Inhibition of Oligodendrocyte by Sublytic C5b-9 Is Associated with Enhanced Synthesis of Bcl-2 and Mediated by Inhibition of -3 Activation This information is current as of September 25, 2021. Lucian Soane, Horea Rus, Florin Niculescu and Moon L. Shin J Immunol 1999; 163:6132-6138; ; http://www.jimmunol.org/content/163/11/6132 Downloaded from

References This article cites 65 articles, 33 of which you can access for free at: http://www.jimmunol.org/content/163/11/6132.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Inhibition of Oligodendrocyte Apoptosis by Sublytic C5b-9 Is Associated with Enhanced Synthesis of Bcl-2 and Mediated by Inhibition of Caspase-3 Activation1

Lucian Soane, Horea Rus, Florin Niculescu, and Moon L. Shin2

We have previously shown that generation of sublytic C5b-9, the membrane attack complex of complement, induces oligoden- drocytes to enter cell cycle and reduces apoptotic cell death in vitro. In the present study, the cellular factors involved in apoptosis of oligodendrocyte progenitor cells and oligodendrocytes, and the inhibitory effect of C5b-9 on apoptotic process were investigated. Oligodendrocyte progenitor cells identified by mAb A2B5 that were isolated from neonatal rat brains were differentiated into oligodendrocytes in serum-free defined medium. The differentiation, which occurs simultaneously with apoptotic cell death, was associated with a rapid loss of bcl-2 mRNA and increased expression of caspase-3 mRNA. Activation of caspase-3 in differentiating Downloaded from cells was demonstrated by the generation of 17- and 12-kDa fragments of caspase-3 proenzyme and by cleavage of poly(ADP- ribose) polymerase, a specific caspase-3 substrate. Cell death associated with differentiation was inhibited by the caspase-3 in- hibitor DEVD-CHO in a dose-dependent manner. Assembly of sublytic C5b-9 resulted in inhibition of caspase-3 activation. In addition, synthesis of BCL-2 in oligodendrocytes was significantly increased by C5b-9. The TNF-␣-induced apoptosis of oligodendrocytes was also inhibited by C5b-9. These results indicate that up-regulation of BCL-2 protein and inhibition of

caspase-3 activation are potential mechanisms by which C5b-9 increases survival of oligodendrocyte in vitro and possibly in vivo http://www.jimmunol.org/ during inflammation and immune-mediated demyelination affecting the CNS. The Journal of Immunology, 1999, 163: 6132–6138.

emyelination in multiple sclerosis (MS)3 and its animal cycle activation by C5b-9 also occurs through release of fibroblast model experimental allergic encephalitis (EAE) is growth factor (FGF) and platelet-derived growth factor (PDGF) (6, D caused by damage to myelin and myelin-producing ol- 7). Increase in cytosolic Ca2ϩ and protein kinase C activation are igodendrocyte (OLG) by activated immune effectors. These effec- responsible for some of the TCC activities, such as platelet acti- tors include macrophages, T cells, proinflammatory cytokines vation and generation of arachidonic acid and metabolites, and are TNF-␣ and monocyte chemoattractant protein-1, and C5b-9 com- elicited by the pore-forming C5b-8 and C5b-9 complexes (4, 5, plexes generated during complement activation (1–3). Sequential 11–14). Additionally, membrane-inserted TCC, including C5b-7, by guest on September 25, 2021 interaction of C5b6, C7, C8, and C9 is associated with amphipathic are able to generate diacylglycerol and stimulate the Ras/Raf-1/ conformational changes of C7, C8␣,C8␤, and C9, resulting in ERK1 pathway via G␤␥ effectors of the G protein (10, 15, 16). assembly of membrane-inserted C5b-7, C5b-8, and C5b-9 com- However, C5b-9 is most effective in inducing DNA synthesis and plexes, collectively referred to as the terminal complement com- cell cycle, in a Gi-ERK1-dependent manner (9, 10, 15, 16). plexes (TCC) (4). Sublytic C5b-9 stimulates target cells and in- OLG that myelinate the central nerve axons differentiate from duces a variety of cellular activities in the absence of cell death (4, the O-2A progenitors, and this process requires axonal contact and 5). One of the activities induced by C5b-9 is cell cycle induction soluble growth factors (17–20). Survival of differentiated OLG (6–9), which is mediated by Gi-dependent activation of Ras, also requires factors such as PDGF and basic FGF (17–19). In Raf-1, and ERK1, and associated with expression of protoonco- developing rat optic nerve, more than 50% of newly differentiated c-fos and c-jun, and increased DNA synthesis (8–10). Cell OLG undergo apoptotic death, which is an essential process for brain tissue modeling during development (17). In serum-free me- dium, O-2A cells differentiate into OLG concomitantly with apo- Department of Pathology, University of Maryland, School of Medicine, Baltimore, MD 21201 ptosis, as in vivo. Apoptosis in vitro is also inhibited by PDGF, Received for publication June 15, 1999. Accepted for publication September 8, 1999. insulin-like growth factor, ciliary neurotrophic factor, and leuke- The costs of publication of this article were defrayed in part by the payment of page mia-inhibitory factor (18–22). charges. This article must therefore be hereby marked advertisement in accordance A critical role of complement in EAE is supported by experi- with 18 U.S.C. Section 1734 solely to indicate this fact. ments in which abrogation of systemic complement activity by 1 This work was supported by National Institutes of Health Grants NS36231 and cobra venom factor or by soluble CR1 inhibited demyelination NS15662. induced by encephalitogenic Ag or Ag-specific T cells (23, 24). 2 Address correspondence and reprint requests to Dr. Moon L. Shin, University of Deposition of C5b-9 in MS and EAE brains and increased levels of Maryland School of Medicine, Department of Pathology, 10 South Pine Street, MSTF 600-E, Baltimore, MD 21201. E-mail address: [email protected] soluble C5b-9 in MS spinal fluids indicated in situ activation and 3 Abbreviations used in this paper: MS, multiple sclerosis; C7D, normal human serum assembly of C5b-9 (25–27). The central nerve myelin, but not the immunochemically depleted of C7; DEVD-CHO, Asp-Glu-Val-Asp-Cho; EAE, ex- peripheral nerve myelin, directly activates the classical pathway of perimental allergic encephalomyelitis; ERK, extracellular signal-related kinase; FGF, complement (28, 29). Activation and assembly of C5b-9 on myelin fibroblast growth factor; GC, galactocerebroside; MBP, myelin basic protein; MTS, methyl tetrazolium salt; NHS, normal human serum; O-2A, OLG progenitor cells cause hydrolysis of myelin basic protein (MBP) and extensive identified by mAb A2B5; OLG, oligodendrocyte; PARP, poly(ADP-ribose) polymer- vesiculation with eventual loss of myelin membrane (30, 31). In ase; PDGF, platelet-derived growth factor; PI-3, phosphatidylinositol-3; PLP, prote- olipid protein; RT, room temperature; TCC, terminal complement complexes repre- addition, the complement-inhibitory CD55 and CD46 are senting C5b-7, C5b-8, and C5b-9. absent in myelin, causing the myelin membrane to be susceptible

