Human Pulmonary Artery Endothelial Cells

Eotaxin-1/CC Chemokine Ligand 11: A Novel Eosinophil Survival Factor Secreted by Human Pulmonary Artery Endothelial Cells

This information is current as Neda Farahi, Andrew S. Cowburn, Paul D. Upton, John of September 29, 2021. Deighton, Anastasia Sobolewski, Ermanno Gherardi, Nicholas W. Morrell and Edwin R. Chilvers J Immunol 2007; 179:1264-1273; ; doi: 10.4049/jimmunol.179.2.1264

http://www.jimmunol.org/content/179/2/1264 Downloaded from

References This article cites 61 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/179/2/1264.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Eotaxin-1/CC Chemokine Ligand 11: A Novel Eosinophil Survival Factor Secreted by Human Pulmonary Artery Endothelial Cells1

Neda Farahi,* Andrew S. Cowburn,* Paul D. Upton,* John Deighton,* Anastasia Sobolewski,* Ermanno Gherardi,† Nicholas W. Morrell,* and Edwin R. Chilvers2*

Airway eosinophilia plays a major role in the pathogenesis of asthma with the inhibition of apoptosis by GM-CSF and IL-5 proposed as a mechanism underlying prolonged eosinophil survival. In vivo and ex vivo studies have indicated the capacity of interventions that drive human eosinophil apoptosis to promote the resolution of inflammation. Far less is known about the impact of transendothelial migration on eosinophil survival, in particular, the capacity of endothelial cell-derived factors to contribute toward the apoptosis-resistant phenotype characteristic of airway-resident eosinophils. We examined the effects of conditioned Downloaded from medium from human pulmonary artery endothelial cells (HPAEC-CM) on eosinophil apoptosis in vitro. HPAEC-CM inhibited eosinophil, but not neutrophil apoptosis. This effect was specific to HPAECs and comparable in efficacy to the survival effects of GM-CSF and IL-5. The HPAEC survival factor was shown, on the basis of GM-CSF, IL-5, and IL-3 detection assays, Ab neutralization, and sensitivity to PI3K inhibition, to be clearly discrete from these factors. Gel filtration of HPAEC-CM revealed a peak of eosinophil survival activity at 8–12 kDa, and PCR confirmed the presence of mRNA for CCL5, CCL11, CCL24, CCL26, and CCL27 in the HPAECs. The CCR3 antagonist GW782415 caused a major inhibition of the HPAEC-CM-induced survival http://www.jimmunol.org/ effect, and Ab neutralization of individual CCR3 chemokines revealed CCL11 as the major survival factor present in the HPAEC- CM. Furthermore, chemokine Ab arrays demonstrated up-regulation of CCL11 in HPAEC-CM. These data demonstrate the capacity of HPAECs to generate CCR3 agonists and the ability of CCL11 to inhibit human eosinophil apoptosis. The Journal of Immunology, 2007, 179: 1264–1273.

irway eosinophilia is a characteristic feature of several migration. The importance of the latter mechanism has been dem- inflammatory diseases including asthma, allergic rhini- onstrated using allergen challenge in animals, which induces a tis, nasal polyposis, and eosinophilic bronchitis. In the rapid and highly coordinated exit of eosinophils into the airway by guest on September 29, 2021 A 2 case of asthma, treatment targeted at eosinophil reduction im- lumen estimated at up to 35,000 cells/min/cm (9). Once present in proves disease control (1–3). Although many of the mechanisms the airway lumen, these cells are either expectorated or undergo that result in the selective recruitment, priming, and activation of senescence-related or Fas/Fas ligand-driven apoptosis, which trig- these cells have been well characterized (4), the processes involved gers phagocytic removal by alveolar macrophages, inflammatory in the elimination of these cells are less well understood. IL-3, macrophages, or bronchial epithelial cells (10, 11). Although eo- IL-5, and GM-CSF are known to play important roles in the mat- sinophils are clearly capable of undergoing constitutive apoptosis uration, terminal differentiation, activation, and survival of eosin- both in vitro and in vivo (12–14), studies examining airway mor- ophils, whereas the CCR3 chemokines CCL5 and CCL11 regulate phology in a variety of allergic inflammatory settings have shown the release of eosinophils from the bone marrow and their migra- little, if any, evidence of eosinophil apoptosis in the airway wall tion to sites of allergic inflammation (5–7). compartment. Although the highly efficient coupling of granulo- Potential mechanisms for the removal of eosinophils from tis- cyte apoptosis to macrophage removal may result in an underes- sues include re-entry into the circulation (as recently demonstrated timation of the true extent of eosinophil apoptosis occurring in for neutrophils (8)), migration to regional lymph nodes, primary vivo, these data support the concept that the capacity of eosino- cytolysis, apoptosis, or, in the bowel and airway, transepithelial phils to undergo constitutive apoptosis within the airway wall or lung interstitial compartment may be severely restricted, i.e., that *Division of Respiratory Medicine, Department of Medicine, University of Cam- these cells adopt an apoptosis-resistant phenotype. bridge School of Clinical Medicine, Addenbrooke’s and Papworth Hospitals, and †Medical Research Council Laboratory of Molecular Biology, Cambridge, United Transmigration of human neutrophils across lung endothelium- Kingdom epithelium bilayers has been shown to induce a sustained inhibi- Received for publication October 10, 2006. Accepted for publication May 11, 2007. tion of apoptosis, which correlates with down-regulation of Fas The costs of publication of this article were defrayed in part by the payment of page ligand and TNF-␣-R1 expression (15). A similar paradigm has charges. This article must therefore be hereby marked advertisement in accordance been proposed for the eosinophil because transmigration of these with 18 U.S.C. Section 1734 solely to indicate this fact. cells across IL-1␤-activated human pulmonary microvascular en- 1 This work was supported by Asthma-U.K., Biotechnology and Biological Sciences Research Council, Aventis, GlaxoSmithKline, and the Wellcome Trust. dothelial cells also has a profound impact on eosinophil receptor expression. This process results in the up-regulation of CD69, 2 Address correspondence and reprint requests to Prof. Edwin R. Chilvers, Division of Respiratory Medicine, Department of Medicine, University of Cambridge School of HLA-DR, and CD54/ICAM-1, together with enhanced respiratory Clinical Medicine, Box 157, Addenbrooke’s Hospital, Hills Road, Cambridge CB2 burst activity and prolonged survival (16); this latter effect has 2QQ, United Kingdom. E-mail address: [email protected] been attributed at least in part to the induction and autocrine effects Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 of GM-CSF. In an in vivo setting, the migrating eosinophil is also www.jimmunol.org The Journal of Immunology 1265 influenced by a variety of other factors including interactions with other inflammatory and structural cells, cell:matrix contact, and a much broader array of endothelial cell-derived cytokines, colony- stimulating factors, and other proinflammatory molecules including platelet-activating factor, eicosanoids, and NO (17, 18). To explore the capacity of human pulmonary artery endothelial cells (HPAECs)3 to modulate apoptotic thresholds in human eosinophils, we sought to characterize the effects of HPAEC conditioned medium (HPAEC-CM) in isolated eosinophils in vitro. These studies suggested that unstimulated primary HPAECs secrete a factor or factors distinct from GM-CSF and IL-5 that results in a profound and selective survival advantage for human eosinophils. Further characterization of this survival factor demonstrated the previously unrecognized capacity of HPAECs to secrete the CCR3 ligands CCL5, CCL11, CCL24, CCL26, and CCL27 (RANTES, eotaxin-1, eotaxin-2, eotaxin-3, and cutaneous T cell- attracting chemokine (CTACK)) and for CCL11 to operate as a novel eosinophil survival factor. These data offer new insights into the mechanisms underlying the apoptosis-resistant phenotype of Downloaded from eosinophils within the airway wall and add to the recognized sites of CCR3 active chemokine generation and the functional attributes of CCL11. Materials and Methods

