will bind to AUE’s near exon 23a of the NF1 transcript and, similarly to the CALCA pathway, suppress TIA proteins and the

splicing factor U2AF 48. When Hu proteins are expressed, the 23a exon is excluded, so the short isoform of NF1 is produced 48. Regulation of the short isoform is considerably important because it has been linked with disease severity. In patients with Neurofibromatosis type 1, lower mRNA levels of the short isoform correlated with the severity of cognitive and intellectual disabilities, glioma, neoplasia, and cerebrovascular disease 49.

More recently, in Drosophila models, ELAV was found to co-regulate alternative splicing and polyadenylation of the Dscam1 gene. Distal PAS usage generates a long 3’ UTR isoform, which was found to be required for skipping of exon 19 50. The isoform was also shown to be important for axon outgrowth, suggesting that ELAV co-regulates splicing and polyadenylation in transcripts essential for neuronal development. Evidently, there are several examples of Hu protein involvement in alternative splicing and polyadenylation; however, an unbiased review of Hu-mediated alternative splicing and polyadenylation in genome- wide brain transcription has yet to be performed.

1.5. Goals of this Study

Very few studies have selectively looked at one member of the Hu family.

HuD is likely the most characterized neuronal Hu protein (nELAV) and has been linked to several regulatory processes and pathologies 51–53. RNA- immunoprecipitation assays and microarrays have been used to identify HuD-specific

binding sites and targets in the brain, most of which promote neuronal development, synaptic plasticity, learning and memory, and cell death 51–53. Moreover, HuD has been linked to several pathologies including epilepsy, BD, mental retardation, mood disorders, substance abuse and addiction, Alzheimer’s disease, HD, and SZ 51,54,55.

Only a few studies have investigated the role of HuD in alternative splicing and alternative polyadenylation. This is largely due to the difficulty of isolating specific targets of HuD and analyzing the makeup of several isoforms with molecular methods. Using a cross-linking immunoprecipitation (CLIP) assay, one study reported that nELAV proteins (HuB, HuC, and HuD) bind to intronic and 3’ UTR sequences to regulate splicing of transcripts involved in neuronal stress and

Alzheimer’s disease 56. Another study utilized a high-throughput sequencing CLIP assay and reported alternative splicing in a double KO model of Elavl3 (HuC) and

Elavl4 (HuD) 57. Genes that were alternatively spliced were closely linked with glutamate levels and excitatory transmission 57. However, given that HuC is mostly nuclear while HuD is mostly cytosolic, it is unclear how much of the changes in alternative splicing are due to deletions in HuC vs. HuD.

A less common approach to analyzing HuD-mediated alternative splicing and polyadenylation is RNA-sequencing (RNA-seq). RNA-seq provides a unique perspective in that a global view of the transcriptome is generated. Given the importance of HuD in nervous system development and function, along with the limited information on the nuclear functions of this protein, we sought to develop a

bioinformatics pipeline to analyze alternative splicing and alternative polyadenylation using RNA-seq data from the neocortex of HuD KO (Elavl4-/-) mice. To do so, two specific aims were set:

1. Develop the necessary methodology to analyze HuD-specific targets with

bioinformatics tools and generate an output of novel alternative splicing and

alternative polyadenylation events.

2. Test the hypothesis that HuD KO will exhibit deficits in alternative splicing

and alternative polyadenylation in the cortex.

Chapter 2

Methodology

2.1. Selection and Explanation of Alternative Splicing Tools

A. Estimating Alternative Splicing with PSI and PIR Metrics Using

ASpli

Several bioinformatics methods exist for studying alternative splicing.

Metrics consistently used for reporting differences in splicing are referred to

as percent spliced in (PSI) and percent intron retained (PIR). PSI values

represent events that involve exons, whereas PIR refers to events that involve

introns. PSI and PIR indicate how efficiently sequences of interest are spliced

into transcripts, allowing them to signify the percentage of transcripts that will

include that specific event 58–61.

ASpli is a new, integrative software package that reports PSI/PIR

metrics as evidence of alternative splicing. The software runs in Program R, a

coding language and environment that is widely used for statistical analyses.

One of ASpli’s greatest strengths is that it facilitates the analysis of both

annotated and novel splicing events 62. These events include exon skipping

(ES), alternative 3’ splice sites (Alt 3ss), alternative 5’ splice sites (Alt 5ss),

and intron retention (IR). Unfortunately, ASpli does not account for mutually

exclusive exons.

To identify alternative splicing events, ASpli first breaks down the genome of interest into bins. That is, each exon and intron annotated in the genome becomes its own bin. Then, information from differential bin usage and junctions is combined with RNA-seq reads 62. Using this information, PSI and PIR are calculated for each event detected (Figure 3). These metrics are reported for each bin involved in the event, providing information about specific exons and introns of genes.

A single manuscript has been published that utilizes ASpli to document changes in alternative splicing between groups. Distributions of change in PSI/PIR (∆PSI/∆PIR) were used to represent genome wide changes in splicing events. Binomial tests were then used to determine significant differences in distributions of alternative splicing 63. Therefore, ASpli appears to be a reliable method to estimate alternative splicing patterns across the genome. However, there has not been use of ASpli to document changes of alternative splicing at the gene level.

Figure 3. Alternative splicing events recognized by ASpli. Purple boxes represent exons and grey boxes represent introns. RNA-seq reads, indicated by black boxes, must map to specific junctions, or exon/intron flanking regions, to be considered for the event. Additionally, reads can map directly to the exon or intron involved in the event to be annotated. PIR and PSI metrics are calculated using ratios between junctions 1, 2, and 3. Adapted from Mancini et. al., 2019.

B. Estimating Alternative Splicing Using Replicate Multivariate Analysis of RNA-seq Data (rMATS)

Other tools have expanded on PSI and PIR metrics to provide a more robust detection method of differential splicing. Replicate multivariate analysis of transcript splicing, or rMATS, uses statistical models to calculate changes in splicing from RNA-seq data. The greatest strength of rMATS is that it incorporates a hypothesis-testing framework in which the null and alternative hypothesis are defined by the user 64. To perform hypothesis testing, rMATS uses a likelihood-ratio test to calculate p-values from differences between mean PSI (ψ) metrics of two samples.

In contrast to ASpli, rMATS only calculates PSI values, but still includes intron-centric events. To calculate PSI, the program considers sequencing read length, splice junction length, and exon/intron length to calculate inclusion or skipping isoforms. Exon skipping, alternative 5’ splice sites, alternative 3’ splice sites, and intron retention events have two splice junctions that map to the inclusion isoform (I), and one junction that maps to the skipping isoform (S) 64. Mutually exclusive exons are considered separately because the included exon and the skipped exon must be determined. Consequently, mutually exclusive exons have two splice junctions for the inclusion isoform of the first exon and two splice junctions for the skipping isoform of the second exon 64. RNA-seq reads are mapped to

these junctions to annotate which event is occurring at specific regions in the genome. Figure 4 depicts the algorithms used for each splicing event in rMATS to calculate short and long isoforms.

When developed, rMATS was found to outperform existing methods of alternative splicing analysis with replicate RNA-seq data, such as Cufflinks and Diffsplice 64. Moreover, rMATS was found to have a 94% validation rate of alternative splicing events with RT-PCR 64. There have also been several studies using rMATS to investigate changes in alternative splicing in neurons

65,66. rMATS is both reliable and accurate in predicting differential splicing in neurons, and although a pipeline was developed utilizing ASpli for splicing analysis, it was ultimately decided to use rMATS for this study.

Figure 4. Schematic illustrating how rMATS considers read counts (r), exon or intron length (e), and junctions (j) for inclusion and skipped isoforms. Exons are represented with purple boxes, and junctions are indicated with black lines. RNA-seq reads in blue map to the inclusion isoform (I), while red reads map to skipping isoforms (S).

The length of the long isoform (ll) and short isoform (ls) are calculated using lengths of exon/introns, junctions, and read counts. Adapted from Shen et. al., 2014.

2.2. Selection and Explanation of Alternative Polyadenylation Tools

A. Estimation of Alternative Polyadenylation with InPAS

Like alternative splicing, there are several bioinformatics tools that

analyze alternative polyadenylation. One metric used to denote differences in

polyadenylation is percent distal polyadenylation index (PDUI). PDUI refers

to the likelihood of the transcript using the distal PAS when there are two or

more sites in the transcript 67,68. Therefore, the greater the PDUI, the longer

the 3’ UTR of the transcript.

A relatively new bioinformatics tool that estimates PDUI is InPAS.

The InPAS software operates in an R environment. It facilitates the discovery

of novel APA sites and differential usage of APA sites from RNA-seq data 69.

One advantage of InPAS is that the algorithm filters polyadenylation sites to

remove false sites due to internal priming through cleanUpdTSeq 70. It also

utilizes another R package, Limma, to identify differential usage of APA sites

between samples 71. Another strength of InPAS is that it includes the 3’ UTR

annotation for the mm10 genome. However, the greatest downside to InPAS

is there are no publications utilizing the tool for polyadenylation analysis.

B. Estimation of Alternative Polyadenylation Using DaPars

A well-documented and reputable software that reports PDUI is

DaPars. DaPars is a Linux-based tool capable of identifying dynamic

polyadenylation usage in standard RNA-seq data 67,68. PDUI is estimated

using both expression levels of transcripts with distal sites and with proximal

sites (Figure 5) 67,68. The program uses a linear regression model to predict the

location of the proximal PAS site, then quantifies lengthening or shortening

through PDUI. Along with PDUI, Fisher’s exact and Benjamini-Hochberg

adjusted p-values are reported to indicate significant changes in

polyadenylation.

DaPars has been used several times to estimate PDUI across many cell

types and species. In neurons specifically, DaPars has been used to study

alternative polyadenylation in neurodegenerative diseases, ASD, and plasticity

26,72,73. The software has proven to be efficient and consistent in predicting

alternative polyadenylation in neurons, so it was chosen for this study.

Figure 5. Percent distal usage index (PDUI) is calculated using expression levels of transcripts that use distal and proximal APA sites. Adapted from Xia et. al., 2014.

2.3. RNA-sequencing

Total RNA was extracted from the adult cortex of two mouse models. The first was a constitutive knockout of the HuD protein (HuD KO, Elavl4 -/-). These mice were created by removing exon 2 of the mouse Elavl4 gene described previously 74.

Briefly, exon 2 of the HuD transcript was replaced with a PGK-Neo vector, causing a frameshift mutation. As controls, we used wild-type (WT) littermates from the same line. Cortices were dissected from male adult mice, approximately three to four months of age, and total RNA was extracted using Trizol (Invitrogen) and quantified using Qbit (Bio-Rad). Aliquots of 2 µg RNA from 3 mice of each genotype were sent to Arraystar, Inc. for paired-end sequencing via an Illumina platform.

2.4. Developing the Alternative Splicing and Polyadenylation Pipeline

A. Initial Quality Check

To identify outliers, custom-written MATLAB code was used to

perform a principal component analysis (PCA) using the gene expression data

Arraystar provided during sequencing. One HuD KO sequencing pair was

considered an outlier because the expression profile was attributed to variation

in the sample population. Additionally, there were obvious aberrations in the

number and quality of reads of the pair. Consequently, the replicate was

excluded from the analysis. Three control replicates and two HuD KO replicates were then used for alternative splicing and polyadenylation analysis.

To determine the quality of raw RNA-sequencing reads, the FastQC software (version 0.11.5) was used. FastQC is a quality control tool specifically made for high throughput data that reports culprits of poor RNA- seq quality, such as adapter dimers, contamination, and bias in the sample, then provides a report on single fastq files 75.

B. Removal of Adapter Sequences

Forward and reverse adapters are joined to the 3’ and 5’ ends of RNA fragments to perform paired-end RNA sequencing. If adapter content is present in more than 5% of reads, FastQC will issue a warning 75. When warnings were issued, the Cutadapt (version 1.15) and Trimmomatic (version

0.38) software were used to remove adapters 76,77. Occasionally, trimming of adapters from RNA-seq reads causes different read lengths. To avoid issues in downstream analysis, specifically with the alternative splicing software, all reads were trimmed to a single length. The following sequences for 3’ and 5’ end adapters were specified for removal in Cutadapt:

-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

-g TCTTTCCCTACACGACGCTCTTCCGATCT

-A AGATCGGAAGAGCGTCGTGTAGGGAAAGA

-G GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

A minimum read length of 145bp was selected by including the -m parameter in the command. Finally, reads greater than 145bp were trimmed to that length using the CROP parameter in Trimmomatic.

C. Alignment of Raw RNA-seq Data with STAR

To align sequencing data to an annotated genome, STAR was used.

STAR is a well-characterized alignment tool that is known to be exceptionally accurate. STAR exhibits better alignment precision, sensitivity, and mapping speed than other RNA-seq aligners, including TopHat, Bowtie, and BWA, for both experimental and simulated data 78. Moreover, STAR can discover non- canonical splice sites, making it particularly useful for this study 78. STAR also reports alignment efficiency to indicate success of alignment. Typically, alignment with >80% reads mapped to a unique location is considered high- quality, while low rates (<50%) are indicative of a problem with library preparations or processing 79. Additionally, a high percentage of multi- mapping reads (>15%) suggests insufficient depletion of rRNA or contamination 79.

Alignment to the M. musculus genome was performed using STAR

(version 2.7.3a), which was downloaded from https://github.com/alexdobin/STAR. Prior to alignment, a genome reference

was created from the UCSC 2015 genome assembly (mm10) by following the directions previously described 78,79. The reference genome, along with paired reads from each experimental replicate, was used to perform the alignment.

The -alignEndsType EndtoEnd parameter was also specified in the command, ensuring that all reads remained a uniform length. Alignment of 145bp reads resulted in BAM files with a read length of 290 for each replicate.

D. Final Quality Check

To perform a final quality check on STAR alignment files, MultiQC

(version 1.8) was utilized. MultiQC is a Linux-based tool that aggregates bioinformatics analyses into one report 80. If alignments were found to be the same read length and have >80% reads mapped to a unique location, the data was considered good quality and alternative splicing and polyadenylation analyses were performed.

E. Alternative Splicing Analysis

i. rMATS

The rMATS software (version 4.0.2) with default settings was used to

detect differential alternative splicing events from RNA-seq data.

Software was downloaded through the rMATS developer webpage:

http://rnaseq-mats.sourceforge.net. BAM files obtained through STAR

alignment were input into the program. From the output files, those that calculated differential splicing using reads that mapped to both exons/intron and splice junctions were used. Significant events were filtered using the Maser software package in Program R (version 1.6.0)

81. It was downloaded through the Bioconductor website at https://www.bioconductor.org/packages/release/bioc/html/maser.html.

Events were considered significant if read coverage ≥ 5, ∣Δψ∣ > 5%, and FDR < 0.05. ii. Visualization of rMATS Results

To visualize rMATS results and differential splicing events between groups, rmats2sashimiplot was used. The tool was downloaded directly from the developer GitHub page: https://github.com/Xinglab/rmats2sashimiplot. BAM files and rMATS output files were used to run the program. Coordinates from each event were then input into the IGV software (version 2.8.2) to determine which exon/intron was involved in splicing 82,83.

F. Alternative Polyadenylation Analysis

i. BAM to BedGraph Conversion

To use the alternative polyadenylation software, it was necessary to

convert BAM files to BedGraph files. To do so, a chromosome

annotation text file for the mm10 genome was downloaded from

UCSC. Then, the conversion was performed using the genomecov

function of the BedTools software (version 2.26.0) 84. It was

downloaded directly from https://github.com/arq5x/bedtools2.

ii. DaPars Analysis

The DaPars software (version 0.9.1) was used to determine alternative

polyadenylation between groups. Software was downloaded from the

developer’s GitHub page: https://github.com/ZhengXia/dapars. Before

use of the tool, a 3’ UTR annotation of the mm10 genome was created

using a BED text file and gene symbol file from the UCSC Table

Browser 85. The DaPars_Extract_Anno.py function was used to create

the annotation, then it was used in the analysis, along with specific

parameters for a read coverage cutoff of 30, an FDR cutoff of 0.10, a

PDUI cutoff of 0.2, and a fold change cutoff of 0.59. A list of genes

involved in alternative polyadenylation was generated as a single

output file. Those listed as “Y” passed all specified parameters and

were considered significant.

iii. Visualization of DaPars Results

To visualize DaPars results, BAM files were input into the IGV

software (version 2.8.2) for each group, then 3’ UTR regions were

examined.

G. Pathway Analysis

Ingenuity Pathway Analysis (IPA) is a bioinformatics tool that utilizes current literature to facilitate the interpretation of gene expression data into biological significance 86. To identify functions, disease implications, and canonical pathways associated with genes identified in AS and APA analyses,

IPA was used (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity- pathway- analysis).

Chapter 3

Results

3.1. Alternative Splicing of Transcripts in HuD KO Cortex

The rMATS software was utilized to detect differential splicing between wild type and HuD KO cortical tissue. Events with read coverage ≥ 5 (instances where aligned reads counts are greater than 5), ∣Δψ∣ > 5% (greater than a 5% change in splicing), and FDR < 0.05 were considered significant. Using these parameters, 310 differential splicing events were reported (Figure 6A). Exon skipping represented the largest proportion of alternative splicing between groups at 77.74%, while both intron retention and mutually exclusive exons represented 3.55% (Figure 6B). Complete rMATS output for all five alternative splicing events can be found in Appendix A

Tables 1-5.

To determine how KO of the HuD protein affected these events, inclusion level was evaluated to predict exon or intron inclusion in transcripts. Inclusion level differences represented the change in exon or intron inclusion level between samples.

A positive inclusion level difference represented greater inclusion in HuD KOs, while a negative inclusion level difference represented decreased inclusion in KOs. Using these parameters, there were 144 total events with increased inclusion levels in KOs and 166 events with decreased inclusion levels in KOs (Figure 6C&D). Specifically, for exon skipping events, transcripts from 114 genes had an increased exon inclusion

level in the KOs, indicating a decreased likelihood of exon skipping. Additionally, the exon inclusion level in mRNAs from 127 genes were decreased in the KOs, meaning there was a greater likelihood of exon skipping in the group.

The results of pathways analyses used to determine the molecular systems impacted by HuD KO are presented in Figure 7. Top biological pathways reported by

IPA that were impacted by alternatively splicing in HuD KOs include Neurological

Disease, Cell Death and Survival, and Nervous System Development and Function

(Figure 7A). Examples of major neuronal functions associated with those categories include loss of neurons (IPA p-value= 0.0273), viability of neurons (p= 0.00204), and synaptic transmission of nervous tissue and pyramidal neurons (p= 0.0152; p=

0.0406) (Figure 7B).

Figure 6. Alternative splicing events reported by rMATS. A) Total number of events significantly different between Control and HuD KO cortex. B) Proportion of alternative splicing events between groups. C) Inclusion level differences in HuD KOs grouped by splicing event. D) Total number of increased and decreased inclusion levels in HuD KOs.

Figure 7. Significant functions and pathways with alternatively spliced genes reported by IPA. A) Top functions associated with alternatively spliced transcripts in HuD KO cortex. B) Top molecules and functions affected by alternative splicing of transcripts. Blue lines predict inhibition of the function, while orange lines predict activation. Blue molecules indicate increased exon inclusion levels in HuD KOs, while red molecules indicate decreased exon inclusion levels.

Since HuD KO appeared to have the largest effect on exon skipping, I focused on these events for the remainder of the study. The exon skipping event with the greatest inclusion level difference occurred in HuD (Elavl4) itself (Figure 8). To identify exons involved in each event, rMATS and Maser output were used to determine chromosomal locations of exon start sites in Integrative Genomics Viewer

- Broad Institute (IGV). Then, alternative splicing was visualized using the rmats2sashimi software. rMATS reported skipping of exon 2, which was the exon targeted to produce the KO model. HuD KO cortex exhibited 0% inclusion of exon 2, while Controls had 100% inclusion of the exon (Figure 9A). When looking at the read coverage plot, reads did not align to exon 2 itself in the KOs. Instead, all reads were shifted to the intron immediately following exon 2 (Figure 9B). The methods used to generate the KO model induced a frameshift, which is represented in these plots. This not only provides evidence that the methods used to generate the KO were successful, but also shows the reliability of the rMATS software.

Other genes where exon skipping was apparently affected by HuD KO were

Ap4e1 and Rapgef4. Both genes were found to have a positive inclusion level difference, indicating that exon skipping occurs less frequently in HuD KOs. rMATS reported skipping of exon 10 in Ap4e1 and skipping of exon 7 in Rapgef4 (Figure 10

A-D). Alternative splicing of Ap4e1 at exon 10 has not previously been reported, so this may be a novel isoform. The gene encodes the AP-4 complex subunit epsilon-1 protein. The protein is involved in intracellular trafficking and sorting of AMPA

receptors to axons 87. Rapgef4 encodes the exchange protein directly activated by cAMP 2 (Epac2), which has been shown to function in the release of excitatory neurotransmitters and neurodevelopment 88. Alternative splicing of Rapgef4 has been reported previously, with different isoforms being expressed in different cell types.

Epac2A is the major splice variant expressed in the brain and contains an extra cAMP-binding domain 89,90. Alternative splicing of exon 7 has been reported and was found to be a brain specific isoform, but it was also proposed that exclusion of exon 7 would not affect translation of the Epac2A protein 91.

Figure 8. Volcano plot demonstrating the genes on which HuD KO had the greatest effect. Elavl4 itself demonstrated the highest inclusion level difference in the negative direction, while Ap4e1 demonstrated the highest inclusion level difference in the positive direction. Rapgef4 was the gene with the highest FDR significance.

Figure 9. Sashimi plot and read coverage graph of exon 2 in Elavl4. A) rMATS reported an inclusion level difference of -1 between HuD KO and Control cortex, indicating that inclusion of exon 2 did not occur in KOs. B) Read coverage graphs indicate that reads did not align to exon 2 in HuD KOs but were shifted into an intron.