Copyright © 1999 by The American Association of Immunologists 0022-1767/99/$02.00 The Journal of Immunology 6133 to C5b-9 (32). Therefore, C5b-9 can contribute to demyelination using an excess of NHS (8, 34). To evaluate the effect of serum C5b-9, by directly damaging the myelin, even in the absence of myelin- OLG sensitized with a dose of anti-GC Ab for 30 min at RT were incubated specific Abs. In OLG, C5b-9 at a sublytic concentration induces with a 1/20 dilution of NHS depleted of C7 (C7D) reconstituted with C7 (10 ␮g/ml). Alternatively, sensitized cells were treated with NHS (1/10) cell cycle, as shown by activation of ERK1 and c-Jun N-terminal and NHS treated with K76 (Otsuka Pharmaceutical, New York, NY) kinase 1, protooncogenes, and G1 progression to S phase (8, 33). (NHS-K76) as a control (8, 34). K76 prevents C5b-9 assembly in serum by Sublytic C5b-9 also induces phenotype changes in OLG by accel- binding to C5 (36). Therefore, C7D and NHS-K76 allow complement ac- erating the decay of mRNA encoding myelin-specific genes (8, tivation to proceed up to C6 and C3, respectively. Purified human com- plement proteins C5-C9 were purchased from Quidel (San Diego, CA), and 34). While activating cell cycle, C5b-9 was also found to inhibit C5b6 complex was prepared from C5 and C6, as described (37). To as- apoptosis of OLG associated with differentiation (8). semble sublytic C5b-9 by using purified proteins, cells were incubated with In this study, we have examined the differentiation-associated C5b6 (30 ␮g) for 15 min, then with C7 (10 ␮g) for 5 min at RT, followed apoptosis of OLG in vitro by investigating involvements of by addition of C8 (10 ␮g) and C9 (10 ␮g) in a final volume of 1 ml (8, 10). caspase-3 and Bcl-2 as possible target sites regulated by C5b-9. Cells were then incubated at 37°C for the indicated time periods. We also tested the ability of C5b-9 to protect OLG from TNF-␣- Northern blot analysis induced apoptosis. RNA was isolated from cells lysed with buffer containing guanidine iso- thiocyanate and 2-ME, and total RNA was purified by ultracentrifugation Materials and Methods ϩ on 5.7 M CsCl (as described in Ref. 38). Poly(A) RNA was prepared from Differentiation of OLG from O-2A progenitor cells in culture total RNA using Dynabead mRNA purification system (Dynal, Great Neck, ϩ Primary O-2A progenitor cells were prepared according to Saneto and de NY). Poly(A) RNA was denatured and electrophoresed on 0.8% agarose- formaldehyde gels, then transferred to a nitrocellulose membrane. After Downloaded from Vellis (35). Glial cells were isolated from neonatal Sprague Dawley rat 32 brains, as described in detail (35, 34). Dispersed glia cells are grown for 10 baking for2hat80°C, the membrane was hybridized with P-labeled days as stratified mixed glial cultures. O-2A progenitors growing on sur- cDNA probes. The probe binding was quantitated by measuring band den- face of the mixed culture were isolated by a series of differential shaking. sities of autoradiogram using Computing Densitometer (Molecular Dy- Cells were placed in OLG defined medium consisting of serum-free namics, Sunnyvalle, CA). Integrated volume of each band was calculated DMEM/Ham’s F-12 containing 500 ng/ml transferrin (Sigma, St. Louis, using the ImageQuant software (Molecular Dynamics), and the results are MO), 75 ng/ml insulin (Sigma), 75 ␮g/ml basic FGF (Collaborative Re- expressed by density ratio to actin. Caspase-3 cDNA probe was obtained by RT-PCR cloning of rat caspase-3 cDNA with the forward (5Ј-GC search, Lexington, MA), and 1 mM sodium pyruvate. O-2A cells isolated http://www.jimmunol.org/ Ј by serial shaking at the time of plating showed 2–3% cell death, as deter- GAAGCTTAAGTGACCATGGACAACCAAC) and reverse (5 -GCGTCTA mined by trypan blue dye exclusion. Differentiation was stepwise, as GACCCAGTCATTCCTTTAGTGA) primers designed according to rat shown by the expression of MBP and proteolipid protein (PLP) mRNA CPP32 cDNA (39). The rat bcl-2 and bax cDNA were gifts from Dr. E. Podack before the expression of galactocerebroside (GC) (17, 35). After 56 h in (University of Miami) and Dr. S. Korsmeyer (Washington University, ␣ 32 OLG defined medium, more than 85% of cells expressed GC, MBP, and St. Louis, MO), respectively. The cDNA was labeled with [ - P]dCTP PLP. Less than 5% of the MBP-negative cells were astrocytes and micro- (New England Nuclear, Boston, MA) using reagents for DNA labeling from glia, and the remaining cells were O-2A cells in different stages of differ- Pharmacia (Piscataway, NJ). entiation. O-2A cells grown in a defined medium for 3 days are designated as OLG. Western blot analysis of caspase-3, PARP protein, and BCL-2