Isolation and culture of human eosinophils and neutrophils http://www.jimmunol.org/ Human granulocytes were isolated from the peripheral blood of healthy normal and atopic donors not receiving topical or systemic medication, as previously detailed (19). Approval was obtained from the Cambridge Re- search Ethics Committee for these studies. Eosinophils were puriﬁed from the mixed granulocyte population using immunomagnetic separation with anti-CD16 microbeads (Miltenyi Biotec). Isolated eosinophils were washed in PBS containing Ca2ϩ/Mg2ϩ and resuspended at 5 ϫ 106 cells/ml in Iscove’s DMEM (Invitrogen Life Technologies) supplemented with 50 U/ml streptomycin and penicillin G and 1ϫ insulin-transferrin-sodium se-

lenite liquid supplement (Sigma-Aldrich). by guest on September 29, 2021 Assessment of granulocyte apoptosis Granulocytes were harvested at 24 h (unless otherwise stated), cytocentri- fuged, fixed in methanol, and stained with Diff-Quik (Greiner). Morphol- ogy was examined by light microscopy under oil using a ϫ100 objective. Apoptotic granulocytes were defined as those with decreased cell size, FIGURE 1. Conditioned medium from HPAECs contains an eosinophil nuclear and cytoplasmic condensation. A total of 300 cells/slide was survival factor. A, Effect of HPAEC-CM on eosinophil apoptosis. Eosin- counted, with the viewer blinded to the experimental conditions. The num- ophils (5 ϫ 106/ml) were incubated in Iscove’s DMEM alone (control), ber of apoptotic cells was calculated as a percentage of the total cell count. IL-5 (10 ng/ml), GM-CSF (10 ng/ml), or with HPAEC-CM. Eosinophils Apoptosis was also assessed by flow cytometry using FITC-labeled An- were harvested at 24 h, and apoptosis was assessed morphologically. Data nexin V (BD Biosciences). Stock FITC-Annexin V was diluted 1/100 and represent the mean Ϯ SEM of three independent experiments, each per- propidium iodide (PI) diluted 1/10 with the supplied binding buffer (final -p Ͻ 0.05 compared with control values). B, Mor ,ء) formed in triplicate concentration, 5 ␮g/ml). Cells were removed from culture at the times indicated, pelleted by centrifugation (300 ϫ g, 5 min, 4°C), and incu- phology of eosinophils cultured in HPAEC-CM. Photomicrographs (orig- bated at 4°C in the dark with 100 ␮l of the above buffer containing inal magnification, ϫ400 magnification) of cytospin preparations. FITC-Annexin V and PI for 15 min. Samples were then diluted with 500 Eosinophils were incubated in Iscove’s DMEM alone, HPAEC-CM, or ␮l of binding buffer and examined using a FACSort (BD Biosciences) unconditioned medium containing IL-5 (10 ng/ml) or GM-CSF (10 ng/ml). by counting 10,000 events per sample, and data were analyzed using Eosinophils were harvested at 24 h. Examples of apoptotic eosinophils are FSC Press software (FSC Press) as previously described (20). indicated with closed arrows. C, Effect of HPAEC-CM on eosinophil ap- Preparation of endothelial cell-conditioned medium optosis (FACS analysis). Eosinophils were incubated in Iscove’s DMEM alone, HPAEC-CM, or unconditioned medium containing IL-5 (10 ng/ml) HPAECs, HUVECs, human aortic artery endothelial cells (HAECs), and or GM-CSF (10 ng/ml). Cells were harvested at 24 h, and apoptosis was human coronary artery endothelial cells (HCAECs) were obtained from assessed by flow cytometry using FITC-labeled human Annexin V and PI. Cambrex. The cells were grown and maintained in endothelial growth me- Histograms showing Annexin V binding are from one experiment repre- dium (EGM-2) supplemented with 2% (v/v) FBS (Invitrogen Life Tech- sentative of two others. nologies) and 100 U/ml penicillin G, 100 ␮g/ml streptomycin, and 25 ng/ml amphotericin B. Cells were used to passage 8 only. Once confluent, cells were washed thoroughly with serum-free Iscove’s DMEM, and then incubated for a further2hinserum-free Iscove’s DMEM, followed by a CM). Trypan blue was used to confirm that the HPAECs were viable after final incubation for 15 h with antibiotic and antimycotic-supplemented se- 15-h serum-free treatment. The CM was removed, centrifuged at 1000 ϫ rum-free Iscove’s DMEM to generate the conditioned medium (IMDM- g (10 min at 4°C), and aliquots were stored at Ϫ80°C. Insulin-transferrin- sodium selenite was added as above to all conditioned and control non- 3 Abbreviations used in this paper: HPAEC, human pulmonary artery endothelial cell; conditioned medium before eosinophil or neutrophil incubation. Smooth HAEC, human aortic endothelial cell; HCAEC, human coronary artery endothelial muscle cells were isolated from the medium of human pulmonary arteries cell; CM, conditioned medium; CTACK, cutaneous T cell-attracting chemokine; PI, present in lung explants (21) and cultured in DMEM supplemented with propidium iodide; CrmE, cytokine response modifier E. 10% (v/v) FBS and the above antibiotics and antimycotics. Human fetal lung 1266 CCL11: AN EOSINOPHIL SURVIVAL FACTOR FROM PULMONARY ENDOTHELIUM Downloaded from http://www.jimmunol.org/

FIGURE 2. Speciﬁcity of HPAEC-CM-induced eosinophil survival effect. A, Effect of HUVEC-CM on eosinophil apoptosis. Eosinophils were incubated with IL-5 (10 ng/ml), HPAEC-CM, and HUVEC-CM. Apoptosis was assessed morphologically. Data represent the mean Ϯ SEM of three independent p Ͻ 0.05 compared with control values). B, Effect of HCAEC-CM and HAEC-CM on eosinophil apoptosis. Eosinophils were incubated ,ء) experiments Ϯ in HAEC-CM or HCAEC-CM. Apoptosis was assessed morphologically. Data represent the mean SEM of three independent experiments, each by guest on September 29, 2021 ,p Ͻ 0.05 compared with control values). C, Effect of eosinophil-endothelial cell contact on eosinophil apoptosis. HPAECs ,ء) performed in duplicate HUVECs, HAECs, and HCAECs were grown to conﬂuence, and the medium was replaced with serum-free Iscove’s DMEM with or without eosinophils (2.5 ϫ 105 eosinophils per well). Eosinophils were harvested at 24 h, and apoptosis was assessed by FACS analysis. Data represent the mean Ϯ SEM of p Ͻ 0.05 compared with control values). D, Effect of HPAEC-CM on constitutive neutrophil apoptosis. Neutrophils (5 ϫ ,ء) three independent experiments 106/ml) were incubated in Iscove’s DMEM alone, with GM-CSF (10 ng/ml) or HPAEC-CM. Neutrophils were harvested at6h(Ⅺ) and at 20 h (f). p Ͻ 0.05 ,ء) Apoptosis was assessed morphologically. Data represent the mean Ϯ SEM of three independent experiments, each performed in triplicate compared with control values). E, Effect of HPAEC-CM on neutrophil shape change. Neutrophils (5 ϫ 106/ml) were incubated for 10 min, and shape change was assessed as described in Materials and Methods. i, Histogram showing the effect of PBS alone or fMLP (1 ␮M) on neutrophil shape change from one experiment (representative of two others). ii, Effect of PBS, fMLP (1 ␮M), HPAEC-CM, fMLP plus HPAEC-CM, IMDM (Iscove’s DMEM), and fMLP plus IMDM on neutrophil shape change. Percentage shape change was calculated based on the percentage of cells in the M2 gate. Data represent the mean Ϯ SEM of three independent experiments, each performed in triplicate.

fibroblasts (HFL-1) (European Collection of Cell Cultures) were cultured in removed and apoptosis was assessed by flow cytometry using FITC-la- Ham’s F12 supplemented with 2 mM glutamine, 1ϫ nonessential amino acids, beled Annexin V (see above). 10% (v/v) FBS, and 100 U/ml penicillin G, 100 ␮g/ml streptomycin, and 25 ng/ml amphotericin B. All cells were maintained at 37°C in a humidified Trypsin treatment of HPAEC-CM atmosphere of air containing 5% CO2. Confirmation of the protein nature of the HPAEC-CM survival factor(s) Measurement of granulocyte polarization responses was sought by determining the effects of both heat treatment (56°C, 45 min) and trypsin digestion. For the latter, HPAEC-CM was incubated with Granulocytes incubated with priming or activating agents under nongradi- trypsin (1500 ng/ml HPAEC-CM) for2hat37°C and the reaction was ent conditions undergo frustrated chemotaxis, which results in a charac- terminated by the addition of 1500 ng/ml soya bean trypsin inhibitor before teristic change in cell morphology (shape change) and consequent alter- assessing the effect on eosinophil apoptosis. ation in their forward light scatter properties under flow cytometry (22). Granulocytes were resuspended at 5 ϫ 106 cells/ml in 100 ␮l of PBS containing Ca2ϩ/Mg2ϩ and incubated with agonists or buffer for 10 min before Gel filtration column chromatography fixation in 0.8% (v/v) glutaraldehyde. Percentage shape change was determined by assessing forward scatter under control and activated conditions G-50 Sephadex Superfine beads (Amersham Biosciences) were packed in a using FACSort and FSC Press software as detailed previously (23, 24). 40-cm column (16-mm internal diameter) and equilibrated in phenol red-free Iscove’s DMEM. HPAEC-CM (10 ml) was freeze-dried, stored at Ϫ80°C, and Eosinophil-endothelial cell coculture resuspended in 550 ␮l of phenol red-free Iscove’s DMEM. Dextran blue (30 mg/ml) and 50 ␮lof125I-labeled cAMP were added to the sample of HPAECs were grown to confluence in 24-well tissue culture plates and HPAEC-CM to give a final volume of 0.61 ml. The suspension was spun at coincubated in the presence or absence of eosinophils (2.5 ϫ 105 per well) 15,000 ϫ g for 5 min at room temperature, and the supernatant was applied to resuspended in serum-free Iscove’s DMEM. At 24 h, the eosinophils were the column. Fractions (1 ml) were collected overnight at 4°C, analyzed for The Journal of Immunology 1267 Downloaded from http://www.jimmunol.org/

