Investigating the Higher-Order Protein Interactions

INVESTIGATING THE HIGHER-ORDER PROTEIN INTERACTIONS

SURROUNDING THE STRIPAK COMPLEX

Lisa Michelle D’Ambrosio

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Molecular Genetics

University of Toronto

Library and Archives Bibliothèque et Canada Archives Canada

Published Heritage Direction du Branch Patrimoine de l’édition

395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada

Your file Votre référence ISBN: 978-0-494-72863-5 Our file Notre référence ISBN: 978-0-494-72863-5

NOTICE: AVIS:

The author has granted a non- L’auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l’Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distribute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. . The author retains copyright L’auteur conserve la propriété du droit d’auteur ownership and moral rights in this et des droits moraux qui protège cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author’s permission.

In compliance with the Canadian Conformément à la loi canadienne sur la Privacy Act some supporting forms protection de la vie privée, quelques may have been removed from this formulaires secondaires ont été enlevés de thesis. cette thèse.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n’y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

INVESTIGATING THE HIGHER-ORDER PROTEIN INTERACTIONS

SURROUNDING THE STRIPAK COMPLEX

Lisa Michelle D’Ambrosio

Master of Science

Department of Molecular Genetics

University of Toronto

2010

Reversible protein phosphorylation is an essential regulatory mechanism used by eukaryotes to coordinate the biochemical processes of the cell. The PP2A phosphatase functions to dephosphorylate specific proteins originally targeted by stimulus-activated protein kinases.

The recent identification of a sub-network surrounding the human PP2A-Striatin holoenzyme, termed STRIPAK, provides insight into novel mechanisms for PP2A function and regulation. Here I reveal that STRIPAK participates in at least two mutually-exclusive sub-complexes, one of which contains the putative cortactin-binding protein, CTTNBP2NL.

I also show that CTTNBP2NL is enriched at the actin cytoskeleton, likely in a STRIPAK- independent manner. This study also reveals that STRIPAK interacts with a subunit of the dynein motor, at least partially, through CTTNBP2NL. Altogether, this work will serve as a platform for the structural and functional characterization of STRIPAK and will ultimately assist in defining novel mechanisms of regulation and function for the human PP2A phosphatase.

ACKNOWLEDGMENTS:

I would like to thank my supervisor, Dr. Anne-Claude Gingras, for providing me with this invaluable experience and for her constant support. I would also like to extend a special thanks to my supervisory committee, Dr. Vuk Stambolic and Dr. Frank Sicheri for their guidance and scientific insight. Also, I would like to acknowledge my co-workers for their mentorship and for many helpful discussions. Most of all, I would like to especially thank my parents, Claudio and Maria D’Ambrosio, whose encouragement continues to strengthen me each day.

This work was funded by the Canadian Institute for Health Research Grant MIP-84314 (to

A.-C. Gingras) and by the Ontario Student Opportunity Trust Fund from the Bank of

Montreal.

iii

TABLE OF CONTENTS:

Chapter I – Introduction 1.1 The PP2A phosphatase: a central regulator of cell processes...... 2 1.1.1 Protein phosphorylation…………………………………………………….....2 1.1.2 Protein phosphatase 2A…………………………………………………….....3 1.2 STRIPAK: a novel PP2A-containing complex revealed by affinity purification and mass spectrometry...... 8 1.2.1 Modularity of the PP2A network……………………...... 8 1.2.2 Description of STRIPAK protein constituents…………………………….....11 1.3 Eukaryotic dynein motors...... 17 1.3.1 The mammalian cytoplasmic dynein 1 complex……...... 18 1.3.2 DYNLL dynein light chain…………………………………………………....20 1.4 Objective...... 25 Chapter II – Material and Methods

2.1 Plasmids and mutagenesis……………………………………………………………....29 2.2 Antibodies……………………………………………………………………………....29 2.3 Cell culture and plasmid transfection…………………………………………………...29 2.4 Generation of HEK293 stable cell lines………………………………………………...29 2.5 RNA interference……………………………………………………………………….30 2.6 Mammalian cell lysis…………………………………………………………………....30 2.7 Immunoprecipitation of mammalian cell lysate……………………………………...... 31 2.8 Immunoblot analysis………………………………………………………………….....31 2.9 Sample digestion and mass spectrometric analysis……………………………………..32 2.10 Indirect immunofluorescence and microscopy………………………………………...33 Chapter III – Results

Copyright Permission Policy...... 40 Preamble………………………………………………………………………………….....42 3.1 FLAG-tagged STRIPAK proteins interact with Striatin in HEK293 cells…………...... 43 3.2 STRIPAK forms at least two mutually exclusive sub-complexes in HEK293 cells...... 44 3.3 STRIPAK proteins localize to distinct sub-cellular compartments in CV1 cells…….....45

3.4 HA-CTTNBP2NL co-localizes with actin filaments in CV1 cells…………………...... 46 3.5 Amino acids 1-170 of CTTNBP2NL are sufficient for establishing and interaction with STRIPAK…………………………………………………………………...... 46 3.6 Localization of CTTNBP2NL to actin filaments is STRIPAK-independent…………...48 3.7 STRIPAK specifically interacts with DYNLL1 and DYNLL2………………………...49 3.8 Amino acids 1-170 of CTTNBP2NL are not required for establishing an interaction with DYNLL1………………………………………………………………………...... 52 3.9 FLAG-CTTNBP2NL and HA-DYNLL1 co-localize in Vero cells…………………...... 53 3.10 CTTNBP2NL may bridge the interaction between DYNLL and STRIPAK……….....54 Chapter IV – Discussion

4.1 Summary of results…………………………………………………………………...... 78 4.2 Functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction………...... 79 4.2.1 CTTNBP2NL may bridge the interaction between DYNLL and STRIPAK.....79 4.2.2 DYNLL may recruit CTTNBP2NL to the actin cytoskeletal network………...80 4.2.3 DYNLL may function with STRIPAKCTTNBP2NL in a dynein-dependent or – independent manner……………………………………………………...... 82 4.2.4 Models for the mode of action of the DYNLL-STRIPAKCTTNBP2NL assembly…………………………………………………………………….....83 4.3 STRIPAK associates mutually exclusively with two distinct sub-complexes…………..85 4.4 Conclusion…………………………………………………………………………….....87 Chapter V – Future Directions 5.1 Functional characterization of CTTNBP2NL…………………………………………...92 5.2 Functional characterization of the DYNLL-STRIPAKCTTNBP2NL interaction……...... 93 5.3 Determine if DYNLL is dependent on dynein for its function with STRIPAKCTTNBP2NL………………………………………………………………...... 94 Literature Cited…………………………………………………………………………....97

LIST OF TABLES:

Chapter II 2.1 DNA plasmids used in this study………………………………………………...... 35 2.2 Primers used for generating FLAG-CTTNBP2NL truncation mutants………...... 36 2.3 Antibodies used in this study…………………………………………………...... 37 2.4 RNAi oligonucleotides used in this study………………………………...... 38 Chapter III 3.1 STRIPAK associates mutually exclusively with two distinct sub-complexes…...... 74 3.2 Interactors for FLAG-CTTNBP2NL as identified by FLAG AP-MS…………...... 75 3.3 Interactors for FLAG-DYNLL as identified by FLAG AP-MS………………...... 76

LIST OF FIGURES:

Chapter I

1.1 The affinity purification and mass spectrometry (AP-MS) procedure...... 26 1.2 Summary of the interactions within STRIPAK as detected by AP-MS...... 27

Chapter III

3.1 Confirmation of the interaction between FLAG-tagged STRIPAK proteins and endogenous Striatin……………………………………………………………...... 56 3.2 Mutually exclusive associations with STRIPAK………………………...... 57 3.3 STRIPAK proteins localize to distinct sub-cellular compartments…………...... 58 3.4 SIKE partially co-localizes to the Golgi apparatus...... 59 3.5 CTTNBP2NL localizes to actin filaments………………………………………...... 60 3.6 Predicted secondary structure of CTTNBP2NL truncation mutants used in this study……………………………………………………………………………...... 61 3.7 STRIPAK does not associate with the C-terminus of CTTNBP2NL……………....62 3.8 Amino acids 1-285 of CTTNBP2NL are necessary for establishing an interaction with STRIPAK………………………………………………………………...... 63 3.9 Amino acids 1-170 of CTTNBP2NL are sufficient for establishing an interaction with STRIPAK…………………………………………………………...... 64 3.10 CTTNBP2NL localizes to actin filaments in a STRIPAK-independent manner…...65 3.11 DYNLL1 associates specifically with STRIPAK……………………………...... 66 3.12 DYNLL2 associates specifically with STRIPAK………………………………...... 67 3.13 Confirmation of the association between FLAG-tagged DYNLL proteins and endogenous STRIPAK proteins………………………………………………...... 68 3.14 Both N and C termini of CTTNBP2NL mediate an interaction with DYNLL1…....69 3.15 Predicted secondary structure of CTTNBP2NL terminal truncation mutants used in this study...... 70 3.16 Amino acids 1-170 of CTTNBP2NL are not sufficient for establishing an interaction with DYNLL1…………………………………………………………...... 71 3.17 CTTNBP2NL and DYNLL1 partially co-localize at the actin filaments…………..72

vii

3.18 CTTNBP2NL may bridge an interaction between DYNLL1 and Mob3…………..73

Chapter IV

4.1 STRIPAK associates mutually exclusively with two distinct sub-complexes…...... 88 4.2 Functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction: Model 1...89 4.3 Functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction: Model 2...90

viii

CHAPTER I

INTRODUCTION

1 2

1.1 The PP2A phosphatase: A central regulator of cell processes

1.1.1 Protein phosphorylation

The capacity of a cell to quickly respond to extracellular stimuli is essential for its survival in a dynamic environment. Protein phosphorylation and dephosphorylation, mediated by protein kinases and phosphatases respectively, can modify protein function in a variety of ways in order to ensure the cell rapidly adapts to external cues. This stimuli-driven phosphorylation or dephosphorylation of a target protein can result, for example, in an increase or decrease of its molecular activity, it can initiate or disrupt interactions with other proteins, or it can stabilize or label it for destruction (Chen et al. 1992; Guy et al. 1995; Usui et al. 1998; reviewed in Cohen 2002). Changes in the phosphorylation status of a protein may even facilitate or inhibit its movement between sub-cellular compartments thereby restricting or facilitating its recruitment to specific cellular components (Ikeda et al. 2007). It is these diverse effects, together with its inherent flexibility and reversibility that classifies protein phosphorylation as the most widely-exploited regulatory strategy used by eukaryotic cells.

The significance of phosphorylation in eukaryotic biology is emphasized by the fact that aberrant phosphorylation events are now thought to be the cause or consequence of many human diseases (Eichhorn et al. 2007). Moreover, the importance of protein phosphorylation is highlighted further by the fact that approximately one-third of proteins within the cell contain covalently bound phosphate, with the majority of this phosphorylation occurring on serine and threonine residues. To manage this large degree of phosphorylation, the human genome encodes for over 400 serine/threonine kinases, many of which target distinct substrates that belong to specific, converging, or even global cellular processes (Manning et al. 2002; reviewed in Virshup and Shenolikar 2009). To ensure that a tight reversible control 3 is in check for these phospho-dependent networks, a similar complexity exists for the number of cellular serine/threonine phosphatases. However, unlike the kinases, this complexity is not due to the large number of catalytic subunits. In fact, the serine/threonine phosphatases are encoded by only approximately 40 catalytic subunits in humans. In vitro studies on these catalytic subunits reveal that, when studied in isolation, they do not discriminate between protein substrates (Moorhead et al. 2007 and references therein). These reports have therefore caused the phosphatase catalytic subunits to be generally regarded as promiscuous.

However, this idea that phosphatases do not have the capacity to discriminate between their substrates has been challenged by the discovery of hundreds of phosphatase-specific regulatory subunits. In fact, studies now show that many of the serine/threonine phosphatases exist as multimeric enzymes whereby the small number of catalytic subunits can associate with the many hundreds of identified regulatory subunits (Csortos et al. 1996;

Tehrani et al. 1996; Tanabe et al. 1996; McCright et al. 1996). It is this combinatorial assembly of regulatory subunits that is thought to provide the substrate specificity, the complexity and the precision required of phospho-dependent networks in order to accurately coordinate the highly regulated processes of the eukaryotic cell.

1.1.2 Protein phosphatase 2A

Protein phosphatases were originally classified on the basis of if they could either dephosphorylate Serine or Threonine (Ser/Thr) residues, Tyrosine (Tyr) residues, or if they exhibited dual specificity and could therefore dephosphorylate Ser/Thr and Tyr residues.

With this in mind, the phosphatases are currently grouped into three main families: (i) the

Ser/Thr phosphatases which consist of the phosphoprotein phosphatase (PPP) and the protein phosphatase Mg2+ or Mn2+ dependent (PPM) sub-groups (ii) the protein Tyr phosphatase 4

(PTP) superfamily which is comprised of a collection of receptor and non-receptor PTP subfamilies together with a selection of dual-specificity enzymes (Alonso et al. 2004 and references therein) and (iii) a group of phosphatases that use an Aspartate (Asp)-based catalytic mechanism to dephosphorylate Ser/Thr residues. It is important to note, however, that this basic classification system has become somewhat less defined with the identification of enzymes can dephosphorylate non-protein targets such as RNA and phosphoinositides

(Alonso et al. 2004; Begley and Dixon 2005). Moreover, various members of the haloacid dehalogenase (HAD) superfamily have recently been reported to exhibit protein phosphatase activity and to specifically target phosphorylated Ser or Tyr residues (Gohla et al. 2005).

The PPM and PPP families, although completely unrelated in sequence, have been selected throughout evolution to develop highly related structures at the catalytic core. The

PPP and PPM phosphatases catalyze serine/threonine dephosphorylation of their target substrates in a single-step reaction using a metal-activated, nucleophilic molecule of water

(Cho et al. 2007; Xing et al. 2006). In direct contrast, catalysis by the PTPs requires the transition through a cysteinyl-phosphate enzyme intermediate (Jia et al. 1995). Importantly, the crystal structures of many phosphatases have recently been solved which will inevitably provide important insight into the diverse processes of catalysis, substrate recognition, and the molecular mechanisms of phosphatase regulation (Egloff et al. 1995; Goldberg et al.

1995; Xing et al. 2006; Cho et al. 2007; Kissinger et al. 1995).

The majority of the cellular serine/threonine phosphatase activity is attributed to two members of the PPP family of enzymes, protein phosphatase 1 (PP1) and protein phosphatase 2A (PP2A). Extensive studies on PP2A have reported it as an enzyme whose function is imperative for the regulation of many cell processes, such as in the control of 5 transcription, translation, metabolism, cell cycle, differentiation, signal transduction and oncogenic transformation (Janssens and Goris 2001 and references therein). In the cell, the

36-kDa catalytic subunit of PP2A exists, most often, in complex with the 65-kDa scaffolding

A subunit (or PR65) to form the dimeric PP2A A/C core (Xing et al. 2006). In vertebrates, the catalytic and scaffolding subunits are each encoded by two genes, thereby generating two protein isoforms for each subunit, referred to as PP2ACα/β and PP2R1Aα/β respectively

(Hemmings et al. 1990; Arino et al. 1988; Khew-Goodall and Hemmings 1988). Despite the fact that these isoforms exhibit subtle differences in tissue expression and that both the

PP2ACα and PP2R1Aα isoforms are much more abundant than their respective β isoforms, the functional significance of generating two isoforms for each of these subunits remains to be clearly defined. With that said, it has been shown that Xenopus oocytes exhibit a gradual decrease in the PP2R1β to PP2R1α mRNA ratio during embryogenesis, suggesting the need for specific isoforms during particular stages of development (Hendrix et al. 1993; Bosch et al. 1995). More specifically, the A subunits consist of 15 tandem, non-identical α-helical repeats that form a hook-like protein structure (Groves et al. 1999; Hemmings et al. 1990).