Figure 10. Sashimi plots and read coverage graphs of exons involved in Ap4e1 and Rapgef4 splicing. A) rMATS reported reduced exon skipping, or greater inclusion level, in HuD KO cortex of exon 10 in Ap4e1. B) Read coverage also indicates greater exon inclusion in KOs. C) rMATS reported reduced exon skipping in HuD KO cortex of exon 7 in Rapgef4. D) Read coverage also indicates greater exon inclusion at exon 7 in KOs.

Although KO of the HuD protein appeared to significantly influence alternative splicing of several genes in the cortex, it was possible that compensatory mechanisms, or indirect consequences of HuD KO, accounted for changes in splicing.

To further identify genes that were directly affected by KO of the protein, we focused only on genes that have been shown to directly interact with HuD. To do so, significant rMATS events were compared with datasets from previous HuD pulldown experiments. In 2010, Bolognani et. al. isolated HuD targets in adult mouse forebrain through RIP-Chip and GST-HuD pulldown experiments. Another study we conducted isolated HuD targets in E18 striatum through a RIP experiment using a HuD specific antibody (not published). Targets from these two experiments were combined into a single dataset, and 738 common genes were found to interact with HuD (Table A.6).

The list of 738 genes was then compared directly to significant rMATS events. We identified 17 genes with direct interaction to HuD that displayed alternative splicing:

Cspp1, Whsc1l1, Atp2c1, Whsc1l1, Ap3s1, Cbx3, Sbno1, Per3, Gria2, Atp2c1, Derl2,

Ttc3, Clint1, Ube2w, Ube2w, Snap25, Stau2, Snap23, Ptpn12, Dram2, Ube2w, and

Cbx3. rMATS reported multiple alternative splicing events in some of these genes

(Atp2c1, Cbx3, Ube2w, and Whsc1l1), and the majority of events were found to be exon skipping (Figure 11).

Figure 11. List of transcripts that were alternatively spliced and found to directly interact with HuD. Exon skipping, alternative 3’ splice sites, and alternative 5’ splice sites occurred in HuD KO cortex. Inclusion Level Difference indicates the likelihood of the exon being spliced into the transcript. A negative value indicates the exon is less likely to be included in HuD KO neurons, while a positive value indicates it is more likely to be included in KOs.

From the 20 genes with mRNAs that were alternatively spliced and targeted by HuD, splicing has been shown to functionally impact protein products of two genes: Snap25 and Gria2. Both genes encode proteins that are primarily involved in synaptic transmission and plasticity.

Snap25 encodes for the SNAP25 protein, which is an essential component of the SNARE complex that is responsible for calcium-dependent exocytosis of neurotransmitters 92. It has also been shown to be differentially regulated during development 93,94. In HuD KO cortices, inclusion of exon 5 of Snap25 was found to occur more frequently, indicating exon skipping occurred less frequently in KOs

(Figure 12A). There have been reports of different exon 5 isoforms in Snap25 transcripts: exon 5a and exon 5b (Figure 12B). It has been proposed that SNAP25a and SNAP25b isoforms differ in their ability to promote vesicle priming and release

95,96. To determine which isoform was being alternatively spliced in HuD KOs, read coverage was viewed at exon 5a and exon 5b. It was discovered that the exon skipping event rMATS reported was of exon 5b in HuD KOs (Figure 12C).

Alternative splicing of Snap25 exons that have already been established demonstrates the validity of the pipeline, and preferential expression of Snap25b in HuD KOs may produce alterations in neurotransmitter release.

Figure 12. Alternative splicing of the Snap25 transcript. A) Sashimi plot depicting the exon 5b skipping event occurring in the Snap25 transcript. The exon is skipped more frequently in Controls. B) Schematic depicting the known splicing mechanism that occurs in exon 5 of Snap25. Snap25a and Snap25b differ in exon 5a or 5b inclusion. C) Read coverage using IGV indicating that alternative splicing occurred in the exon 5b.

Gria2 encodes for the Glutamate receptor 2 (GluR2) protein, an AMPA receptor subunit involved in excitatory neurotransmission 97. Inclusion level of exon

14 was found to be decreased in HuD KOs, indicating exon skipping occurred more frequently (Figure 13A). There have been reports of alternative splicing occurring between exons 14 and 15, which are specified as “flip” or “flop” exons (Figure 13B).

GRIA2 subunits with inclusion of exon 14 are considered the “flop” isoforms, while those with inclusion of exon 15 constitute the “flip” isoforms 98. These isoforms exhibit different pharmacological and kinetic properties on currents evoked by glutamate 99,100. Specifically, the flop sequence promotes rapid AMPA channel opening and faster desensitization in response to glutamate 101,102. Visualization of exons 14 and 15 showed lower read coverage in HuD KOs at exon 14 compared to controls, indicating that KOs contained decreased levels of Gria2 flop isoforms

(Figure 13C). However, there were no changes in alternative splicing at exon 15. The rMATS report of alternative splicing events in Gria2, which has already been well established, supports the validity of the pipeline. These findings might also indicate that HuD is important in regulating the sensitivity of glutamate through alternative splicing, and decreased expression of flop isoforms could point to altered AMPA receptor function in HuD KOs.

Figure 13. Alternative splicing of the Gria2 transcript. A) Sashimi plot depicting the exon skipping event occurring in the Gria2 transcript. Exon 14 is skipped more frequently in HuD KO cortex. B) Schematic depicting the established “flip or flop” mechanism. Flop transcripts include exon 14, while Flip transcripts include exon 15. C) Read coverage using IGV depicting differences in read coverage at exons 14 and 15.

There were also a number of HuD targets that reported greater changes in PSI.

For example, the gene that exhibited the greatest inclusion level difference in KOs relative to Controls was Cbx3. The Cbx3 gene encodes Chromobox 3 (CBX3), a protein involved in transcriptional repression through binding histone H3 tails at methylated sites 103. Alternative splicing of Cbx3 has not been reported, but in this study, two exon-skipping events occurred in the gene. The event with the highest inclusion level difference was reported at exon 3. However, rMATS also reported that the downstream exon in the event was exon 5. This indicates that both exon 3 and exon 4 were skipped, which is reflected in the sashimi plot in Figure 14A. In contrast to the rMATS results, read counts of exon 3 were greater in Controls (Figure 14B).

This suggests that the ratio of transcripts including exon 3 compared to transcripts excluding exon 3 are more telling than read coverage itself.

The greatest inclusion level difference in Controls relative to KOs was Cspp1.

The Cspp1 gene encodes the Centrosome and spindle pole associated protein 1

(CSPP1), which functions in spindle organization and is required for primary cilia formation 104,105. Primary cilia have previously been shown to be critical for neuronal development 106. Alternative splicing of exon 17 has been documented in Cspp1, resulting in a long isoform that is more physiologically relevant 107. However, in this study, rMATS reported an exon-skipping event at exon 12 where the exon is excluded more frequently in HuD KOs (Figure 15A). In this case, read coverage also indicates greater reads in Controls relative to KOs (Figure 15B).

Figure 14. Sashimi and read coverage plots of exons involved in exon skipping events in Cbx3. A) Junction counts indicate that Exon 3 and Exon 4 were included more in HuD KOs. Exon 3 is represented by the reads aligned with the black box on the theoretical transcript, while reads at Exon 4 are seen at the peak immediately after Exon 4. The junction spans both exons, and rMATS reported the downstream exon as Exon 5. B) IGV depicted smaller read counts in Exon 3 in HuD KOs.

Figure 15. Sashimi and read coverage plots of exon skipping event in Cspp1. A) Junction counts indicate that Exon 12 was skipped more in HuD KOs. B) IGV depicted smaller read counts of Exon 12 in HuD KOs.

3.2. Alternative Polyadenylation of Transcripts in HuD KO Cortex

To identify significant alternative polyadenylation events in HuD KOs, the following parameters were employed with DaPars: read coverage > 30, an FDR <

0.10, ∆�� > 0.2, and fold change > 0.59. The program identified alternative polyadenylation of transcripts from 53 genes, with the majority of significantly altered mRNAs shifting towards proximal PAS usage in HuD KOs (Figure 16A).

From these, 11 transcripts presented greater PDUI metrics, or lengthened 3’UTRs, in the KOs, and 42 presented greater PDUI in Controls, indicating 3’ UTR shortening in

KOs. Transcripts with lengthened 3’ UTR and shortened 3’ UTRs are listed in Figure

16B. Complete DaPars output can be found in Table A.7.

The results of pathways analyses used to determine the molecular systems impacted by HuD KO are presented in Figure 17. Significant functions and diseases reported by IPA included Cell-to-Cell Signaling and Interaction, Nervous System

Development and Function, and Neurological Disease (Figure 17A). HuD is known to affect synaptic plasticity and neurotransmission, so genes involved in these processes were emphasized. Within the Nervous System Development and Function category, two of the most prominent genes generating transcripts with shortened 3’

UTRs in KOs were Dtnbp1 and Baiap2 (Figure 17B). Dtnbp1 encodes dysbindin, or dystrobrevin-binding protein 1, while Baiap2 encodes Brain-Specific Angiogenesis

Inhibitor 1-Associated Protein 2. In IPA, DTNBP1 was shown to affect the excitation and firing of interneurons (IPA p-value= 0.00297, p= 0.00887), along with the

probability of release and size of vesicles (p= 0.0322, p= 0.00887). BAIAP2 was shown to be involved in paired-pulse facilitation of collateral synapses (p= 0.00297) and size of postsynaptic density (p= 0.0118). To visualize Dtnbp1 and Baiap2 3’

UTRs, read coverage was compared at both DaPars-predicted proximal PAS and inferred distal PAS. Both genes were found to have lower read coverage after the proximal PAS, indicating that HuD KO neurons contained transcripts with shorter 3’

UTR (Figure 17C&D).

To further determine possible downstream effects of alternatively polyadenylated genes, a network was generated based on their direct relationships

(Figure 18). Baiap2 was found to have a direct relationship to the HTT protein and although HuD has been linked to HD, there has not been previous evidence to suggest a relationship between HuD and HTT. A transcript with a lengthened 3’ UTR in KOs was Fos-related antigen 2 (Fosl2), which was also found to have a direct relationship with BDNF (brain derived neurotrophic factor), a protein with pleiotropic effects in the nervous system and whose mRNA has already been shown to be regulated by

HuD via binding to its long 3’UTR 93.

Finally, to account for the possibility of indirect consequences of HuD KO, the transcripts from the 53 mRNAs reported by DaPars were compared with the previous HuD target dataset. Between these datasets, only 3 genes were identified:

Alg6, Max, and Mmachc (Figure 19). Alg6 encodes for the Dolichyl pyrophosphate

Man9GlcNAc2 alpha-1,3-glucosyltransferase enzyme. Max encodes the Myc-

associated factor X transcription factor, and Mmachc encodes the Methylmalonic aciduria and homocystinuria type C protein. These genes were not reported by IPA in significantly affected pathways, so their role in neuronal pathways were unknown.

Nonetheless, DaPars predicted that Alg6 3’ UTR was longer in KOs, while Max and

Mmachc 3’ UTRs were shorter in KOs. When visualizing the 3’ UTR with IGV,

Alg6, Mmachc, and Max appeared to be shortened in KOs (Figure 20A-C). Overall, it appears that HuD KO did not affect alternative polyadenylation as much as it did alternative splicing, suggesting that HuD is more involved in regulating splicing.

Figure 16. Differences in PDUI between Control and HuD KO cortex. A) Blue points represent significantly lengthened transcripts in HuD KO, while red points represent significantly shortened transcripts. B) Complete list of lengthened and shortened transcripts in HuD KO cortex.

Figure 17. Significant functions and pathways reported by IPA with alternatively polyadenylated genes. A) Top pathways associated with alternatively polyadenylated transcripts. B) Top neuronal functions affected by alternative polyadenylation. Blue lines predict inhibition of the function, while orange lines predict activation. Blue molecules represent increased PDUI in HuD KOs, while red molecules represent decreased PDUI. C) Read coverage graph of Baiap2 3’UTR and D) Dtnbp1 3’ UTR. Both transcripts exhibited decreased PDUI and shorter 3’ UTRs. Blue arrows indicate the location of the DaPars-predicted proximal PAS.

Figure 18. Top pathway associated with alternatively polyadenylated transcripts in HuD KO cortex. Fosl2 was found to have a direct effect on Bdnf, and Htt was found to affect Baiap2 downstream.

Figure 19. List of transcripts that were alternatively polyadenylated and found to directly interact with HuD. DaPars predicted that one gene, Alg6, was lengthened, while two genes, Max and Mmachc, were shortened in HuD KO cortex.

Figure 20. Read coverage graphs of alternatively polyadenylated transcripts in HuD KOs. A) Read coverage graph of Alg6 3’ UTR. The graph indicates shortened 3’UTRs in the HuD KOs. B) Read coverage of Mmachc 3’ UTR. The graph indicates shortened 3’ UTR in KOs. C) Read coverage of Max 3’ UTR. DaPars predicted the proximal PAS occurs in an intron and coverage looks similar in KOs and Controls.

Chapter 4

Discussion

The purpose of this study was to develop a bioinformatics approach to analyze genome-wide changes in alternative splicing and alternative polyadenylation mediated by HuD using RNA sequencing data. We successfully developed and implemented a pipeline that allowed us to determine the impact of HuD KO on these processes. The protein was found to play a role in both processes, but preferentially impacted splicing. Transcripts affected by HuD KO were found to be involved in several neuronal functions, including synaptic transmission.

A total of 310 transcripts were found to be alternatively spliced in HuD KO cortex. The largest proportion of alternative splicing events were identified as exon skipping events, which correlates to previous findings where exon skipping represents the most frequent alternative splicing event in biology 108. These findings also corroborate a recent study in Drosophila, where Hu proteins were found to primarily induce exon skipping and exon inclusion 109.

Genes from transcripts identified by rMATS were found to be involved in several pathways, including neuronal apoptosis. HuD deletion is known to induce cell death in neural stem cells, however the mechanism has yet to be elucidated 74. Still,

Hu proteins are known to regulate splicing of transcripts involved in apoptosis, such as Fas. Overexpression and knockdown of HuR leads to exon 6 skipping and inclusion of the Fas transcript, causing the production of either a membrane-bound

form or soluble form, respectively 110,111. The membrane form of the receptor promotes apoptosis and the soluble form inhibits apoptosis 110. In this study, several transcripts from genes involved in neuronal apoptosis were found to be alternatively spliced in HuD KOs, suggesting splicing of apoptotic genes may promote cell death in HuD KO neurons. However, after comparing HuD targets from previous RNA- immunoprecipitation experiments from cytosolic mRNAs, overlapping genes involved in neuronal cell death were not identified. One possibility is that the role of

HuD in the regulation of mRNA stability and translation involves different transcripts and genes from those that are regulated by HuD in the nucleus. It is also possible that

HuD KO indirectly regulates apoptosis in the brain without direct interaction with transcripts involved in the process.

HuD KO was also found to have apparent effects on splicing in the Rapgef4 and Ap4e1, both of which are involved in excitatory neurotransmission. Although the effects of alternative splicing on their proteins are unknown, variants of these genes have been linked to several nervous system disorders. Ap4e1 deficiency has been tied to cerebral palsy syndrome, speech deficits, and hereditary spastic paraplegia 112–114.

Rare variants in Rapgef2 have also been found in autism patients 115. Mice deficient in Epac2 or mice expressing the autism-related variant exhibit deficits in social interactions and affect dendritic morphology 116–118. It is interesting that Epac2 plays an important role in dendritic organization because KO of HuD during development is known to disrupt dendritic outgrowth 119. Thus, it is possible that increased exon

inclusion in the Rapgef2 gene is trying to compensate for the loss of HuD.

Nonetheless, neither of these genes were found in the HuD target list, so changes in splicing of Rapgef4 and Ap4e1 may not be directly caused by HuD KO.

Two genes involved in neurotransmission that were also alternatively spliced and targeted directly by HuD, were Snap25 and Gria2. Notably, there is already evidence of Snap25 and Gria2 alternative splicing in neurons at the exons reported in this study. Snap25 has two alternatively spliced isoforms, Snap25a and Snap25b, and is regulated in different stages of development 93,120,121. The SNAP25a protein is more abundant in the embryonic mouse brain while the SNAP25b protein becomes the predominant form in the brain after birth during the major period of synaptogenesis

122,123. A single-cell RNA sequencing study showed that neurons expressing exon 5a also expressed genes involved in axon guidance and spine formation, while mature neurons utilizing exon 5b express genes involved in synapse organization and vesicle trafficking 124. SNAP25b is known to regulate short-term synaptic plasticity in adulthood, and loss of SNAP25b affects facilitation of neurotransmitter release and strength of exocytic bursts 123,125,126. A mutually exclusive exon event at exon 5 in

Snap25 was also reported in a double HuC and HuD KO study, suggesting that HuD

KO is likely responsible for the splicing event 57.

Alternative splicing of Gria2 has also been well studied and documented.

Splicing between flip and flop exons occurs in response to activity, mediating short- term synaptic plasticity, and neuronal homeostasis 98,99. The isoforms are also

differentially expressed in cell type- and age-specific manners 101. Electrophysiology studies have shown that flop variants of GluR2 desensitize, or remain inactivated, when glutamate remains bound to the receptor at a faster rate than flip counterparts

101. Flop isoforms were also found to recover more slowly from desensitization 101.

HuD is known to target and regulate expression of Gria2, but it has not been linked to alternative splicing of the transcript until this study.

HuD KO is known to cause several nervous system deficiencies. These effects are largely associated with defective dendritogenesis and lack of neuron specification in brain regions such as the neocortex and hippocampus 74,119. Additionally, HuD KO models have shown behavioral deficits, with one study reporting an abnormal clasping reflex and poor performance on the rotarod test 74. Studies also report deficits in learning and memory, with both KO and overexpression models performing poorly in the Morris Water Maze task or contextual fear conditioning

119,127. Although HuD targets and regulates proteins involved in synaptic plasticity, changes in synaptic plasticity or synaptic transmission have not been directly measured. It would be interesting to take an electrophysiological approach and determine if HuD KO neurons are more sensitive to glutamate or exhibit changes in excitatory transmission. If so, it is possible that alternative splicing of genes such as

Snap25 and Gria2 are responsible for the deficits.

In addition to the neuronal functions and pathways associated with Snap25 and Gria2, both genes have been implicated in several neuropsychiatric disorders.

Some studies suggest that Snap25 imbalances or changes in expression of Snap25-a and Snap25-b isoforms contribute to ADHD and SZ, as well as alcohol use disorder

(AUD) and smoking risk 128–130. Gria2 has also been deemed an addiction-related gene, and HuD has shown to regulate addiction-related behavior 55. GRIA2 flop mRNA levels in the orbital frontal cortex have shown a positive correlation with chronic alcohol use 131. Therefore, it is possible that HuD-mediated alternative splicing of Snap25 and Gria2 plays a role in these disorders. Because HuD-mediated alternative splicing of Snap25 and Gria2 have been implicated in AUD, the pipeline was also utilized on a robust alcohol dataset, and results from that analysis can be found in Appendix B.

It is noteworthy that alternative splicing of Snap23 was also reported between

HuD KOs and Controls. Snap23 encodes the Synaptosome Associated Protein 23, which is ubiquitously expressed. SNAP23 is thought to be 60% identical to SNAP25, so it has been proposed to function in exocytosis 122. Similarly to SNAP25, SNAP23 also has SNAP23-a and SNAP23-b isoforms. There has not been evidence of alternative splicing in neurons, but several splice variants have been documented in other cell types. For example, SNAP-23c, SNAP-23d, and SNAP-23e isoforms have been identified in inflammatory cells 132. In HuD KOs, the use of an alternative 5’ splice site was found to occur more frequently. The use of an alternative 5’ splice site may lead to differences in the coding sequence, but there has not been prior evidence of this event in neurons. Therefore, it would be important to establish how the use of

an alternative 5’ splice site affects the SNAP23 protein and how that could ultimately affect vesicle release.

The two genes that exhibited the greatest effect size in HuD KOs were Cbx3 and Cspp1. CBX3, also known as HP1γ, is a chromatin protein that regulates the transcriptional response through gene silencing in neuronal maturation, development, and differentiation 133–135. Additionally, somatic deletions in the gene was found in the cerebellum of SZ patients 136,137. Cspp1 is broadly expressed in neurons, and the

CSPP1 protein is thought to be involved in neural-specific functions of primary cilia

138,139. Mutations in Cspp1 have also been linked with Jourbert Syndrome, a developmental brain disorder 138. Alternative splicing of exons 3 and 4 in Cbx3 and exon 12 in Cspp1 have not been reported previously, so their impact on these proteins cannot be predicted solely from this study. It is also important to note that junction counts for the exon skipping events are relatively low. Therefore, it would be important to further analyze these events with molecular methods such as PCR with primers specifically targeting the exons involved in splicing. If splicing is found to be impacted, it would then be important to determine if splicing affects protein function.

In addition to alternative splicing, HuD KO neurons also exhibited changes in alternative polyadenylation. There was a higher proportion of transcripts with shorter

3’UTRs in HuD KO neurons, which was expected because HuD is known to bind proximal PAS and physically block cleavage at the site. Thus, lack of HuD binding at the proximal PAS would theoretically result in shorter 3’ UTR transcripts. Although

there were only 53 alternative polyadenylation events reported by DaPars, IPA identified two genes involved in neurotransmission that were significantly affected by

HuD KO: Baiap2 and Dtnbp1.

Baiap2 is primarily involved in actin dynamics at the postsynaptic density of excitatory synapses 140. There are four isoforms of the protein and three validated polyA sites, however the functions of these isoforms remain unknown 141. Baiap2 was also predicted to have downstream effects on the HTT protein. Differential expression of Baiap2 occurs in the early stages of HD mouse models, and HTT is known to colocalize with BAIAP2 in filopodia 142,143. Currently, there is no evidence of a direct link between HuD and HTT. However, it is possible that HuD-mediated alternative polyadenylation of Baiap2 may contribute to the pathophysiology of the disorder.

Dtnbp1 modulates AMPAR-mediated synaptic transmission and plasticity 144.