Determination of cell viability The levels of caspase-3, PARP, and their cleavage products were deter- by guest on September 25, 2021 mined by Western and immunoblot. Cells were lysed with RIPA buffer (30 Viability of O-2A cells during differentiation and the effect of C5b-9 on cell mM Tris-HCl, pH 7.4, 0.15 M NaCl (NaCl), 1% Nonidet P-40, 0.1% SDS, viability were determined by using CellTiter 96 Aqueous cell proliferation 0.5% sodium deoxycholate, 1 mM EDTA, 1 mM DTT, 2 mM MgCl2, 1 assay, according to the instruction supplied by Promega (Madison, WI). mM NaVO4, 0.5 mM PMSF, 100 ␮g/ml aprotinin, and leupeptin), as de- 5 Cells were seeded on poly(D-lysine)-coated 96-well plates at 10 cells/well scribed (16). An equal amount of protein from each cell lysate was used in 200 ␮l of OLG defined medium and cultured at 37°C. At the indicated directly for SDS-PAGE and Western blot, a method sufficient to detect time points, 40 ␮l methyl tetrazolium salt (MTS) solution was added to caspase-3 proenzyme and high levels of the cleavage fragment. To detect each well. Plates were kept at 37°C for additional 2 h, followed by deter- the cleavage fragments, cell lysates (100 ␮g protein) were immunoprecipi- mination of OD at 540 nm under a condition in which absorbance was in tated with rabbit anti-caspase-3 IgG (Santa Cruz Biotechnology, Santa linear range. The results are expressed as percentage of dead cells Ϯ SD, Cruz, CA) in the presence of protein A/G agarose at 4°C overnight. Cell relative to the initial cell number. lysates or immunoprecipitates were analyzed on 10% SDS-PAGE, then by Western blotting using the same rabbit anti-caspase-3 IgG. For PARP, Analysis of apoptosis immunoprecipitates using polyclonal anti-PARP IgG (Boehringer Mann- DNA strand break was detected in cells by TdT-dependent incorporation of heim, Indianapolis, IN) were analyzed by 7% SDS-PAGE, and monoclonal dUTP (Apoptag, Oncor, Gaithersburg, MD). O-2A cells were cultured on anti-PARP IgG1 (Zymed, San Francisco, CA) was used for immunoblot- plastic slide chambers for the indicated time period. Cells were fixed in ting. This was followed by reaction with peroxidase-conjugated goat anti- buffered Formalin at room temperature (RT), then treated with TdT in the rabbit or anti-mouse IgG (Santa Cruz Biotechnology), then by enhanced presence of digoxigenin-dUTP for1hat37°C. After washing, cells were chemiluminescence (ECL; Pierce, Rockford, IL). BCL-2 protein was de- Ј termined similarly by immunoprecipitation of cell lysates. The BCL-2 treated with peroxidase-conjugated anti-digoxigenin IgG F(ab )2 fragments for 1 h; then color was developed using diaminobenzidine as a substrate. Western blot reagents were from Oncogene (Cambridge, MA). Approximately 600 cells with clearly defined nucleus were examined in each sample by TUNEL staining. The number of cells showing apoptosis Effects of caspase-3 inhibitor on OLG viability was counted by identifying TUNEL-positive nuclei. The percentage of apoptotic cells was then calculated using the following formula: (number To test whether caspase-3 activity is required for differentiation-induced of cells with TUNEL-positive nuclei/total number of cells examined) ϫ apoptosis, the cell-permeable caspase-3 inhibitor DEVD-CHO (Calbio- chem, San Diego, CA) was used. O-2A cells were seeded in 96-well plates 100. Results are expressed as mean percentage of cells with TUNEL-pos- 5 ␮ itive nuclei Ϯ SD. at 10 cells/well in 200 l of OLG defined medium and cultured for 24 h. Cells were further incubated for 48 h in the presence of 10–100 ␮Mof Activation of serum complement and C5b-9 assembly DEVD-CHO. Cell viability was then determined, as described earlier. Normal human serum (NHS) pooled from several healthy donors was used Effect of C5b-9 on OLG apoptosis induced by TNF-␣. as a source of serum complement. Rabbit antiserum to GC was used to sensitize rat OLG. The specific anti-GC activity was assayed by treating To test whether sublytic C5b-9 also protects OLG from apoptotic cell death GC-expressing liposomes with trapped 86Rb aqueous marker with anti- induced by TNF-␣ (21, 22, 40), O-2A cells were differentiated in 96-well serum, then measuring the released marker (31). Because anti-GC Abs are plates, then cells were exposed to sublytic NHS or NHS-K76 for 1 h. After mostly IgM isotype, IgM fraction of the antisera was used in most exper- addition of 100 ng/ml of human rTNF-␣ (R&D Systems, Minneapolis, iments. A sublytic dose of Ab was predetermined by titrating anti-GC Ab MN), cells were incubated for 18 h at 37°C, and viability was determined. 6134 ANTI-APOPTOTIC ACTIVITY OF C5b-9

FIGURE 1. O-2A progenitor cells undergo cell death by apoptosis in serum-free defined medium. A, O-2A cells were placed in 96-well plates at 105 cells/well in 200 ␮l of OLG defined medium to allow differentiation. Cell viability was assessed by a method using MTS, as described in Ma- terials and Methods. Background cell death at the time of plating was 2–3%. The percentage of cell death was expressed relative to the initial viable cell number, and the results are shown as mean Ϯ SD of three experiments performed in triplicate. B, O-2A cells were differentiated in

chamber slides as above. Apoptosis was determined by TUNEL method, as Downloaded from described in Materials and Methods. Approximately 600 cells with clearly defined nucleus were examined in each sample, and apoptotic cells were identified by the presence of TUNEL-positive nuclei. Results are expressed as mean percentage of cells with TUNEL-positive nuclei relative to the total number of cells examined Ϯ SD. Data were derived from two separate experiments performed in triplicate. http://www.jimmunol.org/

Results FIGURE 2. Expression of caspase-3 and bcl-2 and bax mRNA during Apoptotic cell death of O-2A progenitor cells during in vitro OLG differentiation. O-2A cells cultured in OLG defined medium for the indicated time periods were examined by Northern blot for mRNA encod- differentiation ϩ ing caspase-3 and PLP (A), and for bcl-2 and bax (B) using 1 ␮g poly(A) Differentiation of OLG is associated with cell death in developing RNA/lane. The data shown represent one of two identical experiments. The brains and during in vitro differentiation (17–19). As shown in Fig. results are also expressed by density ratios to ␤-actin (C). 1A, cell death reached 36% at 48 h, and was increased further to