This hook-shaped structure is ideal as the A subunit acts, in part, as a scaffold which links the catalytic enzyme to a wide array of regulatory proteins, thereby promoting the formation of many unique mutually-exclusive PP2A heterotrimeric holoenzymes. It are these different regulatory proteins that are thought to target the enzyme, both spatially and temporally, to specific protein substrates (Janssens and Goris 2001 and references therein).

The PP2A regulatory subunits identified to date have been grouped into four main gene families: B (B55, PR55), B’ (B56, PR61), B” (PR72, PR130, PR48, PR59) and B”’

(Striatin, Striatin3, Striatin4). Although these four gene families exhibit no sequence 6 similarities, recent studies have reported the existence of a general A subunit-binding consensus motif which aids in defining how the different regulatory subunits are capable of interacting in mutually exclusive PP2A holoenzymes (Ruediger et al. 1992; Ruediger et al.

1993; Li and Virshup 2002). Proposed PP2A-specific functions of the B family of regulatory subunits include the modulation of mitogen-activated protein kinase (MAPK) signalling, neuronal differentiation and Wnt/β-catenin signalling (Kao et al. 2004; Schild et al. 2006;

Zhang et al. 2009) . This group of regulatory proteins are thought to target PP2A to distinct sub-cellular locations through the variable N-termini of their otherwise conserved β-propeller structure (Neer et al. 1994). Conversely, the B’ family regulatory subunits are phosphoproteins that have been implicated in the PP2A-specific control of the cell-cycle, Wnt/β- catenin signalling and synaptic plasticity (McCright et al. 1996; Seeling et al. 1999; Li et al.

2002; Li et al. 2001; Yan et al. 2000). The B’’ subunits identified to date are nuclear, calcium-binding proteins that have reported functions in regulating cell cycle progression whereas the B’’’ Striatins are highly enriched in the mammalian brain and may therefore reveal novel neuronal-specific functions for PP2A (McCright et al. 1996; Yan et al. 2000;

Moreno et al. 2000).

In addition to the combinatorial assembly of the many regulatory subunits, the activity of the PP2A enzyme is also regulated by direct protein modifications at the post- translational level. For example, the tyrosine kinases pp60c-src, pp56lck and the receptors of the epidermal growth factor and insulin families have all been reported to phosphorylate the

PP2A catalytic subunit in vitro (Chen et al. 1992; Chen et al. 1994; Guy et al. 1995;

Srinivasan et al. 1994; Begum and Ragolia 1999; Guo and Damuni 1993; Damuni et al.

1994). This phosphorylation occurs on a conserved tyrosine residue, Tyr307, which is 7 located at the extreme C-terminus of the PP2A catalytic subunit and is thought to promote inactivation of its phosphatase activity. This phosphorylation appears to be functionally significant in vivo as cells stimulated with epidermal growth factor, tumour necrosis factor α, insulin or interleukin-1 all resulted in Tyr307 phosphorylation and inactivation of PP2AC.

Moreover, Tyr307 phosphorylation of PP2AC was detected in both activated human T cells and in fibroblasts overexpressing pp60c-src thereby further emphasizing an in vivo regulatory role for PP2AC phosphorylation. Notably, phosphorylation of various regulatory subunits has also been reported to modulate PP2A enzyme activity and/or complex assembly. For example, it has been shown that the targeted phosphorylation of the B’ subunit, PR61δ, by protein kinase A (PKA) re-directs the specificity of PP2AC towards particular substrates without changing the composition of the A/PR61δ/C complex (Usui et al. 1998).

Alternatively, the B’ subunit, PR61α, has been shown, both in vitro and in vivo, to be phosphorylated by the double-stranded-RNA-dependent protein kinase (PKR). The PKR- dependent phosphorylation of PR61α has been reported, through in vitro studies, to promote an increase in PP2AC phosphatase activity towards the PKR-phosphorylated translation initiation factor 2α and of protein kinase C (PKC)-phosphorylated myelin basic protein (Xu et al. 2000).

The control of PP2AC enzyme activity is not only regulated by phosphorylation, but is also sensitive to methylation (Lee and Stock 1993; Xie and Clarke 1993; Xie and Clarke

1994). It has been reported, to date, that the PP2A catalytic subunit is reversibly methylated by Leucine carboxyl methyltransferase-1 and PP2A methylesterase-1 (PME-1) at its most C- terminal leucine, Leu309 (Ogris et al. 1999). The functional significance of this methylation in regards to the regulation of PP2A enzyme activity remains controversial with multiple 8 groups reporting conflicting data. For example, the in vivo methylation of PP2AC at Leu309 has been reported, by separate groups, to cause either a moderate increase, decrease or no effect on its phosphatase activity (De Baere et al. 1999; Favre et al. 1994; Zhu et al. 1997).

Drawing from this data, it is therefore believed that different aspects of PP2A structure or function, other than enzyme activity, are modulated by methylation of its catalytic subunit.

One such possibility, as proposed by a number of groups, is that PP2AC methylation alters the assembly of various PP2A heterotrimers. For example, methylation of PP2AC was detected in all heterotrimers containing the human B/PR55 subunits whereas only a fraction of PP2AC subunits were methylated in heterotrimers containing the B’’’/Striatin or B’’/PR72 subunits (Moreno et al. 2000; De Baere et al. 1999). Although these studies provide initial insight into the regulation of PP2A, a more comprehensive approach is required in order to understand how these post-translational modifications are capable of modulating phosphatase function in a manner that controls the spatial and temporal assembly of the various PP2A heterotrimeric holoenzymes.

1.2 STRIPAK: A novel PP2A-containing complex revealed by affinity purification and mass spectrometry (AP-MS)

1.2.1. Modularity of the PP2A network

Throughout evolution, there appears to have been a selective advantage for proteins within the cell, such as PP2A, to function in the context of macromolecular assemblies. A conserved property of these assemblies is that they communicate through physical interactions with other assemblies to constitute larger dynamic protein networks. These networks then provide the necessary foundation for cellular processes such as cell signalling, proliferation, apoptosis and cell growth. Therefore, understanding how cellular processes 9 function relies heavily on a comprehensive study of the topology and dynamic properties of protein networks. More specifically, the unique composition of different PP2A holoenzymes is thought to modulate the temporal and spatial activity of the enzyme towards specific substrates. It is therefore important to identify which PP2A complexes co-exist in human cells and to define if and how these different complexes cooperate to modulate specific cellular processes through distinct protein–protein interactions. An effective approach to identify and characterize interaction partners, such as the proteins that associate with the

PP2A phosphatase, is affinity purification coupled with mass spectrometry (AP-MS). There are different variations of the AP-MS technique, but the approach taken by the Gingras laboratory is generally divided into four sections: (i) the generation of cell lines that stably express an epitope-tagged protein of interest, (ii) protein complex purification, (iii) proteolyic digestion of the isolated sample and (iv) the identification of co-precipitating proteins by MS-based analysis (Chen and Gingras 2007; reviewed in Gingras et al. 2007)

(Figure 1.1A). Recently, AP-MS has experienced increasing popularity as the preferred method for resolving large-scale networks of human protein complexes. This effect is likely due to the fact that most purifications are performed at near-physiological conditions and are thereby effective for preserving and/or detecting the presence of post-translational protein modifications (PTMs). This is extremely advantageous when conducting protein interaction studies as PTMs are often crucial for maintaining, facilitating, or modulating the organization and/or activity of human protein complexes. Also, when used in combination with quantitative proteomic methods, such as Stable Isotope Labelling with Amino Acids in Cell

Culture (SILAC), AP-MS has consistently been proven as an extremely powerful approach for studying dynamic changes in the composition of protein complexes in response to 10 particular stimuli or growth conditions (Ong et al. 2002; Gygi et al. 1999). However, while a single AP-MS experiment can successfully identify multiple interactors of a desired protein, this method is not effective when trying to define the composition of multiprotein complexes. For example, the B and B’ proteins associate mutually exclusively with PP2AC and are therefore never present within the same PP2A complex. This information, however, would not be resolved in a single AP-MS of PP2AC as both B and B’ would be identified in the purification. As a result, generation of a high-density interaction map, whereby the interaction partners identified by AP-MS of an initial protein of interest are purified in parallel experiments, can resolve the components of individual protein complexes (Figure

1.1B). By taking an iterative approach and applying it to the standard AP-MS technique, one can therefore achieve a more comprehensive model of the network topology and dynamics characteristic for a target protein (reviewed in Gingras et al. 2007; Gingras et al. 2005).

Using the wealth of biochemical and structural data reported for various PP2A holoenzymes as an experimental platform, the AP-MS technique has been used to map the

PP2A interactome in a collection of model organisms and cell types (Glatter et al. 2009;

Goudreault et al. 2009; Lee et al. 2007). The intricate networks obtained from these studies highlight the modular organization of the PP2A system and provide important insight into the cellular functions attributed to different PP2A complexes. Briefly, the topology of the current human PP2A network reveals that the majority of cellular PP2A enzymes exist in canonical heterotrimeric PP2A core complexes. Data from these studies also report that a small fraction of the phosphatase pool participate in non-canonical PP2A complexes containing the immunoglobulin receptor-associated protein, alpha4, or the protein phosphatase methylesterase, PME1 (Glatter et al. 2009 and references therein). Most 11 importantly, these studies reveal that higher-order complexes centered on specific PP2A heterotrimeric core complexes are formed in human cells. For example, data from

Goudreault et al. (2009) and Glatter et al. (2009) report the existence of a highly-connected

PP2A sub-network surrounding the canonical PP2A-Striatin complex. This sub-network contains the three members of the striatin B’’’ class of PP2A regulatory proteins (Striatin,

Striatin3, Striatin4), the Striatin-interacting protein Mob3, three members of the Germinal

Center Kinase-III (GCK-III) class of serine/threonine kinases (MST4, STK24, STK25), the protein CCM3, as well a specific group of structurally related proteins (STRIP1, STRIP2)

(Figure 1.2). This novel PP2AC•PP2AA•Striatin•Mob3•STRIP•CCM3•GCK-III multiprotein assembly has been defined by Goudreault et al. (2009) as the Striatin-interacting phosphatase and kinase (STRIPAK) complex and provides additional evidence for the existence of higher-order PP2A sub-networks in human cells. The presence of these higher-order phosphatase sub-networks is significant as it not only provides insight into how PP2A signals through interacting complexes but also aids in the understanding of how its enzyme activity is dynamically regulated in the context of the cellular proteome.

1.2.2 Description of STRIPAK protein constituents

As mentioned, the recently identified STIRPAK complex contains, in addition to

PP2A, a series of functionally-diverse proteins – each of which has been ascribed to a variety of cellular processes in different models and organisms. For reference, a brief description of each protein constituent of the STRIPAK complex is outlined below:

Striatins

Striatin is an evolutionarily conserved, intracellular protein that was initially identified as a highly expressed protein in the dorsal striatum and motorneurons of the rat 12 brain, particularly in synaptosomal preparations that were enriched for adenylyl cyclase

(Castets et al. 1996). It is thought to serve as an adaptor for protein complexes and/or as a scaffold for dynamic signalling cascades as it contains a series of domains characteristic for establishing protein interactions. From the N- to C- terminus, these protein-protein interaction domains are: a putative caveloin-binding motif, a coiled-coil domain, a Ca2+- calmodulin binding motif and a large WD-repeat domain. More recently, two additional proteins, Striatin3 and Striatin4, were identified as autoantigens in a human cancer patient as being structurally highly related to Striatin (Castets et al. 2000; Moreno et al. 2000).

Specifically, Striatin3 and Striatin4 are 80 and 75% similar to Striatin respectively with their protein-protein interaction modules exhibiting identical alignment with both Striatin and each other. Although the Striatins do not exhibit any sequence homology to the canonical PP2A regulatory B subunits, immune complexes of Striatin 3-PP2A and Striatin-PP2A have been reported to contain okadaic acid-sensitive, calcium-independent phosphatase activity activated toward the cdc2-phosphorylated histone H1 substrate in the absence of any other known B-type subunit (Moreno et al. 2000; Moreno et al. 2001). The Striatin-specific attenuation of PP2A phosphatase activity therefore suggests that this group of proteins represents a novel family of PP2A regulatory subunits. Since the identification of the

Striatins as regulatory proteins for the PP2A phosphatase, a series of studies were then initiated to gain insight into the cellular function of this class of proteins. For example, genetic analysis in maturing motorneurons reveals that the Striatins appear to be critical for normal locomotor activity and growth of developing dendrites in vivo (Bartoli et al. 1999). It is important to note that although the Striatins are most highly expressed in brain tissue, they are also expressed in liver, fibroblasts, skeletal and cardiac muscle tissues. This suggests that 13 the Striatins may not only carry out tissue-specific functions but may also serve a more ubiquitous role that is independent of cell- or tissue-type. The Striatins have also been shown to interact, in vitro, with the caveolins which are integral membrane proteins that aid in the concentration of signalling networks at the membrane (Gaillard et al. 2001; Simons and Toomre 2000). These studies present the exciting possibility that the Striatins may target

PP2A to microenvironments at the membrane in which they may aid in the modulation of dynamic calcium-dependent signalling and/or in the remodelling/recruitment of signalling networks at the membrane in response to particular stimuli.

STRIP1/2

STRIP1 and STRIP2 (formerly FAM40A and FAM40B respectively) are highly related proteins of unknown function in metazoans. They share 68% similarity and exhibit no significant homology to any proteins present in the human genome (Goudreault et al..

2009). Moreover, STRIP1 and STRIP2 do not contain any defined protein sequence motifs.

However, STRIP1 and STRIP2 exhibit 13% identity with Far11 – a Saccharomyces cerevisiae protein that is important for pheromone signalling. They also have 21% identity with the Neurospora crassa ham-2 gene product – a protein critical for regulating fusion of membranes during fungal growth (Xiang et al. 2002).

GCK-III Kinases

The GCK-III kinases (MST4, STK24, STK25) are a characterized by an N-terminal kinase domain followed by a C-terminal tail that contains putative regulatory domains.

Although the mechanisms of catalysis are still being defined, it is currently believed that autophosphorylation at the activation loop is critical for increasing the enzymatic activity of these kinases. Also, this kinase group contains a putative nuclear localization signal and a 14 putative caspase cleavage site, both of which are located C-terminal to the kinase domain.

Although their substrates and molecular mechanisms of regulation have not been clearly defined, this group of kinases have been implicated in a collection of various processes such as the control of cell proliferation, apoptosis and various stress response pathways (Lin et al.

2001; Odada et al. 1997; Dan et al. 2002; Qian et al. 2001; Pombo et al. 1996; Pombo et al.

2007).

CCM3

CCM3 is an evolutionarily conserved, 25 kDa product of the PDCD10 gene that contains no known functional domains or homology to any other protein in the human genome. Recent studies have focused efforts on defining the cellular function of CCM3. For example, inhibition of the nematode PDCD10 ortholog induces lethality in a fraction of embryos and causes development of a dumpy phenotype in the remaining viable embryos.

Despite the identification of these PDCD10-specific defects, the pathways and mechanism of action that lead to these phenotypic features have not been elucidated. However, mutations in PDCD10 have been reported in patients with familial cases of cerebral cavernous malformations (Guclu et al. 2005). Cerebral cavernous malformations are a type of vascular malformation that affects approximately 0.5 – 1% of the population. The majority of affected individuals are asymptomatic with approximately 30% of affected patients predicted to exhibit symptoms ranging from headaches, seizures, cerebral haemorrhages, strokes, and even death (reviewed in Revencu and Vikkula 2006). Through recent yeast two-hybrid and co-immunoprecipitation studies, CCM3 has been reported to interact with the MST4 serine/threonine kinase – an interaction that has been reported to promote cell growth and transformation by modulation of the ERK-MAPK signalling cascade (Ma et al. 2007). 15

SLMAP/TRAF3IP3

The sarcolemmal-membrane associated protein (SLMAP) is a putative transmembrane protein that has been reported to regulate aspects of myoblast development and muscle contraction in the cardiac sarcolemma (Guzzo et al. 2004). There are four

SLMAP splice variants identified to date, all of which encode for proteins containing two leucine zippers and a transmembrane domain at their C-termini (Wielowieyski et al. 2000).