FIGURE 3. Time-dependent generation and protein nature of HPAEC-CM survival effect. A, Effect of different dilutions of HPAEC-CM on eosinophil apoptosis. Eosinophils were incubated in Iscove’s DMEM alone (control), IL-5 (10 ng/ml), HPAEC-CM (1/1), or HPAEC-CM diluted 1/3, 1/10, or 1/30 with Iscove’s DMEM. Eosino- by guest on September 29, 2021 phils were harvested at 24 h, and apoptosis was assessed morphologically. Data represent the mean Ϯ SEM of three independent experi- p Ͻ 0.01 compared ,ءء ;p Ͻ 0.05 ,ء) ments, each performed in duplicate with control values). B, Effect of HPAEC culture period on the HPAEC- CM-induced survival effect. Eosinophils were incubated with DMEM alone (control), or HPAEC-CM removed following 3, 6, 9, or 15 h of contact with HPAECs. Eosinophils were harvested at 24 h, and apo- FIGURE 4. HPAEC-CM-induced eosinophil survival effect is not me- ptosis was assessed morphologically. Data represent the mean Ϯ SEM diated by IL-5 or GM-CSF. A, ELISA measurement of GM-CSF and IL-5 .p Ͻ in HPAEC-CM. As a positive control, PHA-stimulated PBMCs were used ,ء) of three independent experiments, each performed in duplicate Ϯ 0.05 compared with control values). C, The effect of trypsin digestion Data represent the mean SEM of three independent experiments. B, The on HPAEC-CM-induced eosinophil survival. Iscove’s DMEM with effect of GM-CSF and IL-5 neutralizing Abs on HPAEC-CM-induced eo- soya bean trypsin inhibitor (SBTI) alone or with trypsin plus SBTI, sinophil survival. Iscove’s DMEM alone (control), GM-CSF (10 ng/ml), ␮ ␮ HPAEC-CM with SBTI alone or with trypsin plus SBTI were digested anti-GM-CSF (50 g/ml), GM-CSF (10 ng/ml) plus anti-GM-CSF (50 g/ ␮ as described in Materials and Methods. Eosinophils were harvested at ml), or with IgG (50 g/ml) were incubated for1hat37°C before resus- ␮ 24 h, and apoptosis was assessed morphologically. Data represent the pension with eosinophils. HPAEC-CM alone, with anti-GM-CSF (50 g/ ␮ p Ͻ 0.05 compared ml), or with IgG (50 g/ml) was also incubated for1hat37°C before ,ء) mean Ϯ SEM from three separate experiments with HPAEC-CM values). D, The effect of heat inactivation on resuspension with eosinophils. Anti-IL-5 was also used as described for ␮ HPAEC-CM-induced eosinophil survival. Eosinophils were incubated GM-CSF and at 50 g/ml. Eosinophils were harvested at 24 h, and apo- Ϯ in Iscove’s DMEM alone (control), HPAEC-CM, or their heat-inacti- ptosis was assessed morphologically. Data represent the mean SD of two vated equivalents. DMEM and HPAEC-CM were inactivated by heating independent experiments. C, Effect of LY294002 on HPAEC-CM-induced at 56°C for 45 min. Data represent the mean Ϯ SEM from three inde- eosinophil survival. Eosinophils were preincubated with or without ␮ p Ͻ 0.05 compared with control values). LY294002 (1 M) for 15 min before resuspension in Iscove’s DMEM ,ء) pendent experiments alone (control), GM-CSF (10 ng/ml), HPAEC-CM alone, LY294002, GM- CSF plus LY294002, or HPAEC-CM plus LY294002. Eosinophils were harvested at 24 h, and apoptosis was assessed morphologically. Data rep- 125I-labeled cAMP and dextran blue markers, and the intervening aliquots resent the mean Ϯ SEM of three independent experiments, each performed were stored at Ϫ80°C before coincubation with eosinophils for 24 h. .(p Ͻ 0.05 compared with control values ,ء) in triplicate IL-5 and GM-CSF ELISA IL-5 and GM-CSF were measured using an in-house ELISA. Flat-bottom high binding 96-well ELISA plates (Greiner) were coated with 2 ␮g/ml monoclonal standards and samples with the relevant controls were then added and incu- anti-GM-CSF Ab (R&D Systems), diluted in carbonate buffer (0.15 M sodium bated overnight at 4°C. Following three washes with PBS-T, biotinylated anti- carbonate, 0.35 M sodium bicarbonate, pH 9.6) for 2 h using a working vol- human GM-CSF (R&D Systems) (0.2 ␮g/ml in PBS-T plus 5% FCS) was ume of 50 ␮l. The plates were washed three times with PBS containing 0.05% added, and the incubations continued for2hatroom temperature. The plates Tween 20 (PBS-T) and blocked with 5% heat-inactivated FCS in PBS-T; were washed three times and ExtraAvidin alkaline phosphatase conjugate (1: 1268 CCL11: AN EOSINOPHIL SURVIVAL FACTOR FROM PULMONARY ENDOTHELIUM

FIGURE 5. HPAEC-CM-derived eosinophil survival factor is a CCR3 agonist. A, Representative chemokine membrane array ﬁlm showing HPAEC-CM. Grid references A1, B1, and L4 represent the internal positive controls, and the circled spots represent CCL11 (K1) and IL-8 (I2). B, Densitometry analysis of chemokine arrays with grid references. Data represent the p Ͻ ,ء) mean Ϯ SEM of three independent experiments 0.05 compared with HUVEC-CM values). The mean values were calculated as a percentage of the positive controls (A1 and B1). C, Effect of GW782415 on HPAEC-CM-induced eosinophil survival. Iscove’s DMEM alone (control), GM-CSF (10 ng/ml), GW782415 (10 ␮M), or with GM-CSF plus GW782415 (10 ␮M) were incubated for 30 min at 37°C before resuspension with eosinophils. HPAEC-CM alone, with GW782415 (10 ␮M), or with its diluent (10 ␮M Downloaded from DMSO) was also incubated for 30 min at 37°C before resuspension with eosinophils. Eosinophils were harvested at 24 h, and apoptosis was assessed morphologically. Data represent the mean Ϯ SEM of four inde- p Ͻ 0.01 compared with ,ء) pendent experiments HPAEC-CM values). D, The effect of M3 on HPAEC- http://www.jimmunol.org/ CM-induced eosinophil survival. Iscove’s DMEM (control), GM-CSF (10 ng/ml), M3 (1 ␮g/ml), CrmE (1 ␮g/ ml), GM-CSF plus M3 (1 ␮g/ml), or with GM-CSF plus CrmE (1 ␮g/ml) were incubated for1hat37°C before resuspension with eosinophils. HPAEC-CM alone, with M3 (1 ␮g/ml), or with CrmE (1 ␮g/ml) was also incubated for2hatroom temperature before resuspension with eosinophils. Eosinophils were harvested at 24 h, and apoptosis was assessed morphologically. Data represent the mean Ϯ SD of two independent experiments. by guest on September 29, 2021 Limited availability of M3 precluded additional experimental repeats.