70% at 96 h. Many of these cells showed the characteristic features by guest on September 25, 2021 of apoptosis, including cell process retraction, chromatin conden- sation, and DNA cleavage with ladder formation (data not shown). To determine whether caspase-3 activation is required for cell By TUNEL stain, 31.3 Ϯ 6.5% of cells were apoptotic after 48 h death, O-2A cells in medium for 24 h were cultured for additional in OLG defined medium (Fig. 1B). 48 h with the cell-permeable caspase-3 inhibitor DEVD-CHO. Cell death was inhibited in a dose-dependent manner, with 50% pro- Bcl-2, Bax, and caspase-3 expression during OLG differentiation tection at 25 ␮M and 100% at 100 ␮M of DEVD-CHO (Fig. 4). The expression of caspase-3, bcl-2, and bax during OLG differ- DMSO at concentrations used to resuspend DEVD-CHO was not entiation was examined. Northern blot analysis of poly(A)ϩ RNA toxic to the cell. showed a gradual increase in caspase-3 mRNA expression and a rapid decline of bcl-2 mRNA as early as 2 h (Fig. 2A–C). The Inhibition of caspase-3 activation by C5b-9 changes in bcl-2 and caspase-3 mRNA level are associated with To evaluate the antiapoptotic activity of C5b-9 previously shown differentiation, as shown by the robust expression of PLP mRNA (8), OLG exposed to serum C5b-9 were examined for caspase-3 (Fig. 2A). The bax mRNA expression was reduced by 30% at 6 h, cleavage. As shown in Fig. 5A, a prominent 17-kDa cleavage prod- as shown by density ratios to actin, obtained by quantitative den- uct was seen in control cells treated with C7D for 18 h, which was sitometry (Fig. 2C). The bax mRNA level after 3 days in differ- inhibited by addition of C7 to C7D. Because the data were ob- entiation medium, determined in a separate experiment, was sim- tained by direct analysis of the cell lysates by SDS-PAGE/Western ilar to the initial level (data not shown). Western blot analysis of blotting, presence of the cleavage fragment in unstimulated cells cell lysates showed an increase in 32-kDa caspase-3 proenzyme was not detected. When cell lysates were immunoprecipitated first, after 24 h (1 day) (Fig. 3, A and B), which correlated with in- then examined by Western/immunoblot (Fig. 5B), the caspase-3 creased expression of caspase-3 mRNA. The caspase-3 proenzyme cleavage fragment increased with time in cells exposed to began to decrease on day 3, as shown by the density ratio to ␤-ac- NHS-K76. This increase was inhibited when C5b-9 assembly was tin on the same blot. Because caspase-3 activity requires the proen- allowed in NHS, in contrast to NHS-K76. To exclude a possibility zyme cleavage to active subunits (41), the appearance of 17- and that C5b-9 may have enhanced the serum effect on caspase-3, iden- 12-kDa subunits was evaluated by anti-caspase-3 immunoprecipi- tical experiments were performed by treating cells with C5b-9 as- tation, followed by Western blot. The appearance of anti-caspase- sembled using purified proteins (Fig. 5C). A cleavage fragment of 3-reactive 17- and 12-kDa bands was identified on day 3 (Fig. 3C). caspase-3 was detected in unstimulated OLG. This 17-kDa band Decreased caspase-3 proenzyme with increased cleavage products increased with time in control cells exposed to C5b6, C8, and C9 on day 3 (Fig. 3C) is clearly evident in experiments when cell without C7. However, the cleavage product was barely detected in lysates were immunoprecipitated, then examined by Western cells exposed to C5b-9. We have also examined the effect of C5b-9 blotting. on cleavage of PARP, a specific substrate for caspase-3 (41, 42). The Journal of Immunology 6135 Downloaded from http://www.jimmunol.org/

FIGURE 3. Caspase-3 proenzyme and its activation during OLG dif- ferentiation. A, Cell lysates (50 ␮g protein) of O-2A cells cultured for 1, 3, and 4 days were examined for caspase-3 proenzyme by 10% SDS-PAGE and Western blot. The blot was immunostained with anti-caspase-3 IgG, then with anti-␤-actin, as loading control. B, Densitometric analysis of the radiographic bands is shown as density ratios to ␤-actin. Representative

data from three experiments are shown. C, Caspase-3 activation during by guest on September 25, 2021 OLG differentiation was determined by detection of the 17- and 12-kDa caspase-3 fragments. O-2A cells in culture for 1, 2, and 3 days were lysed, and the lysates, 100 ␮g protein, were immunoprecipitated with rabbit anti- caspase-3 IgG. The immunoprecipitates were then analyzed for the cleav- FIGURE 5. Inhibition of caspase-3 activation in OLG by C5b-9. A, Dif- age products, as in A. ferentiated OLG, 5 ϫ 106 cells/flask, were sensitized with anti-GC Ab, then exposed to C7D Ϯ C7, as described in Materials and Methods.Atthe On Western blotting, the 89-kDa fragment of PARP protein was indicated time points, cell lysates were examined by 10% SDS-PAGE and Western blot. B, Cells were exposed to TCC as above, except that they detected in unstimulated OLG. The PARP cleavage was signifi- were treated with Ab and NHS or NHS-K76 (K76). Cell lysates, 100 ␮g cantly reduced in cells treated with serum C5b-9, compared with protein, were immunoprecipitated with rabbit anti-caspase-3 IgG in the the level of NHS-K76 (Fig. 6). presence of a mixture of protein A- and G-coated agarose. The Ag-Ab complexes were eluted from the beads; then the eluates were examined by 10% SDS-PAGE and Western blotting. Generation of a 17-kDa fragment of caspase-3 was detected as in A using the same anti-caspase-3 IgG. Den- sitometric scan of the band is also shown. C, Similar experiment as in B was conducted by treating cells with purified proteins to assemble C5b-9. Control cells were treated with C5b6, C8, and C9 without C7.

Expression of BCL-2 in OLG exposed to C5b-9 In view of the ability of C5b-9 to inhibit caspase-3 activation, the steps upstream to caspase-3 activation that may be affected by C5b-9 were explored. Caspase-3 can be activated by caspase-9 through mitochondrial pathway or by caspase-8 in death - FIGURE 4. Inhibition of caspase-3 activity prevented cell death asso- dependent pathway (43). We have analyzed the effect of C5b-9 on ciated with differentiation. O-2A cells were cultured for 24 h in 96-well Bcl-2, a potent antiapoptotic factor, which inhibits caspase-3 ac- plates at 105 cells/well in OLG defined medium. Cells were incubated for tivation by regulation of mitochondrial pathway (44). The expres- additional 48 h with 10–100 ␮M of DEVD-CHO. Cell viability was de- termined by a method using MTS, as described in Materials and Methods, sion of bcl-2 mRNA was not affected by C5b-9, as shown in Fig. and the percentage of cell death was assessed at 24 h in culture and also at 7B. However, C5b-9 significantly increased the level of BCL-2 72 h in which cells were incubated with or without the inhibitor for the last protein within 4 h, and to the maximum level at 8 h (Fig. 7A). 48 h. Results are expressed as mean percentage of cell death Ϯ SD of three BCL-2 protein was not detected in unstimulated OLG and in OLG experiments performed in triplicate. treated with control C5b6. 6136 ANTI-APOPTOTIC ACTIVITY OF C5b-9

FIGURE 6. Inhibition of PARP cleavage by C5b-9. OLG treated with Ab and NHS or NHS-K76 for 3 and 6 h were lysed. Cell lysates, 100 ␮g protein, were immunoprecipitated with anti-PARP IgG, as in caspase-3; then the precipitates were analyzed by 7.5% SDS-PAGE and Western blot. A representative data of three experiments is shown.