It is considered a SZ susceptibility gene, and its expression is reduced in the prefrontal cortex and midbrain of patients with SZ 145. Furthermore, variations in the

3’ UTR of the Dtnbp1 gene have been found to alter its expression 145. DTNBP1 variants in the prefrontal cortex are thought to contribute to pathophysiology of SZ through glutamatergic transmission 146,147. Interestingly, HuD transcript levels have also been found to be increased in the prefrontal cortex of SZ patients 148.

Consequently, it is possible that HuD-mediated alternative polyadenylation of Dtnbp1 alters excitatory signaling in SZ.

Fosl2, which was found to be lengthened in HuD KOs, was predicted to affect

BDNF downstream. Fosl2 is considered an immediate early gene (IEG) and is transcribed in response to neuronal stimulation 149. Since HuD is thought to promote lengthening of 3’ UTRs, it is unexpected that this transcript was lengthened in the

HuD KO model. It is possible that indirect consequences of HuD KO promoted the lengthening of the transcript. Although HuD has not been directly linked to Fosl2, it has been linked to BDNF itself. HuD was found to regulate the stability of BDNF transcripts in the brain through binding to sequences in the long 3’ UTR 150. However, alternative polyadenylation of BDNF was not reported in this study.

Comparison of direct cytoplasmic HuD targets and alternative polyadenylated mRNAs revealed only 3 transcripts/genes: Alg6, Max, and Mmachc. Although IPA did not identify neuronal functions of these genes, many diseases associated with them present with neurological symptoms. For example, patients with inherited disorders involving Alg6 display epilepsy, stroke-like episodes, developmental delay, neuropathy, and structural abnormalities 151,152. Patients with mutations in the

Mmachc gene exhibit cognitive impairment, epilepsy, ataxia, pyramidal and peripheral nerve symptoms 153. Additionally, some evidence points to a role of the

MAX protein in neuronal differentiation 154. Although there is some evidence pointing to Alg6, Max, and Mmachc involvement in the nervous system, alternative polyadenylation of these transcripts in neurons has not been reported. Future studies

should focus on verifying the alternative polyadenylation found in these genes, and elucidating the role of Alg6, Max, and Mmachc in neuronal processes.

When comparing DaPars-predicted alternative polyadenylation and coverage from the RNA-sequencing reads, there were a few unexpected findings. First, DaPars reported lengthening of Alg6, but when comparing read coverage graphs, it seemed to indicate the opposite. It is possible that the number of reads aligning to the 3’ UTR of

HuD KOs was smaller overall, so solely visualizing coverage at the distal PAS may not be the most accurate measure. The PDUI calculation takes into account transcripts with lengthened 3’ UTRs relative to the sum of transcripts with both lengthened and shortened 3’ UTRs, so it is likely a better indicator of alternative polyadenylation. In other words, it is important to consider the total number of reads when visualizing 3’

UTR lengthening or shortening. DaPars also predicted the PAS of Mmachc transcript occurred in an intron. Approximately 20% of human genes have one intronic polyadenylation event, but it has not been reported that Mmachc has such a feature

155. To verify these alternative polyadenylation events in HuD KOs, methods such as

PCR and 3’ RACE assays can be used.

Although there is a clear role of HuD in alternative splicing and alternative polyadenylation, there were some limitations in this study. Typically, the viability of

HuD KO models are very low, with the majority of KO embryos dying in-utero.

Therefore, there is a very low probability of live offspring being complete KOs.

Because of these difficulties, the number of biological replicates in this study was

relatively low. This may be cause of concern for valid biological interpretation or statistical analyses. To establish confidence in these findings, quality control analyses and parameters used with rMATS and DaPars were used to limit the number of false positives. However, it would still be of importance to repeat the study with a higher sample number.

Another potential pitfall of this study is the possibility of compensatory mechanisms in response to HuD KO. To account for this issue, or to limit the effect of HuD KO during development, the use of a conditional KO would be ideal, however the mice are not available as of yet. Additionally, due to the functional similarities between Hu proteins, there have been reports of other Hu proteins compensating for the loss of HuR 156,157. Likewise, other Hu proteins may compensate for the loss of HuD. Although, it has been reported that HuB and HuC are not overexpressed in HuD KO mice 57. To ensure that the effects are specific to HuD, this pipeline could be used on sequencing data obtained from a pulldown assay, similar to the one used to gather the HuD target data.

Different isoforms of HuD mRNA have been shown to dictate cellular localization of the protein. At least 4 different isoforms have been identified, and can differ between the inclusion of exon 6 and/or exon 7 and the use of different transcription start sites 52,158. Two of these isoforms have recently been shown to be important for the regulation of glutamatergic neuronal development. Elavl4-v3 and

Elavl-v4, which localize primarily to the nucleus, were found to be involved in the

identity, balance, and connectivity of glutamatergic neurons in the cortex 158. It would be interesting to determine if those isoforms were involved in the splicing events reported in this study.

It is also important to note that between nELAVL proteins, HuC is the most nuclear, so nELAV antibodies used in other studies for RNA-immunoprecipitation experiments may be biased for HuC. Additionally, since HuD also increases mRNA stability, our studies do not distinguish between increased stability of long 3’UTR transcripts containing HuD binding motifs in the cytoplasm from the effect of HuD in the nucleus of the cells. One way to overcome these challenges in future studies would be to isolate nuclear and cytoplasmic subcellular fractions prior to RNA extraction and sequencing.

Global KO of HuD may also cause off-target indirect effects. To limit the detection of indirect effects of HuD KOs, datasets of previously identified HuD targets were compared with alternative splicing and polyadenylation findings. This increased the possibility of direct HuD binding and regulation of these processes, but it must also be stated that HuD target datasets were only available from striatum and forebrain, while splicing and polyadenylation analyses were performed from cortical tissue. Furthermore, bulk RNA sequencing analyses do not allow for determining changes at specific cells types. Isolating and identifying HuD targets from single cell analyses of neurons and other cell types, then comparing rMATS and DaPars results,

would be an optimal approach for studying HuD’s specific role in neuronal alternative splicing and polyadenylation.

In conclusion, HuD KO cortex was found to exhibit deficits in alternative splicing and polyadenylation. Several future directions can be derived from this data to determine the functional impact of splicing and polyadenylation in the brain. First, splicing and polyadenylation of mRNA should be verified using additional molecular techniques. Once verified at the RNA level, the effect of alternative splicing and polyadenylation on protein expression and function must be established. Because genes that were alternatively spliced were strongly associated with neurotransmission, electrophysiology studies can be performed to identify changes in transmission between HuD KO cortex and Controls. Genes that exhibited changes in polyadenylation can be further studied to determine if mRNA export from the nucleus, localization, or stability is affected, which could impact the translation process. Furthermore, CRISPR-Cas9 technology could be used to delete specific exons or mutate the proximal PAS to determine the significance of these events.

Disease can be related to the functional outcome of pre-mRNA processing, so revealing the impact of these changes in mechanisms underlying disease complexity may ultimately result in better treatment options.

APPENDICES

APPENDIX A: Alternative Splicing and Polyadenylation Datasets

APPENDIX B: Utilizing the Pipeline on a Robust Alcohol Dataset

APPENDIX A: Alternative Splicing and Polyadenylation Datasets

Table A.1. Alternative 3’ Splice Site Events Reported by rMATS in HuD KO vs Controls A3SS Inc Lev Gene FDR Diff Chr Strand Exon_long Exon_short Exon flanking Snhg17 0.025177332 -0.377 chr2 - 158359182-158359432 158359182-158359331 158360464-158360599 Zfand2b 0.021229448 -0.309 chr1 + 75168831-75168906 75168834-75168906 75168646-75168707 Alas2 0.021229448 -0.274 chrX + 150552959-150553081 150553004-150553081 150552149-150552344 Smim1 0.033399209 -0.238 chr4 - 154023688-154023891 154023688-154023817 154025504-154025621 Shmt2 0.037254356 -0.209 chr10 - 127520918-127521115 127520918-127521106 127522288-127522444 Psd2 0.021229448 -0.197 chr18 + 35978281-35978685 35978284-35978685 35964830-35965219 Prkd3 0.048457701 -0.194 chr17 - 78962527-78962579 78962527-78962576 78966175-78966451 Wbp1 0.035070747 -0.186 chr6 - 83120772-83120876 83120772-83120873 83121203-83121461 P2rx7 0.032154274 -0.185 chr5 + 122680807-122684289 122683175-122684289 122676662-122676763 Akap8 0.048021318 -0.168 chr17 - 32312286-32313262 32312286-32312373 32314111-32314144 Magi1 0.03770733 -0.148 chr6 - 93694008-93694211 93694008-93694175 93697194-93697487 Ptpn11 0.042372559 -0.1 chr5 - 121144530-121144696 121144530-121144684 121149103-121149234 Vezt 0.042372559 -0.088 chr10 - 93961522-93971707 93961522-93970704 93973835-93974042 Derl2 0.045453812 -0.087 chr11 - 71018312-71018377 71018312-71018374 71019144-71019303 Vezt 0.039581145 -0.073 chr10 - 93961522-93973609 93961522-93970704 93973835-93974042 Ppil2 0.046716529 -0.072 chr16 - 17086556-17087213 17086556-17087115 17088745-17088866 Psap 0.00214982 0.088 chr10 + 60299092-60299229 60299098-60299229 60295946-60296002 Neo1 0.037200327 0.123 chr9 - 58906871-58907094 58906871-58907046 58908404-58908499 Tsc2 0.046162851 0.131 chr17 - 24631945-24632111 24631945-24632106 24632538-24632627 Hdgfrp2 0.037949484 0.168 chr17 + 56096821-56097016 56096848-56097016 56096205-56096276 Jkamp 0.037254356 0.174 chr12 + 72089315-72089406 72089333-72089406 72085839-72086183 Gpr19 0.048457701 0.185 chr6 - 134869092-134870482 134869092-134870443 134877217-134877334 Rnft2 0.028152103 0.209 chr5 - 118237127-118237599 118237127-118237596 118242458-118242516 Dgcr14 0.044251596 0.223 chr16 - 17907750-17907922 17907750-17907919 17909905-17910000 Hdac5 0.032154274 0.249 chr11 - 102218416-102218490 102218416-102218487 102224734-102224955 Plch1 0.040208763 0.26 chr3 - 63699780-63699807 63699780-63699802 63701784-63702138 Ralgps1 0.045453812 0.321 chr2 - 33146570-33146653 33146570-33146650 33158910-33159036 Elavl4 0.020631326 0.41 chr4 - 110203737-110206701 110203737-110206659 110209740-110209778

Table A.2. Alternative 5’ Splice Site Events Reported by rMATS in HuD KO vs Controls A5SS Inc Lev Gene FDR Diff Chr Strand Exon_long Exon_short Exon flanking Zfp386 0.002265957 -0.384 chr12 + 116054722-116054953 116054722-116054817 116058905-116063207 Ecsit 0.030732095 -0.287 chr9 - 22085349-22085427 22085357-22085427 22084023-22084208 Sh3bp5l 0.020793568 -0.243 chr11 + 58330707-58330802 58330707-58330792 58331254-58331863 Spsb2 0.014254927 -0.222 chr6 + 124809227-124809969 124809227-124809911 124810269-124810616 Inpp4a 0.007716599 -0.22 chr1 + 37379922-37380177 37379922-37380060 37387698-37387870 Sema6c 0.003935087 -0.209 chr3 + 95160420-95160712 95160420-95160698 95162615-95162663 Cdkl3 0.030049719 -0.18 chr11 + 52004221-52004510 52004221-52004417 52004910-52005092 Casp3 0.020885231 -0.174 chr8 + 46617291-46617501 46617291-46617496 46629734-46629801 Anapc15 0.010344747 -0.117 chr7 + 101897733-101897817 101897733-101897787 101897942-101898071 Ubl7 0.042845611 -0.116 chr9 + 57910986-57911059 57910986-57911007 57912638-57912850 Vma21 0.045561665 -0.083 chrX + 71816758-71817067 71816758-71816940 71820068-71820177 Ociad1 0.020793568 -0.075 chr5 + 73306578-73306798 73306578-73306753 73313443-73314077 Raly 0.04434879 0.071 chr2 + 154791110-154791548 154791110-154791231 154821007-154821089 Slc4a4 0.020793568 0.153 chr5 + 89046213-89046392 89046213-89046365 89084642-89084718 Snap23 0.022369748 0.156 chr2 + 120567671-120567806 120567671-120567761 120584269-120584365 Tfpt 0.037250126 0.189 chr7 - 3620747-3620983 3620777-3620983 3620324-3620474 Rbm18 0.021136516 0.234 chr2 - 36127181-36127251 36127215-36127251 36122852-36122938 Pigx 0.02355397 0.252 chr16 - 32099470-32099727 32099476-32099727 32097000-32097063 Smc2 0.001820279 0.454 chr4 + 52439221-52439410 52439221-52439334 52440201-52440423

Table A.3. Alternative Exon Skipping Events Reported by rMATS in HuD KO vs Controls ES Gene FDR Inc Lev Diff Chr Strand Exon target Exon upstream Exon downstream Elavl4 3.11725E-06 -1 chr4 - 110251281-110251521 110226545-110226648 110351797-110351911 Prdm2 0.000933856 -0.611 chr4 - 143194661-143194734 143180877-143180991 143212615-143212709 Rgl3 0.00069563 -0.566 chr9 - 21974388-21974540 21974022-21974136 21975608-21975707 Phactr2 0.017464429 -0.545 chr10 - 13261766-13261924 13253342-13253879 13291795-13291962 Cib1 0.025416561 -0.478 chr7 - 80232344-80232378 80228398-80228548 80232510-80232805 Kmt2c 0.036416627 -0.455 chr5 - 25330796-25330900 25329447-25329575 25338413-25338581 Ttll3 3.66407E-05 -0.447 chr6 + 113401302-113401497 113399667-113399771 113405299-113405447 Nsun7 0.048222397 -0.443 chr5 + 66278630-66278840 66276515-66276667 66283592-66283735 Pcsk4 0.004018357 -0.44 chr10 - 80322081-80322209 80321283-80321951 80322724-80322848 Sirt1 0.001529962 -0.422 chr10 - 63336980-63337096 63335636-63335877 63338565-63339032 Mroh7 0.000184553 -0.42 chr4 - 106694991-106695128 106694315-106694429 106699722-106699912 Gtpbp8 0.028772653 -0.411 chr16 - 44745395-44745493 44742504-44742603 44745999-44746363 Ccdc84 0.037599024 -0.401 chr9 - 44412917-44413022 44412453-44412483 44413137-44413201 Eva1c 0.01194133 -0.4 chr16 + 90890530-90890673 90876039-90876191 90894578-90894655 Cspp1 0.034933309 -0.391 chr1 + 10085747-10085952 10083501-10083558 10088051-10088184 Zfp788 0.005376273 -0.371 chr7 + 41643333-41643432 41634680-41634710 41647483-41647617 Polh 0.011101621 -0.356 chr17 - 46194202-46194416 46190607-46190776 46198634-46198768 Atp2c1 0.000916414 -0.35 chr9 - 105494415-105494482 105470037-105470147 105494893-105495133 Prss36 0.031889584 -0.344 chr7 - 127933567-127933832 127933371-127933492 127934390-127934627 Ninl 0.005376273 -0.34 chr2 - 150969980-150970132 150966078-150966242 150971024-150971214 Rbms1 0.001126067 -0.34 chr2 - 60759759-60759806 60758804-60758854 60762053-60762146 Fhod3 0.037602168 -0.329 chr18 + 25020662-25020757 25001791-25002032 25022622-25022978 Accs 0.04518046 -0.326 chr2 - 93838011-93838152 93836188-93836330 93838240-93838285 Tbc1d31 0.036396894 -0.299 chr15 + 57922957-57923135 57912199-57912391 57932532-57932683 Zfp935 0.040734084 -0.299 chr13 - 62456687-62456747 62453016-62455193 62456933-62457059 Ptprh 0.045669314 -0.296 chr7 - 4552628-4552762 4551013-4551135 4554175-4554265 Zfpm2 0.01540906 -0.295 chr15 + 40752896-40753054 40655042-40655583 40774045-40774146 Trpm4 0.00160003 -0.294 chr7 - 45308244-45308421 45305289-45305494 45308544-45308718 Zfand4 0.04777478 -0.292 chr6 + 116305617-116305761 116273573-116273872 116313845-116315017 Pdss2 0.003104956 -0.28 chr10 + 43345528-43345726 43298799-43298933 43372135-43372209 Tmem209 0.011101621 -0.279 chr6 - 30506786-30506917 30505733-30505974 30508454-30508512 Atxn7l2 0.000205569 -0.273 chr3 - 108208917-108209095 108208440-108208505 108210345-108210527 Helq 0.017597514 -0.271 chr5 - 100770398-100770496 100766688-100766801 100771734-100771891 Nrxn3 2.58585E-05 -0.268 chr12 + 90199147-90199236 90168920-90169091 90204511-90204818 Zfp94 0.00022734 -0.265 chr7 - 24311465-24311503 24309071-24309197 24312382-24312495 Ltk 0.012818822 -0.263 chr2 - 119757979-119758161 119755615-119755713 119758247-119758403 Panct2 0.01856699 -0.255 chr1 + 96872485-96872668 96872190-96872390 96877834-96881234 Acox1 0.010227636 -0.25 chr11 - 116189415-116189575 116181913-116182020 116198222-116198381 Gtpbp8 0.00620455 -0.249 chr16 - 44743738-44743868 44742504-44742603 44745999-44746363 Sox17 0.005863256 -0.249 chr1 - 4493100-4493466 4490928-4492668 4493772-4493863 Ccdc120 0.047682645 -0.248 chrX - 7737299-7737439 7736692-7736977 7737894-7738027 Kdm1b 0.043643806 -0.248 chr13 + 47068464-47068635 47067445-47067582 47071892-47072019 Sox17 0.005311328 -0.242 chr1 - 4493100-4493490 4490928-4492668 4493772-4493863 Gatad2a 0.024273063 -0.237 chr8 - 69950653-69950754 69935779-69936036 69995943-69996384 Ryr3 0.028772653 -0.235 chr2 - 112717999-112718129 112712220-112712540 112728847-112728928 Ddx59 0.007435717 -0.234 chr1 + 136434506-136434634 136433713-136433865 136439753-136440220 Whsc1l1 0.02177575 -0.234 chr8 + 25683152-25683322 25682499-25682696 25691015-25691161 Ubr1 0.005211027 -0.223 chr2 - 120866390-120866560 120864318-120864419 120868226-120868303

Table A.3. cont. Alternative Exon Skipping Events Reported by rMATS in HuD KO vs Controls ES Gene FDR Inc Lev Diff Chr Strand Exon target Exon upstream Exon downstream Dusp12 0.000410037 -0.222 chr1 - 170880573-170880691 170880130-170880226 170880915-170881028 Lins 0.012818822 -0.216 chr7 + 66708639-66708728 66708040-66708553 66709294-66709435 Repin1 0.011933463 -0.216 chr6 + 48594862-48594976 48593883-48594052 48596296-48599082 Igf1r 0.017429504 -0.21 chr7 + 68003810-68004355 67952257-67952952 68164993-68165305 Taf6l 0.020218609 -0.209 chr19 - 8785122-8785178 8783835-8783994 8786210-8786316 Gpam 0.027573469 -0.208 chr19 - 55072712-55072770 55069734-55071046 55074571-55074760 Osbpl6 0.002319685 -0.205 chr2 + 76540104-76540196 76523889-76524144 76545978-76546100 Trpm2 0.021016138 -0.2 chr10 - 77969157-77969299 77966851-77967096 77969783-77969872 Smim8 0.04228868 -0.198 chr4 - 34771874-34772053 34771258-34771414 34778224-34778337 Sgce 0.036623282 -0.193 chr6 - 4690469-4690495 4689579-4689767 4691429-4691640 Zfp945 0.00069563 -0.19 chr17 - 22861506-22861561 22857250-22857376 22865247-22865336 Sema6c 0.00592316 -0.184 chr3 + 95167413-95167476 95167006-95167120 95167624-95167680 Krba1 0.002306684 -0.183 chr6 + 48402871-48403010 48395586-48395887 48403378-48403497 Snx13 0.043869176 -0.182 chr12 + 35078900-35079012 35047189-35047411 35085939-35086028 Zfp143 0.002149472 -0.182 chr7 + 110069484-110069602 110061702-110061775 110070478-110070570 Lyrm7 0.00459329 -0.178 chr11 - 54848579-54848660 54839289-54841202 54850345-54850415 Ap3s1 0.011101621 -0.17 chr18 + 46754371-46754462 46741876-46742081 46779188-46779259 Igdcc4 0.013946896 -0.169 chr9 + 65124612-65124776 65123776-65124189 65125285-65125422 Nwd1 0.015076662 -0.169 chr8 + 72688067-72688189 72681924-72682121 72692920-72693128 Bbx 0.030290028 -0.166 chr16 - 50209085-50209144 50202378-50202575 50220445-50220593 Rnf141 0.038302949 -0.165 chr7 - 110837077-110837270 110833737-110833845 110844339-110844381 Dip2a 0.036290283 -0.164 chr10 - 76321490-76321606 76319467-76319586 76327702-76327773 Dlgap2 0.015534142 -0.164 chr8 + 14823574-14823615 14822343-14822695 14829869-14829954 Pbx4 0.03556535 -0.158 chr8 + 69866468-69866603 69859080-69859153 69870029-69870182 Rab34 0.031889584 -0.155 chr11 + 78191208-78191289 78190478-78190542 78191365-78191455 Armc7 0.017761306 -0.154 chr11 + 115476122-115476265 115475677-115476027 115488713-115490466 Pir 0.02468191 -0.152 chrX + 164342474-164342518 164330015-164330099 164358148-164358230 Tfe3 0.00459329 -0.148 chrX + 7767893-7767997 7767439-7767684 7769430-7769547 Ablim2 0.017597514 -0.143 chr5 + 35866705-35866766 35857826-35857964 35873170-35873224 Bdp1 0.011101621 -0.143 chr13 - 100064359-100064489 100060294-100061506 100065877-100066066 Cbx3 0.015076662 -0.142 chr6 + 51478438-51478600 51475231-51475373 51481724-51481818 Relt 0.029742859 -0.141 chr7 - 100848422-100848503 100848019-100848273 100848799-100848879 Sbno1 0.035593429 -0.141 chr5 - 124413185-124413289 124410070-124410382 124414399-124414527 Chd2 0.006128954 -0.139 chr7 - 73540772-73540904 73519477-73519708 73541246-73541746 Ctage5 0.000410037 -0.138 chr12 + 59149464-59149568 59147852-59147923 59154356-59154478 Tut1 0.038912262 -0.135 chr19 + 8955387-8955577 8953850-8954021 8959087-8959402 Per3 0.00592316 -0.134 chr4 - 151029136-151029242 151028749-151028905 151031913-151031991 Fopnl 0.047941671 -0.133 chr16 - 14311047-14311131 14299244-14300209 14313816-14314013 Ift172 0.002430591 -0.132 chr5 - 31271987-31272123 31271640-31271747 31275852-31276019 Macrod2 0.009047185 -0.132 chr2 + 142374231-142374308 142318415-142318507 142384321-142384388 Ints7 0.031889584 -0.131 chr1 + 191583179-191583325 191575636-191575951 191586524-191586661 Xiap 0.00097579 -0.129 chrX + 42094367-42095272 42068398-42068872 42096613-42096712 Ash2l 0.034382013 -0.126 chr8 - 25831273-25831348 25828766-25828859 25832640-25832735 Ube2f 0.014048195 -0.124 chr1 + 91275250-91275317 91265218-91265283 91276386-91276456 Ept1 0.026964058 -0.123 chr5 + 30248412-30248520 30247463-30247531 30252710-30252784 Unc80 0.030286942 -0.122 chr1 + 66694365-66694564 66693692-66693803 66695330-66699148 Gria2 0.036611404 -0.121 chr3 - 80690404-80690518 80689103-80689351 80691320-80691434 Nudt14 0.030754997 -0.119 chr12 - 112938356-112938593 112934733-112935050 112938795-112938859