The N-termini of these different transcripts vary – the longest of which encodes for a putative FHA domain and has been shown to exhibit an enrichment at the centrosome

(Guzzo et al. 2004). TRAF3IP3 (TRAF3-interacting protein 3) is expressed in cells of lymphoid origin and shares 22% identity with SLMAP at the amino acid level. It was initially identified as an interactor of TNF receptor-associated factor 3 (TRAF3) – a critical intracellular receptor important for transducing signals in response to viral infection.

However, recent studies suggest that TRAF3IP3 is a component of the JNK-MAPK signalling module (Dadgostar et al. 2003).

SIKE/FGFR1OP2

Suppressor of IKKε (SIKE) is a 25 kDa coiled-coil-containing protein that was first identified as a negative regulator of the virus-triggered, type I interferon (IFN) response. A single study has reported that SIKE sequesters the serine/threonine kinases TBK1 and IKKε, thereby repressing expression of anti-viral IFN gene products (Huang et al. 2005). AP-MS and sequence analysis done by Goudreault et al. (2009) have revealed that SIKE co- precipitates with, and is 50% identical to, the related protein FGFR1OP2. FGFR1OP2 was initially identified as coiled-coil-containing gene product that is capable of fusing to the tyrosine kinase fibroblast growth factor receptor 1 (FGFR1). This FGFR1OP2-FGFR1 16 fusion product promotes the dimerization and ligand-independent activation of FGFR1 which can result in the development of 8p11 myeloproliferative syndrome - a rare and aggressive malignancy of the hematopoetic system (Grand et al. 2004). Although orthologs of SIKE and

FGFR1OP2 are conserved in metazoans, no function has been attributed to these factors in model organisms.

CTTNBP2/CTTNBP2NL

Cortactin is an actin filament-binding protein that has recently emerged as a critical factor that co-ordinates membrane dynamics and the restructuring of the cytoskeleton in response to stimuli from multiple signalling modules (Wu and Parsons 1993; Schuuring et al.

1993; Schuuring et al. 1998). Cortactin is therefore capable of simultaneously associating with actin and a series of target proteins through its helical repeats and SH3 domain respectively. Cortactin binding protein 2 (CTTNBP2) was initially identified in the rat brain as a 90-kDa protein that bound cortactin – an interaction that was identified by overlaying lysate from rat brain with glutathione S-transferase (GST)-Cortactin (Ohoka and Takai

1998). Moreover, subsequent co-immunoprecipitation analyses revealed that CTTNBP2 interacts with the SH3 domain of cortactin through its C-terminal proline-rich domain. The protein CTTNBP2NL (Cortactin binding protein 2, N-terminal-like) is 38% identical and

53% similar to the N-terminus of CTTNBP2 over 649aa. This N-terminal portion is predicted to contain a ~200 aa stretch of coiled-coil motifs. Additionally, although CTTNBP2NL has not been shown to associate with cortactin, sequence analysis of its C-terminus reveals that it contains the proline-rich domain as noted in CTTNBP2. Although it is tempting to speculate a role for these factors in the modulation of cortactin-dependent processes at the 17 cytoskeleton, there have been no reports to date on the in vivo function of both CTTNBP2 and CTTNBP2NL.

Mob3

Mob3 is a 25-kDa protein that was initially shown, by yeast-two hybrid and co- precipitation analysis, to specifically associate with the PP2A regulatory subunit, Striatin

(Moreno et al. 2001). Although Mob3 does not contain any domains of known function, its protein sequence exhibits limited homology to the α-subunit of clathrin adaptors - proteins that promote the formation of small vesicles within the cytoplasm (Pearse 1976). Moreover, through yeast-two hybrid analysis, Mob3 was also shown to interact specifically with two factors critical for facilitating normal trafficking of membrane vesicles within the cell, namely nucleoside-diphosphate kinase (NDPK) and Eps15 (Baillat et al. 2002). TAP AP-MS experiments by Goudreault et al. (2009) also report that Mob3 (and Striatin4) interacts with a specific light chain of the cytoplasmic dynein motor complex, DYNLL – an interaction whose functional significance remains to be defined in eukaryotes.

1.3 Eukaryotic Dynein Motors

Dyneins are evolutionarily conserved, minus-end-directed microtubule motors that use adenosine triphosphate (ATP) to mediate a variety of processes within the cell. These multi-subunit ATP-driven motors are classified, based on function, into two groups: the axonemal and cytoplasmic dyneins (Gibbons 1965; Sale et al. 1977; Paschal et al. 1987;

Paschal and Vallee 1987; Pazour et al. 1999; Sakakibara et al. 1999; Pfister et al. 2006). The axonemal dyneins constitute the majority of cellular dyneins and are required for regulating the microtubule-based structure that provides the motility required of all eukaryotic flagella and cilia (Wickstead and Gull 2007; reviewed in Gibbons 1996). Two cytoplasmic dynein 18 complexes have been identified to date. The most abundant cytoplasmic dynein, cytoplasmic dynein 1, is ubiquitously expressed in human tissues and is critical for many cellular functions such as mRNA localization, breakdown of the nuclear envelope, organization of the microtubule spindle, migration of the nucleus during mitosis, targeted transport of organelles and preserving the organization of the endoplasmic reticulum and Golgi apparatus

(Karki and Holzbaur 1999; Tracer et al. 2007; Lee et al. 2006). The second cytoplasmic dynein complex, cytoplasmic dynein 2, is expressed primarily in ciliated cells and has been shown to have a unique role in maintaining normal intra-flagellar transport (IFT), a process required for eukaryotic ciliary and flagellar assembly (Porter et al. 1999; Pazour et al. 1999; reviewed in Asai et al. 2009).

1.3.1 The Mammalian Cytoplasmic dynein 1 Complex

The core of the cytoplasmic dynein 1 complex is composed of two dynein heavy chains that homodimerize via regions in their N-termini. The dynein heavy chain belongs to the ATPases associated with cellular activities (AAA) family of ATPases (Neuwald et al.

1999). This large (~ 350 kDa) ATPase motor domain, which is located at the C-terminus of the heavy chain polypeptide, folds to form a ring of seven densities, six of which are AAA domains (Samso et al 1998). Although these multiple AAA domains of the heavy chain contain ATP binding consensus sites, hydrolysis of ATP at a single site (AAA1) has shown to be necessary and sufficient to drive motility along the microtubule (Gibbons et al. 1987;

Mocz and Gibbons 2001). The heavy chain is also capable of binding directly to the microtubule through a coiled-coil extension that protrudes between the AAA4 and AAA5 domains of the heptameric motor head (Gee et al. 1997). Homodimers of specific intermediate chains and light intermediate chains have been shown to associate with 19 overlapping regions of the N-terminus of the heavy chain – a region which also overlaps with the heavy chain dimerization domain (Tynan et al. 2000; Vallee et al. 1988; Habura et al.

1999). The exact stoichiometry of the intact complex remains controversial, however, it is generally thought that the complete motor complex consists of dimers of three light chain families, DYNLT, DYNLRB and DYNLL, which associate directly with the intermediate subunits (Lo et al. 2001; Mok et al. 2001). Note that although a single gene encodes for the heavy chain of cytoplasmic dynein 1, multiple genes encode for the intermediate, light intermediate and light chains. These multiple genes are also reported to generate a series of protein isoforms as a result of alternative splicing and protein phosphorylation (Koonce and

Samso 2004). Consequentially, it is likely that several distinct cytoplasmic dynein 1 holoenzymes with different subunit combinations can co-exist within a cell, each of which may provide a functional specificity for dynein regulation or cargo interactions (reviewed in

Caviston et al. 2006; Vale 2003). For example, a light intermediate chain isoform, DLIC-1, interacts specifically with the centrosomal protein, pericentrin, thereby promoting the recruitment of DLIC-1-containing dynein complexes to the centrosome (Tynan et al. 2000).

In contrast, a highly divergent DLIC isoform has been reported to interact specifically with dynein at flagellar structures where it is proposed to aid in IFT (Grissom et al. 2002; reviewed in Vale 2003). Further, cytoplasmic dynein 1 requires the activity of various other accessory proteins, such as the dynactin complex, for in vivo function. Dynactin is comprised of at least seven different proteins, which together act as an adaptor that connects the cytoplasmic dynein motor to a range of cargoes and is also thought to increase dynein motor processivity (Karki et al. 1995; Schroer and Sheetz 1991; King and Schroer 2000). The functional importance of dynactin as a dynein regulator is emphasized by the fact that 20 overexpression of dynactin subunits has been shown to result in defects in most, if not all, cytoplasmic dynein-mediated transport (Burkhardt et al. 1997). However, dynactin has also been reported to associate with several different protein partners in such a way that links dynein to various cargoes. For example, the dynactin subunit, Arp1, has been shown to specifically interact with Golgi-associated spectrin (Holleran et al. 2001) whereas another dynactin subunit, dynamitin, associates with bicaudal D, a protein that is tethered to GTP- loaded Rab6 on vesicle membranes (Hoogenraad et al. 2001). It is therefore now apparent that many diverse proteins interact with the cytoplasmic dynein 1 complex, many of which appear to be directly involved in regulating dynein-based transport. However, the molecular mechanisms exploited by these interactors to ensure normal dynein function and/or assembly remain to be clearly defined.

1.3.2 The DYNLL dynein light chain

In addition to their role as constituents of the cytoplasmic dynein 1 complex, a series of the dynein light chain subunits have been reported to perform alternative cellular functions that extend beyond their microtubule motor-dependent activities (Pfister et al. 2006). The most characterized example of this is the DYNLL subunit – a conserved 10 kDa protein that exists as two mammalian isoforms, DYNLL1 and DYNLL2 (reviewed in Pfister et al 2005).

Note that the designation, DYNLL, will be used when differentiation between isoforms is not relevant. DYNLL was first identified in axonemal dyneins (King and Patel-King 1995;

Piperno and Luck 1979; Pfister et al. 1982) and was then later reported to associate with the dynein intermediate chains in order to enhance the structural integrity of the dynein motor and to regulate the association with the dynactin processivity complex (Vaughan et al. 2001).

Because of its diverse functions, mutations that lead to partial loss of DYNLL appear to 21 result in a broad array of pleiotropic phenotypes, including morphogenetic defects and abnormal neurogenesis, whereas null mutations are lethal in many organisms (Dick et al.

1996; reviewed in King 2008). For example, genetic studies in both metazoans and the green algae, Chlamydomonas, reveal that DYNLL deficiencies result in defects in dynein-driven intraflagellar transport due to irregular flagellar assembly and function (Pazour et al. 1998).

Alternatively, hypomorphic mutations in the Drosophila DYNLL gene result in aberrant oogenesis and in abnormal patterning of the embryonic nervous system (Phillis et al. 1996).

In fact, a collection of recent proteomic and biochemical data reveal that DYNLL is incorporated into a number of diverse protein complexes, further suggesting that it has many distinct roles within the cell that are independent of its function in the dynein motor. For example, DYNLL proteins have been reported to be integral components of a series of multimeric complexes such as myosin V (Espindola et al. 2000), neuronal nitric oxide synthase (nNOS) (Jaffrey and Snyder 1996), Bim and Bmf apoptotic factors (Puthalakath et al. 2001), and a complex required for class I transcription in trypanosomes (Brandenburg et al. 2007). DYNLL proteins are even targeted during viral pathogenesis, for example, by the rabies virus P protein (Raux et al. 2000). In addition to its structural role in maintaining protein complex integrity, data reported by Jung et al. (2008) suggests that DYNLL may also function in regulating the cellular response to various signalling inputs, including activation of nuclear factor B (NF-kB) in response to changes in the cellular redox state (Jung et al.

2008). More specifically, the two mammalian DYNLL isoforms, DYNLL1 and DYNLL2, are expressed at very different levels in various tissues and differ in only six of their 89 residues. Studies reported by Puthalakath et al. (2001) suggest that these proteins exhibit isoform-dependent associations with both apoptotic factors and actin- and microtubule-based 22 molecular motors. However, this idea of isoform-specific function remains controversial as recent proteomic analysis reported that both DYNLL1 and DYNLL2 associate with cytoplasmic dynein in rat brain (Wilson et al. 2001). In fact, the functional significance of

DYNLL isoform diversity is probably much more complex than originally thought as the closely related protein, DNAL4/LC10, although was initially identified in axonemal dyneins, has recently been found to exhibit an extensive expression profile in mammals – a property that is inconsistent with a unique role in motile cilia or flagella (Tanner et al. 2008). There is considerable reason to suspect that the diverse processes affected by DYNLL function are due, at least in part, to its obligate dimeric state. The DYNLL monomer consists of two α- helices that are flanked by β strands: one β strand is N-terminal to the helices and four β strands are C-terminal to the helices (Liang et al. 1999). The crystal structure of the DYNLL dimer shows that its interface is composed of two β sheets that each contain four strands from one monomer and a fifth strand that crosses over from the second monomer (Liang et al. 1999). This conformation results in the generation of two identical grooves that facilitate binding of target proteins. Despite being evolutionarily conserved, the exposed helical surfaces of the DYNLL dimer do not seem to be important for protein binding as no interactions at these sites have been reported. It was initially hypothesized that the function of the DYNLL dimer was to mediate attachment of cargoes to the dynein motor (Schnorrer et al. 2000). Structurally, this would imply that one binding groove associates with the intermediate chain of the dynein motor and the second groove mediates an interaction with the target cargo protein. However, recent biochemical studies of the DYNLL dimer in complex with different target proteins suggest that it is both structurally and thermodynamically unlikely that DYNLL is simultaneously bound to both dynein and cargo 23

(Benison et al. 2007; Williams et al. 2007). This data is also supported by the fact that most mammalian DYNLL is not associated with dynein in the cell (King et al. 1996). Although still controversial, it is now believed that DYNLL has a critical role in promoting stability in disordered regions of target proteins and in regulating dimerization of proteins within macromolecular complexes (Barbar 2008). It is important to note, however, that DYNLL does not seem to function solely to preserve the structure of multi-protein assemblies. In fact, data from several groups have proposed a regulatory function for DYNLL in various processes. For example, Jaffrey et al. (1996) suggest a DYNLL-dependent control of nNOS function via regulation of the enzyme’s oligomeric state. Alternatively, DYNLL1 has been reported to modulate the activation of NFkB in response to changes in the cellular redox state by altering its capacity to interact with NFkB (Jung et al. 2008). These examples therefore support the idea that the functions of DYNLL extend beyond a role in preserving protein complex structure. Moreover, it appears that only the dimeric DYNLL complex is capable of associating with protein targets. This data has led to multiple studies on understanding if and how the monomer-dimer equilibrium of the cellular DYNLL pool functions to control

DYNLL-dependent interactions. For example, It has been reported that the conserved Ser88 of DYNLL1 is phosphorylated in response to the epidermal growth factor-mediated activation of the serine/threonine kinase PAK1 – a modification that is likely to function in the enhanced division of breast cancer cells (Vadlamundi et al. 2004). In fact, in vitro studies of Ser88 Glu88 phosphomimetic mutants revealed that the DYNLL monomer-dimer transition is modulated in response to the phosphorylation status of this residue (Song et al.

2008; Song et al. 2007; reviewed in King 2008). It is important to note, however, that the reported phosphorylation of DYNLL1 by PAK1 may be challenged by studies that suggest 24 that association of PAK1 with DYNLL1 may obstruct the Ser88 phosphorylation site on

DYNLL1 from the kinase active site. This data is also supported by reports that indicate that

PAK1 is not capable of phosphorylating recombinant Drosophila DYNLL in vitro (Lightcap et al. 2008).