Protection of TNF-␣-induced cell death by C5b-9 We have examined whether C5b-9 also protects OLG from apo- ptosis induced by other factors. TNF-␣ was tested, since TNF-␣ induces apoptotic cell death in OLG both in vivo and in vitro (21,

22, 45). In our system, 100 ng/ml of TNF-␣ induced 50% cell Downloaded from death after 18 h (Fig. 8A). Pretreatment with NHS, but not with NHS-K76, protected OLG from cell death (Fig. 8A). The cleavage FIGURE 8. Effect of C5b-9 on cell death induced by TNF-␣. A, Anti- product of caspase-3 proenzyme, which was increased by TNF-␣, GC-sensitized OLG were incubated with NHS or NHS-K76 for1hat was abolished in OLG treated with NHS (Fig. 8B). 37°C. Then 100 ng/ml of human rTNF-␣ was added, and cells were incu- bated for 18 h before determining the cell viability. B, An identical exper- iment as in A was performed, except that cell lysates were prepared and the Discussion http://www.jimmunol.org/ protein (100 ␮g) was immunoprecipitated with anti-caspase-3 IgG, then The C5b-9 complex is a pleiotropic effector generated during in- examined for the 17-kDa cleavage fragment. flammation and immune response. When inserted into the target cell membrane, C5b-9, depending on doses, causes cell death or cell activation (4, 5). We have previously shown that at a sublytic Although apoptosis is induced by a variety of stimuli, execution concentration, C5b-9 enhances OLG survival in vitro through in- of the apoptotic program involves a common mechanism, which hibition of apoptosis (8). C5a and C5b-9 have been implicated in relies on the activation of , cysteine proteases belonging to cell injury associated with apoptosis seen in a rat ischemia/reper- the IL-1-converting enzyme/CED-3 family. The role of individual fusion model (46). However, regulation of apoptosis by sublytic caspases and their relative importance in apoptosis have been re- by guest on September 25, 2021 C5b-9 has not been reported. In addition, C5a receptor is not ex- cently clarified (43). Caspase-8 and caspase-10 are activated early pressed by OLG (47). Therefore, the antiapoptotic activity of in apoptotic process and are considered initiators, while caspase-3 C5b-9 may be a new biological function with a potential and caspase-7 activated at a later phase of apoptosis are effectors significance. acting on a large number of substrates. Death receptor-induced pathways of apoptosis require activation of the caspase-8 and caspase-3, whereas apoptosis following growth factor deprivation and stress-induced cell injury appears to be through mitochondrial dysfunction by releasing , which triggers activation of caspase-9, then caspase-3 (43–45, 48–51). In addition, apopto- sis may also be mediated by a poorly understood caspase-indepen- dent pathway (52). Disruption of caspase-8 produces fetal death without anomalies of the nervous system. In contrast, dis- ruption of caspase-3 or caspase-9 genes results in abnormal neural development, in addition to fetal death (48–50). Despite the find- ing that caspase-1 and caspase-3 are expressed in OLG and in- volved in TNF-␣-induced apoptosis (53), the specific caspases re- sponsible for differentiation-induced OLG apoptosis have not been clearly defined. In this study, we have investigated caspase-3 and Bcl-2 in OLG apoptosis and the effect of sublytic C5b-9 in this process. In view of the potent antiapoptotic activity of BCL-2 (54) and the key role of caspase-3 as an apoptosis effector (43, 48), rapid loss of bcl-2 FIGURE 7. Effects of C5b-9 on expression of bcl-2 mRNA and protein mRNA expression concomitant with increasing caspase-3 mRNA in OLG. A, O-2A cells differentiated in vitro for 3 days (OLG) were ex- and protein at the onset of cell differentiation suggested a role for posed to C5b-9 or C5b6 assembled with purified components. After 4, 8, these two proteins in differentiation-induced apoptosis. Proteolytic and 18 h, cells were lysed. Cell lysates were immunoprecipitated with activation of caspase-3, as indicated by the generation of 17- and anti-BCL-2 IgG, and the protein was analyzed by 10% SDS-PAGE and Western blot, using anti-BCL-2 IgG (Oncogene, Cambridge, MA). Purified 12-kDa subunits and the 89-kDa cleavage fragment of PARP, was BCL-2 protein (Pierce, Rockford, IL) was used as a positive control. B, detected during OLG differentiation. Furthermore, caspase-3 in- OLG were exposed to C5b-9 assembled with purified components as in A. hibitor DEVD-CHO effectively protected OLG from cell death. Northern blot was performed at 3 and 6 h, using 1 ␮g of poly(A)ϩ RNA/ Together, these findings indicated that caspase-3 activation is es- lane, for bcl-2 and ␤-actin mRNA expression. sential for differentiation-induced apoptosis. Caspase-3 activation The Journal of Immunology 6137 was abrogated by C5b-9, as shown by inhibition of caspase-3 2. Martin, R., H. F. McFarland, and D. E. MCFarlin. 1992. Immunologic aspects of proenzyme cleavage into its active subunits. This finding was con- demyelinating diseases. Annu. Rev. Immunol. 10:153. 3. Shin, M. L., H. Rus, and F. Niculescu. 1998. Complement system in central sistent with the inhibition of PARP cleavage, a substrate for acti- nervous system disorders. In The Human Complement System in Health and vated caspase-3. Regulation of BCL-2 expression was examined as Disease. J. E. Volanakis and M. M. Frank, eds. Marcel Dekker, New York, a possible step upstream to the caspase-3 affected by C5b-9. In p. 499. 4. Shin, M. L., H. G. Rus, and F. I. Niculescu. 1996. Membrane attack by comple- OLG, bcl-2 mRNA was expressed at a very low level without ment: assembly and biology of the terminal complement complexes. In Biomem- detectable protein, as examined by sensitive methods, such as the branes. A. G. Lee, ed. JAI Press, Greenwich, p. 123. use of poly(A)ϩ RNA for Northern blot and analysis of cell lysates 5. Morgan, B. P. 1989. Complement membrane attack on nucleated cells: resistance, recovery and non-lethal effects. Biochem. J. 264:1. by immunoprecipitation and Western immunoblot. Interestingly, 6. Halperin, J. A., A. Taratuska, and A. Nicholson Weller. 1993. Terminal comple- C5b-9 was able to increase BCL-2 protein without significantly ment complex C5b-9 stimulates mitogenesis in 3T3 cells. J. Clin. Invest. 91: affecting the mRNA level, suggesting a possible role of C5b-9 in 1974. 7. Benzaquen, L. R., A. Nicholson-Weller, and J. A. Halperin. 1994. Terminal com- posttranscriptional regulation of Bcl-2. Detection of bcl-2 mRNA plement proteins C5b-9 release basic fibroblast growth factor and platelet-derived in the absence of BCL-2 protein in germinal center B cells (55) and growth factor from endothelial cells. J. Exp. Med. 179:985. in a trophoblastic tumor cell line when induced to differentiate (56) 8. Rus, H. G., F. Niculescu, and M. L. Shin. 1996. Sublytic complement attack induces cell cycle in oligodendrocytes. J. Immunol. 156:4892. also suggested a step of translational regulation of Bcl-2. A spe- 9. Niculescu, F., T. Badea, and H. Rus. 1999. Sublytic C5b-9 induces proliferation cific cis element within the promoter has been identified as a reg- of aortic smooth muscle cells: role of mitogen activated protein kinase and phos- ulatory site involved in the translational control of bcl-2 gene (57). phatidylinositol 3-kinase. Atherosclerosis 142:47. 10. Niculescu, F., H. Rus, T. van Biesen, and M. L. Shin. 1997. Activation of Ras and How BCL-2 synthesis is regulated by C5b-9 remains unclear. We mitogen-activated protein kinase pathway by terminal complement complexes is have shown that sublytic C5b-9 induces ERK1 pathway, and this G protein dependent. J. Immunol. 158:4405. Downloaded from is through activation of phosphatidylinositol-3 (PI-3) kinase (9, 10, 11. Carney, D. F., T. J. Lang, and M. L. Shin. 1990. Multiple signal messengers generated by terminal complement complexes and their role in terminal comple- 33). In OLG, ERK1 activated by C5b-9 are responsible for en- ment complex elimination. J. Immunol. 145:623. hanced DNA synthesis (33), and C5b-9 increased the p70 S6 ki- 12. Wiedmer, T., B. Ando, and P. J. Sims. 1987. Complement C5b-9-stimulated 2ϩ nase activity (33), a ribosomal kinase responsible for protein syn- platelet secretion is associated with a Ca -initiated activation of cellular protein kinases. J. Biol. Chem. 262:13674. thesis (58). PI-3 kinase has been shown to inhibit apoptosis, and 13. Seeger, W., N. Suttorp, A. Hellwig, and S. Bhakdi. 1986. Noncytolytic terminal