Table A.3. cont. Alternative Exon Skipping Events Reported by rMATS in HuD KO vs Controls ES Gene FDR Inc Lev Diff Chr Strand Exon target Exon upstream Exon downstream Repin1 0.011101621 -0.119 chr6 + 48594791-48594976 48593883-48594052 48596296-48599082 Ibtk 0.044684761 -0.118 chr9 - 85722275-85722452 85720744-85721346 85724047-85724224 Tfcp2 0.020218609 -0.117 chr15 - 100522389-100522495 100520563-100520715 100525567-100525672 Atp2c1 0.020218609 -0.113 chr9 - 105494415-105494597 105470037-105470147 105494893-105495133 Herc4 0.030136146 -0.113 chr10 + 63289052-63289241 63287898-63288009 63299120-63299239 Tspan14 0.031889584 -0.112 chr14 - 40934188-40934285 40918630-40918680 40966776-40966807 Map3k4 0.030754997 -0.105 chr17 - 12243500-12243596 12242650-12242805 12247303-12247369 Rbm34 0.022861255 -0.104 chr8 - 126969983-126970128 126965382-126965622 126970738-126970909 Vps26a 0.036611404 -0.103 chr10 - 62471060-62471135 62469901-62470057 62480558-62480707 Eps15 0.023183644 -0.102 chr4 + 109382785-109382966 109379867-109380029 109385319-109387816 Tatdn1 0.048614117 -0.102 chr15 - 58923905-58923968 58921274-58921417 58926436-58926485 Cdk8 0.024432036 -0.098 chr5 + 146292624-146292767 146286108-146286239 146295163-146295232 Nit1 0.009521541 -0.094 chr1 - 171344288-171344539 171343694-171343827 171344914-171345000 Slc35a2 0.038912262 -0.091 chrX + 7892140-7892867 7889612-7889763 7894191-7894492 Dzip3 0.016909775 -0.088 chr16 - 48984535-48984635 48982060-48982132 48993790-48994112 Nme3 0.016321543 -0.085 chr17 + 24897028-24897140 24896852-24896953 24897214-24897529 Ttc3 0.010125331 -0.074 chr16 + 94409684-94409729 94408554-94408716 94410833-94410956 Rnf123 0.038371824 -0.073 chr9 - 108052445-108052587 108052214-108052308 108056037-108056121 Ivns1abp 0.002736419 -0.072 chr1 + 151350981-151351109 151349376-151349603 151351554-151351723 Pum1 0.011336386 -0.072 chr4 + 130668925-130669298 130663359-130663467 130701042-130701110 Clint1 0.026874892 -0.07 chr11 + 45902211-45902285 45895060-45895129 45906181-45906467 Rai1 0.023876639 -0.07 chr11 + 60185096-60190622 60140082-60140370 60193939-60194032 Slbp 0.017597514 -0.07 chr5 - 33649743-33649847 33646010-33646069 33651963-33652079 Rps6kb1 0.011101621 -0.068 chr11 - 86516744-86516987 86513983-86516191 86517583-86517640 Pdcl3 0.010662353 -0.067 chr1 + 38991246-38991375 38987814-38987849 38994915-38995005 Sipa1l1 0.011419628 -0.065 chr12 + 82311349-82311409 82265957-82266025 82340662-82342499 Ttll11 0.040283423 -0.065 chr2 - 35784089-35784195 35751226-35752492 35795357-35795602 Irf2 0.042860882 -0.061 chr8 + 46793493-46793585 46739745-46739936 46806471-46806570 Dnm1l 0.022078746 -0.057 chr16 - 16318764-16318841 16318445-16318477 16319452-16319508 Arap2 0.01258994 -0.055 chr5 - 62606075-62606209 62602446-62604656 62611704-62611767 Gas2l1 0.017429504 -0.054 chr11 - 5062415-5062511 5062155-5062326 5062594-5062701 Ptgr2 0.023876639 0.053 chr12 + 84296228-84296356 84295217-84295335 84298011-84298202 Fibp 0.011863189 0.055 chr19 + 5464334-5464431 5464129-5464215 5464925-5465052 Pcyox1 0.031889584 0.058 chr6 - 86395914-86396120 86394409-86394583 86396973-86397150 Tecr 0.017178863 0.059 chr8 - 83573411-83573455 83573220-83573323 83574478-83574528 Ube2w 0.017597514 0.068 chr1 - 16585276-16585431 16568674-16571282 16597951-16598053 Ube2w 0.01258994 0.077 chr1 - 16581927-16582002 16568674-16571282 16597951-16598053 Mettl10 0.049269076 0.078 chr7 - 132850595-132850709 132837100-132837207 132851426-132851491 Unc80 0.036102696 0.079 chr1 + 66685616-66685672 66683149-66683287 66692508-66692589 Hr 0.016909775 0.08 chr14 + 70567502-70567632 70567149-70567218 70567776-70567895 Snap25 0.025037203 0.08 chr2 + 136770057-136770174 136769743-136769860 136773895-136774020 Clip4 0.033999832 0.081 chr17 + 71834184-71834307 71831205-71831339 71837694-71837758 Bin1 0.025037203 0.082 chr18 + 32430750-32430857 32429700-32429723 32431983-32432093 Iah1 0.045124309 0.085 chr12 + 21321334-21321455 21319770-21319931 21323289-21323607 Mknk1 0.043607728 0.087 chr4 + 115864539-115864612 115862977-115863056 115866462-115866566 Cul4a 0.025037203 0.088 chr8 + 13106194-13106309 13105721-13105903 13115470-13115573 Spast 0.040774874 0.089 chr17 + 74359254-74359349 74356086-74356169 74367248-74367435 Rap1gds1 0.010662353 0.09 chr3 - 138983722-138983868 138965868-138965996 139015546-139015671

Table A.3. cont. Alternative Exon Skipping Events Reported by rMATS in HuD KO vs Controls ES Gene FDR Inc Lev Diff Chr Strand Exon target Exon upstream Exon downstream Pptc7 0.044071317 0.093 chr5 + 122313595-122313793 122308131-122308310 122317111-122317234 Stau2 0.034763325 0.094 chr1 - 16486020-16486150 16463035-16463194 16519173-16519302 Mpp2 0.009521541 0.095 chr11 - 102080653-102080771 102064569-102064721 102085300-102085362 Dlgap1 0.00241646 0.098 chr17 + 70718196-70718225 70662569-70662809 70761075-70761445 Aamdc 0.025540391 0.101 chr7 - 97558131-97558226 97550331-97550741 97575588-97575691 Ppfia2 0.024196491 0.102 chr10 + 106767474-106767548 106761983-106762147 106800737-106800853 Aamdc 0.028772653 0.108 chr7 - 97565151-97565300 97550331-97550741 97575588-97575691 Kif21a 0.036027395 0.109 chr15 - 90952711-90952818 90951246-90951374 90956295-90956509 Ndufab1 0.003404614 0.109 chr7 - 122093617-122093704 122091586-122091685 122096609-122096731 Prpf40a 0.010127629 0.111 chr2 - 53153964-53154072 53153464-53153528 53156623-53156985 Epb4.1l4b 0.02252715 0.116 chr4 - 57076914-57077002 57076534-57076603 57077164-57077251 Cmc2 0.025481158 0.117 chr8 - 116911128-116911234 116894088-116894159 116921351-116921436 Fars2 0.024273063 0.117 chr13 + 36204509-36205141 36117643-36118005 36232122-36232281 Slc22a23 0.039336255 0.117 chr13 - 34305158-34305261 34298997-34299151 34344159-34345182 Odf2 0.003404614 0.119 chr2 + 29893001-29893154 29892186-29892276 29893444-29893569 Cacul1 0.043294686 0.12 chr19 - 60537414-60537503 60534136-60534274 60543010-60543112 Ralgps1 0.034129653 0.129 chr2 - 33157772-33157929 33146570-33146650 33158910-33159036 Atxn2 0.003104956 0.131 chr5 + 121781333-121781542 121779418-121779596 121783857-121784039 Tanc2 0.000157532 0.132 chr11 + 105919951-105920051 105916914-105917060 105921748-105929303 Sdccag3 0.020587354 0.133 chr2 - 26385990-26386063 26384682-26384821 26386904-26387311 Ascc1 0.027520157 0.135 chr10 + 60012462-60012559 60007727-60007826 60013596-60013774 Adgrl2 0.040283423 0.14 chr3 - 148827212-148827238 148826365-148826533 148828477-148828568 Armcx1 0.011629437 0.147 chrX + 134718370-134718461 134717938-134718050 134718726-134718818 Ncor2 0.040283423 0.151 chr5 - 125124770-125124980 125119482-125119609 125153607-125153652 Kctd17 0.005311328 0.155 chr15 + 78436901-78437099 78435585-78435710 78438487-78439303 Zfp746 0.038570869 0.156 chr6 - 48082154-48082267 48067169-48067360 48083093-48083174 Fnip1 0.031889584 0.157 chr11 + 54487712-54487795 54482495-54482586 54489269-54489340 Hdac5 0.038302949 0.165 chr11 - 102219145-102219281 102218416-102218487 102224734-102224955 Nup98 0.008987739 0.167 chr7 - 102169363-102169503 102163689-102163822 102176313-102176405 Nf1 0.038382932 0.168 chr11 + 79463233-79463295 79458771-79458906 79468717-79468875 Prkdc 0.018007989 0.168 chr16 + 15795028-15795139 15791873-15791981 15799867-15800053 Tbc1d12 0.038912262 0.172 chr19 + 38901308-38901415 38895986-38896069 38907771-38907852 Rgl2 0.017429504 0.175 chr17 + 33930245-33930441 33929894-33930044 33931726-33931809 Dtnb 0.049032686 0.177 chr12 + 3773551-3773640 3772587-3772746 3779619-3779654 Ptpn12 0.009321426 0.182 chr5 - 21029776-21029884 21022018-21022094 21055649-21055797 Tenm2 0.011863189 0.183 chr11 - 36385119-36385328 36300196-36300430 36864668-36864943 Trpc6 0.03606589 0.184 chr9 + 8649298-8649531 8643506-8643722 8652936-8653200 Wdr17 0.011101621 0.186 chr8 - 54685396-54685518 54681346-54681530 54690004-54690234 Ormdl2 0.011101621 0.187 chr10 - 128820261-128820514 128819954-128820105 128821542-128821631 Zmym4 0.001941797 0.189 chr4 - 126923064-126923234 126915581-126915665 126923569-126923630 Ccdc136 0.038302949 0.193 chr6 + 29412364-29412534 29411248-29411385 29412902-29413087 Phka1 0.038371824 0.2 chrX - 102557096-102557272 102555526-102555617 102559565-102559734 Uty 0.024273063 0.2 chrY - 1137658-1137732 1136848-1136996 1137807-1137871 Ofd1 0.011703549 0.203 chrX - 166424976-166425082 166414976-166415095 166426820-166426993 Trmt44 0.020218609 0.203 chr5 - 35566422-35566528 35565361-35565544 35568761-35568832 Dph6 0.006978488 0.204 chr2 - 114523044-114523138 114519712-114519799 114535525-114535586 Myh15 0.030136146 0.205 chr16 + 49182836-49183006 49176951-49177076 49186995-49187099 Socs7 0.017429504 0.206 chr11 + 97376437-97376541 97373066-97373130 97377936-97378066

Table A.3. cont. Alternative Exon Skipping Events Reported by rMATS in HuD KO vs Controls ES Gene FDR Inc Lev Diff Chr Strand Exon target Exon upstream Exon downstream Mpv17 0.014713087 0.208 chr5 - 31145246-31145278 31144700-31144752 31145495-31145590 Tpm1 0.040283423 0.209 chr9 - 67029664-67029742 67022593-67023441 67031029-67031098 Lrch1 0.02468191 0.21 chr14 - 74835649-74835775 74826598-74826703 74857977-74858121 Rcc1 0.047954613 0.211 chr4 - 132337731-132337910 132335717-132335813 132339925-132340006 Rims1 0.015978429 0.212 chr1 - 22404444-22404515 22397451-22397563 22421741-22421830 Caap1 0.014036803 0.214 chr4 - 94549119-94549194 94521062-94521135 94551265-94551465 Cdk5rap2 0.034047402 0.217 chr4 - 70337341-70337559 70317427-70317597 70349144-70349245 Rims1 0.049637222 0.218 chr1 - 22425871-22425933 22397451-22397563 22427462-22427587 Slc30a6 0.001266441 0.219 chr17 + 74419532-74419600 74418620-74418667 74423017-74424229 Rapgef4 0.0000000000828 0.223 chr2 + 72174423-72174476 72141153-72141172 72174802-72174908 Kat2b 0.018234628 0.224 chr17 + 53665406-53665442 53663535-53663649 53665653-53665716 Meis3 0.002156962 0.225 chr7 + 16177961-16178011 16177709-16177868 16178745-16178795 Fnbp1 0.008287182 0.229 chr2 - 31052985-31053137 31040405-31040514 31054024-31054218 Arhgef12 0.004266799 0.233 chr9 - 43040540-43040596 43027197-43027295 43042591-43042676 Tmem164 0.037443309 0.237 chrX + 142682291-142682949 142681400-142681556 142752040-142752089 Hectd2 0.033621942 0.239 chr19 + 36601429-36601528 36599596-36599719 36604250-36604357 Adamts10 0.004022 0.244 chr17 + 33543636-33543781 33543198-33543305 33543872-33543935 Plxnb3 0.043294686 0.245 chrX + 73764362-73764513 73763978-73764147 73765267-73765372 Hectd2 0.033142661 0.248 chr19 + 36601432-36601528 36599596-36599719 36604250-36604357 Cdk5rap1 0.008797826 0.249 chr2 - 154360557-154360767 154354090-154354210 154365962-154366062 Kbtbd3 0.04777478 0.254 chr9 + 4313702-4313806 4309816-4309934 4316827-4317071 Adgrl2 0.043294686 0.256 chr3 - 148827212-148827238 148826365-148826533 148827541-148827585 Fnbp1 0.010662353 0.259 chr2 - 31044882-31044896 31040405-31040514 31054024-31054218 Ints10 0.017597514 0.263 chr8 + 68824190-68824267 68822157-68822250 68825052-68825129 Dram2 0.003104956 0.264 chr3 + 106571611-106571693 106566045-106566184 106572973-106573065 Wdfy3 0.020218609 0.272 chr5 - 101935990-101936073 101930828-101931005 101937282-101937739 Usp35 0.001655295 0.273 chr7 - 97322049-97322178 97321560-97321661 97324208-97324340 Lims2 0.048026069 0.282 chr18 + 31944139-31944205 31941740-31941899 31944436-31944556 Dyx1c1 0.048614117 0.287 chr9 + 72961258-72961391 72960582-72960729 72964091-72964236 Caap1 0.011101621 0.288 chr4 - 94550422-94550506 94521062-94521135 94551265-94551465 Rpl27a 0.024362993 0.3 chr7 + 109520468-109520642 109519918-109519993 109521601-109522369 Slc25a40 0.031889584 0.303 chr5 + 8427196-8427267 8422838-8423039 8427408-8427516 Tfb2m 0.047954613 0.303 chr1 - 179544898-179544986 179542307-179542457 179545822-179546267 Flna 0.005039033 0.307 chrX - 74232967-74232990 74230506-74230753 74233149-74233338 Dusp11 0.006450594 0.31 chr6 - 85950514-85950560 85950018-85950093 85952305-85952365 Mdn1 0.017030486 0.324 chr4 + 32734342-32734451 32733337-32733724 32735193-32735895 Tec 0.032639669 0.336 chr5 - 72779421-72779486 72773831-72773885 72782003-72782175 Ccdc37 0.017030486 0.346 chr6 - 90415700-90415892 90413961-90414028 90417610-90417710 Bbs9 0.010662353 0.363 chr9 + 22476570-22476625 22475715-22476055 22490818-22490940 Gm20754 0.036248463 0.365 chr3 + 73564937-73565381 73559449-73559526 73594343-73594830 Dennd1a 0.035593429 0.401 chr2 - 38136926-38136975 38048725-38048794 38159807-38159850 Ube2w 0.000534415 0.406 chr1 - 16585276-16585352 16568674-16571282 16597951-16598053 Cbx3 0.010662353 0.413 chr6 + 51475231-51475373 51471816-51471868 51481724-51481818 Mov10 0.001416094 0.44 chr3 - 104799698-104799795 104799392-104799608 104799946-104800049 Aifm3 0.040774874 0.456 chr16 + 17506899-17506919 17504918-17505016 17507127-17507482 Msantd1 0.001941797 0.457 chr5 + 34921404-34921679 34915915-34917915 34923324-34923839 Lypd6b 0.018007989 0.462 chr2 + 49903376-49903452 49787686-49787773 49930925-49930984 Ltk 0.002127063 0.467 chr2 - 119758524-119758661 119758247-119758403 119758756-119758906 Ap4e1 0.000036640 0.618 chr2 + 127043647-127043756 127043421-127043543 127046148-127046287

Table A.4. Alternative Intron Retention Events Reported by rMATS in HuD KO vs Controls

Gene FDR Inc Lev Diff Chr Strand Intron Chkb 0.006036926 -0.248 chr15 - 89428411-89428827 Dusp22 0.042813274 -0.186 chr13 + 30708677-30711232 Hus1 0.043690064 -0.17 chr11 - 8993137-8996932 Actr3 0.043690064 -0.095 chr1 - 125435285-125435727 Pdcd4 0.049563888 -0.085 chr19 + 53929083-53929861 Clk1 0.00631607 -0.079 chr1 - 58419667-58421308 Fam134a 0.043690064 0.064 chr1 + 75146430-75147909 Ciz1 0.046204447 0.084 chr2 + 32370864-32371408 Inpp5d 0.043690064 0.219 chr1 + 87715038-87715313 Pla2g6 0.046204447 0.255 chr15 - 79327635-79328371 Ret 0.000360622 0.464 chr6 - 118151748-118155435

Table A.5. Alternative Mutually Exclusive Exon Events Reported by rMATS in HuD KO vs Controls

MXE

Gene FDR Inc Lev Diff Chr Strand Exon 1 Exon 2 Whsc1l1 0.047551582 -0.351 chr8 + 25683152-25683322 25691015-25691161

Ptcd3 0.00621196 -0.189 chr6 - 71883444-71883592 71884540-71884625 Rapgef4 0.003976053 -0.186 chr2 + 72141153-72141172 72174423-72174476 Aifm3 0.036714033 -0.155 chr16 + 17504918-17505016 17506899-17506919

Mapk9 0.042141777 -0.11 chr11 + 49873836-49873907 49874264-49874335 St6galnac6 0.048654108 0.111 chr2 + 32609226-32609316 32612224-32612403 Inpp5f 0.00310096 0.197 chr7 + 128690627-128690698 128691752-128691825

Pias1 0.047551582 0.206 chr9 - 62902759-62902832 62912750-62912855 Ints10 0.042141777 0.261 chr8 + 68824190-68824267 68825052-68825129 Carf 0.047551582 0.28 chr1 + 60108083-60108200 60109222-60109449