250) (Sigma-Aldrich) added and incubated at room temperature for 2 h. After HPAEC-CM was preincubated with Ab at the concentration specified for two further washes, 1 mg/ml p-nitrophenyl phosphate (Sigma-Aldrich) was 1 h at 37°C before resuspension with eosinophils (5 ϫ 106/ml) and further added diluted in diethanolamine buffer. The latter buffer was prepared culture. The following Ab and IgG concentrations were used: IL-5 and ⅐ by dissolving 101 mg of MgCl2 6H2O in 800 ml of distilled H2O before GM-CSF at 50 ␮g/ml; CCL27, CCL11, CCL24, CCL26, and CCL5 at 10 the addition of 97 ml of diethanolamine and adjustment of the pH to 9.8. ␮g/ml. For the PI3K inhibition experiments 1 ␮M LY294002 (Calbio- Plates were read at 405 nm using a Bio-Rad 550 microplate reader and chem) was preincubated with the eosinophils for 15 min before the addition the data were analyzed using MPM III Vs 1.57 software. The detection of medium. The pan chemokine blocker M3 and control viral TNF-␣ re- limit of this ELISA for GM-CSF was 30 pg/ml. The IL-5 ELISA was ceptor cytokine response modifier E (CrmE) were donated by Dr. A. Alcami performed as described above with the substitution of IL-5 mAb at a (University of Cambridge, Cambridge, U.K.). The CrmE protein was gener- coating concentration of 2 ␮g/ml and the use of monoclonal anti-goat/ ated and purified using the same conditions as M3. GW782415 was a gift from sheep-alkaline phosphatase (GT-34) (Sigma-Aldrich) (1:400). The detection limit of this assay for IL-5 was 100 pg/ml. Dr. C. Horgan (GlaxoSmithKline, Stevenage, U.K.). Quantification of human chemokines Quantitative PCR The presence of chemokines in HPAEC-CM and HUVEC-CM was assessed using the human protein chemokine array kit (RayBiotech) (see Fig. Total RNA was isolated from the HPAECs using RNeasy columns (Qia- 5) as detailed in the manufacturer’s instructions. The resultant blots were gen) with the additional on column DNA digest step (RNase-Free DNase quantified by densitometry (Scion Image; Scion Corporation). The levels of Set; Qiagen). RNA (in micrograms) was transcribed into cDNA using a CCL11 were also measured using a CCL11 Duoset ELISA (R&D Systems) first-strand cDNA synthesis kit (AccuScript; Stratagene). IQ SYBR-green according to the manufacturer’s instructions. The HPAEC-CM and supermix (Bio-Rad Laboratories) was used with primers for CCL5, HUVEC-CM were also analyzed by Rules-Based Medicine using the Luminex CCL11, CCL24, CCL26, and CCL27 (Qiagen) for quantitative PCR FlowMetrix system. (iCycler IQ system; Bio-Rad Laboratories). Control primers for ␤-actin Inhibition of HPAEC-CM cytokines and chemokines were designed in-house: sense, GCACCACACCTTCTACAATGA, anti- sense, TGTCACGCACGATTTCCC; product length, 400 bp. The mean In the cytokine and chemokine neutralization experiments, all Abs and cycle thresholds (Ct) were determined for the genes of interest and endog- isotype-matched IgG controls were obtained from R&D Systems; enous ␤-actin. The Journal of Immunology 1269

Statistical analysis Unless otherwise stated, all data are expressed as mean Ϯ SEM of (n) independent experiments, each performed in duplicate or triplicate. Data were analyzed using GraphPad Prism and Student’s t test. A value of p Ͻ 0.05 was considered significant. Results Conditioned medium from HPAECs contains an eosinophil survival factor As previously described (6, 25), coincubation of human eosinophils for 24 h with either GM-CSF or IL-5 results in a substantial inhibition of apoptosis (Fig. 1A); this effect was evident using either direct morphological quantification (Fig. 1, A and B)orAn- nexin V staining (Fig. 1C). Culture of eosinophils for 24 h under otherwise identical conditions in medium that had been in contact with a monolayer of HPAECs for 15 h also inhibited eosinophil apoptosis (Fig. 1). The efficacy of the HPAEC-CM survival of this effect was comparable with that of GM-CSF and IL-5. Of note, all

control, IL-5, and GM-CSF incubations were performed using me- Downloaded from dium that had been handled in an identical manner aside from exposure to HPAECs. To determine whether the atopy status of the eosinophil donor could alter the HPAEC-CM-induced eosinophil survival response, data from 10 atopic and 10 nonatopic donors were analyzed sep-

arately. There were no significant differences between the two http://www.jimmunol.org/ groups with regards to basal apoptosis rates or the survival effect induced by HPAEC-CM (data not shown). Specificity of HPAEC-CM survival effect To investigate the specificity of the above eosinophil survival to HPAECs, conditioned medium was prepared in an identical manner from a variety of other nonpulmonary human endothelial cells including HUVECs, aorta (HAECs), and coronary artery (HCAECs). As shown in Fig. 2, A and B, these conditioned media by guest on September 29, 2021 had no effect on eosinophil apoptosis when assessed at 24 h. Con- ditioned medium from human lung fibroblasts (HFL-1) and smooth muscle cells derived from human pulmonary arteries likewise had no effect on eosinophil survival (data not shown). In contrast, HPAECs, HUVECs, and HCAECs all inhibited eosinophil apoptosis when the two cell types were in direct contact (Fig. 2C). Hence, whereas endothelial cells appear to display a generic capacity to prolong eosinophil survival when cultured together, HPAECs possess an additional and distinct survival mechanism FIGURE 6. Identification of CCL11 as a novel HPAEC-derived mediated by a soluble factor. product capable of causing survival of human eosinophils. A, The Of particular interest, HPAEC-CM had no effect on the rate of mRNA expression of CCR3 agonists by HPAECs. Quantitative PCR neutrophil apoptosis assessed at either 6 or 20 h (Fig. 2D). Like- cycle thresholds for CCL5, CTACK, CCL11, CCL24, and CCL26 wise, there was no effect of the HPAEC-CM on neutrophil shape mRNA. ␤-Actin mRNA expression was detected as a control. Confluent change assessed by flow cytometry (Fig. 2E, i and ii) or by light HPAECs were serum-starved for 15 h as described in Materials and microscopy (data not shown), an assay that is highly sensitive in Methods before RNA isolation. Data represent the mean of duplicate detecting agents that cause neutrophil priming or activation. samples from a single experiment with the SD values all under 5% of the mean value. B, The effect of CCR3 agonists on eosinophil apoptosis. Time-dependent generation and protein nature of the Eosinophils were incubated in Iscove’s DMEM alone (control), GM- ␮ HPAEC-CM survival effect CSF (10 ng/ml), CCL5 (200 ng/ml), CCL27 (10 g/ml), CCL11 (200 ng/ml), CCL24 (500 ng/ml), and CCL26 (5 ␮g/ml). Eosinophils were HPAEC-CM concentration-response experiments identified loss of harvested at 24 h, and apoptosis was assessed morphologically. Data the eosinophil survival effect at HPAEC-CM dilutions of 1/10 di- represent the mean Ϯ SEM of seven independent experiments, each .(p Ͻ 0.05 compared with control values ,ء) lution or greater (Fig. 3A). This implies that despite possessing an performed in triplicate antiapoptotic efficacy comparable with GM-CSF and IL-5, this Values represent mean Ϯ SEM apoptosis values expressed as a per- survival factor(s) displays either low potency or is expressed in centage of the control value. C, The effect of CCL11 Ab neutralization low abundance by the HPAEC-CM. Time course experiments on the HPAEC-CM-induced eosinophil survival effect. Samples were shown in Fig. 3B revealed that a minimum conditioning period of preincubated with the Ab or isotype-matched IgG controls for1hat 37°C before resuspension with eosinophils (5 ϫ 106/ml) as described in 15 h was required to demonstrate the HPAEC-CM eosinophil sur- Materials and Methods. Values represent mean Ϯ SEM apoptosis val- -p Ͻ 0.05 com ,ء) vival. Hence, the HPAEC-CM-mediated eosinophil survival effect ues expressed as a percentage of the control value was both concentration and time dependent. Likewise, heat inac- pared with HPAEC-CM values). tivation of HPAEC-CM or pretreatment with trypsin completely 1270 CCL11: AN EOSINOPHIL SURVIVAL FACTOR FROM PULMONARY ENDOTHELIUM

Table I. The effect of CCR3 chemokine neutralizing Abs on HPAEC-CM-induced eosinophil survivala