this is thought to be through activation of Akt kinase and by in- complement complexes may serve as calcium gates to elicit leukotriene B4, gen- http://www.jimmunol.org/ creasing BCL-2 (59, 60). In postmitotic cells such as OLG, C5b-9, eration in human polymorphonuclear leukocytes. J. Immunol. 137:1286. 14. Cybulsky, A. V., J. Papillon, and A. J. McTavish. 1998. Complement activates instead of inducing proliferation, may enhance cell survival. The phospholipases and protein kinases in glomerular epithelial cells. Kidney Int. putative antiapoptotic signaling generated by C5b-9 may include 54:360. PI-3 kinase. C5b-9, by increasing BCL-2, may stabilize mitochon- 15. Niculescu, F., H. Rus, S. Shin, T. Lang, and M. L. Shin. 1993. Generation of diacylglycerol and ceramide during homologous complement activation. J. Im- drial inner membrane permeability, or inhibit the interaction of munol. 150:214. BAX with outer membrane proteins (61). BCL-2 prevents cyto- 16. Niculescu, F., H. Rus, and M. L. Shin. 1994. Receptor-independent activation of chrome c release and inhibits activation of caspase-9 and caspase-3 guanine nucleotide-binding regulatory proteins by terminal complement com- plexes. J. Biol. Chem. 269:4417. (54). Therefore, up-regulation of BCL-2 protein by C5b-9 in OLG 17. Barres, B. A., I. K. Hart, H. S. Coles, J. F. Burne, J. T. Voyvodic, may precede the inhibition of caspase-3 activation. C5b-9 also W. D. Richardson, and M. C. Raff. 1992. Cell death and control of cell survival by guest on September 25, 2021 inhibited cell death and caspase-3 activation induced by TNF-␣. in the oligodendrocyte lineage. Cell 70:31. ␣ 18. Barres, B. A., R. Schmid, M. Sendnter, and M. C. Raff. 1993. Multiple extra- TNF- induces apoptosis via caspase-8 through the recruitment of cellular signals are required for long-term oligodendrocyte survival. Development TRADD/FADD (TNFR-associated /Fas-associated 118:283. death domain) proteins to the TNFR1 (62). However, TNF-␣ also 19. Raff, M. C., B. A. Barres, J. F. Burne, H. S. Coles, Y. Ishizaki, and M. D. Jacobson. 1993. and the control of cell survival: generates ceramide, which induces caspase-9 activation and apo- lessons from the nervous system. Science 262:695. ptosis, in a caspase-8-independent manner (49, 63). We can spec- 20. Ludwin, S. K. 1997. The pathobiology of the oligodendrocyte. J. Neuropathol. ulate that C5b-9 inhibits OLG apoptosis induced by differentiation Exp. Neurol. 56:111. ␣ 21. Louis, J. C., E. Magal, S. Takayama, and S. Varon. 1993. CNTF protection of and by TNF- , and this is mediated through up-regulation of oligodendrocytes against natural and -induced death. Sci- BCL-2 protein and inhibition of caspase-9 and caspase-3. ence 259:689. Our finding that C5b-9 rescues OLG from differentiation-in- 22. D’Souza, S. D., K. A. Alinauskas, and J. P. Antel. 1996. Ciliary neurotrophic ␣ factor selectively protects human oligodendrocytes from tumor necrosis factor- duced apoptosis and apoptosis caused by TNF- may have a bi- mediated injury. J. Neurosci. Res. 43:289. ological significance in inflammatory and immune-mediated de- 23. Linington, C., B. P. Morgan, N. J. Scolding, P. Wilkins, S. Piddlesden, and myelination. Apoptosis of OLG has been observed in EAE and MS D. A. Compston. 1989. The role of complement in the pathogenesis of experi- ␥ mental allergic encephalomyelitis. Brain 112:895. (64, 65). IFN- , cuprizone, and HTLV-1, known to induce demy- 24. Piddlesden, S. J., M. K. Storch, M. Hibbs, A. M. Freeman, H. Lassmann, and elination in vivo, also induce OLG apoptosis (66–68). Therefore, B. P. Morgan. 1994. Soluble recombinant complement receptor 1 inhibits in- an understanding of mechanisms leading to and preventing apo- flammation and demyelination in antibody-mediated demyelinating experimental allergic encephalomyelitis. J. Immunol. 152:5477. ptosis of OLG and its progenitor cells is critically important to 25. Linington, C., H. Lassmann, B. P. Morgan, and D. A. Compston. 1989. Immu- develop rational approaches to enhance OLG survival and nohistochemical localization of terminal complement component C9 in experi- remyelination. mental allergic encephalomyelitis. Acta Neuropathol. 79:78. 26. Compston, D. A., B. P. Morgan, A. K. Campbell, P. Wilkins, G. Cole, N. D. Thomas, and B. Jasani. 1989. Immunocytochemical localization of terminal complement complex in multiple sclerosis. Neuropathol. Appl. Neurobiol. 15: Acknowledgments 307. We thank Drs. E. Podack and S. Korsemyer who generously provided bcl-2 27. Sanders, M. E., C. L. Koski, D. Robbins, M. L. Shin, M. M. Frank, and K. A. Joiner. 1986. Activated terminal complement in cerebrospinal fluid in Guil- and bax cDNA, respectively. We also appreciate the excellent technical lain-Barre syndrome and multiple sclerosis. J. Immunol. 136:4456. help of Dr. M. Chi in preparing primary OLG and O-2A progenitors and 28. Vanguri, P., B. A. Silverman, C. L. Koski, and M. L. Shin. 1982. Complement the preparation of the manuscript by N. Dehghan. activation by isolated myelin: activation of the classical pathway in the absence of myelin-specific antibodies. Proc. Natl. Acad. Sci. USA 79:3290. 29. Cyong, J. C., S. S. Witkin, B. Rieger, E. Barbarese, R. A. Good, and N. K. Day. References 1982. Antibody-independent complement activation by myelin via the classical complement pathway. J. Exp. Med. 155:587. 1. Benveniste, E. N. 1997. Role of macrophages/microglia in multiple sclerosis and 30. Vanguri, P., and M. L. Shin. 1988. Hydrolysis of myelin basic protein in human experimental allergic encephalomyelitis. J. Mol. Med. 75:165. myelin by terminal complement complexes. J. Biol. Chem. 263:7228. 6138 ANTI-APOPTOTIC ACTIVITY OF C5b-9