Usp35 0.004909346 0.44 chr7 - 97321560-97321661 97322049-97322178

Table A.6. List of HuD Targets Used in rMATS and DaPars Comparisons

HuD Targets "E1 E18 Ctx" and "STR RIP-seq": 1110004F10Rik Asph Casd1 Crls1 Elmod2 Gnl3l Kctd13 Metap2 Nrgn Ppp1r12a Rer1 Selk Spint2 Thoc1 Ube2g1 Zfp113 6430704M03Rik Atat1 Catsper2 Csnk2a1 Emilin1 Gpcpd1 Kdm6b Mex3c Nrp1 Ppp1r15b Rfk Sema4d Spred2 Thra Ube2h Zfp161 A830010M20Rik Atl3 Cbfa2t2 Cspp1 Eml5 Gpm6a Khdrbs1 Mgea5 Nrxn1 Ppp1r2 Rgmb Sema5a Sri Tia1 Ube2l3 Zfp187 Aasdhppt Atp11a Cbfb Cyb5r3 Entpd7 Gpr137c Khdrbs3 Mier1 Nsg2 Ppp2ca Rgs7bp Sema6a Srp14 Tial1 Ube2m Zfp238 Abcb7 Atp11c Cbx1 Cyp51 Epb4.1l3 Gpr85 Kif1b Mier3 Nucks1 Ppp2r5e Rhoc Senp5 Srp72 Timp2 Ube2w Zfp280d Abce1 Atp1b1 Cbx3 Cyth2 Epha3 Gria2 Kif2a Mkln1 Nudt3 Ppp4r2 Rif1 Serbp1 Srp9 Tle4 Ufd1l Zfp362 Abi1 Atp2b1 Cbx5 D0H4S114 Erbb4 Gtf2a1 Kif5c Mllt11 Nudt4 Ppp6c Rimklb Serf2 Srpk1 Tm9sf3 Upf2 Zfp385b Abi2 Atp2c1 Ccdc6 Dach1 Ergic1 H2afz Kitl Mmachc Nufip2 Pramef8 Riok3 Serinc3 Srrm2 Tmcc1 Uqcrb Zfp410 Acat2 Atp6v1d Ccdc82 Dchs1 Etf1 H3f3a Klf6 Mmp16 Onecut2 Prkacb Rnf145 Serpinh1 Srsf1 Tmed2 Usf1 Zfp563 Acbd5 Atp6v1g1 Ccnb1 Dck Etl4 H3f3b Kpna1 Morf4l1 Otud1 Prkar1a Rnf2 Set Srsf10 Tmed7 Utrn Zfp606 Actb Atpif1 Ccnd2 Dctn5 Etv1 Haus2 Kpna4 Morf4l2 Otud6b Prpf39 Rnpc3 Sf3a1 Srsf2 Tmed9 Vamp2 Zfp654 Actr2 Atrx Ccnt2 Dcun1d1 Etv3 Hdgfrp3 Krt222 Mpp7 Pabpc1 Prps2 Rora Sf3b1 Srsf9 Tmem106b Vamp3 Zfp706 Acvr1b Atxn7l3b Ccnyl1 Dcun1d3 Fabp5 Hells Laptm4a Mrpl17 Pabpc5 Prune Rorb Sfxn3 Ssbp1 Tmsb10 Vim Zfp770 Acvr2a Azin1 Cd200 Dcun1d5 Fbn2 Helz Larp4 Mrpl48 Pabpn1 Psd3 Rpl14 Sh3glb1 Ssbp2 Tmsb4x Vps54 Zic1 Adamts18 B2m Cd24a Dcx Fbxo3 Hiatl1 Ldb2 Mrps10 Pafah1b1 Psip1 Rpl19 Shroom2 Ssh2 Tmtc3 Vps72 Zmat2 Adk B4galt5 Cd44 Ddhd1 Fem1c Hint3 Lin7a Mrps21 Pafah1b2 Psmd11 Rpl23 Sirt6 St13 Tmx3 Vti1a Zmpste24 Adprh B4galt6 Cdc27 Ddx17 Fgd4 Hipk2 Lin7c Msi2 Paip2 Ptar1 Rpl23a Skil St3gal1 Tmx4 Vti1b Zmym5 Aff3 Bach2 Cdc37l1 Ddx21 Fkbp1a Hist1h4d Lmf2 Mtap2 Pak2 Ptma Rpl24 Skp1a St8sia1 Tnfrsf21 Wac Zrsr2 Agpat1 Basp1 Cdc42 Ddx3x Flrt2 Hist2h2be Lnp Mtf2 Pak3 Ptms Rpl28 Slc12a2 Stag2 Tob2 Wbp4 Agpat5 Bcap31 Cdc42ep3 Ddx50 Fndc3a Hmgb1 Lrch2 Mtx3 Pbx3 Ptn Rpl36 Slc16a2 Stau1 Tox2 Wdr37 Alcam Bcl11b Cdk17 Dek Foxo1 Hmgb2 Lrp8 Mxd1 Pcbp1 Ptpn12 Rpl36a Slc1a1 Stau2 Tpbg Whsc1 Alg10b Bcl7a Cdk19 Dennd4a Foxp2 Hmgn1 Lrrc8c Myef2 Pcnp Ptprd Rpl37a Slc25a36 Stmn1 Tpd52 Whsc1l1 Alg6 Bcl7b Cdk5r1 Derl2 Frmd5 Hmgn2 Lrrtm4 Mylk Pdgfa Ptpre Rprd2 Slc25a44 Stmn2 Tpd52l2 Wwp1 Ammecr1l Bclaf1 Celf1 Dlg1 Fryl Hnrnpa3 Lsm1 Myo1c Pdia4 Purb Rps10 Slc35a5 Stmn3 Tpm3 Xpr1 Ank3 Bex1 Celf2 Dmtf1 Fth1 Hnrnpab Lsm3 Mzt1 Per3 Qk Rps18 Slc35e1 Strbp Tpm4 Ybx1 Ankle2 Bex2 Cep170 Dnaja4 Fubp1 Hnrnpd Luc7l2 Naa38 Pfdn2 Rab11a Rps20 Slc38a9 Strn Tra2a Yipf4 Anp32a Bicd1 Cetn2 Dnajb6 Fundc2 Hnrnph1 Luc7l3 Nap1l1 Pfn2 Rab14 Rps21 Slc39a10 Stt3a Tram1 Yipf5 Anxa1 Bmi1 Cetn4 Dnajb9 Fut9 Hnrnpk Magi2 Napb Phf12 Rab2a Rps26 Slc4a7 Sub1 Trim8 Ypel2 Ap1ar Bmpr1a Cfdp1 Dopey1 Fyttd1 Hnrnpu Map3k7 Ncam1 Phf6 Rab2b Rps28 Slc7a5 Sumo2 Trmt11 Ythdf2 Ap1s2 Bnip3l Cfl1 Dpysl2 Fzd3 Hnrpdl Map6d1 Ncapg Phip Rab3a Rsad1 Slc8a1 Svip Trmt61b Ythdf3 Ap3s1 Braf Ckap4 Dpysl3 G2e3 Hook1 Marcks Ncs1 Pias2 Rab3c Rsrc2 Slco5a1 Syncrip Trp53 Ywhae Ap3s2 Brd4 Clasp2 Dram2 G3bp1 Hspa13 Marcksl1 Ndfip1 Picalm Rab5a Rtn3 Smarca5 Sypl Trp53inp1 Ywhag Apbb2 Brdt Clcn3 Dtl Gabrb2 Hspa8 Matr3 Ndufb4 Pik3r1 Rab6 Rtn4ip1 Smarcc1 Syt1 Trp53inp2 Ywhah Aph1a Brwd1 Cldnd1 Dtymk Gabrb3 Htr1a Max Ndufb8 Pikfyve Rab7 Rufy3 Smc5 Tacc1 Trpm7 Ywhaz Api5 Bsg Clint1 Dusp7 Gabrg1 Ide Mbd5 Nek7 Pkd2 Rabgap1l Runx1t1 Snap23 Taf12 Tsc22d1 Zbtb20 Appbp2 Btf3 Clvs2 Dynll1 Gabrg3 Idh1 Mbnl2 Neto2 Pkig Rabl3 Rwdd4a Snap25 Taf1d Tsc22d3 Zbtb33 Appl1 Btf3l4 Cnih4 Eapp Garnl3 Igf2bp3 Mbtd1 Nfasc Plekha3 Racgap1 S100pbp Snrpd3 Tardbp Ttc13 Zbtb41 Arf3 Bub3 Cnn3 Edem3 Gdap1 Il1rap Mcart1 Nfia Plxna2 Ralb Safb Snrpf Tbcel Ttc28 Zbtb44 Arf4 Bzw1 Cnot2 Edil3 Gja1 Impad1 Mcc Nfib Plxna4 Ranbp1 Sarnp Soat1 Tcea1 Ttc3 Zbtb8a Arglu1 C1d Cnot6 Ei24 Glo1 Insig1 Mccc1 Nfyb Pogz Rap2c Satb1 Son Tcf4 Ttc9 Zc3h15 Arid1b C430048L16Rik Cnot7 Eif1 Glrx2 Iws1 Mdga2 Nhsl1 Polb Rbbp4 Sbno1 Sorbs2 Tcfap4 Tug1 Zc4h2 Arid2 Cadm2 Col1a2 Eif2s2 Gmfb Jmy Mdm4 Nip7 Polr1d Rbm14 Scai Sox11 Tead1 Tulp4 Zcrb1 Arid4b Calm1 Coq10b Eif4a1 Gmps Kalrn Mecp2 Nkain1 Pot1a Rbm3 Scn2a1 Sox2 Tfam Twf1 Zdbf2 Arid5b Calm2 Cox17 Eif4g2 Gnai1 Kcna4 Med23 Nktr Pou2f1 Rbm39 Scn2b Sox4 Tfdp2 Txnip Zdhhc2 Arl8b Calm3 Cplx1 Eif5 Gnaq Kcnj16 Meg3 Nlk Ppapdc2 Rbmx Scrt2 Sox5 Tfrc Ube2b Zeb1 Armc1 Calr Cplx2 Eif5b Gnaz Kcnj3 Meis2 Nmt2 Ppargc1a Rbpj Sdc2 Sox8 Tgs1 Ube2d1 Zeb2 Arpp19 Camkk2 Cpox Elk3 Gnb1 Kcnma1 Mesdc2 Nova2 Ppig Rc3h2 Sec22b Sp1 Thada Ube2d2 Zfhx3 Asb8 Canx Crk Elmo1 Gng2 Kctd12 Mest Nras Ppp1cb Reep3 Sec62 Spin1 Thap2 Ube2d3 Zfp106

Table A.7. Alternative Polyadenylation Events Reported by DaPars in HuD KO vs Controls Predicted KO Control Gene Chr Strand Proximal APA Loci PDUI PDUI ∆PDUI FDR Event

Alg6 chr4 + 99762837 chr4:99761871-99763460 0.89 0.503333333 0.386666667 0.011155103 3' UTR Lengthened in KO chr9:108301320- Amt chr9 + 108301595 108302302 0.49 0.76 -0.27 0.059742328 3' UTR Shortened in KO chr11:120006359- Baiap2 chr11 + 120006663 120006782 0.59 0.89 -0.3 0.009572925 3' UTR Shortened in KO

Brf2 chr8 - 27124419 chr8:27123832-27124620 0.82 0.526666667 0.293333333 0.081324885 3' UTR Lengthened in KO

Cdadc1 chr14 - 59560631 chr14:59560298-59560921 0.955 0.623333333 0.331666667 0.001784994 3' UTR Lengthened in KO chr5:106982964- Cdc7 chr5 + 106983757 106984439 0.58 1 -0.42 0.00081838 3' UTR Shortened in KO chr12:104763114- Clmn chr12 - 104771762 104771963 0.66 1 -0.34 0.000795711 3' UTR Shortened in KO chr8:109547999- Dhx38 chr8 - 109548135 109548483 0.535 0.806666667 -0.271666667 0.044120255 3' UTR Shortened in KO

Dis3l2 chr1 + 87049824 chr1:87049623-87050097 0.83 0.513333333 0.316666667 0.028517715 3' UTR Lengthened in KO

Dpy30 chr17 - 74299623 chr17:74299474-74299824 0.305 0.62 -0.315 3.90E-06 3' UTR Shortened in KO

Dtnbp1 chr13 - 44922214 chr13:44922080-44922454 0.405 0.616666667 -0.211666667 0.002314614 3' UTR Shortened in KO

Evc2 chr5 + 37424752 chr5:37424409-37425054 0.44 0.696666667 -0.256666667 0.093192244 3' UTR Shortened in KO

Fhod3 chr18 + 25133151 chr18:25132911-25133507 0.47 0.723333333 -0.253333333 0.00825868 3' UTR Shortened in KO

Fosl2 chr5 + 32152872 chr5:32152671-32157839 0.53 0.86 -0.33 0.027522192 3' UTR Shortened in KO chr5:134357661- Gtf2ird1 chr5 - 134358917 134359118 0.56 0.95 -0.39 0.003873969 3' UTR Shortened in KO

Gtf3c5 chr2 - 28566763 chr2:28566245-28567177 0.55 1 -0.45 0.000227544 3' UTR Shortened in KO chr12:103439954- Ifi27 chr12 + 103440155 103440245 0.45 0.713333333 -0.263333333 0.012162562 3' UTR Shortened in KO

Ift88 chr14 + 57517673 chr14:57517337-57517936 0.71 0.413333333 0.296666667 0.081324885 3' UTR Lengthened in KO

Ino80b chr6 - 83122045 chr6:83121765-83122364 0.385 0.683333333 -0.298333333 0.066313941 3' UTR Shortened in KO

Lactb2 chr1 - 13626269 chr1:13625900-13626904 0.435 0.866666667 -0.431666667 0.002729299 3' UTR Shortened in KO

Lrfn3 chr7 - 30355902 chr7:30355514-30356103 0.56 0.945 -0.385 0.000332386 3' UTR Shortened in KO

Max chr12 - 76939313 chr12:76939169-76939514 0.4 0.74 -0.34 0.02618836 3' UTR Shortened in KO

Med16 chr10 - 79895106 chr10:79894706-79895410 0.535 0.83 -0.295 0.004200052 3' UTR Shortened in KO

Med16 chr10 - 79895106 chr10:79894707-79895410 0.535 0.833333333 -0.298333333 0.004200052 3' UTR Shortened in KO chr4:116702434- Mmachc chr4 - 116703210 116703867 0.55 0.893333333 -0.343333333 0.013452577 3' UTR Shortened in KO

Mrpl14 chr17 + 45698285 chr17:45698048-45698495 0.43 0.67 -0.24 0.030207965 3' UTR Shortened in KO chr7:140150155- Mtg1 chr7 + 140150356 140150628 0.43 0.7 -0.27 0.074556572 3' UTR Shortened in KO

Nell1 chr7 + 50863100 chr7:50862899-50863289 0.45 0.763333333 -0.313333333 0.001372363 3' UTR Shortened in KO

Pfn4 chr12 + 4778414 chr12:4778180-4778813 0.59 1 -0.41 0.001462151 3' UTR Shortened in KO

Table A.7. cont. Alternative Polyadenylation Events Reported by DaPars in HuD KO vs Controls Predicted Proximal Control Gene Chr Strand APA Loci KO PDUI PDUI ∆PDUI FDR Event Phf14 chr6 + 12039525 chr6:12039211-12039759 0.52 1 -0.48 0.000110358 3' UTR Shortened in KO chr4:117128730- Plk3 chr4 - 117128958 117129178 0.94 0.56 0.38 0.00836812 3' UTR Lengthened in KO Pole4 chr6 - 82647384 chr6:82646712-82648036 0.405 0.64 -0.235 0.0355674 3' UTR Shortened in KO Prkra chr2 - 76630317 chr2:76629898-76630568 1 0.64 0.36 8.55E-05 3' UTR Lengthened in KO chr15:102462171- Prr13 chr15 + 102462597 102462806 0.475 0.716666667 -0.241666667 0.001744266 3' UTR Shortened in KO chr14:69697304- R3hcc1 chr14 - 69697401 69697602 0.18 0.433333333 -0.253333333 0.04259319 3' UTR Shortened in KO chr14:73182459- Rcbtb2 chr14 + 73182660 73184054 0.82 0.493333333 0.326666667 0.047819371 3' UTR Lengthened in KO Rmdn1 chr4 + 19606494 chr4:19606085-19606932 1 0.58 0.42 0.001662139 3' UTR Lengthened in KO chr12:28658993- Rnaseh1 chr12 + 28659194 28659591 0.5 0.95 -0.45 0.000228407 3' UTR Shortened in KO chr12:104413412- Serpina3n chr12 + 104413653 104414329 0.49 1 -0.51 3.73E-06 3' UTR Shortened in KO

Sin3b chr8 + 72757796 chr8:72757175-72758203 0.395 0.623333333 -0.228333333 0.064481161 3' UTR Shortened in KO

Snx25 chr8 - 46033568 chr8:46033261-46033822 0.37 0.64 -0.27 0.007970637 3' UTR Shortened in KO

Snx9 chr17 + 5931013 chr17:5930570-5931956 0.28 0.69 -0.41 0.019242511 3' UTR Shortened in KO chr7:130764254- Tacc2 chr7 + 130764635 130764885 0.16 0.36 -0.2 0.009653488 3' UTR Shortened in KO chr6:113710734- Tatdn2 chr6 + 113710935 113711082 0.37 0.965 -0.595 3.20E-05 3' UTR Shortened in KO chr4:151982638- Thap3 chr4 - 151982959 151983352 0.4 0.736666667 -0.336666667 0.004017189 3' UTR Shortened in KO chr7:141332910- Tmem80 chr7 + 141333196 141333327 1 0.625 0.375 0.004686906 3' UTR Lengthened in KO chr15:89085756- Trabd chr15 + 89086260 89087075 0.49 0.826666667 -0.336666667 0.057076233 3' UTR Shortened in KO chr11:69325439- Trappc1 chr11 + 69325640 69325793 0.345 0.566666667 -0.221666667 0.00335037 3' UTR Shortened in KO chr16:11074986- Txndc11 chr16 - 11075410 11075642 0.925 0.573333333 0.351666667 0.000260377 3' UTR Lengthened in KO chr10:88746607- Utp20 chr10 - 88746745 88747059 0.4 0.86 -0.46 0.002729299 3' UTR Shortened in KO

Wdr75 chr1 + 45823509 chr1:45823308-45823638 0.225 0.613333333 -0.388333333 0.000951389 3' UTR Shortened in KO chr4:154156532- Wrap73 chr4 + 154156733 154156818 0.25 0.57 -0.32 0.091094941 3' UTR Shortened in KO

Zfp467 chr6 - 48439130 chr6:48436613-48439357 0.615 1 -0.385 0.00420588 3' UTR Shortened in KO

APPENDIX B: Utilizing the Pipeline on a Robust Alcohol Dataset

This study allowed for the development of a pipeline where alternative splicing and alternative polyadenylation can be measured from RNA-sequencing data.

Due to the difficulties of obtaining HuD KO mouse models, the number of replicates were relatively low. Nonetheless, the study provided evidence of HuD-regulated splicing of Gria2 and Snap25, and those same alternative splicing events have previously been linked to alcohol use disorder (AUD). To utilize the pipeline on a more robust dataset and to determine if Gria2 and Snap25 are differentially spliced in a mouse model of alcohol use, a splicing analysis was performed on a second dataset.

In the second dataset, C57BL/6J mice were exposed to an alcohol paradigm where they were given 0 (Water-Water; ‘WW’), 1 (Water-Ethanol; ‘WE’), or 15

(Ethanol-Ethanol; ‘EE’) days of limited access to an unsweetened, 20% ethanol solution. Importantly, the 1st day of ethanol experience in the WE group occurred on the 15th day of ethanol experience in the EE group. The WW group were used as controls, while the WE and EE groups represented acute and chronic exposure, respectively. Brain punches from the prefrontal cortex (PFC) and nucleus accumbens

(ACB) were taken immediately after the final 2-hour drinking session, and paired- end, 75bp Illumina sequencing was performed on the collected tissue. Alternative splicing was then measured utilizing the pipeline and parameters previously described.

A total of 55 replicates were used in the analysis. In the ACB set, the EE group contained 10 replicates, the WE group contained 11 replicates, and the WW group contained 6 replicates. In the PFC set, the EE group contained 12 replicates, the

WE group contained 9 replicates, and the WW group contained 7 replicates.

Evidently, this dataset contained a greater sample size compared to the previous set.

Three separate rMATS analyses were performed for each brain group to capture splicing changes between acute and chronic ethanol exposure: EE vs WW, EE vs

WE, and WE vs WW.

As expected, exon skipping represented the largest proportion of alternative splicing events at 66.0%, and intron retention represented the smallest proportion at

2.1% (Figure B.1). Differential splicing events associated with each comparison (EE vs WW; EE vs WE; WE vs WW) are summarized in Tables B.1-B.3. Surprisingly,

Snap25 and Gria2 were not found to be alternatively spliced genes. This challenges previous studies that have reported splicing of these genes in individuals with AUD.

It is also unknown if HuD protein levels were affected in the EE and WE groups, so to determine if HuD KO regulates splicing of these genes in alcohol use, another study should be performed where HuD KO mice are exposed to the same alcohol paradigm.

Figure B.1. Summary of alternative splicing events reported by rMATS. A) Number of genes with alternative splicing events between each comparison group (EE vs WW; EE vs WE; WE vs WW) in both ACB and PFC brain regions. B) Proportions of alternative splicing events reported overall.