As mentioned, DYNLL has been reported to associate with many seemingly functionally unrelated proteins. A series of biochemical studies have revealed that most of these DYNLL interactors contain either a (K/R)XTQT or a G(I/V)QVD motif – sequences that have since been characterized as DYNLL-binding motifs (Rodriguez-Crespo et al.

2001). To understand how these interactors associate with DYNLL, the three-dimensional structure of DYNLL complexed with peptides of various target proteins, were solved both by crystallography and multidimensional nuclear magnetic resonance (NMR) techniques (Liang et al. 1999; Fan et al. 2001; Fan et al. 1998). Specifically, structural analysis of the

DYNLL/nNOS and DYNLL/Bim complexes reveal that both (K/R)XTQT and G(I/V)QVD consensus motifs bind as a sixth β strand at the dimeric DYNLL interface (reviewed in

Benison et al. 2007; Benison et al. 2008). These structures also reveal that the Glutamine (Q) in these DYNLL-binding motifs creates strong hydrogen bonds with the DYNLL resides

Glu35 and Lys36 - a region that corresponds to a conserved site in the binding groove of the

DYNLL dimer (Fan et al. 2001; reviewed in Navarro-Lerida et al. 2004). Despite these initial findings, how the binding sites of the DYNLL interface are capable of recognizing two distinct consensus sequences remains unclear and therefore warrants a more systematic comparison between the structures of the various DYNLL complexes.

1.4 Objective

The tight regulation of protein phosphorylation is essential for the coordination of most, if not all, the biochemical processes of the eukaryotic cell. The PP2A phosphatase functions to dephosphorylate specific target proteins in response to stimuli-driven changes in dynamic signalling networks. Understanding how PP2A is regulated to control both its temporal and spatial functions towards specific substrates lies, in part, to its association with its distinct regulatory subunits. The recent identification of a higher-order sub-network surrounding the PP2A-Striatin holoenzyme, termed STRIPAK, provides initial insight into potentially novel mechanisms for PP2A function and regulation.

This work focuses on the general question: what proteins and/or complexes interact with STRIPAK? Here, I provide preliminary data that not only addresses this key question but that also elaborates on the characterization of a specific interaction between the

STRIPAK protein, CTTNBP2NL, and a light chain subunit of the cytoplasmic dynein 1 complex, DYNLL. This work will serve as a foundation for further studies on the structural and functional characterization of STRIPAK and will inevitably aid in defining novel mechanisms of regulation for the human PP2A phosphatase. 26

Figure 1.1 The affinity purification and mass spectrometry (AP-MS) procedure. (A) A diagram outlining the experimental steps of the AP-MS approached used in this study. A FLAG-tagged protein of interest is stably expressed in HEK293 cells and the lysate is immunopurified for the FLAG tag. The isolated protein complexes are digested with sequencing-grade Trypsin and the resulting peptide mixture is separated and ionized by reverse-phase chromatography before it enters into the mass spectrometry for peptide sequencing. The acquired MS data is analyzed on peptide sequencing software which assigns peptides to their corresponding protein identification. (B) The iterative FLAG-tagging approach for the identification of protein complexes. This research was originally published in Molecular and Cellular Proteomics. Goudreault M, D'Ambrosio LM, Kean MJ, Mullin MJ, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Molecular and Cellular Proteomics. 2009. pp. 175-71. © The American Society for Biochemistry and Molecular Biology. 27

Figure 1.2 Summary of the interactions within STRIPAK as detected by AP-MS with FLAG-tagged STRIPAK proteins as identified by Goudreault et al. 2009. Green nodes represent the previously characterized association between PP2AC, PP2A A, Striatins and Mob3; Pink nodes highlight the previously characterized interactions between CCM3 and the GCK-III kinases. Bait to prey relationship is indicated by the directionality of the arrows. Self-pointing arrows indicate that a self-interaction was detected. This research was originally published in Molecular and Cellular Proteomics. Goudreault M, D'Ambrosio LM, Kean MJ, Mullin MJ, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Molecular and Cellular Proteomics. 2009. pp. 175-71. © The American Society for Biochemistry and Molecular Biology.

CHAPTER II

MATERIALS & METHODS

28 29

2. Methods:

2.1 Plasmids and Mutagenesis

All plasmids and primers used in this study are reported in Table 2.1 and 2.2 respectively. All constructs were generated by using the Pfu DNA polymerase (BioBasics) in a single PCR reaction using the appropriate primers containing the desired restriction endonuclease sites. PCR products were extracted with phenol, digested with the co- oresponding restriction endonucleases (NewEngland BioLabs) and purified by standard agarose gel extraction methods (BioBasics). The gel purified, digested PCR products were ligated into a Calf Intestinal Alkaline Phosphatase (CIP)-treated, gel purified parent vector containing the desired peptide tag for 18 hours at room temperature. All constructs were partially sequenced.

2.2 Antibodies

All antibodies used in this study are outlined in Table 2.3.

2.3 Cell Culture and Plasmid Transfection

HEK293, HEK293T, CV1 and Vero cells were cultured in high glucose Dulbecco’s

Modified Eagle’s Medium (4500 mg/L glucose, 4 mM L-glutamine, sodium pyruvate,

ThermoScientific) supplemented with 10% fetal bovine serum (Invitrogen) at 5% CO2 humidified atmosphere at 37°C. Stable and transient plasmid transfections were performed with Lipofectamine PLUS (Invitrogen) for HEK293 and HEK293T cells or with

Lipofectamine 2000 (Invitrogen) for CV1 and Vero cells according to the manufacturer’s protocol. All cell lines were seeded in a 6-well format and transfected at a cell confluency of

90-95%. Cells were harvested 48 hours post-transfection unless otherwise indicated.

2.4 Generation of HEK 293 Stable Cell Lines 30

All HEK293 stable cell lines used in this study were generated by A.-C. Gingras.

Low passage HEK293 cells (ATCC CRL1573) were seeded in a 6-well format and transfected with 1 ug plasmid DNA as outlined in section 2.3. Note that all plasmids encode for a FLAG-tagged recombinant protein of interest. Cells were re-plated at a low dilution 24 hours post-transfection and were then placed under G418 selection (750 μg active G418/mL

DMEM, Inalco) 48 hours post-transfection. Approximately 14 days after selection, cells were trypsinized and expanded for stock generation. Expression of FLAG-tagged recombinant proteins was analyzed by immunoblotting with mouse anti-FLAG antibody (see section 2.7).

2.5 RNA Interference

HEK293 cells were transfected with siRNA (20nM) using Opti-MEM reduced serum

(Invitrogen) and RNAiMAX (Invitrogen) as outlined in the manufacturer’s protocol. Cells were harvested 72 hours post-transfection as indicated. Target sequences for all RNA interference oligonucleotides are indicated in Table 2.4. Individual siRNAs targeting human

CTTNBP2NL were purchased from the siGENOME Set of 4 Upgrade siRNA

(DKFZP547A023, ThermoScientific). Reduction of protein levels was monitored by immunoblotting with antibodies targeted to the endogenous protein of interest.

2.6 Mammalian Cell Lysis

Cells were washed in ice-cold 1X PBS, harvested by scraping, and centrifuged at

1500 rpm for 5 minutes. Cell pellets were lysed in lysis buffer (10% glycerol, 50 mM

Hepes-KOH pH 8.0, 100 mM KCl, 2 mM EDTA pH 8.0, 0.1% Nonidet P-40, 10 mM NaF,

0.25 mM NaOVO3, 50 mM β-glycerophosphate) supplemented with 2 mM DTT, 1 mM

PMSF, 1:500 dilution of protease inhibitor cocktail (Sigma), 5 nM okadaic acid, and 5 nM calyculin A) at 150 µL lysis buffer/60-mm plate. Resuspended pellets were incubated on ice 31 for 30 minutes followed by two cycles of freezing on dry ice and thawing at 37°C. (Note that samples prepared for mass spectrometry analysis were lysed in 1 mL lysis buffer/150- mm plate and were lysed passively by incubation end-over-end at 4°C for 30 minutes). The lysate was cleared by centrifuging samples at 13,000 rpm for 20 min at 4°C. Protein concentration of the cleared lysate was determined using BSA and the Bradford Protein

Assay reagent (BioRad).

2.7 Immunoprecipitation of Mammalian Cell Lysate

Anti-FLAG M2 Affinity Gel beads (SIGMA) were pre-washed 3 times in lysis buffer

(see section 2.6). 10 ul packed beads per 10 mg lysate were incubated end-over-end for 1.5 hours (for immunoblot analysis) or 3 hours (for mass spectrometric analysis) at 4°C. Beads were pelleted at 3000 rpm for 2 minutes at 4°C and were then washed end-over-end 3 times in lysis buffer at room temperature (1 minute/wash). For immunoblot analysis, the immunoprecipitate was eluted from beads in 3 times bead volume of 2X laemmli sample buffer (60 mM Tris-HCl pH 6.8, 2% SDS, 10% Glycerol, 5% 2-mercaptoethanol, 0.02%

Bromophenol Blue). Protein samples were boiled at 100°C for 10 minutes and centrifuged at

13, 000 rpm for 1 minute. For mass spectrometric analysis, beads were washed twice in rinsing buffer (50 mM ammonium bicarbonate pH 8.0, 75 mM KCl), eluted in 3 times bead volume of 0.5 M ammonium hydroxide (pH > 11.0) and lyophilized.

2.8 Immunoblot Analysis

Protein samples were separated by Sodium Dodecyl Sulphate-Polyacrylamide Gel

Electrophoresis (SDS-PAGE) using the BioRad Minigel system. Separated proteins were then transferred to nitrocellulose membrane (PerkinElmer) using the BioRad Mini Trans-Blot

Electrophoretic Transfer System (100V for 1 hr on ice). Successful protein transfer was 32 monitored by staining membranes with 0.2% Ponceau S. The membrane was then blocked in blocking buffer (5% non-fat dried milk in 1X TBST (Tris-HCl pH 7.5, NaCl, 0.1% Tween

20)) for 1 hour at room temperature with gentle agitation. The blocked membrane was incubated overnight at 4°C with the desired primary antibody diluted to the appropriate final concentration in blocking buffer. The membrane was then washed 3 times with gentle agitation in 1X TBST for 10 minutes per wash. Membranes were then incubated for 1 hr at room temperature with horseradish-peroxidase (HRP) anti-mouse or anti-rabbit antibodies at a dilution of 1:5000 in blocking buffer, followed by 3 washes in 1X TBST for 10 minutes per wash. Membranes were then soaked for 1 minute in diluted LumiGOL Reagent and

Peroxide (dilution of 1:20, Cell Signalling) and exposed on T2 Blue Medical X-ray Film

(FujiFilm) for detection of HRP-bound proteins.

2.9 Sample Digestion and Mass Spectrometric Analysis

A stably expressed FLAG-tagged protein of interest was immunoprecipitated from

HEK293 cells as noted in section 2.7. The lyophilized samples were resuspended in 50 mM ammonium bicarbonate, pH 8.0 and digested at 37°C with sequencing-grade modified

Trypsin (0.75 ug for 16 hours followed by an additional 0.25 ug for 2 hours, SIGMA). The digested samples were lyophilized, resuspended in HPLC-grade H2O and then lyophilized again until dry. The samples were then resuspended in HPLC Buffer A (2% Acetonitrile,

0.1% Formic Acid) and loaded onto capillary columns (75 um inner diameter fused silica,

Innovaquartz) packed in-house with Magic 18AQ (5 um, 100 A, Polymicrom). MS/MS data was acquired by a data-dependent program (65 minute – 2 hour acetonitrile 2-40% gradient method) on a ThermoFinnigan LTQ with the aid of a Proxeon NanoSource and an Agilent

1100 capillary pump. The RAW files were then searched with the MASCOT search engine 33

(Matrix Sciences, London, UK) against the human NCBI Reference Sequence (RefSeq) database (release 29) with a precursor ion mass tolerance of 3.0 and a fragment ion mass tolerance of 0.8. Trypsin specificity of two missed cleavages was permitted and methionine oxidation was selected as a variable modification. Data was then imported into the

Laboratory Information Management System ProHits, Analyst module (Liu et al., manuscript in preparation) and then exported to Excel files for manual annotation. Proteins detected in the FLAG datasets were eliminated from final lists of intereactors. For all datasets, only those proteins that were detected in all replicates and with an averaged MASCOT score 80, >

2 averaged unique peptides and 35% project frequency were reported.

2.10 Indirect Immunofluorescence and Microscopy

CV1 or Vero cells were seeded onto 22 X 22-mm coverslips and transfected with 1 ug plasmid DNA at a cell confluency of 80-90%. 24 hours post-transfection, cells were fixed in either (i) 4% paraformaldehyde (PFA) at room temperature for 10 minutes and then permeabilized with 0.2% Triton-X 100 in 1X PBS for 5 minutes or (ii) in ice-cold 100% methanol for 10 minutes. Fixed cells were washed twice in 1X PBS for 10 minutes with gentle agitation at room temperature and then blocked with blocking solution (0.2% gelatin from cold water fish (FGS) in 1X PBS) for 24 hours at 4°C. Cells were then incubated with the anti-HA monoclonal antibody or anti-FLAG monoclonal antibody at a dilution of 1:1000 for 1 hour at 37°C. Cells were then washed twice in blocking solution at room temperature for 10 minutes per wash with moderate agitation and were then incubated with a fluorophore- conjugated anti-mouse antibody (Alexa 488 or Texas Red) at a dilution of 1:500 in blocking solution for 1 hour at 37°C. Note that Phalloidin Alexa 488 was combined with the fluorophore-conjugated anti-mouse antibody at a dilution of 1:500 when co-staining with 34 actin was desired. Cells were then washed once in blocking solution with Hoechst 33342

(final concentration of 1 ug/ml) for 10 minutes with gentle agitation at room temperature and were then washed twice with blocking solution for 10 minutes per wash at room temperature.

Mounting media (Prolong Gold Anti-fade Reagent, Invitrogen) was used to apply fixed cells to microscopy slides. Images were acquired on a fluorescence microscope (Nikon Eclipse

80i) at a magnification of 60X and an exposure of 100 ms (unless otherwise indicated) using the NIS-Elements BR 3.0 software (Build 505). Images were merged in Adobe Photoshop

CS2 (version 9.0.2) when necessary.