31. Liu, W. T., P. Vanguri, and M. L. Shin. 1983. Studies on demyelination in vitro: O. Kollet, et al. 1998. Targeted disruption of the mouse gene ablates the requirement of membrane attack components of the complement system. cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal J. Immunol. 131:778. prenatally. Immunity 9:267. 32. Koski, C. L., A. E. Estep, S. Sawant-Mane, M. L. Shin, L. Highbarger, and 50. Kuida, K., T. F. Haydar, C. Y. Kuan, Y. Gu, C. Taya, H. Karasuyama, M. S. Su, G. M. Hansch. 1996. Complement regulatory molecules on human myelin and P. Rakic, and R. A. Flavell. 1998. Reduced apoptosis and cytochrome c-mediated glial cells: differential expression affects the deposition of activated complement caspase activation in mice lacking caspase 9. Cell 94:325. proteins. J. Neurochem. 66:303. 51. Hakem, R., A. Hakem, G. S. Duncan, J. T. Henderson, M. Woo, M. S. Soengas, 33. Rus, H., F. Niculescu, T. Badea, and M. L. Shin. 1997. Terminal complement A. Elia, J. L. de la Pompa, D. Kagi, W. Khoo, et al. 1998. Differential requirement complexes induce cell cycle entry in oligodendrocytes through mitogen activated for caspase 9 in apoptotic pathways in vivo. Cell 94:339. protein kinase pathway. Immunopharmacology 38:177. 52. Xiang, J., D. T. Chao, and S. J. Korsmeyer. 1996. BAX-induced cell death may 34. Shirazi, Y., H. G. Rus, W. B. Macklin, and M. L. Shin. 1993. Enhanced degra- not require interleukin 1␤-converting enzyme-like proteases. Proc. Natl. Acad. dation of messenger RNA encoding myelin proteins by terminal complement Sci. USA 93:14559. complexes in oligodendrocytes. J. Immunol. 150:4581. 53. Hisahara, S., S. Shoji, H. Okano, and M. Miura. 1997. ICE/CED-3 family exe- 35. Saneto, R. P., and J. de Vellis. 1985. Characterization of cultured rat oligoden- cutes oligodendrocyte apoptosis by tumor necrosis factor. J. Neurochem. 69:10. drocytes proliferating in a serum-free, chemically defined medium. Proc. Natl. 54. Adams, J. M., and S. Cory. 1998. The Bcl-2 protein family: arbiters of cell Acad. Sci. USA 82:3509. survival. Science 281:1322. 36. Hong, K., T. Kinoshita, W. Miyazaki, T. Izawa, and K. Inoue. 1979. An anti- complementary agent, K-76 monocarboxylic acid: its site and mechanism of in- 55. Chleq-Deschamps, C. M., D. P. LeBrun, P. Huie, D. P. Besnier, R. A. Wamke, hibition of the complement activation cascade. J. Immunol. 122:2418. R. K. Sibley, and M. L. Cleary. 1993. Topographical dissociation of BCL-2 37. DiScipio, R. G., C. A. Smith, H. J. Muller-Eberhard, and T. E. Hugli. 1983. The messenger RNA and protein expression in human lymphoid tissues. Blood 81: activation of human complement component C5 by a fluid phase C5 convertase. 293. J. Biol. Chem. 258:10629. 56. Sakuragi, N., H. Matsuo, G. Coukos, E. E. Furth, M. P. Bronner, 38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Analysis of RNA: Northern C. M. VanArsdale, S. Krajewski, J. C. Reed, and J. F. Struss III. 1994. Differ- hybridization. In Molecular Cloning, Vol. 1. N. Ford, C. Nolan, and M. Ferguson, entiation-dependent expression of the BCL-2 proto-oncogene in the human tro- eds. Cold Spring Harbor Laboratory Press, Plainview, p. 7.39. phoblast lineage. J. Soc. Gynecol. Invest. 1:164. 39. Ni, B., X. Wu, Y. Du, Y. Su, E. Hamilton Byrd, P. K. Rockey, P. Rosteck Jr., 57. Harigai, M., T. Miyashita, M. Hanada, and J. C. Reed. 1996. A cis-acting element Downloaded from G. G. Poirier, and S. M. Paul. 1997. Cloning and expression of a rat brain in- in the BCL-2 gene controls expression through translational mechanisms. Onco- terleukin-1␤-converting enzyme (ICE)-related protease (IRP) and its possible gene 12:1369. role in apoptosis of cultured cerebellar granule neurons. J. Neurosci. 17:1561. 58. Evans, S. W., and W. L. Farrar. 1987. Interleukin 2 and diacylglycerol stimulate 40. Robbins, D. S., Y. Shirazi, E. Drysdale, A. Lieverman, H. S. Shin, and phosphorylation of 40 S ribosomal S6 protein: correlation with increased protein M. L. Shin. 1987. Production of cytotoxic factor for oligodendrocytes by stim- synthesis and S6 kinase activation. J. Biol. Chem. 262:4624. ulated astrocytes. J. Immunol. 139:2593. 59. Ahmed, N. N., H. L. Grimes, A. Bellacosa, T. O. Chan, and P. N. Tsichlis. 1997. 41. Nicholson, D. W., A. Ali, N. A. Thornberry, J. P. Vaillancourt, C. K. Ding, M Transduction of interleukin-2 antiapoptotic and proliferative signals via Akt pro-