Table B.1. Summary of Alternative Splicing Events Reported by rMATS in EE vs WE EE vs WE ACB PFC Event GeneID FDR IncLevelDifference Event GeneID FDR IncLevelDifference A3SS P2ry14 1.15341E-05 0.283 A3SS 5430405H02Rik 0.009613168 -0.128 A3SS Bdh2 0.000843945 0.206 A3SS Jmjd4 0.038972978 -0.08 A3SS Hdgfrp2 0.013808741 -0.074 A5SS Trmt61a 0.001051935 0.146 A3SS Ly6a 0.020191596 -0.092 A5SS Rreb1 2.1554E-05 -0.255 A3SS Hdgfrp2 0.03647138 -0.099 A5SS Brpf1 0.000299187 0.117 A3SS Pcdh9 0.03647138 -0.074 A5SS Myt1l 0.043333169 -0.122 A3SS Dtna 0.03647138 0.059 A5SS Steap2 0.043333169 0.235 A3SS Qk 0.03647138 0.073 A5SS Casp3 0.000299187 0.164 A3SS Luc7l 0.03647138 0.116 IR Nipa2 1.92E-04 -0.1 A5SS Zscan22 0.014290619 0.079 ES Strada 0.008702616 0.167 A5SS Zscan22 0.014290619 0.089 ES Eri2 0.006416063 -0.139 A5SS Nrde2 0.014290619 -0.084 ES Acox1 0.003344627 0.134 A5SS Pih1d1 0.03753545 0.119 ES Sgk3 0.006416063 -0.132 A5SS Stat1 0.017156068 -0.12 ES Prrg2 1.89273E-06 -0.227 IR Nipa2 0.017917942 -0.136 ES U2af1 0.003574418 -0.087 ES Zscan22 0.013208219 0.112 ES Mok 0.001460106 0.244 ES Cdc123 0.02927791 0.07 ES Gmip 1.07E-02 -0.071 ES Iqce 0.029682869 -0.089 ES 9930021J03Rik 0.009879649 0.163 ES Otud3 0.041209687 -0.126 ES Vmn2r29 0.00246662 -0.159 ES Mtss1 1.30917E-05 0.124 ES Ccdc136 0.001460106 0.217 ES Mtss1 0.029682869 0.071 ES Ccdc136 0.00336702 0.182 ES Tmbim6 1.30917E-05 0.283 ES Rbm6 0.027193478 -0.081 ES Atad3aos 1.58E-07 0.391 ES Atp9b 0.012717738 0.096 ES Armc8 0.023965154 0.071 ES Traf6 0.003162298 -0.167 ES 3110082J24Rik 0.004255713 0.066 ES Pign 0.018292364 -0.18 ES Vps13c 0.011579605 -0.074 ES AU022252 0.005761438 0.105 ES Ccdc136 0.006071958 -0.121 ES Tbcd 0.011395521 0.058 ES Ccdc136 0.004255713 -0.11 ES Zfp930 0.003344627 0.181 ES Pign 0.000153807 -0.136 ES Ccdc173 0.011395521 -0.13 ES Kat2b 1.24355E-05 -0.107 ES Zufsp 0.04257762 -0.089 ES Chuk 0.029682869 0.126 ES Dennd1a 0.002558876 -0.095 ES Phc2 0.045331773 -0.13 ES Mgat4c 0.005304155 0.171 ES Col25a1 0.046900734 0.09 ES Etnk2 0.000440346 -0.167 ES Ythdf3 0.036268699 -0.179 ES Slc27a1 0.003344627 0.144 ES Ccdc173 1.28191E-05 -0.287 ES Mical3 2.17E-02 -0.054 ES Cables2 7.22591E-06 -0.189 ES Cdpf1 0.002403957 -0.124 ES Asph 0.023965154 0.068 ES Cdpf1 0.000477239 -0.096 ES Atp11c 0.043121404 -0.121 ES Azin2 0.000186878 -0.127 ES Map4k4 0.043121404 0.094 ES Azin2 0.000210422 -0.107 ES Galnt7 0.031271837 0.132 ES Med7 0.000186878 0.107 ES Sorbs3 0.015663594 0.148 ES Tank 0.000477239 0.162 ES Alg9 0.034745366 -0.061 ES Pkd1 0.00050107 -0.113 ES Sdccag3 0.021392209 -0.128 ES Cwc22 0.025485812 -0.263 ES Prdm2 0.026117661 -0.099 ES Cbx3 0.000227856 0.14 ES Slc39a13 0.001492532 0.096 MXE 9930021J03Rik 0.032888505 0.059 ES Bco2 0.006946195 -0.223 MXE BC030499 0.007815763 -0.101 ES Htr7 0.033107114 -0.09 ES Dguok 0.017787062 -0.055 ES Cdkl2 0.034694673 0.113 ES Mboat2 0.030427677 -0.223 ES Tyk2 0.000391625 -0.174 ES Tyk2 0.001055841 -0.18 ES Rab11fip1 0.033107114 -0.206 ES Ggcx 0.029682869 -0.097 ES Eif5a 0.033369597 -0.096 ES Adal 0.033304816 -0.16 ES Grip1 0.024978151 -0.12 MXE Txndc16 0.034599768 0.071 MXE Trim23 0.046521449 0.088 MXE Pds5b 0.030028546 -0.092 MXE Fign 0.007445715 0.194 MXE Luc7l3 0.030028546 0.056 MXE 9230110C19Rik 0.048471662 -0.109 MXE 1110038B12Rik 0.000996803 0.103

Table B.2. Summary of Alternative Splicing Events Reported by rMATS in EE vs WW EE vs WW ACB PFC Event GeneID FDR IncLevelDifference Event GeneID FDR IncLevelDifference A3SS Gm9866 0.02977157 -0.103 A3SS Ccne2 3.85E-05 -0.143 A3SS Tle4 0.02553626 -0.082 A3SS Otof 0.00014348 -0.223 A3SS Hook2 0.00081929 -0.127 A3SS Dmpk 0.00694877 -0.162 A3SS Pars2 1.28E-07 -0.394 A3SS Tpm2 1.68E-03 -0.305 A3SS Qk 0.02553626 0.082 A3SS Orc2 0.02363334 -0.099 A3SS Akap8 0.00659191 -0.144 A3SS Nphp1 0.01969652 0.13 A3SS Spata5 0.0322782 0.301 A5SS Trmt61a 0.00057601 0.14 A5SS Ube2j2 0.00098094 -0.135 A5SS Zfp691 0.00194046 -0.255 A5SS Camk1d 2.91E-05 -0.087 A5SS Zfp740 0.04858688 0.12 A5SS D16Ertd472e 0.01018611 -0.129 A5SS Pwwp2b 0.04858688 -0.101 A5SS Ndst3 0.00093997 -0.208 A5SS Mrps23 0.00108731 0.158 A5SS Lair1 0.00033658 -0.265 A5SS St3gal3 0.04858688 -0.053 A5SS Zc3h7a 0.00735983 0.096 A5SS Fbxo6 0.00057601 -0.157 A5SS Cbll1 8.50E-05 -0.193 A5SS Fbxo6 0.0087112 -0.135 A5SS BC017643 0.01159832 -0.098 A5SS Serpinb6a 0.00909423 -0.193 A5SS Kcnq2 0.01684865 -0.075 A5SS Stx16 4.31E-06 -0.152 A5SS Stat1 9.20E-05 -0.15 IR Nipa2 6.70E-07 -0.164 IR Hdac10 0.02899199 0.378 IR Nagpa 0.01896196 -0.168 ES Pfkfb3 0.01039563 -0.194 IR Luc7l 7.59E-06 0.164 ES Ubxn11 6.82E-05 0.306 ES Strada 0.0376879 0.149 ES Mrps36 0.04539811 0.122 ES Cdk5rap1 0.04341323 0.094 ES Pigv 0.01754543 0.14 ES Reps2 0.01443659 0.051 ES Cers5 0.01362214 -0.236 ES Arhgap10 0.03192039 0.14 ES Tbc1d13 3.89E-05 -0.165 ES Rpain 0.01443659 -0.069 ES Atad3aos 0.00051966 0.315 ES Rpain 0.00075269 -0.148 ES Utrn 1.80E-02 0.112 ES Rptor 0.03073669 -0.059 ES Sh3pxd2a 0.02097275 -0.075 ES Fam160b2 3.97E-02 -0.078 ES Kat6a 0.00264563 -0.118 ES Gusb 0.02702117 0.16 ES Pot1a 0.02097275 -0.148 ES Abcc1 8.28E-05 -0.172 ES 2700081O15Rik 0.02694179 -0.104 ES Prpf40b 0.00017859 -0.121 ES 2700081O15Rik 0.01753839 -0.092 ES Crebbp 0.047471 -0.059 ES Zfand6 0.000106 0.052 ES Scoc 0.0376879 0.081 ES Ndufab1 0.00097758 -0.187 ES Zfp266 0.01495847 -0.095 ES Sox5 0.00483495 -0.186 ES Fhod3 0.00242858 -0.172 ES Kat2b 0.00051966 -0.098 ES Ccdc173 0.00214603 -0.271 ES Uspl1 0.03773888 0.175 ES Rcbtb2 0.04325012 0.121 ES Armc5 0.02097275 0.114 ES Miat 0.01846821 -0.095 ES Fam160b2 0.00014257 -0.138 ES Miat 0.00018768 -0.101 ES Mtf2 0.00147101 -0.153 ES Nrip1 0.00390987 -0.108 ES Fbxo34 0.01554743 -0.131 ES Usp54 0.02225224 -0.122 ES Vwa5b1 0.02517295 -0.241 ES Ppargc1b 0.0301767 -0.142 ES Trappc6a 0.00139983 0.077 ES Timm9 0.02966506 -0.103

Table B.2. cont. Summary of Alternative Splicing Events Reported by rMATS in EE vs WW EE vs WW ACB PFC Event GeneID FDR IncLevelDifference Event GeneID FDR IncLevelDifference ES Dhdh 0.020972746 0.091 ES Plec 0.001829703 -0.149 ES Prss36 3.89E-05 -0.322 ES Zmym2 0.008604729 0.061 ES Tcerg1 0.020972746 -0.083 ES Etnk2 2.42E-04 -0.186 ES Pmm2 0.007472093 -0.095 ES Stx16 1.15E-05 -0.286 ES Stk35 0.000977583 -0.097 ES Lrp8 0.018573731 -0.117 ES Ccbl1 0.026941794 0.118 ES Tada2a 0.014958472 0.112 ES Zfp688 0.015222073 -0.183 ES Nme6 0.00214603 0.306 ES Chd2 0.0100954 0.127 ES Azin2 0.000690041 -0.135 ES Kif21a 0.000977583 -0.203 ES Azin2 0.000752693 -0.116 ES Glra3 0.004834954 -0.138 ES Prdm10 1.15E-05 -0.185 ES Gm166 0.037738882 -0.144 ES Phf7 8.28E-05 -0.132 ES Sorbs3 0.034348972 0.178 ES Rab11fip1 0.014958472 0.372 ES Adgre5 3.89E-05 -0.247 ES Snrpn 0.001813546 -0.168 ES D2hgdh 0.033929546 0.25 ES Prdm2 0.02392014 -0.118 ES Cntn1 0.012825362 -0.06 ES Atg16l2 0.000977583 -0.165 ES Zfp846 0.010395633 -0.148 ES Caprin2 0.003299898 0.166 ES Nfia 0.001913102 -0.074 ES Edem2 0.044292856 0.081 ES Nnt 0.032634322 0.145 ES Pld2 0.015727578 -0.147 ES Kmt2c 0.000825679 -0.148 ES Pus7 0.043435861 0.33 ES Mettl10 0.015547431 0.117 ES Zmym4 0.003618845 -0.055 ES Tyk2 0.003618845 -0.179 ES Tyk2 0.008525796 -0.22 ES Zfp672 0.008839662 0.308 ES Pxdn 0.020972746 -0.078 MXE Txndc16 0.046991731 0.076 MXE Pds5b 0.011394535 -0.111 MXE Vapa 0.010111242 0.069 MXE Pvr 0.000194514 -0.247 MXE Atp6v0b 0.022018058 0.075 MXE Esco1 0.007571415 0.163 MXE Ptk2b 0.042502785 0.098 MXE 1110038B12Rik 0.008429945 0.166

Table B.3. Summary of Alternative Splicing Events Reported by rMATS in WE vs WW WE vs WW ACB PFC Event GeneID FDR IncLevelDifference Event GeneID FDR IncLevelDifference A3SS 3632454L22Rik 0.009591972 0.224 A3SS Ehmt1 0.01642165 -0.215 A3SS Zfp692 2.47676E-06 -0.253 A3SS Atp6v0a1 0.018248455 0.069 A3SS Tmem176b 0.005873962 -0.111 A3SS Cbll1 0.0435849 0.123 A3SS Pars2 7.06E-07 -0.323 A3SS 5430405H02Rik 0.000105342 0.312 A5SS Ube2j2 0.006470789 -0.104 A3SS Tpm2 0.00153635 -0.193 A5SS Ezh2 0.010397874 0.291 A5SS Rreb1 0.000902508 0.226 A5SS Camk1d 0.000127338 -0.09 A5SS Zfp691 0.000902508 -0.334 A5SS Ndst3 0.000204253 -0.284 A5SS Mrps23 0.003346695 0.12 A5SS Gpr68 0.000127338 -0.185 A5SS Cipc 0.000258016 -0.183 A5SS Lair1 0.000294492 -0.304 A5SS Steap2 0.024634934 -0.256 A5SS Clasrp 0.049074572 0.126 A5SS Stx16 0.00015231 -0.152 A5SS Gpn2 0.049074572 -0.069 A5SS Stat1 0.000902508 -0.218 A5SS 1190007I07Rik 0.000182888 -0.107 IR Luc7l 3.55629E-06 0.211 ES Trim25 0.008725416 -0.189 ES Eri2 1.1458E-05 0.423 ES Siglech 0.002836032 -0.144 ES Acox1 9.26908E-05 -0.171 ES Hdac4 0.023250315 -0.09 ES Rtn3 0.045171268 0.064 ES Kat6a 0.000127659 -0.186 ES Rtn3 0.04238042 0.069 ES 2010315B03Rik 0.000220488 0.235 ES Fam151b 0.027833357 0.101 ES Ap5z1 0.046489017 -0.079 ES Fam151b 0.000337048 0.147 ES Sox5 0.01312525 -0.231 ES Hdac4 0.005000685 -0.116 ES Pign 6.65E-04 0.361 ES Suv420h1 0.01109759 0.08 ES Armc5 0.046489017 0.105 ES Wiz 0.042412209 0.225 ES Fam160b2 0.000220488 -0.164 ES Ildr2 0.04238042 -0.087 ES Fbxo34 0.013266907 -0.167 ES Ildr2 0.043861804 -0.087 ES Disp1 0.000150746 -0.263 ES Lgals8 9.26908E-05 -0.141 ES Usp49 0.041578282 -0.13 ES Pign 0.006971833 0.212 ES Trappc6a 8.55771E-06 0.126 ES Srp9 0.000459306 -0.187 ES Prss36 3.05121E-05 -0.332 ES Fggy 0.031133163 -0.166 ES Ccdc173 3.54299E-05 0.34 ES Ift81 0.042512392 0.086 ES Stk35 0.005248849 -0.1 ES Mro 0.001180588 -0.165 ES Kif21a 0.006916435 -0.147 ES Dpp7 0.015328377 -0.089 ES Nrip1 0.001713956 -0.097 ES Stx16 0.000306288 -0.226 ES Mllt10 0.000150746 -0.095 ES Tada2a 0.02932469 0.103 ES Caprin2 0.018233633 0.196 ES Trmt10b 0.031397446 -0.147 ES Rasgrp3 0.002254736 -0.251 ES Pbx4 1.1458E-05 0.164 ES Tada2a 0.013266907 0.129 ES Phf7 0.04238042 -0.11 ES Shank2 0.041578282 -0.153 ES Phf7 0.018376706 -0.186 ES Nnt 0.021258348 0.164 ES Rab11fip1 0.039566311 0.243 ES Rab11fip1 1.23E-07 0.333 MXE Pdzd4 0.001138266 -0.072 MXE Tesk2 0.009037609 -0.156 MXE Pdzd4 0.009551473 -0.093 MXE Tfdp2 0.048469246 0.107 MXE Pdzd4 0.001302286 -0.055 MXE Plec 0.043648927 -0.122 MXE Arrb1 0.02112386 -0.083 MXE Ldah 0.048160248 -0.104 MXE Sobp 0.02112386 -0.081

Although Snap25 and Gria2 were not found to be alternatively spliced with acute or chronic exposure to ethanol, it was still of interest to determine if spliced genes were also targeted by HuD. To identify genes regulated by HuD and impacted by alcohol consumption, the list of genes rMATS reported in the three comparison analyses were compared to the HuD target dataset. Additionally, spliced genes were compared between ACB and PFC brain regions.

A total of 18 genes were found to be both alternatively spliced and targeted by

HuD (Figure B.2.). Several of the genes have already been shown to be impacted by different levels of alcohol exposure. For example, one study showed that Luc7l3,

Utrn, Tfdp2, and Rtn3 are differentially expressed between low and high ethanol consuming rat lines 159. Another study revealed that Cbx3 and Mtf2 are differentially expressed in the ACB after continuous access to ethanol 160. A differential gene analysis previously conducted on this dataset showed that Lrp8 was differentially expressed in the PFC, but expression of other HuD targets was not changed. This suggests that alternative splicing and differential expression are not always associated. However, it is still possible that alternative splicing of these genes impacts protein expression and function, so characterizing protein in response to ethanol would be important.

Figure B.2. Overlap of genes reported by rMATS in each brain region and treatment group with HuD targets.

Between the 18 alternatively spliced genes that were found to be targeted by

HuD, there was one gene that was also found to be spliced in HuD KO cortex: Cbx3.

As previously described, Cbx3 encodes a protein that is involved in transcriptional silencing of heterochromatin. The exon skipping event reported between the EE and

WE group was also found to occur at exon 3 (Figure B.3). Furthermore, the downstream exon was listed as exon 5. This is now the second instance where skipping of exon 3 occurred in conjunction with skipping of exon 4, and it would be interesting to determine if this is always the case. Junction counts did appear to be relatively low, but rMATS still reported a significant 14% change in inclusion level

(FDR=2.28e-04). Therefore, it would be important to verify this event with molecular methods to determine if chronic and acute ethanol exposure differentially regulates splicing of the Cbx3 gene.

FDR=2.28e-04

Figure B.3. Sashimi plot of Cbx3 exon skipping event reported by rMATS in PFC. According to genomic coordinates, skipping of exons 3 and 4 occurs more frequently in WE.

Another gene that drew interest in the alcohol dataset, and also functions in chromatin remodeling, was histone deacetylase 4 (Hdac4). The gene encodes for the

HDAC4 protein, which is a histone deacetylase that condenses chromatin and represses transcription 161. It was not found to be targeted by HuD, but it was found to be alternatively spliced in both ACB and PFC brain regions between WE and WW groups. Ample evidence of HDAC involvement in AUD exists, and HDAC inhibitors, such as trichostatin A (TSA), have been proposed as potential therapeutics for the disorder 162–164. Other HDAC inhibitors, including suberoylanilide hydroxamic acid and sodium butyrate, have also been shown to alleviate symptoms of alcohol withdrawal and reduce ethanol intake, respectively 165,166. However, alternative splicing of Hdac4 in alcohol use has not been investigated.

Using the coordinates provided by rMATS and the IGV software, the exon involved in Hdac4 alternative splicing was exon 5. Inclusion level differences between WE and WW in the ACB were -0.09, and -0.116 in the PFC, indicating decreased inclusion of exon 5 for both groups (Figures B.4&5). Interestingly, alternative splicing of Hdac4 was not reported in the chronic ethanol group (EE). It has been proposed that HDAC activity differs between acute and chronic ethanol exposure. In a study that used very similar acute and chronic exposure models,

HDAC activity was found to initially decrease in the amygdala after one injection of ethanol 167. In their chronic ethanol model, where mice were exposed to a liquid

ethanol diet for 15-16 days, HDAC activity was unchanged relative to the control group. A neuroadaptation is thought to occur after chronic ethanol exposure to normalize HDAC activity. A different study has also shown that HDAC4 is degraded after long term, but not short term, exposure to ethanol in the ACB 168.

There is little information on alternative splicing of exon 5 in the Hdac4 transcript, and it is unknown if the splicing variant would impact translation. If exon 5 exclusion of Hdac4 affects protein expression, it would be interesting to determine if

HDAC4 protein and activity levels differ between EE, WE, and WW groups. If so, ethanol-induced alternative splicing of Hdac4 may regulate HDAC4 activity, and because HDAC4’s primary function is the regulation of transcription, it may ultimately affect the transcriptional response to ethanol.

FDR=2.33e-02

Figure B.4. Sashimi plot of Hdac4 exon skipping event reported by rMATS in ACB. According to genomic coordinates, skipping of exon 5 occurs more in WE group.

FDR=5.00e-03

Figure B.5. Sashimi plot of Hdac4 exon skipping event reported by rMATS in PFC. According to genomic coordinates, skipping of exon 5 occurs more in WE group.

In addition to alternative splicing, an alternative polyadenylation analysis was performed with the alcohol datasets. A total of 57 genes were found to have alternatively polyadenylated transcripts in both brain regions (Table B.4). The majority of those genes were attributed to the ACB in the EE vs WE and EE vs WW comparison analyses. Only one gene, Celsr3, was found to differ in the PFC. The majority of the alternative polyadenylation events were found to be lengthening of the

3’ UTR, suggesting that chronic ethanol exposure drives usage of the distal PAS

(Figure B.6). Furthermore, 56 out of 57 alternative polyadenylation events were found to occur in the ACB brain region, suggesting that ethanol exposure primarily affects alternative polyadenylation in the ACB rather than the PFC.

To determine if polyadenylated genes were potentially regulated by HuD, the

DaPars list was compared to the HuD target list. As seen in Figure B.7, there was a total of 6 mutual genes between the two lists. All events were reported to be lengthened 3’ UTRs, which may provide evidence of HuD regulation because its primary mechanism is to promote distal PAS usage by binding to the proximal site.

To determine if HuD plays a role in alternative polyadenylation of these transcripts, the pipeline can be utilized again on RNA-seq data that was taken by a HuD pulldown in chronic, acute, and water groups. This would allow for HuD targets to be specifically analyzed and can give insight into the role of HuD in response to ethanol.

A gene that was found to be targeted by HuD and lengthened with both chronic and acute ethanol exposure in the ACB was H3f3a (Figure B.8). H3f3a

encodes the Histone 3.3 (H3.3) protein, which is primarily involved in the transcriptional response through chromatin remodeling. More specifically, H3.3 is associated with an active state of chromatin, with its incorporation into a nucleosome accumulating acetylation and methylation modifications associated with gene activation 169,170. In neurons, H3.3 has been shown to regulate genes involved in plasticity and cognition, and is also important in differentiation and development

171,172. The impact of alternative polyadenylation of H3f3a in neurons is not well understood, and its role in alcohol use has not been explored. It would be important to verify alternative polyadenylation of H3f3a in response to chronic and acute ethanol exposure through molecular methods.

Several studies have linked chromatin remodeling to alcohol use, and potential therapies for AUD primarily target the pathway. It is noteworthy to find that both alternative splicing and polyadenylation of genes involved in chromatin remodeling occur in response to acute and/or chronic ethanol exposure. This may point to a potential mechanism in which chromatin remodeling affects the transcriptional response to ethanol. These findings highlight the importance of using bioinformatics methods to look at co-or post-transcriptional modifications that may impact protein translation and function.