Name Vector Cloning Sites FLAG-CTTNBP2NL* pcDNA3-FLAG EcoRI/NotI FLAG-STRIP1 pcDNA3-FLAG EcoRV/NotI FLAG-STRN pcDNA3-FLAG AscI/NotI FLAG-STRN3 pcDNA3-FLAG EcoRI/NotI FLAG-CCM3 pcDNA3-FLAG AscI/NotI FLAG-SIKE pcDNA3-FLAG EcoRI/XhoI FLAG-TRAF3IP3 pcDNA3-FLAG EcoRI/NotI FLAG-MOB3 pcDNA3-FLAG AscI/NotI FLAG-PP2AAα pcDNA3-FLAG AscI/NotI FLAG-PP2ACα pcDNA3-FLAG EcoRI/NotI FLAG-SLMAP pcDNA3-FLAG EcoRI/NotI FLAG-STK24 pcDNA3-FLAG EcoRI/NotI FLAG-STK25 pcDNA3-FLAG EcoRI/NotI FLAG-MST4 pcDNA3-FLAG AscI/NotI FLAG-DYNLL1 pcDNA3-FLAG EcoRI/NotI FLAG-DYNLL2 pcDNA3-FLAG EcoRI/NotI FLAG-PP4R2 pcDNA3-FLAG PmeI/PacI FLAG-IRF3 pcDNA3-FLAG EcoRI/NotI HA-CTTNBP2NL pcDNA3-FLAG EcoRI/NotI HA-STRIP1 pcDNA3-FLAG EcoRV/NotI HA-STRN pcDNA3-FLAG AscI/NotI HA-STRN3 pcDNA3-FLAG EcoRI/NotI HA-CCM3 pcDNA3-FLAG AscI/NotI HA-SIKE pcDNA3-FLAG EcoRI/XhoI HA-TRAF3IP3 pcDNA3-FLAG EcoRI/NotI HA-MOB3 pcDNA3-FLAG AscI/NotI HA-PP2AAα pcDNA3-FLAG AscI/NotI HA-PP2ACα pcDNA3-FLAG EcoRI/NotI HA-SLMAP pcDNA3-FLAG EcoRI/NotI HA-STK24 pcDNA3-FLAG EcoRI/NotI HA-STK25 pcDNA3-FLAG EcoRI/NotI HA-MST4 pcDNA3-FLAG AscI/NotI HA-DYNLL1 pcDNA3-FLAG EcoRI/NotI HA-DYNLL2 pcDNA3-FLAG EcoRI/NotI GST-CTTNBP2NL pGEX-2T-TEV-Hta EcoRI/NotI

Table 2.1 DNA plasmids used in this study. *All FLAG-CTTNBP2NL truncation mutants were generated from this construct. 36

Name Primer Sequence CTTNBP2NL 70-639 ATGATTGAAGAACGCTATGGAAAATATAAC CTTNBP2NL 170-639 ATGCAGAAGAAGCTCTCTAGTCAGCTG CTTNBP2NL 195-639 ATGATGCTAGTGCTTGAGTGC CTTNBP2NL 210-639 ATGGAAGGACAGAAGGCAGGA CTTNBP2NL 225-639 ATGGAAGGACAGAAGGCAGGA CTTNBP2NL 285-639 ATGGAAGAGAACCGGACCAAA CTTNBP2NL 1-170 TCCTATTCCAGCTGACTAGAGAG CTTNBP2NL 1-413 TCCTACAGTGAGCTCCCACTGGAAGAG CTTNBP2NL 1-464 TCCTATTTGTGGCGAGCTGCATG CTTNBP2NL 1-479 TCCTACTGTAGGCCACTGGCTTG CTTNBP2NL 1-494 TCCTAAGAGTTGTCTATGAGGGT CTTNBP2NL 1-509 TCCTAGGAGAGCACCTGAGTGAC CTTNBP2NL 1-524 TCCTAGTTGGGAGAGACTGGCTT CTTNBP2NL 1-539 TCCTAGGCAGTGTTGGCTAGATT CTTNBP2NL 1-554 TCCTACACTTTCCCTGGAGTAGG CTTNBP2NL 1-569 TCCTAGGTTGGGGACTTGATTCC CTTNBP2NL 1-584 TCCTACTTGGGTGGGATGGGTGG CTTNBP2NL 1-599 TCCTAGGTCAATGGAGTGGTAGC CTTNBP2NL 1-614 TCCTAAAGGTCTTCTGCAGTGGT CTTNBP2NL 1-629 TCCTAATCCTTACCATTTGCTAC

Table 2.2 Primers used for generating FLAG-CTTNBP2NL truncation mutants.

Antibody Name Clone No. Distributor Raised Against Isotype

FLAG M2 F3165 SIGMA DYKDDDDKG Mouse IgG1 HA.11 16B12 Covance YPYDVPDYA Mouse IgG1

CTTNBP2NL 1863 B4 - GST-CTTNBP2NL 1-413 (human) Rabbit IgG STRIP1 1811 B3 - GST-STRIP 93-387 (human) Rabbit IgG

Mob3 1809 B3 - GST-MOB3 1-225 (human) Rabbit IgG STRN (Striatin) 6 BD Biosciences STRN 450-600 (human) Mouse IgG2b MST4 9 BD Biosciences MST4 296-416 (human) Mouse IgG1 SG2NA (Striatin3) 4956 Cell Signaling Tech. SG2NA 1-240 (human) Mouse IgG1 PP2A A 2041 Cell Signaling Tech. KLH-PP2A (human) Rabbit IgG TIP41 - - Full length Tip41 (human) Rabbit IgG Anti-mouse NA913V GE Healthcare Mouse IgG Donkey IgG Anti-rabbit NA934 GE Healthcare Rabbit IgG Donkey IgG Alexa 488 52103A Invitrogen Mouse IgG Goat IgG Texas Red-X 51914A Invitrogen Mouse IgG Goat IgG

Table 2.3 Antibodies used in this study.

Gene Name Species RefSeq Product Code Target Sequence Distributor CTTNBP2NL Human NM_018704 D-013834-01 AGAAGAAGCUCUCUAGUCA ThermoScientific CTTNBP2NL Human NM_018704 D-013834-02 GCACAAACCCACUCUCUAU ThermoScientific CTTNBP2NL Human NM_018704 D-013834-03 GAGAAGAGCCGGGUGAGUA ThermoScientific CTTNBP2NL Human NM_018704 D-013834-04 CAUCCAUGCUAGUGCUUGA ThermoScientific

Table 2.4 RNAi oligonucleotides used in this study.

CHAPTER III

RESULTS

39 40

PREAMBLE:

I began my investigations by confirming the protein composition of STRIPAK - a novel PP2A-containing complex. This work was initiated as part of a collaborative project within the Gingras laboratory that emerged following the identification of novel interactors for the catalytic PP2A subunit by high-density mass spectrometry. Here I describe that

STRIPAK can form at least two mutually exclusive complexes, one of which contains the poorly characterized Cortactin Binding Protein 2 N-terminal Like (CTTNBP2NL) protein.

The results presented in this work suggest that the first 170 amino acids of CTTNBP2NL are sufficient for establishing an interaction with STRIPAK and that CTTNBP2NL may localize to the actin cytoskeleton in a STRIPAK-independent manner. I then report on a novel protein interaction detected between STRIPAK and one of the light chains of the dynein microtubule motor known as DYNLL. I also reveal that this interaction between STRIPAK and DYNLL may be bridged, at least in part, by CTTNBP2NL. Taken together, my results reveal the higher-order protein interaction network surrounding the STRIPAK complex, they provide initial insight into how STRIPAK associates with CTTNBP2NL and DYNLL and they also highlight a potential role for STRIPAKCTTNBP2NL in the regulation of actin- dependent process. These results are significant as they will ultimately assist in defining the molecular pathways in which STRIPAKCTTNBP2NL functions and, more importantly, how its cellular activities are regulated to ensure the tight control of its targeted biological processes.

3. Results:

3.1 FLAG-tagged STRIPAK proteins interact with Striatin in HEK293 cells

As described in section 1.2, iterative affinity-purification and sample analysis by mass spectrometry was used to generate a high-density interaction map surrounding the catalytic PP2A subunit. Analysis of the acquired mass spectrometry data revealed the protein constituents of the novel PP2A-containing complex, STRIPAK (Goudreault et al.

2009). In order to confirm the protein components of STRIPAK as detected in our mass spectrometry results, I performed a series of immunoprecipitation and immunoblotting analyses. Specifically, each STRIPAK protein was cloned into the pcDNA3 vector containing an N-terminal FLAG peptide tag (M. Goudreault) and was stably expressed in

HEK293 cells (A.-C. Gingras). Pools of each of these FLAG-tagged STRIPAK stable cells were then lysed and the cleared lysate was immunopurified with FLAG-M2 agarose beads.

The immunoprecipitates were then resolved by SDS-PAGE, transferred to nitrocellulose and then immunoblotted for the endogenous Striatin protein. The result from this experiment revealed an interaction between each FLAG-tagged STRIPAK protein with the endogenously expressed Striatin protein (Figure 3.1A). These interactions were specific as the negative controls, FLAG-alpha4 and pcDNA3-FLAG, failed to co-precipitate Striatin. This indicates that the interaction between the FLAG-tagged STRIPAK proteins and Striatin is not due to the presence of the FLAG epitope or to the relatively moderate overexpression of the FLAG- tagged recombinant proteins. Note that the comparatively low level of Striatin in FLAG-

PP2AC and FLAG-PP2AA purifications is most likely due to the many alternate protein complexes in the cell in which the PP2AC and PP2AA subunits assemble. All the FLAG- tagged STRIPAK proteins were expressed at relatively similar protein levels with the 44 exception of FLAG-CTTNBP2 and FLAG-SLMAP which were both consistently expressed at relatively low protein levels (but were still capable of co-precipitating Striatin upon prolonged exposure) (Figure 3.1B). These results are consistent with our mass spectrometry data and therefore confirm, by an alternative experimental approach, that Striatin associates specifically with the proteins of the STRIPAK complex.

3.2 STRIPAK forms at least two mutually exclusive sub-complexes in HEK293 cells

Purified FLAG immunoprecipitates from FLAG-CTTNBP2 or FLAG-CTTNBP2NL stable cell lines contained peptides corresponding to most STRIPAK proteins as revealed by mass spectrometry analysis. These isolated samples, however, contained no detectable peptides corresponding to SLMAP, SIKE or FGFR1OP2. In contrast, FLAG immunoprecipitates from cells stably expressing the SLMAP-related protein, FLAG-

TRAF3IP3, captured peptides corresponding to SIKE and FGFR1OP2 but no peptides of

CTTNBP2 or CTTNBP2NL were detected. FLAG-SIKE immunoprecipitates exhibited a similar peptide profiles as those from FLAG-TRAF3IP3 as in they contained a relatively large number of peptides for SLMAP and FGFR1OP2 and no detectable peptides of

CTTNBP2 or CTTNBP2NL (Table 3.1). These data suggest that STRIPAK associates mutually exclusively with two distinct sub-complexes – one that contains CTTNBP2 and

CTTNBP2NL and the other containing SIKE/FGFR1OP2 and SLMAP/TRAF3IP3. To support this model, I co-transfected HA-tagged CTTNBP2NL or HA-tagged TRAF3IP3 with selected FLAG-tagged STRIPAK proteins (SIKE, Mob3, Striatin3, STRIP1, STK24,

CTTNBP2NL, TRAF3IP3) or with the FLAG-tagged negative controls (PP4R2, pcDNA3-

FLAG). The cells were then lysed and the cleared lysate was immunopurified with FLAG-

M2 agarose beads. The immunoprecipitate was separated by SDS-PAGE and analysed for 45 co-precipitating HA-tagged proteins by immunoblotting with an anti-HA antibody. As expected, both HA-CTTNBP2NL and HA-TRAF3IP3 were efficiently recovered in FLAG-

Mob3, FLAG-Striatin3, FLAG-STRIP1 and FLAG-STK24 immunoprecipitates but not in the negative control samples. In agreement with our mass spectrometry results, HA-

CTTNBP2NL was not detected in FLAG-SIKE or FLAG-TRAF3IP3 immunoprecipitates

(Figure 3.2A). Conversely, HA-TRAF3IP3 co-precipitated with FLAG-SIKE but not with

FLAG-CTTNBP2NL (Figure 3.2B). This is consistent with our model that STRIPAK forms mutually exclusive interactions with (i) SIKE, FGFR1OP2, SLMAP/TRAF3IP3 or with (ii)

CTTNBP2NL and CTTNBP2.

3.3 STRIPAK proteins localize to distinct sub-cellular compartments in CV1 cells

As an initial effort to characterize the function of STRIPAK in mammalian cells, the cellular localization of several STRIPAK proteins was investigated. HA-tagged STRIPAK proteins were transiently transfected in CV1 cells and their cellular localization was detected by indirectly staining for the HA epitope. Staining for HA-STRIP1 revealed a diffuse signal throughout the cytoplasm of the cell whereas HA-Striatin3- and HA-SLMAP-expressing cells, although exhibiting a relatively subtle cytoplasmic signal, displayed an enrichment at the cytoplasmic periphery of the nuclear membrane. In contrast, staining for HA-SIKE and

HA-MST4 revealed a localization of these proteins to what appeared to be the membranes of the Golgi apparatus. This enrichment of HA-SIKE at the membrane of the Golgi apparatus was then confirmed by co-staining HA-SIKE-expressing cells with the Golgi membrane protein, Golgin-97 (Figure 3.4). Note that although not investigated in these studies, a localization of MST4 at the Golgi membrane has been observed from our group and others

(M. Kean, unpublished data, Preisinger et al. 2004). Contrastingly, staining for HA- 46

CTTNBP2NL revealed its distinct, and apparently exclusive, presence at the cytoskeleton network (Figure 3.3). Comparable localization patterns at the cytoskeletal network was also observed in CV1 and Vero cells transiently expressing N-terminal GFP-tagged or FLAG- tagged CTTNBP2NL proteins which suggests that this cytoskeletal enrichment is consistent between different mammalian cell types and not due to the addition of a particular peptide tag. This set of experiments therefore reveals that the different STRIPAK proteins tested localize to distinct compartments within the cell.

3.4 HA-CTTNBP2NL co-localizes with actin filaments in CV1 cells

To further characterize the cytoskeletal localization of HA-CTTNBP2NL identified in section 3.3, CV1 cells were transiently transfected with HA-CTTNBP2NL and were co- stained for the HA epitope and the actin filaments. Merged signals revealed a striking co- localization of HA-CTTNBP2NL with the actin filaments (Figure 3.5). This observed co- localization is not likely to be due to artefacts caused by the HA tag because cells transfected with pcDNA3-HA did not exhibit any residual signal at the actin filaments. Also, it is unlikely that the enrichment of HA-CTTNBP2NL at the actin filaments is due to leakage of emitted signals through ectopic filters because the spectral profiles for the filters used in this study do not overlap. Note that the enrichment of HA-CTTNBP2NL and FLAG-

CTTNBP2NL at the actin network was also observed in transiently transfected Vero cells which suggests that this localization pattern is consistent between different mammalian cell types and is not due to the addition of a particular peptide tag.

3.5 Amino acids 1-170 of CTTNBP2NL are sufficient for establishing an interaction

with STRIPAK 47

To map the region of CTTNBP2NL that is required for binding to STRIPAK, a series of

N- and C-terminal truncated forms of CTTNBP2NL were cloned into the mammalian pcDNA3 vector containing an N-terminal FLAG tag (Figure 3.6). The full length and truncated forms of FLAG-CTTNBP2NL were transiently expressed in HEK293T cells and the lysate from these cells were immunopurified with FLAG-M2 agarose beads. The isolated samples were eluted directly in Laemmli sample buffer, separated by SDS-PAGE and analyzed for co-precipitating STRIPAK proteins by immunoblotting with antibodies targeted to Mob3, STRIP1 and Striatin3. As expected, full length FLAG-CTTNBP2NL interacted with the endogenously expressed STRIPAK proteins Mob3, STRIP1 and Striatin3. All the

C-terminal truncated forms of FLAG-CTTNBP2NL were still able to establish an interaction with Mob3, STRIP1 and Striatin3 (Figure 3.7) whereas no interaction was detected between these STRIPAK proteins with the N-terminal truncated forms of FLAG-CTTNBP2NL

(collective deletion of amino acids 1-285) (Figure 3.8). This indicates that the first 70 amino acids of CTTNBP2NL are necessary for mediating an interaction with the STRIPAK proteins

Mob3, STRIP1 and Striatin3. To determine if amino acids 1-70 of CTTNBP2NL are sufficient for establishing an interaction with Mob3, STRIP1 and Striatin3, a FLAG-tagged mutant form of CTTNBP2NL was generated containing only the amino acids 1-70 (FLAG-

CTTNBP2NL 1-70). This mutant, however, was not capable of expressing in HEK293T cells. Therefore, a slightly larger FLAG-tagged mutant form of CTTNBP2NL was generated that contained the amino acids 1-170 (FLAG-CTTNBP2NL 1-170). This mutant was successfully expressed in HEK293T cells and the lysate from these cells was immunopurified with FLAG-M2 agarose beads. The immunoprecipitate was separated by

SDS-PAGE, transferred to nitrocellulose and immunoblotted with antibodies targeted to 48

Mob3, STRIP1 and Striatin3. As noted in Figure 3.9, this FLAG-CTTNBP2NL 1-170 construct was capable of establishing an interaction with Mob3, STRIP1 and Striatin3, but not with the negative controls FLAG-IRF3 or pcDNA3-FLAG. This indicates that amino acids 1-170 of FLAG-CTTNBP2NL are necessary and sufficient for establishing an interaction with the STRIPAK proteins Mob3, STRIP1 and Striatin3.