Gallant, Y. Gareau, P. R. Griffin, M. Labelle, Y. A. Lazebnik, et al. 1995. Iden- tein kinase. Proc. Natl. Acad. Sci. USA 94:3627. http://www.jimmunol.org/ tification and inhibition of the ICE/CED-3 protease necessary for mammalian 60. Kennedy, S. G., A. J. Wagner, S. D. Conzen, J. Jordan, A. Bellacosa, apoptosis. Nature 376:37. P. N. Tsichlis, and N. Hay. 1997. The PI 3 kinase/Akt signaling pathway delivers 42. Lazebnik, Y. A., S. H. Kaufmann, S. Desnoyers, G. C. Poirier, and an anti-apoptotic signal. Genes Dev. 11:701. W. C. Earnshaw. 1994. Cleavage of poly(ADP-ribose) polymerase by a protein- 61. Shimizu, S., M. Narita, and Y. Tsujimoto. 1999. Bcl-2 family proteins regulate ase with properties like ICE. Nature 371:346. the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. 43. Thornberry, N. A., and Y. Lazebnik. 1998. Caspases: enemies within. Science Nature 399:483. 281:1313. 62. Ashkenazi, A., and V. M. Dixit. 1998. Death receptors: signaling and modulation. 44. Green, D. R., and J. C. Reed. 1998. Mitochondria and apoptosis. Science 281: Science 281:1305. 1309. 63. Larocca, J. N., M. Farooq, and W. T. Norton. 1997. Induction of oligodendrocyte 45. Akassoglou, K., J. Bauer, G. Kassiotis, M. Pasparakis, H. Lassmann, G. Kollias, apoptosis by C2-ceramide. Neurochem. Res. 22:529. and L. Probert. 1998. Oligodendrocyte apoptosis and primary demyelination in- 64. Pender, M. P., K. B. Nguyen, P. A. McCombe, and J. F. R. Kerr. 1991. Apoptosis

duced by local TNF/p55TNF receptor signaling in the central nervous system of by guest on September 25, 2021 transgenic mice: models for multiple sclerosis with primary oligodendrogliopa- in the nervous system in experiental allergic encephalomyelitis. J. Neurol. Sci. thy. Am. J. Pathol. 153:801. 104:81. 46. Vakeva, A. P., A. Agah, S. A. Rollins, L. A. Matis, L. Li, and G. L. Stahl. 1998. 65. Ozawa, K., G. Suchanek, H. Breitschopf, W. Bruck, W. Budka, H. Budka, Myocardial infarction and apoptosis after myocardial ischemia and reperfusion: K. Jellinger, and H. Lassmann. 1994. Patterns of oligodendroglial pathology in role of terminal complement components and inhibition by anti-C5 therapy. Cir- multiple sclerosis. Brain 117:1311. culation 97:2259. 66. Vartanian, T., Y. Li, M. Zhao, and K. Stefansson. 1995. Interferon-␥-induced 47. Gasque, P., S. K. Singhrao, J. W. Neal, O. Gotze, and B. P. Morgan. 1997. oligodendrocyte cell death: implications for the pathogenesis of multiple sclero- Expression of the receptor for complement C5a (CD88) is up-regulated on reac- sis. Mol. Med. 1:732. tive astrocytes, microglia, and endothelial cells in the inflamed human central 67. Blakemore, W. F. 1972. Observations on oligodendrocyte degeneration, the res- nervous system. Am. J. Pathol. 150:31. olution of status spongiosus and remyelination in cuprizone intoxication in mice. 48. Kuida, K., T. S. Zheng, S. Na, C. Kuan, D. Yang, H. Karasuyama, P. Rakic, and J. Neurocytol. 1:413. R. A. Flavell. 1996. Decreased apoptosis in the brain and premature lethality in 68. Seto, K., M. Abe, O. Ohya, O. Itakura, N. Ishiguro, H. Ikeda, A. Wakisaka, and CPP32-deficient mice. Nature 384:368. T. Yoshiki. 1995. A rat model of HTLV-I infection: development of chronic 49. Varfolomeev, E. E., M. Schuchmann, V. Luria, N. Chiannilkulchai, progressive myeloneuropathy in seropositive WKAH rats and related apoptosis. J. S. Beckmann, I. L. Mett, D. Rebrikov, V. M. Brodianski, O. C. Kemper, Acta Neuropathol. 89:483.