Table B.4. Complete DaPars Results from EE vs WE vs WW Analyses Predicted EE WE Gene Chr Strand Proximal Location ΔPDUI FDR Event PDUI PDUI APA chr11:109667430- Prkar1a chr11 + 109668932 0.637 0.417 0.220 1.83E-15 Lengthened 3' UTR 109669663 chr6:15437877- Foxp2 chr6 + 15440569 0.555 0.301 0.254 7.81E-03 Lengthened 3' UTR 15441977 chr1:16642765- Eloc chr1 - 16643277 0.486 0.276 0.210 4.04E-05 Lengthened 3' UTR 16643478 chr14:72537953- Fndc3a chr14 - 72539089 0.674 0.445 0.229 6.82E-02 Lengthened 3' UTR 72540481 chr13:64737591- Cntnap3 chr13 - 64737932 0.703 0.290 0.413 1.64E-02 Lengthened 3' UTR 64738668 chr2:4938307- Phyh chr2 + 4938508 0.615 0.405 0.210 4.26E-03 Lengthened 3' UTR 4938743 chr19:47734824- Sfr1 chr19 + 47735231 0.565 0.355 0.210 1.31E-06 Lengthened 3' UTR 47735588 chr3:137866386- H2az1 chr3 + 137866633 0.677 0.405 0.272 1.29E-06 Lengthened 3' UTR 137866922 chr15:51962604- Rad21 chr15 - 51963233 0.724 0.469 0.255 2.07E-04 Lengthened 3' UTR 51964247 chr6:23051972- Ptprz1 chr6 + 23052260 0.561 0.353 0.208 5.18E-02 Lengthened 3' UTR 23052916 chr12:54746357- Snx6 chr12 - 54746675 0.798 0.525 0.273 6.82E-02 Lengthened 3' UTR 54747059 chr16:91689322- Cryzl1 chr16 - 91689693 0.494 0.271 0.223 5.83E-02 Lengthened 3' UTR 91689915 chr7:34140697- Uba2 chr7 - 34140967 0.681 0.437 0.244 2.28E-03 Lengthened 3' UTR 34141466 chr3:115122180- Olfm3 chr3 + 115122908 0.606 0.386 0.220 3.96E-02 Lengthened 3' UTR 115125764 chr1:180802560- H3f3a chr1 - 180802870 0.554 0.335 0.219 4.83E-17 Lengthened 3' UTR 180803205 EE vs WE chr11:50385777- Hnrnph1 chr11 + 50386106 0.486 0.244 0.242 1.74E-08 Lengthened 3' UTR ACB 50386528 chr10:85131700- Cry1 chr10 - 85132106 0.669 0.411 0.258 5.41E-02 Lengthened 3' UTR 85132307 chr6:30747052- Mest chr6 + 30747408 0.555 0.341 0.214 2.04E-02 Lengthened 3' UTR 30747554 chr14:103113411- Mycbp2 chr14 - 103113742 0.655 0.406 0.249 1.32E-03 Lengthened 3' UTR 103114235 chr2:78919958- Ube2e3 chr2 + 78920266 0.583 0.351 0.232 2.28E-03 Lengthened 3' UTR 78920583 chr3:121734106- F3 chr3 + 121734711 0.841 0.508 0.333 8.38E-04 Lengthened 3' UTR 121735052 chr9:73479424- Unc13c chr9 - 73480706 0.787 0.507 0.280 2.50E-04 Lengthened 3' UTR 73481155 chrX:109160130- Sh3bgrl chrX + 109161419 0.593 0.382 0.211 1.38E-02 Lengthened 3' UTR 109162467 chr12:75714248- Sgpp1 chr12 - 75715537 0.785 0.492 0.293 3.91E-03 Lengthened 3' UTR 75716664 chr3:31163076- Cldn11 chr3 + 31163755 0.610 0.387 0.223 2.79E-09 Lengthened 3' UTR 31164326 chrX:136708783- Tceal1 chrX + 136709412 0.502 0.287 0.215 8.43E-02 Lengthened 3' UTR 136709873 chr12:70465978- Tmx1 chr12 + 70466326 0.514 0.281 0.233 4.11E-02 Lengthened 3' UTR 70467624 chr9:54365158- Dmxl2 chr9 - 54365877 0.640 0.373 0.267 9.44E-03 Lengthened 3' UTR 54366627 chr11:51791327- Sar1b chr11 + 51791535 0.680 0.388 0.292 2.25E-04 Lengthened 3' UTR 51791953 chr5:43744618- Fbxl5 chr5 - 43745174 0.491 0.268 0.223 3.10E-03 Lengthened 3' UTR 43745375 chr16:65539129- Chmp2b chr16 - 65539497 0.723 0.433 0.290 8.38E-04 Lengthened 3' UTR 65540250

Table B.4. cont. Complete DaPars Results from EE vs WE vs WW Analyses Predicted EE WW Gene Chr Strand Proximal Location ΔPDUI FDR Event PDUI PDUI APA chr9:73479424- Unc13c chr9 - 73480706 0.787 0.513 0.274 4.43E-04 Lengthened 3' UTR 73481155 chr6:23051972- Ptprz1 chr6 + 23052261 0.561 0.348 0.213 2.56E-02 Lengthened 3' UTR 23052916 chr5:43744618- Fbxl5 chr5 - 43745174 0.491 0.245 0.246 2.36E-04 Lengthened 3' UTR 43745375 chr14:105114140- Rbm26 chr14 - 105115085 0.470 0.180 0.290 7.93E-02 Lengthened 3' UTR 105115286 chr10:85131700- Cry1 chr10 - 85132106 0.669 0.433 0.236 9.92E-02 Lengthened 3' UTR 85132307 chr1:180802560- H3f3a chr1 - 180802869 0.554 0.313 0.240 3.44E-21 Lengthened 3' UTR 180803205 chr3:31163076- Cldn11 chr3 + 31163753 0.611 0.405 0.206 1.53E-07 Lengthened 3' UTR 31164326 chr15:51962604- Rad21 chr15 - 51963234 0.724 0.427 0.297 9.05E-06 Lengthened 3' UTR 51964247 chr3:121734106- F3 chr3 + 121734711 0.841 0.483 0.358 3.97E-05 Lengthened 3' UTR 121735052 chr2:4938307- Phyh chr2 + 4938508 0.615 0.383 0.232 2.46E-04 Lengthened 3' UTR 4938743 chr4:101152370- Jak1 chr4 - 101153389 0.565 0.872 -0.307 3.89E-08 Shortened 3' UTR 101153590 chr7:34140697- Uba2 chr7 - 34140967 0.681 0.395 0.286 1.15E-04 Lengthened 3' UTR 34141466 EE vs WW chr3:137866386- H2az1 chr3 + 137866649 0.653 0.423 0.230 4.89E-05 Lengthened 3' UTR ACB 137866922 chr14:29974476- Selenok chr14 + 29974677 0.748 0.493 0.255 9.33E-06 Lengthened 3' UTR 29975074 chr11:50385777- Hnrnph1 chr11 + 50386107 0.486 0.242 0.244 4.99E-09 Lengthened 3' UTR 50386528 chr11:51791327- Sar1b chr11 + 51791535 0.680 0.342 0.338 4.29E-06 Lengthened 3' UTR 51791953 chr1:16642765- Eloc chr1 - 16643277 0.486 0.233 0.253 1.34E-07 Lengthened 3' UTR 16643478 chr16:65539129- Chmp2b chr16 - 65539496 0.722 0.468 0.254 4.06E-03 Lengthened 3' UTR 65540250 chr16:91689322- Cryzl1 chr16 - 91689693 0.494 0.263 0.231 2.26E-02 Lengthened 3' UTR 91689915 chr12:70465978- Tmx1 chr12 + 70466326 0.514 0.272 0.242 1.38E-02 Lengthened 3' UTR 70467624 chr6:15437877- Foxp2 chr6 + 15440578 0.551 0.322 0.229 1.31E-02 Lengthened 3' UTR 15441977 chr18:10644411- Abhd3 chr18 - 10644916 0.504 0.272 0.232 3.45E-02 Lengthened 3' UTR 10645235 chr9:54365158- Dmxl2 chr9 - 54365877 0.640 0.385 0.255 9.32E-03 Lengthened 3' UTR 54366627 chrX:38197297- Tmem255a chrX - 38197965 0.652 0.412 0.240 2.31E-02 Lengthened 3' UTR 38199656 chr1:58411988- Clk1 chr1 - 58412139 0.502 0.302 0.200 9.64E-03 Lengthened 3' UTR 58412340 Predicted EE WE Gene Chr Strand Proximal Location ΔPDUI FDR Event PDUI PDUI APA WE vs chr9:108851301- Celsr3 chr9 + 108851540 0.920 0.580 0.340 2.11E-02 Lengthened 3' UTR WW PFC 108852969

EE vs WE ACB EE vs WW ACB WE vs WW PFC Lengthened 3' UTR 31 24 1 Shortened 3' UTR 0 1 0 TOTAL 31 25 1

Figure B.6. Summary of significant alternative polyadenylation events reported by DaPars between alcohol groups.

Figure B.7. Comparison of HuD targets with alternatively polyadenylated genes in alcohol analysis. Only genes in the ACB and the EE vs WE comparison group were found to be targeted by HuD.

Figure B.8. Read coverage graphs of H3f3a in EE, WE, and WW groups in the ACB. Distal PAS usage differs between all three groups, with chronic exposure (EE) causing the greatest change in PDUI. The blue arrow indicates the DaPars predicated proximal PAS site.

References

1. Glisovic, T., Bachorik, J. L., Yong, J. & Dreyfuss, G. RNA-binding proteins and

post-transcriptional gene regulation. FEBS Lett. 582, 1977–1986 (2008).

2. Bolognani, F. & Perrone-Bizzozero, N. I. RNA–protein interactions and control

of mRNA stability in neurons. J. Neurosci. Res. 86, 481–489 (2008).

3. Baralle, D. & Baralle, M. Splicing in action: assessing disease causing sequence

changes. J. Med. Genet. 42, 737–748 (2005).

4. Zheng, S. et al. PSD-95 is post-transcriptionally repressed during early neural

development by PTBP1 and PTBP2. Nat. Neurosci. 15, 381–388 (2012).

5. Zheng, S. Alternative splicing and nonsense‐mediated mRNA decay enforce

neural specific gene expression. Int. J. Dev. Neurosci. 55, 102–108 (2016).

6. Jaffrey, S. R. & Wilkinson, M. F. Nonsense-mediated RNA decay in the brain:

emerging modulator of neural development and disease. Nat. Rev. Neurosci. 19,

715–728 (2018).

7. Pan, Q., Shai, O., Lee, L. J., Frey, B. J. & Blencowe, B. J. Deep surveying of

alternative splicing complexity in the human transcriptome by high-throughput

sequencing. Nat. Genet. 40, 1413–1415 (2008).

8. Wang, E. T. et al. Alternative isoform regulation in human tissue

transcriptomes. Nature 456, 470–476 (2008).

9. Xu, Q., Modrek, B. & Lee, C. Genome-wide detection of tissue-specific

alternative splicing in the human transcriptome. Nucleic Acids Res. 30, 3754–

3766 (2002).

10. Vuong, C. K., Black, D. L. & Zheng, S. The neurogenetics of alternative

splicing. Nat. Rev. Neurosci. 17, 265–281 (2016).

11. Dredge, B. K., Polydorides, A. D. & Darnell, R. B. The splice of life:

Alternative splicing and neurological disease. Nat. Rev. Neurosci. 2, 43–50

(2001).

12. Reble, E., Dineen, A. & Barr, C. L. The contribution of alternative splicing to

genetic risk for psychiatric disorders. Genes Brain Behav. 17, e12430 (2018).

13. Glatt, S. J., Cohen, O. S., Faraone, S. V. & Tsuang, M. T. Dysfunctional gene

splicing as a potential contributor to neuropsychiatric disorders. Am. J. Med.

Genet. Part B Neuropsychiatr. Genet. Off. Publ. Int. Soc. Psychiatr. Genet.

156B, 382–392 (2011).

14. Colgan, D. F. & Manley, J. L. Mechanism and regulation of mRNA

polyadenylation. Genes Dev. 11, 2755–2766 (1997).

15. Yeh, H.-S. & Yong, J. Alternative Polyadenylation of mRNAs: 3’-Untranslated

Region Matters in Gene Expression. Mol. Cells 39, 281–285 (2016).

16. Zhang, X., Virtanen, A. & Kleiman, F. E. To polyadenylate or to deadenylate:

that is the question. Cell Cycle Georget. Tex 9, 4437–4449 (2010).

17. Di Giammartino, D. C., Nishida, K. & Manley, J. L. Mechanisms and

Consequences of Alternative Polyadenylation. Mol. Cell 43, 853–866 (2011).

18. Hu, J., Lutz, C. S., Wilusz, J. & Tian, B. Bioinformatic identification of

candidate cis-regulatory elements involved in human mRNA polyadenylation.

RNA N. Y. N 11, 1485–1493 (2005).

19. Mansfield, K. D. & Keene, J. D. Neuron-specific ELAV/Hu proteins suppress

HuR mRNA during neuronal differentiation by alternative polyadenylation.

Nucleic Acids Res. 40, 2734–2746 (2012).

20. Elkon, R., Ugalde, A. P. & Agami, R. Alternative cleavage and polyadenylation:

extent, regulation and function. Nat. Rev. Genet. 14, 496–506 (2013).

21. Derti, A. et al. A quantitative atlas of polyadenylation in five mammals. Genome

Res. 22, 1173–1183 (2012).

22. MacDonald, C. C. Tissue-specific mechanisms of alternative polyadenylation:

Testis, brain, and beyond (2018 update). Wiley Interdiscip. Rev. RNA 10, e1526

(2019).

23. Miura, P., Sanfilippo, P., Shenker, S. & Lai, E. C. Alternative polyadenylation in

the nervous system: to what lengths will 3’ UTR extensions take us? BioEssays

News Rev. Mol. Cell. Dev. Biol. 36, 766–777 (2014).

24. Lau, A. G. et al. Distinct 3’UTRs differentially regulate activity-dependent

translation of brain-derived neurotrophic factor (BDNF). Proc. Natl. Acad. Sci.

107, 15945–15950 (2010).

25. An, J. J. et al. Distinct Role of Long 3′ UTR BDNF mRNA in Spine

Morphology and Synaptic Plasticity in Hippocampal Neurons. Cell 134, 175–

187 (2008).

26. Patel, R., Brophy, C., Hickling, M., Neve, J. & Furger, A. Alternative cleavage

and polyadenylation of genes associated with protein turnover and

mitochondrial function are deregulated in Parkinson’s, Alzheimer’s and ALS

disease. BMC Med. Genomics 12, 60 (2019).

27. Li, S.-H. & Li, X.-J. Huntington and its Role in Neuronal Degeneration. The

Neuroscientist 10, 467–475 (2004).

28. Chang, J. W., Yeh, H. S. & Yong, J. Alternative Polyadenylation in Human

Diseases. Endocrinol. Metab. Seoul Korea 32, 413–421 (2017).

29. Romo, L., Mohn, E. S. & Aronin, N. A Fresh Look at Huntingtin mRNA

Processing in Huntington’s Disease. J. Huntingt. Dis. 7, 101–108 (2018).

30. Romo, L., Ashar-Patel, A., Pfister, E. & Aronin, N. Alterations in mRNA 3′

UTR Isoform Abundance Accompany Gene Expression Changes in Human

Huntington’s Disease Brains. Cell Rep. 20, 3057–3070 (2017).

31. Yoon, Y. et al. Anxiety-associated alternative polyadenylation of the serotonin

transporter mRNA confers translational regulation by hnRNPK. Proc. Natl.

Acad. Sci. 110, 11624–11629 (2013).

100

32. Hartley, C. A. et al. Serotonin transporter polyadenylation polymorphism

modulates the retention of fear extinction memory. Proc. Natl. Acad. Sci. 109,

5493–5498 (2012).

33. Ovadia, G. & Shifman, S. The Genetic Variation of RELN Expression in

Schizophrenia and Bipolar Disorder. PLoS ONE 6, e19955 (2011).

34. Aranda-Abreu, G. E., Behar, L., Chung, S., Furneaux, H. & Ginzburg, I.

Embryonic Lethal Abnormal Vision-Like RNA-Binding Proteins Regulate

Neurite Outgrowth and Tau Expression in PC12 Cells. J. Neurosci. 19, 6907–

6917 (1999).

35. Campos, A. R., And, D. G. & White, K. Mutant Alleles at the Locus elav in

Drosophila melanogaster lead to Nervous System Defects. A Developmental-

Genetic Analysis. J. Neurogenet. 2, 197–218 (1985).

36. King, P. H., Levine, T. D., Fremeau, R. T., Jr & Keene, J. D. Mammalian

homologs of Drosophila ELAV localized to a neuronal subset can bind in vitro

to the 3’ UTR of mRNA encoding the Id transcriptional repressor. J. Neurosci.

Off. J. Soc. Neurosci. 14, 1943–1952 (1994).

37. Ma, W.-J., Cheng, S., Campbell, C., Wright, A. & Furneaux, H. Cloning and

Characterization of HuR, a Ubiquitously Expressed Elav-like Protein. J. Biol.

Chem. 271, 8144–8151 (1996).

38. Hinman, M. N. & Lou, H. Diverse molecular functions of Hu proteins. Cell.

Mol. Life Sci. CMLS 65, 3168–3181 (2008).

101

39. Okano, H. J. & Darnell, R. B. A Hierarchy of Hu RNA Binding Proteins in

Developing and Adult Neurons. J. Neurosci. 17, 3024–3037 (1997).

40. Amara, S. G., Jonas, V., Rosenfeld, M. G., Ong, E. S. & Evans, R. M.

Alternative RNA processing in calcitonin gene expression generates mRNAs

encoding different polypeptide products. Nature 298, 240–244 (1982).

41. COPP, D. H., CAMERON, E. C., CHENEY, B. A., DAVIDSON, A. G. F. &

HENZE, K. G. Evidence for Calcitonin—A New Hormone from the Parathyroid

That Lowers Blood Calcium. Endocrinology 70, 638–649 (1962).

42. Copp, D. H. & Cheney, B. Calcitonin—a Hormone from the Parathyroid which

Lowers the Calcium-level of the Blood. Nature 193, 381–382 (1962).

43. Fisher, L. A. et al. Stimulation of noradrenergic sympathetic outflow by

calcitonin gene-related peptide. Nature 305, 534–536 (1983).

44. Rosenfeld, M. G. et al. Production of a novel neuropeptide encoded by the

calcitonin gene via tissue-specific RNA processing. Nature 304, 129–135

(1983).

45. Zhu, H., Hasman, R. A., Barron, V. A., Luo, G. & Lou, H. A nuclear function of

Hu proteins as neuron-specific alternative RNA processing regulators. Mol. Biol.

Cell 17, 5105–5114 (2006).

46. Zhu, H., Zhou, H.-L., Hasman, R. A. & Lou, H. Hu Proteins Regulate

Polyadenylation by Blocking Sites Containing U-rich Sequences. J. Biol. Chem.

282, 2203–2210 (2007).

102

47. Cichowski, K. & Jacks, T. NF1 Tumor Suppressor Gene Function: Narrowing

the GAP. Cell 104, 593–604 (2001).

48. Zhu, H., Hinman, M. N., Hasman, R. A., Mehta, P. & Lou, H. Regulation of

neuron-specific alternative splicing of neurofibromatosis type 1 pre-mRNA.

Mol. Cell. Biol. 28, 1240–1251 (2008).

49. Assunto, A. et al. Isoform-specific NF1 mRNA levels correlate with disease

severity in Neurofibromatosis type 1. Orphanet J. Rare Dis. 14, 261 (2019).

50. Zhang, Z. et al. Elav-Mediated Exon Skipping and Alternative Polyadenylation

of the Dscam1 Gene Are Required for Axon Outgrowth. Cell Rep. 27, 3808-

3817.e7 (2019).

51. Bolognani, F., Contente-Cuomo, T. & Perrone-Bizzozero, N. I. Novel

recognition motifs and biological functions of the RNA-binding protein HuD

revealed by genome-wide identification of its targets. Nucleic Acids Res. 38,

117–130 (2010).

52. Bronicki, L. M. & Jasmin, B. J. Emerging complexity of the HuD/ELAVl4

gene; implications for neuronal development, function, and dysfunction. RNA N.

Y. N 19, 1019–1037 (2013).

53. Tiruchinapalli, D. M., Ehlers, M. D. & Keene, J. D. Activity-dependent

expression of RNA binding protein HuD and its association with mRNAs in

neurons. RNA Biol. 5, 157–168 (2008).

103

54. Perrone-Bizzozero, N. Role of HuD in nervous system function and pathology.

Front. Biosci. S5, 554–563 (2013).

55. Oliver, R. J. et al. Neuronal RNA-binding protein HuD regulates addiction-

related gene expression and behavior. Genes Brain Behav. 17, e12454–e12454

(2018).

56. Scheckel, C. et al. Regulatory consequences of neuronal ELAV-like protein

binding to coding and non-coding RNAs in human brain. eLife 5, e10421

(2016).

57. Ince-Dunn, G. et al. Neuronal Elav-like (Hu) proteins regulate RNA splicing

and abundance to control glutamate levels and neuronal excitability. Neuron 75,

1067–1080 (2012).

58. Schafer, S. et al. Alternative Splicing Signatures in RNA‐seq Data: Percent

Spliced in (PSI). Curr. Protoc. Hum. Genet. 87, (2015).

59. Katz, Y., Wang, E. T., Airoldi, E. M. & Burge, C. B. Analysis and design of

RNA sequencing experiments for identifying isoform regulation. Nat. Methods

7, 1009–1015 (2010).

60. Park, E., Pan, Z., Zhang, Z., Lin, L. & Xing, Y. The Expanding Landscape of

Alternative Splicing Variation in Human Populations. Am. J. Hum. Genet. 102,

11–26 (2018).

61. Braunschweig, U. et al. Widespread intron retention in mammals functionally

tunes transcriptomes. Genome Res. 24, 1774–1786 (2014).