No Ab Plus Neutralizing Ab

Ab Details Control GM-CSF HPAEC-CM IgG HPAEC-CM ϩ IgG Ab alone HPAEC-CM GM-CSF

Anti-CCL11 100 38 Ϯ 433Ϯ 395Ϯ 23 41 Ϯ 1NS 100 Ϯ 16 105 Ϯ 12* 38 Ϯ 4 Anti-CCL24 100 39 Ϯ 541Ϯ 275Ϯ 13 59 Ϯ 6NS 98 Ϯ 472Ϯ 20NS 40 Ϯ 15 Anti-CCL26 100 37 Ϯ 158Ϯ 9 109 Ϯ 24 65 Ϯ 5NS 105 Ϯ 10 89 Ϯ 15NS 62 Ϯ 27 Anti-CCL5 100 35 Ϯ 050Ϯ 884Ϯ 12 65 Ϯ 2NS 100 Ϯ 987Ϯ 10NS 53 Ϯ 8 Anti-CCL27 100 28 Ϯ 239Ϯ 476Ϯ 044Ϯ 3NS 69 Ϯ 9.5 42 Ϯ 2NS 41 Ϯ 5

a Cell medium was preincubated with the Ab or isotype-matched IgG control for1hat37°Cbefore resuspension with eosinophils as described in Materials and Methods. Eosinophils were harvested at 24 h, and apoptosis was assessed morphologically. Values represent apoptosis expressed as a percentage of the control value and are the mean Ϯ p Ͻ 0.05 compared with HPAEC-CM values). Note that each set of neutralization experiments was conducted separately due to ,ء) SEM of three independent experiments limitations on human eosinophil number. abrogated the survival effect (Fig. 3, C and D), indicating the likely human chemokine Ab array assay to detail the chemokines present protein nature of the HPAEC-derived survival factor. in HPAEC-CM and HUVEC-CM, 2) examination of the effects of chemokine inhibition on the HPAEC-CM survival effect using the HPAEC-CM survival effect on eosinophils is not mediated by herpes virus-encoded broad spectrum secreted chemokine binding Downloaded from GM-CSF or IL-5 protein M3 (31), and 3) examination of the effects of the CCR3 GM-CSF and IL-5 are both potent eosinophil survival cytokines antagonist GW782415 on the HPAEC-CM survival effect. expressed by HPAECs and eosinophils (26, 27). Consequently, Using the human chemokine Ab array assay, IL-8 and CCL11 IL-5 and GM-CSF were considered to be the most likely candi- (eotaxin-1) were identiﬁed as the only chemokines that were dates for the HPAEC-derived eosinophil survival factor. However, present to a greater extent in the HPAEC-CM compared with

GM-CSF and IL-5 levels, when measured by ELISA in three sep- HUVEC-CM samples (Fig. 5, A and B). Importantly, this assay http://www.jimmunol.org/ arately prepared CMs, did not differ between the HPAEC-CM and revealed no differences in the levels of the CCR3 chemokines HUVEC-CM (which had no survival influence on human eosino- CCL5, CCL24, CCL26, CCL27, MCP-2, -3, or -4 (Fig. 5B). Given phils) (Fig. 4A). Furthermore, for GM-CSF in particular, the levels that eosinophils do not express receptors for IL-8 (32), a direct role were below the concentration reported elsewhere to induce eosin- for this cytokine in the HPAEC-CM survival effect was considered ophil survival (28). Independent analysis of HPAEC-CM and unlikely. HUVEC-CM samples by multiplexed particle-based flow cytom- The ability of GW782415 to block specifically CCR3-mediated etry again revealed no difference in the levels of these two cyto- eosinophil responses has been established in tests by GlaxoSmith- kines in the two conditioned medium (GM-CSF: HPAEC-CM, 27 Kline and by Fryer et al. (33). Furthermore, the ability of pg/ml; HUVEC-CM, 42 pg/ml; IL-5: HPAEC-CM, 31 pg/ml; GW782415 to block CCR3 responses was confirmed by examining by guest on September 29, 2021 HUVEC-CM, 28 pg/ml). IL-3, a further well-characterized eosin- eosinophil shape change responses in whole blood, where this ophil survival cytokine (28), was only detected by multiplexed compound fully inhibited CCL11-induced eosinophil polarization flow cytometry at sub-picogram per milliliter amounts and did not (data not shown). As shown in Fig. 5C, GW782415 (10 ␮M) differ between HPAEC-CM and HUVEC-CM (0.3 and 0.6 pg/ml, caused a ϳ70% reduction of the HPAEC-CM-mediated inhibition respectively). In addition, incorporation of lactose into our assay of eosinophil apoptosis without affecting the rate of apoptosis un- system, which blocks the eosinophil survival affects of the galec- der basal or GM-CSF-stimulated conditions. tin-like molecule ecalectin (29), had no influence on the The broad-spectrum chemokine inhibitor M3 (31) was likewise HPAEC-CM survival effect (data not shown). used to investigate the role of chemokines in the eosinophil-sur- Although the concentrations of IL-5 and GM-CSF did not differ vival response. Although M3 was able to fully block IL-8-medi- between the HPAEC-CM and HUVEC-CM, both were detectable; ated superoxide anion production and enhanced survival in neu- likewise, IL-5 has been reported to inhibit eosinophil apoptosis at trophils (data not shown), M3 had no effect on the survival effect concentrations as low as 10 pg/ml (30). For this reason, cytokine of HPAEC-CM (or GM-CSF) in eosinophils (Fig. 5D). Of note, Ab neutralization experiments were performed. As shown in Fig. however, coincubation of purified eosinophils with CrmE, a control 4B, whereas anti-IL-5 and anti-GM-CSF completely blocked the poxvirus-derived soluble TNFR (34) prepared under identical condi- eosinophil survival effect of 10 ng/ml IL-5 and 10 ng/ml GM-CSF, tions to M3, imparted a significant survival effect (Fig. 5D), and al- respectively, neither Ab was able to influence the HPAEC-CM though M3 binds to most of the C, CC, CXC, and CX3C family survival effect. Furthermore, coincubation of eosinophils with the proteins, the individual binding affinities vary and for eotaxin-1 is phosphoinositide 3-kinase inhibitor LY294002 (1 ␮M) prevented Ͼ1000 pM (Dr. A. Alcami, unpublished observations). GM-CSF-mediated inhibition of eosinophil apoptosis but failed to modulate the HPAEC-CM-induced eosinophil survival response Identification of eotaxin-1 as a novel product of HPAECs (Fig. 4C). Together, these data suggest that the HPAEC-CM sur- capable of inhibiting eosinophil apoptosis vival response is not mediated by GM-CSF, IL-5, or IL-3. Quantitative PCR demonstrated that HPAECs express mRNA for CCL5, CCL11, CCL24, CCL26, and CCL27 (Fig. 6A), supporting HPAEC-CM eosinophil survival factor operates via the CCR3 the possibility that one or more of these CCR3 agonists might receptor underlie the HPAEC-CM eosinophil survival effect. To verify that Gel filtration chromatography followed by assay of the individual CCR3 agonists have the capacity to influence apoptotic thresholds fractions for inhibition of eosinophil survival demonstrated a mo- in vitro, we first used coculture experiments using CCL5, CCL11, lecular mass for the HPAEC-CM survival factor of ϳ8–12 kDa CCL24, CCL26, and CCL27 at concentrations reported to be op- (data not shown), suggesting the involvement of a chemokine. timal for previously described biological actions. In contrast to Three complementary strategies were then pursued: 1) use of a previous reports (35), CCL5, CCL11, CCL24, CCL26, and CCL27 The Journal of Immunology 1271

Ras/Raf-1, Jak/Stat, PI3K, and NF-␬B pathways (13, 42–44). The concept that the microenvironment present within the inﬂamed airway wall may confer a primed and apoptosis-resistant phenotype in the eosinophil (45) has also been proposed as a potential mechanism responsible for the persistence of tissue eosinophilia following anti-IL-5 and IL-12 treatment in asthmatic subjects (46, 47). The above studies initially suggested that GM-CSF might ac- count for the observed survival effect of HPAEC-CM in human eosinophils; this possibility was excluded, however, by the presence of equivalent and low picogram per milliliter amounts of GM-CSF in both HPAEC-CM and HUVEC-CM and, more con- vincingly, by the failure of anti-GM-CSF neutralizing Abs or the PI3K inhibitor, LY294002, to modulate the HPAEC-CM survival FIGURE 7. The effect of CCL11 addition to HUVEC-CM in mediating response. Moreover, a role for GM-CSF would not have supported eosinophil apoptosis. A, ELISA measurement of CCL11 in HPAEC-CM. the very clear eosinophil over neutrophil selectivity observed As a positive control, TNF-␣-stimulated PBMCs were used. Data represent in the survival effect. A similar set of data was obtained to exclude Ϯ the mean SEM of three independent experiments each performed in the involvement of IL-5. Knowledge of the protein nature, pre- B duplicate. , Effect of the addition of CCL11 to HUVEC-CM on eosinophil dicted size (8–12 kDa), and the major blockade of the biological apoptosis. Eosinophils were incubated in Iscove’s DMEM alone (control), effect by the selective CCR3 antagonist GW782451 focused our Downloaded from IL-5 (10 ng/ml), HPAEC-CM, HUVEC-CM, or HUVEC-CM containing 40, 400, 4000 pg/ml, or 200 ng/ml CCL11. Eosinophils were harvested at attention on the CC family of chemokines and led to the detection 24 h, and apoptosis was assessed morphologically. Data represent the of CCL11, CCL24, CCL26, CTACK, and RANTES in the mean Ϯ SEM of three independent experiments, each performed in trip- HPAEC-CM. Although all ﬁve of these chemokines were shown to p Ͻ 0.05 compared with control values). display the capacity to induce eosinophil survival in vitro, only ,ء) licate neutralization of CCL11 caused complete loss of the survival ef-