3.6 Localization of CTTNBP2NL to actin filaments is STRIPAK independent

Knowing that truncation of the first N-terminal 70 amino acids of CTTNBP2NL abolishes its capacity to interact with selected STRIPAK proteins and that CTTNBP2NL is enriched at the actin network, I next wanted to determine if the localization of CTTNBP2NL at the actin filaments is dependent on its interaction with STRIPAK. To do this, an N- terminal FLAG-tagged construct of CTTNBP2NL that had been deleted for its first N- terminal 170 amino acids (FLAG-CTTNBP2NL 170-639) was transiently expressed in Vero cells. Note again, as reported in section 3.5, that this FLAG-CTTNBP2NL 170-639 construct cannot establish an interaction with STRIPAK. Moreover, this FLAG-

CTTNBP2NL 170-639 construct was used in this experiment as opposed to FLAG-

CTTNBP2NL 70-639 because its protein product is expressed more stably in HEK293T cells relative to the protein product of FLAG-CTTNBP2NL 70-639. The cellular localization of

FLAG-CTTNBP2NL 170-639 was then visualized by fluorescence microscopy by indirectly staining for the FLAG epitope. The microscopy images from this study indicate that FLAG-

CTTNBP2NL 170-639 is capable of localizing to the actin filaments (Figure 3.10). The enrichment of FLAG-CTTNBP2NL 170-639 to the actin fibres was comparable to that observed for the full length FLAG-CTTNBP2NL (Figure 3.10). 49

As reported in section 3.5, the FLAG-CTTNBP2NL 1-170 construct is sufficient for establishing an interaction with STRIPAK. I therefore transiently expressed this FLAG-

CTTNBP2NL 1-170 construct in Vero cells, stained for the FLAG epitope and then monitored its cellular localization by fluorescence microscopy to again, determine if the enrichment of CTTNBP2NL at the actin network is STRIPAK-dependent. Images from this study revealed that the majority of FLAG-CTTNBP2NL 1-170 was dispersed throughout the cytoplasm and nucleus (Figure 3.10). Taken together, these results indicate that (i)

CTTNBP2NL localization to actin fibres is independent of its interaction with STRIPAK and

(ii) that amino acids 1-170 of CTTNBP2NL are not necessary for establishing its enrichment to the actin cytoskeletal network.

3.7 STRIPAK specifically interacts with DYNLL1 and DYNLL2

Since CTTNBP2NL was found to be enriched at actin fibres in mammalian cells this suggests that it may be an important regulator of actin-dependent processes. To help determine if CTTNBP2NL functions in any known actin-dependent processes, a FLAG- tagged CTTNBP2NL was stably expressed in HEK293 cells (A.-C. Gingras) and the lysate from these cells were analyzed by FLAG AP-MS. The acquired MS data was obtained and filtered by parameters outlined in section 2.9. The numbers of total and unique peptides within these isolated samples were then averaged from two independently-processed biological replicates. The filtered data revealed that the proteins corresponding to the most abundant total and unique peptides detected in the FLAG-CTTNBP2NL purifications are the components of the STRIPAK complex, primarily the Striatin proteins (Table 3.2). Note that no peptides corresponding to cortactin or to any known cortactin-binding proteins and/or actin regulators were detected in these samples. However, in addition to STRIPAK, a 50 substantial number of peptides corresponding to the DYNLL1 subunit of the cytoplasmic dynein 1 microtubule motor were also detected in these samples. This was interesting not only because it is a known regulator of cytoskeletal-mediated processes, but that peptides corresponding to DYNLL1 were also previously detected in TAP AP-MS purifications of

Mob3 and Striatin4 in mammalian (HEK293) cells (Goudreault et al. 2009). To assess the specificity of the interaction between CTTNBP2NL and DYNLL1, the reciprocal FLAG AP-

MS experiment was performed. To do this, FLAG-tagged DYNLL1 was generated and stably expressed in HEK293 cells (R.J. Schuler, A.-C. Gingras). The lysate from these cells were analyzed in parallel with HEK293 cells stably expressing the pcDNA3-FLAG vector by

FLAG AP-MS. The acquired MS data was filtered by the parameters outlined in section 2.9 with the exception that a project frequency of 40% was applied. Note that a project frequency of 40% means that proteins present in more than 40% of the AP-MS experiments within the Gingras database (>800 AP-MS experiments) were removed from the dataset.

FLAG-DYNLL2 HEK293 stable cells were also generated (R.J. Schuler, A.-C. Gingras) and analyzed by FLAG AP-MS to determine if FLAG-DYNLL1 and FLAG-DYNLL2 interact with different proteins of the STRIPAK complex.

Table 3.3 lists the specific interactors for FLAG-DYNLL1 and FLAG-DYNLL2 following data filtration. As expected, FLAG-DYNLL1 co-precipitated with the previously reported interactors 53BP1, Gephyrin and the major subunits of the cytoplasmic dynein 1 complex. These interactors were also detected in FLAG-DYNLL2 purifications with the numbers of peptides comparable to those identified in the FLAG-DYNLL1 samples. This analysis also revealed many additional DYNLL interactors that have not been reported to interact with human DYNLL1 or DYNLL2, particularly the components of the STRIPAK 51 complex. The number of peptides corresponding to the STRIPAK proteins were relatively similar in both FLAG-DYNLL1 and FLAG-DYNLL2 samples. Also, when the mass spectrometry datasets were normalized for protein size (number of peptides/molecular weight of protein), the most abundant number of peptides identified corresponded to CTTNBP2NL and the Striatins. To confirm the interaction between STRIPAK and DYNLL, FLAG-tagged

STRIPAK proteins were transiently co-expressed with HA-DYNLL1 or HA-DYNLL2 in

HEK293T cells. Cells were harvested, lysed and the cleared lysate was immunopurified with

FLAG-M2 agarose beads. The immunoprecipitates were eluted directly in Laemmli sample buffer, the samples were separated by SDS-PAGE and co-precipitating HA-DYNLL was detected by immunoblotting with an anti-HA antibody. As expected, all of the recombinant

FLAG-tagged STRIPAK proteins that were tested were capable of co-precipitating both HA-

DYNLL1 (Figure 3.11) and HA-DYNLL2 (Figure 3.12). These interactions were specific as the FLAG-tagged STRIPAK proteins were not capable of co-precipitating the unrelated

FLAG-tagged protein, FLAG-PP4R2 or the pcDNA3-FLAG vector. The specificity of the interaction between STRIPAK and the DYNLL proteins was tested further by analyzing lysate from HEK293 cells that stably expressed FLAG-DYNLL1, FLAG-DYNLL2 or

FLAG-DHX38. These lysates were immunopurified with FLAG-M2 agarose and the isolated immune complexes were resolved by SDS-PAGE, transferred to nitrocellulose and probed with antibodies targeted to the endogenous Striatin and PP2AAα proteins. Note that FLAG-

DHX38 was used in this experiment as a negative control as it does not interact with

DYNLL, Striatin or PP2AAα. These immunoblots revealed that the FLAG-DYNLL proteins interact with the endogenously expressed Striatin and PP2AAα proteins but not with the 52 negative control, FLAG-DHX38 (Figure 3.13). Altogether, these results reveal that

STRIPAK associates specifically with both DYNLL1 and DYNLL2.

3.8 Amino acids 1-170 of CTTNBP2NL are not required to interact with DYNLL1

As mentioned in section 3.7, when the FLAG-DYNLL1 and FLAG-DYNLL2 mass spectrometry datasets were normalized for protein size, the most abundant number of peptides identified corresponded to CTTNBP2NL and to the Striatin proteins. This suggests that the DYNLL proteins may bind directly to CTTNBP2NL and/or to the Striatins.

Therefore, I initiated a series of in vivo binding assays to map the region of CTTNBP2NL that is required for binding to DYNLL. I used the full length and the truncated forms of

FLAG-CTTNBP2NL that were generated in section 3.5 and transiently co-expressed them with HA-DYNLL1 in HEK293T cells. Cells were harvested, lysed and the cleared lysate was immunopurified with FLAG-M2 agarose beads. The immunoprecipitates were eluted directly in Laemmli sample buffer, resolved by SDS-PAGE and transferred to nitrocellulose.

Any co-precipitating HA-DYNLL1 protein was then analyzed by immunoblotting with an anti-HA antibody. All of the FLAG-CTTNBP2NL truncation mutants tested were capable of co-precipitating with HA-DYNLL1 (Figure 3.14). These interactions are specific as the

FLAG-CTTNBP2NL constructs were not capable of co-precipitating with the unrelated protein FLAG-tagged protein, FLAG-IRF3 or the pcDNA3-FLAG vector. This suggests that

DYNLL may require both termini of CTTNBP2NL for binding. To address the possibility that both termini of CTTNBP2NL are required for establishing an interaction with DYNLL1, a series of CTTNBP2NL constructs containing truncations at both N- and C-termini were designed and cloned into the mammalian pcDNA3 vector containing an N-terminal FLAG tag (Figure 3.15). The truncated forms of FLAG-CTTNBP2NL were transiently co- 53 expressed with HA-DYNLL1 in HEK293T cells. The transiently transfected cells were harvested, lysed and were immunopurified with FLAG-M2 agarose beads. The immunoprecipitates were eluted directly in Laemmli sample buffer and any co-precipitating

HA-DYNLL1 was analyzed by immunoblotting with an anti-HA antibody. All of the FLAG-

CTTNBP2NL truncation mutants tested, except for the FLAG-CTTNBP2NL 1-170 construct, were capable of co-precipitating with HA-DYNLL1. Importantly, HA-DYNLL1 did not co-precipitate with the negative controls, FLAG-IRF3 or pcDNA3-FLAG (Figure

3.16). Altogether, this experiment shows that both termini of CTTNBP2NL are dispensable for establishing an interaction with DYNLL1 and that amino acids 1-170 of CTTNBP2NL are not sufficient for establishing this interaction.

3.9 FLAG-CTTNBP2NL and HA-DYNLL1 partially co-localize in Vero cells

At this point, my results clearly show that CTTNBP2NL is enriched at the actin cytoskeleton and that it interacts specifically with STRIPAK and DYNLL. The question that then arises is what function(s) these interactions serve within the cell. As an initial effort to characterize the functional relevance of the interaction between CTTNBP2NL and DYNLL1 in mammalian cells, I decided to evaluate where in the cell that these two proteins co- localize. To do this, FLAG-CTTNBP2NL was transiently co-expressed with HA-DYNLL1 in Vero cells and the cellular localization of each protein was visualized by fluorescence microscopy by indirectly staining for the FLAG and HA tags. When compared to pcDNA3-

HA and pcDNA3-FLAG controls, the images reveal that a small fraction of HA-DYNLL1 co-localizes with FLAG-CTTNBP2NL at distinct foci throughout the cytoplasm with the majority of HA-DYNLL1 being enriched within and surrounding the nucleus (Figure 3.17).

This suggests that a relatively small fraction of the cellular DYNLL protein pool may interact 54 with CTTNBP2NL at, what at least appears to be, random positions throughout the cytoplasmic actin network and it also reveals that the interaction between DYNLL and

CTTNBP2NL may be enriched at the actin fibres surrounding the nucleus.

3.10 CTTNBP2NL may bridge the interaction between DYNLL and STRIPAK

There is considerable reason to suspect that CTTNBP2NL may bridge the interaction between DYNLL and STRIPAK. As has been briefly mentioned and what will be discussed further in section 4.2, when the averaged FLAG-DYNLL MS datasets were normalized according to protein size, it is apparent that the most abundant number of total and unique peptides corresponds to CTTNBP2NL and to the Striatins. This suggests that CTTNBP2NL and the Striatins may bind DYNLL directly (although this has yet to be tested) and thereby may act as adaptors that indirectly link DYNLL to the other identified STRIPAK proteins.

To determine if DYNLL and STRIPAK interact through CTTNBP2NL, HEK293 cells stably expressing FLAG-DYNLL1 were transfected either with siRNA targeted to the gene that encodes for CTTNBP2NL or with siRNA control oligonucleotides. Cells were then incubated for 72 hours at 37°C. Following this incubation period, cells were harvested, lysed and the cleared lysate was immunopurified with FLAG-M2 agarose beads. The FLAG- immunoprecipitates were then analyzed for levels of co-precipitating Mob3 by western blotting with an antibody targeted to the endogenous Mob3 protein. If CTTNBP2NL, at least in part, bridges the interaction between DYNLL1 and STRIPAK, it is expected that there will be a reduction in the level of Mob3 that co-precipitates with FLAG-DYNLL1 in

CTTNBP2NL siRNA-treated cells relative to siRNA control-treated cells. Immunoblot results reveal an apparent reduction of Mob3 that co-precipitated with FLAG-DYNLL1 in cells that had been treated with CTTNBP2NL siRNA relative to cells that were treated with 55 the siRNA control oligonucleotides (Figure 3.18). This reduction in co-precipitating Mob3 in CTTNBP2NL siRNA-treated cells is likely not due to a relatively lower level of immunopurified FLAG-DYNLL1 as immunoprecipitates generated from FLAG-DYNLL1 cells treated with CTTNBP2NL siRNA contained slightly greater levels of FLAG-DYNLL1 relative to the amount of FLAG-DYNLL1 present in the immunoprecipitate from control siRNA-treated cells. Altogether, this result suggests that CTTNBP2NL may, at least partially, bridge the interaction between STRIPAK and DYNLL1.

Figure 3.1 Confirmation of the interaction between FLAG-tagged STRIPAK proteins and endogenous Striatin. (A) Lysate from HEK293 cells stably expressing the indicated FLAG-tagged STRIPAK proteins were immunopurified with FLAG-M2 agarose beads. Immunoprecipitate of lysate from HEK293 cells stably expressing FLAG-alpha4 or pcDNA3-FLAG were used as negative controls. Samples were separated by SDS-PAGE, transferred to nitrocellulose and analyzed for co- precipitation with endogenous Striatin by immunoblotting (α-STRN, indicated by arrow). Upon prolonged exposure, Striatin was detected in FLAG-SIKE, FLAG- SLMAP and FLAG-CTTNBP2 samples. (B) Recombinant protein expression detected in whole cell lysate from HEK293 cells stably expressing the indicated FLAG-tagged proteins. Upon prolonged exposure, TRAF3IP3, CTTNBP2NL, CTTNBP2, PP2AAα were detected. The antibody heavy and light chains are indicated by asterisks (*).This research was originally published in Molecular and Cellular Proteomics. Goudreault M, D'Ambrosio LM, Kean MJ, Mullin MJ, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Molecular and Cellular Proteomics. 2009. pp. 175-71. © The American Society for Biochemistry and Molecular Biology.

Figure 3.2 Mutually exclusive associations with STRIPAK. STRIPAK associates with (A) CTTNBP2NL or (B) TRAF3IP3 in a mutually exclusive manner. Lysate from HEK293T cells transiently co-expressing the indicated FLAG- and HA-tagged constructs was were immunopurified with FLAG-M2 agarose beads. FLAG-PP4R2 and pcDNA3-FLAG were used as negative controls. Immune complexes were resolved on SDS-PAGE and transferred onto nitrocellulose. Co-precipitation of HA- tagged proteins was detected by immunoblotting with an anti-HA antibody (top panels, arrows). The precipitated FLAG-tagged proteins were detected with anti- FLAG antibody (middle panels). The expression of HA-tagged proteins is comparable in all samples (bottom panels). The antibody light and heavy chains are indicated by asterisks (*).This research was originally published in Molecular and Cellular Proteomics. Goudreault M, D'Ambrosio LM, Kean MJ, Mullin MJ, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Molecular and Cellular Proteomics. 2009. pp. 175- 71. © The American Society for Biochemistry and Molecular Biology.