104

62. Mancini, E., Iserte, J., Yanovsky, M. & Chernomoretz, A. ASpli: Analysis of

alternative splicing using RNA-Seq. R Package Version 1120 (2019).

63. De Troyer, L. et al. Stress-induced lncRNA LASTR fosters cancer cell fitness

by regulating the activity of the U4/U6 recycling factor SART3. Nucleic Acids

Res. 48, 2502–2517 (2020).

64. Shen, S. et al. rMATS: Robust and flexible detection of differential alternative

splicing from replicate RNA-Seq data. Proc. Natl. Acad. Sci. 111, E5593 (2014).

65. Liu, J., Geng, A., Wu, X., Lin, R.-J. & Lu, Q. Alternative RNA Splicing

Associated With Mammalian Neuronal Differentiation. Cereb. Cortex 28, 2810–

2816 (2017).

66. Wamsley, B. et al. Rbfox1 Mediates Cell-type-Specific Splicing in Cortical

Interneurons. Neuron 100, 846-859.e7 (2018).

67. Xia, Z. et al. Dynamic analyses of alternative polyadenylation from RNA-seq

reveal a 3’-UTR landscape across seven tumour types. Nat. Commun. 5, 5274–

5274 (2014).

68. Masamha, C. P. et al. CFIm25 links alternative polyadenylation to glioblastoma

tumour suppression. Nature 510, 412–416 (2014).

69. Ou, J., Park, S. M., Green, M. R. & Zhu, L. J. InPAS: a bioconductor package

for the identification of novel alternative PolyAdenylation Sites (PAS) using

RNA-seq data. R Package Version 1180.

105

70. Sheppard, S., Lawson, N. D. & Zhu, L. J. Accurate identification of

polyadenylation sites from 3’ end deep sequencing using a naive Bayes

classifier. Bioinforma. Oxf. Engl. 29, 2564–2571 (2013).

71. Ritchie, M. E. et al. limma powers differential expression analyses for RNA-

sequencing and microarray studies. Nucleic Acids Res. 43, e47–e47 (2015).

72. Szkop, K. J. et al. Dysregulation of Alternative Poly-adenylation as a Potential

Player in Autism Spectrum Disorder. Front. Mol. Neurosci. 10, 279 (2017).

73. Hirai, T. et al. Aberrant plasticity of peripheral sensory axons in a painful

neuropathy. Sci. Rep. 7, 3407 (2017).

74. Akamatsu, W. et al. The RNA-binding protein HuD regulates neuronal cell

identity and maturation. Proc. Natl. Acad. Sci. U. S. A. 102, 4625–4630 (2005).

75. Andrews, S. FastQC: a quality control tool for high throughput sequence data.

76. Martin, M. Cutadapt removes adapter sequences from high-throughput

sequencing reads. EMBnet.journal 17, 10 (2011).

77. Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for

Illumina sequence data. Bioinforma. Oxf. Engl. 30, 2114–2120 (2014).

78. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29,

15–21 (2013).

79. Dobin, A. & Gingeras, T. R. Mapping RNA-seq Reads with STAR. Curr.

Protoc. Bioinforma. 51, 11.14.1-11.14.19 (2015).

106

80. Ewels, P., Magnusson, M., Lundin, S. & Käller, M. MultiQC: summarize

analysis results for multiple tools and samples in a single report. Bioinformatics

32, 3047–3048 (2016).

81. Veiga, F. T. maser: Mapping Alternative Splicing Events to pRoteins. (2020).

82. Thorvaldsdóttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics

Viewer (IGV): high-performance genomics data visualization and exploration.

Brief. Bioinform. 14, 178–192 (2012).

83. Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24–26

(2011).

84. Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for

comparing genomic features. Bioinformatics 26, 841–842 (2010).

85. Karolchik, D. et al. The UCSC Table Browser data retrieval tool. Nucleic Acids

Res. 32, D493–D496 (2004).

86. Krämer, A., Green, J., Pollard, J. & Tugendreich, S. Causal analysis approaches

in Ingenuity Pathway Analysis. Bioinformatics 30, 523–530 (2014).

87. Guardia, C. M., De Pace, R., Mattera, R. & Bonifacino, J. S. Neuronal functions

of adaptor complexes involved in protein sorting. Curr. Opin. Neurobiol. 51,

103–110 (2018).

88. Sugawara, K., Shibasaki, T., Takahashi, H. & Seino, S. Structure and functional

roles of Epac2 (Rapgef4). Gene 575, 577–583 (2016).

107

89. Niimura, M. et al. Critical role of the N-terminal cyclic AMP-binding domain of

Epac2 in its subcellular localization and function. J. Cell. Physiol. 219, 652–658

(2009).

90. Ozaki, N. et al. cAMP-GEFII is a direct target of cAMP in regulated exocytosis.

Nat. Cell Biol. 2, 805–811 (2000).

91. Hoivik, E. A. et al. DNA methylation of alternative promoters directs tissue

specific expression of Epac2 isoforms. PloS One 8, e67925–e67925 (2013).

92. Antonucci, F. et al. SNAP-25, a Known Presynaptic Protein with Emerging

Postsynaptic Functions. Front. Synaptic Neurosci. 8, (2016).

93. Bark, I. C. Structure of the Chicken Gene for SNAP-25 Reveals Duplicated

Exons Encoding Distinct Isoforms of the Protein. J. Mol. Biol. 233, 67–76

(1993).

94. Johansson, J. U. et al. An Ancient Duplication of Exon 5 in the Snap25 Gene Is

Required for Complex Neuronal Development/Function. PLoS Genet. 4,

e1000278 (2008).

95. Delgado-Martinez, I., Nehring, R. B. & Sorensen, J. B. Differential Abilities of

SNAP-25 Homologs to Support Neuronal Function. J. Neurosci. 27, 9380–9391

(2007).

96. Nagy, G. et al. The SNAP-25 linker as an adaptation toward fast exocytosis.

Mol. Biol. Cell 19, 3769–3781 (2008).

108

97. Wright, A. & Vissel, B. The essential role of AMPA receptor GluR2 subunit

RNA editing in the normal and diseased brain. Front. Mol. Neurosci. 5, (2012).

98. Balik, A., Penn, A. C., Nemoda, Z. & Greger, I. H. Activity-regulated RNA

editing in select neuronal subfields in hippocampus. Nucleic Acids Res. 41,

1124–1134 (2013).

99. Penn, A. C., Balik, A., Wozny, C., Cais, O. & Greger, I. H. Activity-mediated

AMPA receptor remodeling, driven by alternative splicing in the ligand-binding

domain. Neuron 76, 503–510 (2012).

100. Sommer, B. et al. Flip and flop: a cell-specific functional switch in glutamate-

operated channels of the CNS. Science 249, 1580–1585 (1990).

101. Pei, W. et al. Flip and Flop: A Molecular Determinant for AMPA Receptor

Channel Opening. Biochemistry 48, 3767–3777 (2009).

102. Koike, M., Tsukada, S., Tsuzuki, K., Kijima, H. & Ozawa, S. Regulation of

Kinetic Properties of GluR2 AMPA Receptor Channels by Alternative Splicing.

J. Neurosci. 20, 2166 (2000).

103. Smallwood, A. et al. CBX3 regulates efficient RNA processing genome-wide.

Genome Res. 22, 1426–1436 (2012).

104. Patzke, S. et al. CSPP Is a Ciliary Protein Interacting with Nephrocystin 8 and

Required for Cilia Formation. Mol. Biol. Cell 21, 2555–2567 (2010).

109

105. Asiedu, M., Wu, D., Matsumura, F. & Wei, Q. Centrosome/Spindle Pole–

associated Protein Regulates Cytokinesis via Promoting the Recruitment of

MyoGEF to the Central Spindle. Mol. Biol. Cell 20, 1428–1440 (2009).

106. Park, S. M., Jang, H. J. & Lee, J. H. Roles of Primary Cilia in the Developing

Brain. Front. Cell. Neurosci. 13, 218 (2019).

107. Patzke, S., Stokke, T. & Aasheim, H.-C. CSPP and CSPP-L associate with

centrosomes and microtubules and differently affect microtubule organization. J.

Cell. Physiol. 209, 199–210 (2006).

108. Michael Sammeth, Sylvain Foissac & Roderic Guigó. A general definition and

nomenclature for alternative splicing events. PLoS Comput. Biol. 4, (2008).

109. Lee, S. et al. Overlapping activities of ELAV/Hu RNA binding proteins specify

multiple neural alternative splicing programs.

http://biorxiv.org/lookup/doi/10.1101/2020.09.21.305912 (2020)

doi:10.1101/2020.09.21.305912.

110. Izquierdo, J. M. Hu Antigen R (HuR) Functions as an Alternative Pre-mRNA

Splicing Regulator of Fas Apoptosis-promoting Receptor on Exon Definition. J.

Biol. Chem. 283, 19077–19084 (2008).

111. Izquierdo, J. M. Cell-specific regulation of Fas exon 6 splicing mediated by Hu

antigen R. Biochem. Biophys. Res. Commun. 402, 324–328 (2010).

110

112. Moreno-De-Luca, A. et al. Adaptor protein complex-4 (AP-4) deficiency causes

a novel autosomal recessive cerebral palsy syndrome with microcephaly and

intellectual disability. J. Med. Genet. 48, 141–144 (2011).

113. Raza, M. H. et al. Association between Rare Variants in AP4E1, a Component

of Intracellular Trafficking, and Persistent Stuttering. Am. J. Hum. Genet. 97,

715–725 (2015).

114. Abou Jamra, R. et al. Adaptor protein complex 4 deficiency causes severe

autosomal-recessive intellectual disability, progressive spastic paraplegia, shy

character, and short stature. Am. J. Hum. Genet. 88, 788–795 (2011).

115. International Molecular Genetic Study of Autism Consortium (IMGSAC) et al.

Screening of nine candidate genes for autism on chromosome 2q reveals rare

nonsynonymous variants in the cAMP-GEFII gene. Mol. Psychiatry 8, 916–924

(2003).

116. Srivastava, D. P. et al. Social, Communication, and Cortical Structural

Impairments in Epac2-Deficient Mice. J. Neurosci. 32, 11864–11878 (2012).

117. Srivastava, D. P. et al. An autism-associated variant of Epac2 reveals a role for

Ras/Epac2 signaling in controlling basal dendrite maintenance in mice. PLoS

Biol. 10, e1001350–e1001350 (2012).

118. Jones, K. A., Sumiya, M., Woolfrey, K. M., Srivastava, D. P. & Penzes, P. Loss

of EPAC2 alters dendritic spine morphology and inhibitory synapse density.

Mol. Cell. Neurosci. 98, 19–31 (2019).

111

119. DeBoer, E. M. et al. Prenatal deletion of the RNA-binding protein HuD disrupts

postnatal cortical circuit maturation and behavior. J. Neurosci. Off. J. Soc.

Neurosci. 34, 3674–3686 (2014).

120. Bark, I. C. & Wilson, M. C. Human cDNA clones encoding two different

isoforms of the nerve terminal protein SNAP-25. Gene 139, 291–292 (1994).

121. Irfan, M. et al. SNAP-25 isoforms differentially regulate synaptic transmission

and long-term synaptic plasticity at central synapses. Sci. Rep. 9, 6403 (2019).

122. Prescott, G. R. & Chamberlain, L. H. Regional and developmental brain

expression patterns of SNAP25 splice variants. BMC Neurosci. 12, 35 (2011).

123. Sørensen, J. B. et al. Differential Control of the Releasable Vesicle Pools by

SNAP-25 Splice Variants and SNAP-23. Cell 114, 75–86 (2003).

124. Song, Y. et al. Single-Cell Alternative Splicing Analysis with Expedition

Reveals Splicing Dynamics during Neuron Differentiation. Mol. Cell 67, 148-

161.e5 (2017).

125. Bark, C. Developmentally Regulated Switch in Alternatively Spliced SNAP-25

Isoforms Alters Facilitation of Synaptic Transmission. J. Neurosci. 24, 8796–

8805 (2004).

126. Blue, R. E., Curry, E. G., Engels, N. M., Lee, E. Y. & Giudice, J. How

alternative splicing affects membrane-trafficking dynamics. J. Cell Sci. 131,

jcs216465 (2018).

112

127. Bolognani, F. et al. Associative and spatial learning and memory deficits in

transgenic mice overexpressing the RNA-binding protein HuD. Neurobiol.

Learn. Mem. 87, 635–643 (2007).

128. Johansson, J. U. et al. An ancient duplication of exon 5 in the Snap25 gene is

required for complex neuronal development/function. PLoS Genet. 4,

e1000278–e1000278 (2008).

129. Barakauskas, V. E. et al. Quantitative mass spectrometry reveals changes in

SNAP-25 isoforms in schizophrenia. Schizophr. Res. 177, 44–51 (2016).

130. Thompson, P. M. et al. SNAP-25a/b Isoform Levels in Human Brain

Dorsolateral Prefrontal Cortex and Anterior Cingulate Cortex. Mol.

Neuropsychiatry 1, 220–234 (2015).

131. Acosta, G., Freidman, D. P., Grant, K. A. & Hemby, S. E. Alternative Splicing

of AMPA Subunits in Prefrontal Cortical Fields of Cynomolgus Monkeys

Following Chronic Ethanol Self-Administration. Front. Psychiatry 2, (2012).

132. Shukla, A., Corydon, T. J., Nielsen, S., Hoffmann, H. J. & Dahl, R.

Identification of Three New Splice Variants of the SNARE Protein SNAP-23.

Biochem. Biophys. Res. Commun. 285, 320–327 (2001).

133. Huang, C. et al. Cbx3 maintains lineage specificity during neural differentiation.

Genes Dev. 31, 241–246 (2017).

113

134. Mathison, A. et al. Discovery, expression, cellular localization, and molecular

properties of a novel, alternative spliced HP1γ isoform, lacking the

chromoshadow domain. PLOS ONE 15, e0217452 (2020).

135. Oshiro, H., Hirabayashi, Y., Furuta, Y., Okabe, S. & Gotoh, Y. Up-regulation of

HP1γ expression during neuronal maturation promotes axonal and dendritic

development in mouse embryonic neocortex. Genes Cells 20, 108–120 (2015).

136. Mladinov, M. et al. Gene expression profiling of the dorsolateral and medial

orbitofrontal cortex in schizophrenia. Transl. Neurosci. 7, 139–150 (2016).

137. Kim, J. et al. Somatic deletions implicated in functional diversity of brain cells

of individuals with schizophrenia and unaffected controls. Sci. Rep. 4, 3807

(2014).

138. Akizu, N. et al. Mutations in CSPP1 lead to classical Joubert syndrome. Am. J.

Hum. Genet. 94, 80–86 (2014).

139. Shaheen, R. et al. Mutations in CSPP1, encoding a core centrosomal protein,

cause a range of ciliopathy phenotypes in humans. Am. J. Hum. Genet. 94, 73–

79 (2014).

140. Kang, J., Park, H. & Kim, E. IRSp53/BAIAP2 in dendritic spine development,

NMDA receptor regulation, and psychiatric disorders. Neuropharmacology 100,

27–39 (2016).

114

141. Miyahara, A., Okamura-Oho, Y., Miyashita, T., Hoshika, A. & Yamada, M.

Genomic structure and alternative splicing of the insulin receptor tyrosine kinase

substrate of 53-kDa protein. J. Hum. Genet. 48, 410–414 (2003).

142. Kuhn, A. et al. Mutant huntingtin’s effects on striatal gene expression in mice

recapitulate changes observed in human Huntington’s disease brain and do not

differ with mutant huntingtin length or wild-type huntingtin dosage. Hum. Mol.

Genet. 16, 1845–1861 (2007).

143. Tourette, C. et al. A Large Scale Huntingtin Protein Interaction Network

Implicates Rho GTPase Signaling Pathways in Huntington Disease. J. Biol.

Chem. 289, 6709–6726 (2014).

144. Orozco, I. J., Koppensteiner, P., Ninan, I. & Arancio, O. The schizophrenia

susceptibility gene DTNBP1 modulates AMPAR synaptic transmission and

plasticity in the hippocampus of juvenile DBA/2J mice. Mol. Cell. Neurosci. 58,

76–84 (2014).

145. Weickert, C. S. et al. Human Dysbindin (DTNBP1) Gene Expression inNormal

Brain and in Schizophrenic Prefrontal Cortex and Midbrain. Arch. Gen.

Psychiatry 61, 544 (2004).

146. Fallgatter, A. J. et al. DTNBP1 (dysbindin) gene variants modulate prefrontal

brain function in schizophrenic patients - support for the glutamate hypothesis of

schizophrenias. Genes Brain Behav. (2010) doi:10.1111/j.1601-

183X.2010.00574.x.

115

147. Fallgatter, A. J. et al. DTNBP1 (Dysbindin) Gene Variants Modulate Prefrontal

Brain Function in Healthy Individuals. Neuropsychopharmacology 31, 2002–

2010 (2006).

148. Hakak, Y. et al. Genome-wide expression analysis reveals dysregulation of

myelination-related genes in chronic schizophrenia. Proc. Natl. Acad. Sci. 98,

4746–4751 (2001).

149. Yap, E.-L. & Greenberg, M. E. Activity-Regulated Transcription: Bridging the

Gap between Neural Activity and Behavior. Neuron 100, 330–348 (2018).

150. Allen, M. et al. HuD promotes BDNF expression in brain neurons via selective

stabilization of the BDNF long 3’UTR mRNA. PloS One 8, e55718–e55718

(2013).

151. Morava, É. et al. ALG6-CDG: a recognizable phenotype with epilepsy,

proximal muscle weakness, ataxia and behavioral and limb anomalies. J. Inherit.

Metab. Dis. 39, (2016).

152. Freeze, H. H., Eklund, E. A., Ng, B. G. & Patterson, M. C. Neurology of

inherited glycosylation disorders. Lancet Neurol. 11, 453–466 (2012).

153. Wang, X., Sun, W., Yang, Y., Jia, J. & Li, C. A clinical and gene analysis of

late-onset combined methylmalonic aciduria and homocystinuria, cblC type, in

China. J. Neurol. Sci. 318, 155–159 (2012).

116

154. Sarkar, S. A. & Sharma, R. P. Modulation of c-myc, max, and mad gene

expression during neural differentiation of embryonic stem cells by all-trans-

retinoic acid. Gene Expr. 10, 125–135 (2002).

155. Tian, B., Pan, Z. & Lee, J. Y. Widespread mRNA polyadenylation events in

introns indicate dynamic interplay between polyadenylation and splicing.

Genome Res. 17, 156–165 (2007).

156. Chi, M. N. et al. The RNA-binding protein ELAVL1/HuR is essential for mouse

spermatogenesis, acting both at meiotic and postmeiotic stages. Mol. Biol. Cell

22, 2875–2885 (2011).

157. Dai, W., Zhang, G. & Makeyev, E. V. RNA-binding protein HuR autoregulates

its expression by promoting alternative polyadenylation site usage. Nucleic

Acids Res. 40, 787–800 (2012).

158. Popovitchenko, T. et al. Translational derepression of Elavl4 isoforms at their

alternative 5′ UTRs determines neuronal development. Nat. Commun. 11, 1674

(2020).

159. McBride, W. J. et al. Gene expression in the ventral tegmental area of 5 pairs of

rat lines selectively bred for high or low ethanol consumption. Pharmacol.

Biochem. Behav. 102, 275–285 (2012).

160. Bell, R. L. et al. Gene expression changes in the nucleus accumbens of alcohol-

preferring rats following chronic ethanol consumption. Pharmacol. Biochem.

Behav. 94, 131–147 (2009).

117

161. Sando, R. et al. HDAC4 Governs a Transcriptional Program Essential for

Synaptic Plasticity and Memory. Cell 151, 821–834 (2012).

162. Warnault, V., Darcq, E., Levine, A., Barak, S. & Ron, D. Chromatin remodeling

— a novel strategy to control excessive alcohol drinking. Transl. Psychiatry 3,

e231–e231 (2013).

163. Pandey, S. C., Sakharkar, A. J., Tang, L. & Zhang, H. Potential role of

adolescent alcohol exposure-induced amygdaloid histone modifications in

anxiety and alcohol intake during adulthood. Neurobiol. Dis. 82, 607–619

(2015).

164. Bourguet, E., Ozdarska, K., Moroy, G., Jeanblanc, J. & Naassila, M. Class I

HDAC Inhibitors: Potential New Epigenetic Therapeutics for Alcohol Use

Disorder (AUD). J. Med. Chem. 61, 1745–1766 (2018).

165. Chen, W.-Y. et al. The histone deacetylase inhibitor suberoylanilide hydroxamic

acid (SAHA) alleviates depression-like behavior and normalizes epigenetic

changes in the hippocampus during ethanol withdrawal. Alcohol 78, 79–87

(2019).

166. Simon-O’Brien, E. et al. The histone deacetylase inhibitor sodium butyrate

decreases excessive ethanol intake in dependent animals: HDAC inhibition and

alcoholism. Addict. Biol. 20, 676–689 (2015).

118

167. Pandey, S. C., Ugale, R., Zhang, H., Tang, L. & Prakash, A. Brain Chromatin

Remodeling: A Novel Mechanism of Alcoholism. J. Neurosci. 28, 3729–3737

(2008).

168. Griffin, E. A. et al. Prior alcohol use enhances vulnerability to compulsive

cocaine self-administration by promoting degradation of HDAC4 and HDAC5.

Sci. Adv. 3, e1701682 (2017).

169. Jang, C.-W., Shibata, Y., Starmer, J., Yee, D. & Magnuson, T. Histone H3.3

maintains genome integrity during mammalian development. Genes Dev. 29,

1377–1392 (2015).

170. Bano, D., Piazzesi, A., Salomoni, P. & Nicotera, P. The histone variant H3.3

claims its place in the crowded scene of epigenetics. Aging 9, 602–614 (2017).

171. Maze, I. et al. Critical Role of Histone Turnover in Neuronal Transcription and

Plasticity. Neuron 87, 77–94 (2015).

172. Xia, W. & Jiao, J. Histone variant H3.3 orchestrates neural stem cell

differentiation in the developing brain. Cell Death Differ. 24, 1548–1563 (2017).

119