ficacy of the HPAEC-CM. http://www.jimmunol.org/ all inhibited eosinophil apoptosis at 24 h, although to a lesser ex- Our data appear to contradict earlier reports that eotaxin-1 en- tent than GM-CSF (Fig. 6B). To confirm that CCL11, which was hances survival only in mouse eosinophils (29, 48, 49). In the latter the only CCR3 agonist differentially expressed between the study, which was conducted in Ag-exposed BALB/c mice, the HPAEC-CM and the HUVEC-CM, was responsible for the spontaneous survival of eosinophils purified from the bronchoal- HPAEC-CM eosinophil survival effect, individual Ab neutraliza- veolar lavage fluid was enhanced in the presence of the anti-CCR3 tion studies were performed (Table I and Fig. 6C). This demon- Ab 23321A (an effect not observed with CCR3 antagonist strated that anti-CCL11 Abs but not Abs against CCL5, CCL24, GW782451 in the current study), and the authors demonstrated a CCL26, or CCL27 could fully reverse the HPAEC-CM-mediated concentration-dependent survival effect of rhCCL11, CCL24, and eosinophil survival effect. Furthermore, the level of CCL11 de- CCL26, most marked when CCL11 and CCL26 were applied to- by guest on September 29, 2021 tected in the HPAEC-CM by ELISA was 40 pg/ml (Fig. 7A). The gether. However, the magnitude of the survival effect was signif- addition of 40 pg/ml CCL11 to HUVEC-CM resulted in an eosin- icantly lower than that induced by GM-CSF and only observed at ophil survival response comparable with that conferred by concentrations of CCL11 at 150 ng/ml; moreover, the effect was HPAEC-CM (Fig. 7B). These results highlight a potential role for also ablated by anti-GM-CSF Abs suggesting an autocrine effect HPAEC-derived CCL11 as an in vivo modulator of eosinophil again quite unlike that observed in the current study. We recognize longevity. that the eosinophil survival effect of exogenous CCL11 (eotaxin-1) alone was not as efficacious as GM-CSF; this may reflect an ad- Discussion ditional more modest contribution from the other CCR3 agonists This study demonstrates the capacity of HPAECs to secrete an present within the HPAEC-CM. The reasons underlying the lack of array of chemokines that activate CCR3, including CCL5, CCL11, effect of rhCCL11 on eosinophil survival in previous studies using CCL24, CCL26, and CCL27, and for these CCR3 ligands to delay human peripheral blood-derived cells is uncertain but may relate to human eosinophil apoptosis in vitro. differences in cell purification and/or culture techniques. This observation informs directly the current debate regarding This study therefore adds to the repertoire of biological effects the capacity of eosinophils to undergo apoptosis in human airway of CCL11 and points to a new and important site of production, tissues. Hence, Persson, Erjefalt, and colleagues (36, 37) have pro- namely the pulmonary artery endothelium. CCL11 (eotaxin-1) is vided compelling evidence that, although eosinophil cytolysis is recognized to mediate eosinophil chemotaxis and activation in observed in the airway mucosa, most eosinophils leave via trans- both mice and humans and is thought to play a central role in epithelial migration and that apoptosis is only detected in cells eosinophil recruitment to the airways of Ag-challenged animals present in the airway lumen. This observation also holds true fol- (50, 51). CCL11 is also recognized to induce chemotaxis in ba- lowing corticosteroid treatment, which is a powerful inducer of sophils, Th2 lymphocytes, airway smooth muscle cells, and mast eosinophil apoptosis both in vitro and within the airway lumen (2, cells (52, 53). Likewise, in humans, CCL11 can be readily detected 12). These findings, together with the recognized differences in the in the sputum of patients with moderate and severe asthma and morphology of circulating and tissue eosinophils, have suggested accounts for ϳ50% of the total eosinophil chemotactic activity that the chemoattraction, transendothelial migration, and tissue present in such samples (54). It is perhaps not surprising therefore residency of eosinophils may cause a significant change in their that we now reveal an additional antiapoptotic capacity of this capacity to undergo apoptosis (16). Previous studies have sug- important human chemokine. gested that this phenotypic switch may relate to the exposure of Previously identified sites for the production of CCL11 in the migrating cells to GM-CSF (16), IL-3 (38), IL-5 (19), IL-13 (39), lung include T lymphocytes, macrophages, eosinophils, smooth

IL-15 (40), or leukotriene B4 (41), and occur through changes in muscle, ﬁbroblasts, bronchial epithelial cells, and, most recently, the phosphorylation of Syk and Lyn and activation of the p21 airway parasympathetic neurons (33, 55–58); our identiﬁcation of 1272 CCL11: AN EOSINOPHIL SURVIVAL FACTOR FROM PULMONARY ENDOTHELIUM

CCL5, CCL11, CCL24, CCL26 mRNA and CCL27 in primary lived neutrophils in a model of reverse endothelial migration. J. Leukoc. Biol. 79: HPAECs and demonstration of their capacity to release these che- 303–311. 9. Erjefalt, J. S., and C. G. A. Persson. 2000. New aspects of degranulation and fates mokines following serum starvation are hence novel. The absence of airway mucosal eosinophils. Am. J. Respir. Crit. Care Med. 161: 2074–2085. of any eosinophil survival effect of conditioned medium from al- 10. Tsuyuki, S., C. Bertrand, F. Erard, A. Trifilieff, J. Tsuyuki, M. Wesp, ternative endothelial sources, including coronary artery, aorta, and G. P. Anderson, and A. J. Coyle. 1995. Activation of the Fas receptor on lung eosinophils leads to apoptosis and the resolution of eosinophilic inflammation of umbilical vein also suggests a degree of heterogeneity and possible the airways. J. Clin. Invest. 96: 2924–2931. specificity in the generation of these chemokines. However, we 11. Walsh, G. M., D. W. Sexton, M. G. Blaylock, and C. M. Convery. 1999. Resting and cytokine-stimulated human small airway epithelial cells recognize and engulf have not studied the capacity of endothelial cells from alternative apoptotic eosinophils. Blood 94: 2827–2835. sites to express mRNA for CC chemokines or their capacity to 12. Stern, M., L. Meagher, J. Savill, and C. Haslett. 1992. Apoptosis in human eo- secrete these agents following stimulation, for example with IL-13, sinophils: programmed cell death in the eosinophil leads to phagocytosis by mac- ␤ ␣ rophages and is modulated by IL-5. J. Immunol. 148: 3543–3549. IL-1 , or TNF- . In a previous detailed description of cytokine 13. Simon, H.-U., S. Yousefi, C. Schranz, A. Schapowal, C. Bachert, and K. Blaser. and chemokine expression in HPAECs, HCAECs, and HUVECs 1997. Direct demonstration of delayed eosinophil apoptosis as a mechanism caus- (18), these cell types were all shown to express transcripts for ing tissue eosinophilia. J. Immunol. 158: 3902–3908. ␣ 14. Ying, S., Q. Meng, L. Taborda-Barata, and A. B. Kay. 1997. Association of IL-1 , IL-5, IL-8, MCP-1, and GM-CSF. In addition, there was apoptosis of neutrophils and eosinophils and their ingestion by macrophages with weak expression of IL-6 and CCL5 in HCAECs and HPAECs, resolution of the allergen-induced cutaneous late phase response in atopic human respectively, following TNF-␣ activation. Furthermore, the che- subjects. Proc. Assoc. Am. Physicians 109: 42–50. 15. Hu, M., X. Lin, Q. Du, E. J. Miller, P. Wang, and H. H. Simms. 2005. Regulation mokine CCL27 has previously only been shown to be expressed by of polymorphonuclear leukocyte apoptosis: role of lung endothelium-epithelium keratinocytes (59). Of interest, IL-8 levels were also found to be bilayer transmigration. Am. J. Physiol. 288: L266–L274. increased in the HPAEC-CM compared with HUVEC-CM. Al- 16. Yamamoto, H., J. B. Sedgwick, R. F. Vrtis, and W. W. Busse. 2000. The effect Downloaded from of transendothelial migration on eosinophil function. Am. J. Respir. Cell Mol. though IL-8 itself does not influence eosinophil survival (32), it is Biol. 23: 379–388. a potent chemotactic, priming, and activation stimulus in neutro- 17. Bochner, B. S., F. W. Luscinskas, M. A. Gimbrone, Jr., W. Newman, phils (60), suggesting that increased IL-8 release by pulmonary S. A. Sterbinsky, C. P. Derse-Anthony, D. Klunk, and R. P. Schleimer. 1991. Adhesion of human basophils, eosinophils, and neutrophils to interleukin 1-ac- artery endothelial cells may recruit additional inflammatory cells tivated human vascular endothelial cells: contributions of endothelial cell adhe- and therefore amplify inflammation. This is supported by reports sion molecules. J. Exp. Med. 173: 1553–1557. 18. Krishnaswamy, G., J. Kelley, L. Yerra, J. K. Smith, and D. S. Chi. 1999. Human showing that when neutrophils and eosinophils are coincubated http://www.jimmunol.org/ endothelium as a source of multifunctional cytokines: molecular regulation and with IL-8, there is enhanced eosinophil migration across Matrigel- possible role in human disease. J. Interferon Cytokine Res. 19: 91–104. coated Transwell inserts (22). It is also interesting to speculate 19. Haslett, C., L. A. Guthrie, M. M. Kopaniak, R. B. Johnston, Jr., and whether recognized microvascular abnormalities detected in P. M. Henson. 1985. Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccharide. Am. J. Pathol. asthma and other pulmonary disorders (61) may further modulate 119: 101–110. the local production of eosinophil-active chemokines from endo- 20. Cowburn, A. S., K. Cadwallader, B. Reed, N. Farahi, and E. R. Chilvers. 2002. Role of PI3-kinase dependent BAD phosphorylation and altered transcription in thelial cells. cytokine-mediated neutrophil survival. Blood 100: 2607–2616. These observations suggest that HPAECs have a previously un- 21. Morrell, N. W., P. D. Upton, S. Kotecha, A. Huntley, M. H. Yacoub, J. M. Polak, recognized capacity to elaborate and secrete CCR3 chemokines, in and J. Wharton. 1999. Angiotensin II activates MAPK and stimulates growth of