Figure 3.3 STRIPAK proteins localize to distinct sub-cellular compartments. HA- tagged STRIPAK proteins were transiently expressed in CV1 cells for 24 hours prior to fixation and permeablization in 4% PFA and 0.2% Triton-X100 respectively. Cells were then blocked overnight in 0.2% gelatin from fresh water fish and then incubated with a mouse anti-HA antibody. Cells were then incubated with an anti- mouse antibody conjugated with the Alexa 488 fluorophore and nuclei were stained with Hochest 33342. All images were acquired at 100ms at a magnification of 60X. 59

Figure 3.4 HA-SIKE partially co-localizes with the Golgi apparatus. HA-tagged SIKE was transiently expressed in CV1 cells for 24 hours prior to fixation and permeablization in 4% PFA and 0.2% Triton-X100 respectively. Cells were then blocked overnight in 0.2% gelatin from fresh water fish and then incubated with a mouse anti-HA antibody and with a rabbit anti-golgin-97 antibody. Cells were then incubated with an anti-mouse antibody conjugated with the Texas Red fluorophore and with the anti-rabbit antibody conjugated with the Alexa 488 fluorophore. Nuclei were stained with Hochest 33342. All images were acquired at 100ms at a magnification of 60X. 60

Figure 3.5 CTTNBP2NL localizes to actin filaments. HA-CTTNBP2NL was transiently expressed in CV1 cells for 24 hours prior to fixation and permeablization in 4% PFA and 0.2% Triton-X100 respectively. Cells were then blocked overnight in 0.2% gelatin from fresh water fish and then incubated with a mouse anti-HA antibody. Cells were then incubated with an anti-mouse antibody conjugated to a Texas Red fluorophore and with Phalloidin Alexa 488. Nuclei were stained with Hoechst 33342. All images were acquired at 100ms at a magnification of 60X. Merged images have been enlarged for enhanced visualization of protein co- localization (blue arrows, far right column). 61

Figure 3.6 Predicted secondary structure of (A) CTTNBP2NL and (B) N- and C- terminal CTTNBP2NL truncation mutants used in this study. These constructs were cloned into the pcDNA3-FLAG vector and expressed in HEK293T cells. 62

Figure 3.7 STRIPAK does not associate with the C-terminus of CTTNBP2NL. Lysate from HEK293T cells transiently expressing the indicated FLAG-tagged constructs were immunopurified with FLAG-M2 agarose beads. FLAG-IRF3 and pcDNA3-FLAG were used as negative controls. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co-precipitation of FLAG-tagged CTTNBP2NL constructs with endogenously expressed STRIPAK proteins was detected by immunoblotting with the indicated antibodies. The precipitated FLAG-tagged proteins were detected with an anti- FLAG antibody. (*) indicates non-specific band that cross-reacts anti-FLAG antibody. 63

Figure 3.8 Amino acids 1-285 of CTTNBP2NL are necessary for establishing an interaction with STRIPAK. Lysate from HEK293T cells transiently expressing the indicated FLAG-tagged constructs were immunopurified with FLAG-M2 agarose beads. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co-precipitation of FLAG-tagged CTTNBP2NL constructs with endogenously expressed STRIPAK proteins was detected by immunoblotting with the indicated antibodies and the precipitated FLAG-tagged proteins were detected with an anti-FLAG antibody. (*) indicates non-specific cross-reactive band (top band). 64

Figure 3.9 Amino acids 1-170 of CTTNBP2NL are sufficient for establishing an interaction with STRIPAK. Lysate from HEK293T cells transiently expressing the indicated FLAG-tagged constructs were immunopurified with FLAG-M2 agarose beads. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co-precipitation of FLAG-tagged CTTNBP2NL constructs with endogenously expressed STRIPAK proteins was detected by immunoblotting with the indicated antibodies and the precipitated FLAG-tagged proteins were detected with an anti-FLAG antibody. Note that no expression of FLAG-CTTNBP2NL 1-70 was detected. (*) indicates non-specific cross-reactive band. 65

Figure 3.10 CTTNBP2NL localizes to actin filaments in a STRIPAK-independent manner. Full length or the indicated truncation mutants of FLAG-CTTNBP2NL were transiently expressed in Vero cells for 24 hours prior to fixation and permeablization in 4% PFA and 0.2% Triton-X100 respectively. Cells were then blocked overnight in 0.2% gelatin from fresh water fish and then incubated with a mouse anti-FLAG antibody. Cells were then incubated with an anti-mouse antibody conjugated with the Texas Red fluorophore and with Phalloidin Alexa 488. Nuclei were stained with Hoechst 33342. All images were acquired at 100ms at a magnification of 60X. 66

Figure 3.11 DYNLL1 associates specifically with STRIPAK. Lysate from HEK293T cells transiently co-expressing the indicated FLAG- and HA-tagged constructs were immunopurified with FLAG-M2 agarose beads. FLAG-PP4R2 and pcDNA3-FLAG were included as negative controls. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co- precipitation of FLAG-tagged proteins with HA-DYNLL1 was detected by immunoblotting for the HA epitope (top panel, arrows). The precipitated FLAG- tagged proteins were detected with an anti-FLAG antibody (middle panel). The expression of HA-tagged proteins is comparable in all samples (bottom panel). (*) indicates non-specific band that cross-reacts anti-FLAG antibody. 67

Figure 3.12 DYNLL2 associates specifically with STRIPAK. Lysate from HEK293T cells transiently co-expressing the indicated FLAG- and HA-tagged constructs were immunopurified with FLAG-M2 agarose beads. FLAG-PP4R2 and pcDNA3-FLAG were included as negative controls. Immune complexes were resolved by SDS- PAGE and transferred onto nitrocellulose. Co-precipitation of FLAG-tagged proteins with HA-DYNLL2 was detected by immunoblotting for the HA epitope (top panel, arrows). The precipitated FLAG-tagged proteins were detected with an anti-FLAG antibody (middle panel). The expression of HA-tagged proteins is comparable in all samples (bottom panel). (*) indicates non-specific band that cross-reacts anti-FLAG antibody. 68

Figure 3.13 Confirmation of the association between FLAG-tagged DYNLL proteins and endogenous STRIPAK proteins. Lysate from HEK293 cells stably expressing the indicated FLAG-tagged DYNLL proteins was performed with FLAG-M2 agarose beads. FLAG immunoprecipitate from FLAG-DHX38 stable HEK293 cells were included as a negative control. Isolated samples were resolved by SDS-PAGE, transferred to nitrocellulose and analyzed for co- precipitation with endogenous Striatin or PP2AAα by immunoblotting (position of endogenous Striatin indicated by arrow). (*) indicates non-specific cross- reacting band. 69

Figure 3.14 Both N and C termini of CTTNBP2NL mediate an interaction with DYNLL1. Lysate from HEK293T cells transiently expressing the indicated FLAG- or HA-tagged constructs was performed with FLAG-M2 agarose beads. FLAG-IRF3 and pcDNA3-FLAG were used as negative controls. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co-precipitation of FLAG-tagged proteins with HA-DYNLL1 was detected by immunoblotting with the anti-HA antibody (top panel) and the precipitated FLAG-tagged proteins were detected with an anti-FLAG antibody (middle panel). The expression levels of the FLAG-tagged proteins were comparable (bottom panel). (*) indicates non-specific band that cross-reacts anti-FLAG antibody. 70

Figure 3.15 Predicted secondary structure of (A) CTTNBP2NL and (B) Terminal CTTNBP2NL truncation mutants used in this study. These constructs were cloned into the pcDNA3-FLAG vector and expressed in HEK293T cells. 71

Figure 3.16 Amino acids 1-170 of CTTNBP2NL are not sufficient for establishing an interaction with DYNLL1. Lysate from HEK293T cells transiently expressing the indicated FLAG- or HA-tagged constructs was performed with FLAG-M2 agarose beads. FLAG-IRF3 and pcDNA3-FLAG were used as negative controls. Immune complexes were resolved by SDS-PAGE and transferred onto nitrocellulose. Co- precipitation of FLAG-tagged proteins with HA-DYNLL1 was detected by immunoblotting with the anti-HA antibody (top panel) and the precipitated FLAG- tagged proteins were detected with an anti-FLAG antibody (middle panel). The expression levels of the FLAG-tagged proteins were comparable (bottom panel). Note that expression of full length FLAG-CTTNBP2NL and FLAG-CTTNBP2NL 70- 569 were not detected in this experiment. (*) indicates non-specific band that cross- reacts anti-FLAG antibody. 72

Figure 3.17 CTTNBP2NL and DYNLL1 partially co-localize at the actin filaments. FLAG-CTTNBP2NL and HA-DYNLL1 were transiently co-expressed in CV1 cells for 24 hours prior to fixation and permeablization in 4% PFA and 0.2% Triton-X100 respectively. Cells were then blocked overnight in 0.2% gelatin from fresh water fish and then incubated with an anti-FLAG antibody conjugated to Texas Red and with an anti-HA antibody conjugated to Alexa488. Nuclei were stained with Hoechst 33342. All images have been acquired at 100ms and at a magnification of 60X. 73

Figure 3.18 CTTNBP2NL may bridge an interaction between DYNLL1 and Mob3. (A) Knockdown of CTTNBP2NL in HEK293 cells stably expressing FLAG-DYNLL1. HEK293 cells stably expressing FLAG-DYNLL1 were transfected with 20nM siRNA targeted to CTTNBP2NL or with 20nM control siRNA. As a negative control, HEK293 cells stably expressing pcDNA3-FLAG were transfected with 20nM control siRNA. Cells were harvested 72 hours post-transfection and the expression of CTTNBP2NL and Mob3 were analyzed by SDS-PAGE and immunoblotting. (B) CTTNBP2NL may bridge an interaction between DYNLL1 and Mob3. FLAG- immunoprecipitation was performed on lysate from FLAG-DYNLL1 or pcDNA3- FLAG HEK293 stable cells that had been treated with the indicated siRNAs. The immunoprecipitates were resolved by SDS-PAGE, transferred to nitrocellulose and immunoblotted for the endogenous Mob3 protein (position of Mob3 indicated by arrow). (*) indicates cross-reacting non-specific band.

74 Number of Total Peptidesa (Unique Peptides)a Gene Name Protein Name FLAG-SIKE FLAG-TRAF3IP3 FLAG-CTTNBP2 FLAG-CTTNBP2NL STRN Striatin 65 (27.5) 73 (29) 45 (26) 84 (28) STRN3 Striatin3 42.5 (20) 62 (25) 65 (21) 92.5 (23.5) STRN4 Striatin4 26.5 (12) 48 (16) 51 (18) 72.5 (17) FAM40A STRIP1 42 (18) 67 (29) 57 (25) 60 (21.5) FAM40B STRIP2 0 18 (6) 16 (8) 10.5 (3) MOBKL3 Mob3 12 (5.5) 29 (6) 27 (6) 34 (6) PPP2CA PP2ACα 10 (3.5) 12 (8) 12 (7) 18 (6.5)* PPP2R1A PP2AAα 31 (10) 38 (18) 39 (17) 15.5 (2.5)* PDCD10 CCM3 7 (5) 8 (6) 5 (4) 34 (10.5) STK24 STK24 2.5 (1.5) 7 (6) 4 (4) 23.5 (6.5) CTTNBP2 CTTNBP2 0 0 135 (33) 0 CTTNBP2NL CTTNBP2NL 0 0 7 (7) 144.5 (30.5) RP5-1000E10.4 SIKE 0 37 (12) 0 0 FGFR1OP2 FGFR1OP2 30 (11.5) 29 (15) 0 0 SLMAP SLMAP 30.5 (15) 0 0 0 TRAF3IP3 TRAF3IP3 0 63 (14) 0 0

Table 3.1 STRIPAK associates mutually exclusively with two distinct protein sub-complexes. HEK293 cells stably expressing the indicated FLAG-tagged proteins were immunopurified with FLAG-M2 agarose beads. The isolated samples were eluted in ammonium hydroxide, digested with Trypsin and anaylzed by liquid chromatography and tandem mass spectrometry. The acquired data was filtered as outlined in section 2.9 with the exception that a project frequency cut-off of 40% was applied. A sub-set of the filtered results revealing only the STRIPAK interactors are presented here. FLAG-SIKE (N=2), FLAG-TRAF3IP3 (N=1; A.-C. Gingras), FLAG-CTTNBP2 (N=1; A.-C. Gingras), FLAG-CTTNBP2NL (N=2). (a) averaged. (*) number of peptides corresponding to PP2ACβ and PP2AAβ. 75

Number of Total Gene Protein Peptides (Unique Name Name Peptides)a STRN3 Striatin3 92.5 (23.5) STRN Striatin 84 (28) STRN4 Striatin4 72.5 (17) FAM40A STRIP1 60 (21.5) PDCD10 CCM3 34 (10.5) MOBKL3 Mob3 34 (6) RP6-213H19.1 MST4 22 (6) STK24 STK24 23.5 (6.5) CPVL CPVL 16.5 (7.5) PPP2CB *PP2ACβ 18 (6.5) PPP2R1B *PP2AAβ 15.5 (2.5) KHDRBS1 Sam68 10 (4.5) FAM40B STRIP2 10.5 (3) EIF3A EIF3A 14 (11) MTHFD1 MTHFD1 10 (6.5) RPS2P5 RPS2P5 8.5 (4.5) DYNLL1 DYNLL1 8.5 (2) EIF3C EIF3C 6 (4) EIF4A1 EIF4A1 6.5 (3.5) GNB2L1 GNB2L1 4 (3) DIABLO DIABLO 4.5 (2.5) LOC389901 LOC389901 3.5 (2.5) GAPDH GAPDH 6 (4) C22orf28 C22orf28 3.5 (3) EIF3G EIF3G 4.5 (2.5) U2AF2 U2AF2 3.5 (2.5) EIF5B EIF45B 3.5 (2.5)

Table 3.2 Interactors for CTTNBP2NL as identified by FLAG AP-MS. HEK293 cells stably expressing FLAG-CTTNBP2NL were immunopurified with FLAG-M2 agarose beads. The isolated samples were eluted in ammonium hydroxide, digested with Trypsin and anaylzed by liquid chromatography and tandem mass spectrometry. The results were filtered according to parameters outlined in section 2.9 and the resulting number of total and unique peptides for each interactor is indicated. FLAG- CTTNBP2NL (N=2). (a) averaged number of peptides. * PP2ACα and PP2AAα were detected in one of the two independent replicates. STRIPAK proteins are highlighted in green. 76

Number of Total Peptides a (Unique Peptides) Protein Name FLAG-DYNLL1 FLAG-DYNLL2 Reference Gephryin 57.5 (19) 87.5 (20.5) (45) ZMYM2 47.5 (19.5) 76.5 (28) This study Striatin3 30.5 (16) 42 (15) This study EML3 14.5 (8.5) 29.5 (16) This study ZMYM4 50 (21) 60.5 (29) This study MORC3 51.5 (18) 49 (20) This study 53BP1 42 (23.5) 113 (44) (102) AKAP9 35 (21.5) 25 (18.5) This study CTTNBP2NL 32.5 (15) 41 (18) This study NEK9 38 (16) 66.5 (18.5) This study HMMR 23 (12) 35.5 (19.5) This study C20orf117 28 (13.5) 39 (20.5) This study TLK2 33 (10) 38 (16) This study DYNC1I2 26 (8.5) 35 (13.5) (117) DYNC1LI1 26 (13) 30.5 (11) (117) AMOT 17.5 (7) 33 (12.5) This study OPTN 16.5 (10) 20 (9) This study DYNC1LI2 16 (8.5) 15.5 (7.5) (117) UHRF1BP1L 13.5 (8.5) 17 (10.5) This study WDR60 20 (9.5) 26 (13) This study SPAG5 14.5 (9.5) 10.5 (7) This study KANK1 13.5 (8) 26 (13.5) This study Striatin 16.5 (7.5) 25.5 (12.5) This study FAM83D 22 (9) 27 (11.5) This study RCOR1 13.5 (6.5) 23 (9.5) This study AOF2 21 (9.5) 47 (21.5) This study Striatin4 15.5 (7) 12.5 (6.5) This study Mob3 9 (3) 9 (2.5) This study STRIP1 5.5 (3.5) 11 (8) This study KIAA1468 6 (4) 7 (5) This study SCML1 5.5 (3.5) 13 (4.5) This study WDR34 5 (3.5) 8 (4.5) This study PP2ACα 4.5 (3.5) 6 (3) This study RSBN1 4.5 (3) 3.5 (2.5) This study

Table 3.3 Interactors for DYNLL1 and DYNLL2 as identified by FLAG AP-MS. HEK293 cells stably expressing FLAG-DYNLL1 and FLAG-DYNLL2 were immunopurified with FLAG-M2 agarose beads. The isolated samples were eluted in ammonium hydroxide, digested with Trypsin and anaylzed by liquid chromatography and tandem mass spectrometry. The results were filtered according to parameters outlined in section 2.9 and the resulting number of total and unique peptides for each interactor is indicated. FLAG-DYNLL1 (N=2), FLAG-DYNLL2 (N=2). (a) averaged number of peptides. References assigned based on reports from NCBI Pubmed and Biogrid searches.