human pulmonary artery smooth muscle via AT1 receptors. Am. J. Physiol. 277: by guest on September 29, 2021 particular CCL11, and for this agent to operate as a survival agent L440–L448. in human eosinophils. This extends the previously recognized rep- 22. Kikuchi, I., S. Kikuchi, T. Kobayashi, K. Hagiwara, Y. Sakamoto, M. Kanazawa, ertoire of actions for CCL11 (eotaxin-1) and suggests a mechanism and M. Nagata. 2006. Eosinophil trans-basement membrane migration induced by interleukin-8 and neutrophils. Am. J. Respir. Cell Mol. Biol. 34: 760–765. for the aberrant survival of eosinophils in airway allergic 23. Qu, J., A. M. Condliffe, M. Lawson, R. J. Plevin, R. A. Riemersma, inflammation. G. R. Barclay, D. B. McClelland, and E. R. Chilvers. 1995. Lack of effect of recombinant platelet-derived growth factor on human neutrophil function. J. Im- munol. 154: 4133–4141. Acknowledgments 24. Kitchen, E., A. G. Rossi, A. M. Condliffe, C. Haslett, and E. R. Chilvers. 1996. We thank Drs. P. Jose, D. Sexton, and A. Alcami for helpful discussions. Demonstration of reversible priming of human neutrophils using platelet-activating factor. Blood 88: 4330–4337. 25. Yamaguchi, Y., T. Suda, S. Ohta, K. Tominaga, Y. Miura, and T. Kasahara. 1991. Disclosures Analysis of the survival of mature human eosinophils: interleukin-5 prevents The authors have no financial conflict of interest. apoptosis in mature human eosinophils. Blood 78: 2542–2547. 26. Krishnaswamy, G., J. K. Smith, R. Mukkamala, K. Hall, W. Joyner, L. Yerra, and D. S. Chi. 1998. Multifunctional cytokine expression by human coronary endo- References thelium and regulation by monokines and glucocorticoids. Microvasc. Res. 55: 1. Bousquet, J., P. Chane, J. Y. Lacoste, G. Barneon, N. Ghavanian, I. Enander, 189–200. P. Venge, S. Ahlstedt, J. Simony-Lafontaine, and P. Godard. 1990. Eosinophilic 27. Levi-Schaffer, F., P. Lacy, N. J. Severs, T. M. Newman, J. North, B. Gomperts, inflammation in asthma. N. Engl. J. Med. 323: 1033–1039. A. B. Kay, and R. Moqbel. 1995. Association of granulocyte-macrophage colony- 2. Woolley, K. L., P. G. Gibson, K. Carty, A. J. Wilson, S. H. Twaddell, and stimulating factor with the crystalloid granules of human eosinophils. Blood 85: M. J. Woolley. 1996. Eosinophil apoptosis and the resolution of airway inflam- 2579–2586. mation in asthma. Am. J. Respir. Crit. Care Med. 54: 237–243. 28. Tai, P. C., L. Sun, and C. J. Spry. 1991. Effects of IL-5, granulocyte/macrophage 3. Kankaanranta, H., M. A. Lindsay, M. A. Giembycz, X. Zhang, E. Moilanen, and colony-stimulating factor (GM-CSF) and IL-3 on the survival of human blood P. J. Barnes. 2000. Delayed eosinophil apoptosis in asthma. J. Allergy Clin. eosinophils in vitro. Clin. Exp. Immunol. 85: 312–316. Immunol. 106: 77–83. 29. Matsumoto, R., M. Hirashima, H. Kita, and G. J. Gleich. 2002. Biological ac- 4. Gleich, G. J. 2000. Mechanisms of eosinophil-associated inflammation. tivities of ecalectin: a novel eosinophil-activating factor. J. Immunol. 168: J. Allergy Clin. Immunol. 105: 651–663. 1961–1967. 5. Collins, P. D., S. Marleau, D. A. Griffiths-Johnson, P. J. Jose, and T. J. Williams. 30. Okada, S., J. B. Hagan, M. Kato, J. L. Bankers-Fulbright, L. W. Hunt, 1995. Cooperation between interleukin-5 and the chemokine eotaxin to induce G. J. Gleich, and H. Kita. 1998. Lidocaine and its analogues inhibit IL-5-medi- eosinophil accumulation in vivo. J. Exp. Med. 182: 1169–1174. ated survival and activation of human eosinophils. J. Immunol. 160: 4010–4017. 6. Clutterbuck, E. J., E. M. Hirst, and C. J. Sanderson. 1989. Human interleukin-5 31. Parry, C. M., J. P. Simas, V. P. Smith, C. A. Stewart, A. C. Minson, S. Efstathiou, (IL-5) regulates the production of eosinophils in human bone marrow cultures: and A. Alcami. 2000. A broad spectrum secreted chemokine binding protein comparison and interaction with IL-1, IL-3, IL-6 and GM-CSF. Blood 73: encoded by a herpesvirus. J. Exp. Med. 191: 573–578. 1504–1512. 32. Petering, H., O. Gotze, D. Kimmig, R. Smolarski, A. Kapp, and J. Elsner. 1999. 7. Palframan, R. T., P. D. Collins, T. J. Williams, and S. M. Rankin. 1998. Eotaxin The biological role of interleukin-8: functional analysis and expression of induces a rapid release of eosinophils and their progenitors from the bone mar- CXCR1 and CXCR2 on human eosinophils. Blood 93: 694–702. row. Blood 91: 2240–2248. 33. Fryer, A. D., L. H. Stein, Z. Nie, D. E. Curtis, C. M. Evans, S. T. Hodgson, 8. Buckley, C. D., E. A. Ross, H. M. McGettrick, C. E. Osbourne, O. Haworth, P. J. Jose, K. E. Belmonte, E. Fitch, and D. B. Jacoby. 2006. Neuronal eotaxin C. Schmutz, P. C. Stone, M. Salmon, N. M. Matharu, R. K. Vohra, et al. 2006. and the effects of CCR3 antagonist on airway hyperreactivity and M2 receptor Identification of a phenotypically and functionally distinct population of long- dysfunction. J. Clin. Invest. 116: 228–236. The Journal of Immunology 1273

34. Saraiva, M., and A. Alcami. 2001. CrmE, a novel soluble tumor necrosis factor 48. Wedi, B., U. Raap, U. Lewrick, and A. Kapp. 1998. IL-4-induced apoptosis in receptor encoded by poxviruses. J. Virol. 75: 226–233. peripheral blood eosinophils. J. Allergy Clin. Immunol. 102: 1013–1020. 35. Iversen, P. O., D. Robinson, S. Ying, Q. Meng, A. B. Kay, I. Clark-Lewis, and 49. Shinagawa, K., A. Trifilieff, and G. P. Anderson. 2003. Involvement of CCR3- A. F. Lopez. 1997. The GM-CSF analogue E21R induces apoptosis of normal and reactive chemokines in eosinophil survival. Int. Arch. Allergy Immunol. 130: activated eosinophils. Am. J. Respir. Crit. Care Med. 156: 1628–1632. 150–157. 36. Uller, L., M. Anderson, L. Grieff, C. G. A. Persson, and J. S. Erjefalt. 2004. 50. Conroy, D. M., and T. J. Williams. Eotaxin and the attraction of eosinophils to the Occurrence of apoptosis, secondary necrosis, and cytolysis in eosinophilic nasal asthmatic lung. 2001. Respir. Res. 2: 150–156. polyps. Am. J. Respir. Crit. Care Med. 170: 742–747. 51. Jose, P. J., D. A. Griffiths-Johnson, P. D. Collins, D. T. Walsh, R. Moqbel, 37. Erjefalt, J. S., L. Uller, M. Malm-Erjefalt, and C. G. Persson. 2004. Rapid and N. F. Totty, O. Truong, J. J. Hsuan, and T. J. Williams. 1994. Eotaxin: a potent efficient clearance of airway tissue granulocytes through transepithelial migra- chemoattractant cytokine detected in a guinea pig model of allergic airways in- tion. Thorax 59: 136–143. flammation. J. Exp. Med. 179: 881–887. 38. Her, E., J. Frazer, K. F. Austin, and W. F. Owen, Jr. 1991. Eosinophil haema- 52. Menzies-Gow, A., S. Ying, I. Sabroe, V. L. Stubbs, D. Soler, T. J. Williams, and topoietins antagonize the programmed cell death of eosinophils: cytokine and A. B. Kay. 2002. Eotaxin (CCL11) and eotaxin-2 (CCL24) induce recruitment of glucocorticoid effects on eosinophils maintained by endothelial cell-conditioned eosinophils, basophils, neutrophils and macrophages as well as features of early- medium. J. Clin. Invest. 88: 1982–1987. and late-phase allergic reactions following cutaneous injection in human atopic 39. Luttmann, W., B. Knoechel, M. Foerster, H. Matthys, J. C. Virchow, Jr., and and nonatopic volunteers. J. Immunol. 169: 2712–2718. C. Kroegel. 1996. Activation of human eosinophils by IL-13: induction of CD69 53. Joubert, P., S. Lajoie-Kadoch, I. Labonte, A. S. Gounni, K. Maghni, surface antigen, its relationship to messenger RNA expression, and promotion of V. Wellemans, J. Chakir, M. Laviolette, Q. Hamid, and B. Lamkhioued. 2005. cellular viability. J. Immunol. 157: 1678–1683. CCR3 expression and function in asthmatic airway smooth muscle cells. J. Im- munol. 175: 2702–2708. 40. Hoontrakoon, R., H. W. Chu, S. J. Gardai, S. E. Wenzel, P. McDonald, 54. Dent, G., C. Hadjicharalambous, T. Yoshikawa, R. L. Handy, J. Powell, V. A. Fadok, P. M. Henson, and D. L. Bratton. 2002. Interleukin-15 inhibits I. K. Anderson, R. Louis, D. E. Davies, and R. Djukanovic. 2004. Contribution spontaneous apoptosis in human eosinophils via autocrine production of granu- of eotaxin-1 to eosinophil chemotactic activity of moderate and severe asthmatic locyte-colony stimulating factor and nuclear factor-␬B activation. Am. J. Respir. sputum. Am. J. Respir. Crit. Care Med. 169: 1110–1117. Crit. Care Med. 26: 404–412. 55. Ghaffar, O., Q. Hamid, P. M. Renzi, Z. Allakhverdi, S. Molet, J. C. Hogg,

41. Lee, E., T. Robertson, J. Smith, and S. Kilfeather. 2000. Leukotriene receptor Downloaded from S. A. Shore, A. D. Luster, and B. Lamkhioued. 1999. Constitutive and cytokine- antagonists and synthesis inhibitors reverse survival in eosinophils of asthmatic stimulated expression of eotaxin by human airway smooth muscle cells. individuals. Am. J. Respir. Crit. Care Med. 161: 1881–1886. Am. J. Respir. Crit. Care Med. 159: 1933–1942. 42. Alam, R., K. Pazdrak, S. Stafford, and P. Forsythe. 1995. The interleukin-5/ 56. Hoeck, J., and M. Woisetschlager. 2001. STAT6 mediates eotaxin-1 expression receptor interaction activates Lyn and Jak2 tyrosine kinases and propagates sig- in IL-4 or TNF-␣-induced ﬁbroblasts. J. Immunol. 166: 4507–4515. nals via the Ras-Raf-1-MAP kinase and the Jak-STAT pathways in eosinophils. 57. Ying, S., D. S. Robinson, Q. Meng, J. Rottman, R. Kennedy, D. J. Ringler, Int. Arch. Allergy Immunol. 107: 226–227. C. R. Mackay, B. L. Daugherty, M. S. Springer, S. R. Durham, et al. 1997. 43. Fujihara, S., C. Ward, I. Dransﬁeld, R. T. Hay, I. J. Uings, B. Hayes, Enhanced expression of eotaxin and CCR3 mRNA and protein in atopic asthma: S. N. Farrow, C. Haslett, and A. G. Rossi. 2002. Inhibition of nuclear factor-␬B association with airway hyperresponsiveness and predominant co-localization of http://www.jimmunol.org/ ␣ activation un-masks the ability of TNF- to induce human eosinophil apoptosis. eotaxin mRNA to bronchial epithelial and endothelial cells. Eur. J. Immunol. 27: Eur. J. Immunol. 32: 457–466. 3507–3516. 44. Pazdrak, K., B. Olszewska-Pazdrak, S. Stafford, R. P. Garofalo, and R. Alam. 58. Chan, V. J., J. K. Burgess, J. C. Ratoff, B. J. O’Connor, A. Greenough, T. H. Lee, 1998. Lyn, Jak2, and Raf-1 kinases are critical for the antiapoptotic effect of and S. J. Hirst. 2006. Extracellular matrix regulates enhanced cotaxin expression interleukin 5, whereas only Raf-1 kinase is essential for eosinophil activation and in asthmatic airway smooth muscle cells. Am. J. Respir. Crit. Care Med. 174: degranulation. J. Exp. Med. 188: 421–429. 379–385. 45. Farahi, N., A. S. Cowburn, A. G. Rossi, and E. R. Chilvers. 2004. Eating their 59. Morales, J., B. Homey, A. P. Vicari, S. Hudak, E. Oldham, J. Hedrick, R. Orozco, way out of trouble: selective uptake of apoptotic eosinophils by bronchial epi- N. G. Copeland, N. A. Jenkins, L. M. McEvoy and A. Zlotnik. 1999. CTACK, a thelial cells. Clin. Exp. Allergy 34: 1503–1506. skin-associated chemokine that preferentially attracts skin-homing memory T 46. Leckie, M. J., A. ten Brinke, J. Khan, Z. Diamant, B. J. O’Connor, C. M. Walls, cells. Proc. Natl. Acad. Sci. USA 96: 14470–14475. A. K. Mathur, H. C. Cowley, K. F. Chung, R. Djukanovic, et al. 2000. Effects of 60. Teran, L. M., M. P. Carroll, A. J. Frew, A. E. Redington, D. E. Davies, I. Lindley,

an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyper- P. H. Howarth, M. K. Church, and S. T. Holgate. 1996. Leukocyte recruitment by guest on September 29, 2021 responsiveness, and the late asthmatic response. Lancet 356: 2144–2148. after local endobronchial allergen challenge in asthma: relationship to procedure 47. Bryan, S. A., B. J. O’Connor, S. Matti, M. J. Leckie, V. Kanabar, J. Khan, and to airway interleukin-8 release. Am. J. Respir. Crit. Care Med. 154: S. J. Warrington, L. Renzetti, A. Rames, J. A. Bock, et al. 2000. Effects of 469–476. recombinant human interleukin-12 on eosinophils, airway hyper-responsiveness, 61. McDonald, D. M. 2001. Angiogenesis and remodelling of airway vasculature in and the late asthmatic response. Lancet 356: 2114–2116. chronic inﬂammation. Am. J. Respir. Crit. Care Med. 164: S39–S45.