CHAPTER IV

DISCUSSION

77 78

4. Discussion:

4.1 Summary of results

As reported, STRIPAK is a novel complex that surrounds the human PP2A-Striatin holoenzyme and was identified as a collaborative project in the Gingras laboratory by high- density AP-MS. Through a series of in vivo interaction assays, I have confirmed the protein composition of STRIPAK – a protein complex that consists of the catalytic and scaffolding subunits of PP2A, the three members of the striatin B’’’ class of PP2A regulatory proteins

(Striatin, Striatin3, Striatin4), the Striatin-interacting protein Mob3, the three members of the

Germinal Center Kinase-III (GCK-III) class of serine/threonine kinases (MST4, STK24,

STK25), the protein CCM3, as well as two related proteins (STRIP1, STRIP2) (Goudreault et al. 2009). I have also demonstrated, by iterative AP-MS, that STRIPAK can associate mutually exclusively with at least two different sub-complexes. Both sub-complexes contain proteins that are poorly characterized, both structurally and functionally: the first sub- complex contains the SIKE/FGFR1OP2 and SLMAP/TRAF3IP3 proteins and the second sub-complex contains the CTTNBP2/CTTNBP2NL proteins (Figure 4.1). I continued to show that the first 170 amino acids of CTTNBP2NL are sufficient for establishing an interaction with STRIPAK and that CTTNBP2NL localizes to the actin cytoskeleton, most likely in a STRIPAK-independent manner. I also report on the novel interaction detected between the STRIPAKCTTNBP2NL assembly and a light chain subunit (DYNLL1/2) of the cytoplasmic dynein 1 complex – an interaction that was initially identified by AP-MS and confirmed for specificity by in vivo interaction assays. Additionally, through in vivo knockdown studies, this work revealed that the interaction between STRIPAK and DYNLL1 may be bridged, at least in part, by CTTNBP2NL. Together, the experiments presented 79 expand our knowledge of the protein composition of – and the sub-networks surrounding - the STRIPAK complex and highlights its potential in the regulation of cellular processes at, or requiring, the actin cytoskeleton.

4.2 Functional significance of the DYNLL- STRIPAKCTTNBP2NL interaction

4.2.1 CTTNBP2NL may bridge the interaction between DYNLL and STRIPAK

Using TAP AP-MS to define the network topology surrounding the human PP2A catalytic subunit, our group reported on a novel interaction between the Striatin-interacting protein Mob3 and a specific light chain of the cytoplasmic dynein 1 motor complex, known as DYNLL1. Within this same set of mass spectrometry data, we also found that another

STRIPAK protein, Striatin4, is also capable of specifically associating with DYNLL1

(Goudreault et al. 2009). The fact that two, seemingly unrelated, components of the

STRIPAK complex were found to interact with a distinct subunit of the dynein motor prompted us to question whether STRIPAK may function together with dynein in human cells. With this question in mind, I then decided to further characterize the specificity of these interactions. In other words, can the interaction between Mob3/Striatin4 and DYNLL1 be detected in reciprocal purifications when using DYNLL1 (or DYNLL2) as bait? In order to address this question, FLAG-DYNLL1 and FLAG-DYNLL2 were purified by FLAG AP-

MS from human cells and the isolated samples were analyzed by liquid chromatography and tandem mass spectrometry. Note that FLAG purification was used rather than a TAP-based approach because of following two reasons: (i) weaker and/or transient interactors may be detected because of the rapid single step purification associated with the FLAG tag and (ii) the FLAG tag is small and therefore is less likely to interfere with protein assemblies and/or the activity of various enzymes. It is also important to mention that since cytoskeletal 80 proteins are often classified as contaminants in our AP-MS analysis, it was therefore critical that DYNLL be purified as bait to ensure the specificity of its interactors (i.e. Mob3 and

Striatin4). A final reason for why it was critical to use DYNLL as bait is because it is a very small protein (10-kDa, 89 residues). This is of concern when reviewing tandem mass spectrometry data because the analyzer of the mass spectrometer is programmed to identify proteins that correspond to the most abundant peptides within a sample. In other words, larger proteins have more chances relative to smaller proteins of being detected by random sampling. As a result, a small, 10-kDa protein may be a real interactor for a particular bait protein but may not be detected in the MS dataset because of the presence of many other competing (and often larger) interactors. When the averaged FLAG-DYNLL MS datasets were normalized according to protein size, it is apparent that the most abundant number of total and unique peptides actually corresponds to CTTNBP2NL and to the Striatins. This suggests that CTTNBP2NL and the Striatins may bind DYNLL directly (although this has yet to be tested) and thereby may act as adaptors that indirectly link DYNLL to the other identified STRIPAK proteins. This idea is further supported by the results of my in vivo knockdown studies which revealed that in the absence of CTTNBP2NL there is an approximate two-fold reduction in the levels of Mob3 that interacts with DYNLL1. This result may be explained by various scenarios: (i) CTTNBP2NL and the Striatins work together to bridge the DYNLL1-Mob3 interaction (ii) the structurally-related CTTNBP2 protein may partially restore this interaction in the absence of CTTNBP2NL or (iii)

CTTNBP2NL may independently mediate the interaction but any residual CTTNBP2NL protein remaining after gene knockdown may be sufficient to form low levels of DYNLL1-

Mob3 complexes. 81

4.2.2 DYNLL may recruit CTTNBP2NL to the actin cytoskeleton network

If CTTNBP2NL does, at least in part, bridge the interaction between DYNLL and

STRIPAK and if CTTNBP2NL does in fact localize to the actin filaments in a STRIPAK- independent manner, it is therefore possible that DYNLL may play a role in recruiting and/or maintaining CTTNBP2NL at the actin cytoskeletal network. This idea is worth considering, given the multiple pieces of evidence that suggest a role for DYNLL as an adaptor for actin- binding factors. For example, a chicken homolog of DYNLL has been identified as a stoichiometric member of myosin-Va, a non-canonical myosin motor that associates with the actin network in order to mediate anterograde transport (Espindola et al. 2000). Also,

DYNLL has been shown to sequester the proapoptotic Bcl-2 family member, Bmf, to the actin cytoskeleton (Puthalakath et al. 2001). It is also interesting to note that cortactin - a critical regulator of actin-based processes and a bona fide actin-binding protein - contains a putative DYNLL binding motif and may therefore also serve as an adaptor to link DYNLL- containing complexes to the actin network. Relevant to this work, I have shown, through in vivo interaction and immunofluorescence studies, that the only truncation mutant of

CTTNBP2NL (FLAG-CTTNBP2NL 1-170) that is not capable of interacting with DYNLL is also not capable of localizing to the actin filaments, suggesting that DYNLL may be important for targeting or maintaining CTTNBP2NL at the actin network. This may be achieved by a variety of possible situations. For example, DYNLL dimers may align, in series, along the actin filament whereby one monomer may bind, either directly or indirectly

(i.e. through actin motors), to the filament whereby the other monomer binds CTTNBP2NL.

Alternatively, CTTNBP2NL may directly bind both actin and dynein (or myosinV)- complexed DYNLL and would thereby provide a novel interface for dynamic actin and/or 82 microtubule processes. However, this latter model, although worth considering, assumes that

DYNLL is associated and functions with motor complexes. Therefore, in order to begin defining the functional significance of the DYNLL-CTTNBP2NL interaction, an initial point of study would be to determine if the DYNLL subunits that associate with the

STRIPAKCTTNBP2NL assembly are also simultaneously complexed with molecular motors.

4.2.3 DYNLL may function with STRIPAKCTTNBP2NL in a dynein-dependent or – independent manner

As mentioned, DYNLL, although initially identified in Chlamydomonas as a light chain subunit for the outer arm axonemal dynein, functions in a series of additional protein complexes that are independent of its association with dynein microtubule motors. DYNLL seems to fulfill diverse roles within each of these dynein-independent complexes – functions that range from maintaining the structure of multi-protein assemblies to the regulation of enzyme activity. A question that is therefore important to address in order to define the function of the STRIPAKCTTNBP2NL interaction is to determine if the DYNLL subunits that form an interaction with CTTNBP2NL (and STRIPAK) are also dynein-associated. A relatively simple way to address this question would be to see if CTTNBP2NL and/or

STRIPAK are bona fide interactors for the other various subunits of the dynein motor (i.e. heavy, light intermediate, intermediate chains) (see section 5.3). Although this issue has yet to be explored in human cells, there have been reports that a Caenorhabditis elegans ortholog of a specific STRIPAK protein (STRIP1/2) may modify dynein function. Breifly, a genetic screen was conducted with the goal of identifying novel modifiers of cytoplasmic dynein in C. elegans (O’Rourke et al. 2007). A conditional C. elegans cytoplasmic dynein heavy chain mutant was screened at a permissive temperature with a genome-wide RNA 83 interference library to reduce the function of individual genes. This study resulted in the isolation and characterization of twenty dynein-specific suppressor genes that, when reduced in function, were able to suppress heavy chain dynein mutants but not any other conditionally mutant loci. One of these suppressors, which exhibited an approximate 20-fold suppression of the embryonic lethality characteristic of dynein heavy chain mutants, corresponded to the C. elegans gene F10E7.8 (O’Rourke et al. 2007). This gene is a conserved ortholog of the of the human STRIPAK protein, STRIP1/2 with a percentage identity of 36%. This suggests that the C. elegans STRIP1/2 ortholog may modify, regulate or function with cytoplasmic dynein – a function that may also apply to human STRIP1/2 and therefore to the collective STRIPAKCTTNBP2NL complex. However, given the relatively low percentage identity between the C. elegans and human STRIP1/2 orthologs and the fact that C. elegans STRIP1/2 is nuclear (O’Rourke et al. 2007) whereas in humans it is largely cytoplasmic (this study), suggests that these orthologs may have diverged throughout evolution to mediate different processes.

4.2.4 Models for the mode of action of the DYNLL-STRIPAKCTTNBP2NL assembly

The various cellular processes that require the DYNLL-CTTNBP2NL interaction are, at this point, entirely undefined. However, combining the data from this work with reports from the current literature, we can develop some possible hypotheses for why this interaction has been positively selected for in human cells. The first possibility, as introduced above, is that STRIPAKCTTNBP2NL may act as a mobile signalling module that localizes to different cellular compartments in response to specific stimuli and is thereby capable of localizing its signals to spatially-restricted targets. This hypothetical mobility of the STRIPAKCTTNBP2NL module may be achieved through the interaction of CTTNBP2NL with dynein- and/or 84 myosinV-bound DYNLL which would permit the respective microtubule and/or actin-based transport of the STRIPAKCTTNBP2NL complex (Figure 4.2). This concept of transporting pre- assembled signalling modules as vesicular cargo by motor complexes has been recently highlighted by the discovery that specific kinesin motors are capable of transporting MAPK cascades (reviewed in Schnapp 2003). In fact, several lines of evidence emphasize the importance of motor-driven transport of signalling complexes. For example, a series of neuronal signalling modules, such as the AMPA GluR complex (Lee et al. 2002), the JNK signalling cascade (Verhey et al. 2001) and various presynaptic complexes (Lee et al. 2002), attach to unique ‘linker’ subunits of specific kinesin motors. These motors then transport these modules to their required destination, most often to the synaptic junction – a region where a high degree of localized signalling is required. In these cases, it has been suggested that these signalling molecules are loaded onto their scaffolds away from their final destinations and that active transport along microtubules delivers these pre-assembled signalling modules to particular destinations (Schnapp 2003 and references therein).

However, to what these possible destinations and the specific targets are for the

STRIPAKCTTNBP2NL complex still remains unclear. This model provides the interesting idea that STRIPAKCTTNBP2NL migrates to specific sub-cellular domains through its interaction with cytoskeletal motor-coupled DYNLL subunits in response to particular stimuli. This concept therefore links the two, seemingly independent, fields of signal transduction and molecular motors – a connection that has only recently gained appreciable attention.

Alternatively, DYNLL may interact with STRIPAKCTTNBP2NL in a manner that is independent from the various molecular motors. For example, DYNLL may bind, either directly or indirectly, to the actin filaments in either a constitutive manner or in response to a 85 specific signal (i.e. PAK1-mediated phosphorylation). Here, DYNLL may then act as a scaffold to link the STRIPAKCTTNBP2NL signalling module to the cytoskeletal network.

Moreover, DYNLL may bind actin ubiquitously throughout the entire network or exhibit a more concentrated enrichment at actin-rich regions (i.e. plasma membrane, nuclear periphery) thereby localizing the STRIPAKCTTNBP2NL network either throughout, or to specific micro-domains of, the actin cytoskeleton. These hypothetical models would be ideal for connecting signalling events with the cytoskeletal restructuring required during a collection of stimuli-induced processes such as cell motility, cell invasion, synaptogenesis, endocytosis, intercellular contact assembly and/or host-pathogen interactions (reviewed in

Cosen-Binker and Kapus 2006). In this way, the cell can control the recruitment of specific signalling molecules to the localized STRIPAKCTTNBP2NL module in order to enhance the specificity, speed and coordination of its target processes (Figure 4.3).

4.3 STRIPAK associates mutually exclusively with two distinct sub-complexes

Taking into consideration that only the CTTNBP2/CTTNBP2NL sub-complex associates with DYNLL, this leads us to ask the question of why human cells have positively selected for STRIPAK to form two mutually exclusive complexes. Again, according to the

AP-MS and in vivo interaction studies presented in this work, STRIPAK can associate with the CTTNBP2/CTTNBP2NL assembly or with the SIKE/FGFR1OP2 and

SLMAP/TRAF3IP3 sub-complex. Knowing this, the following series of selected questions may be presented:

(i) Why does STRIPAK associate mutually exclusively with these two distinct sub-

complexes? 86

(ii) Do these two STRIPAK assemblies co-exist constitutively within the cell or are they

formed in a manner that is spatially, temporally and/or transcriptionally

controlled?

(iii) Do these two STRIPAK assemblies communicate with each other to modulate a

specific cell response or function as independent entities within distinct

pathways?

A possible answer to these questions is that both STRIPAK assemblies work co- operatively to transduce a signal that results in the modulation of a specific cellular process.

The execution of this co-operative signal may occur in many ways. For example, the two assemblies may work in parallel, associating with distinct receptors and/or substrates in response to a common stimulus. The signals transmitted from these separate complexes may then converge on a specific target(s) to amplify a desired response. Alternatively, these two

STRIPAK modules may act in series, whereby the signal transmitted by one assembly is relayed to the second assembly thereby resulting in a unified cellular response. Although the identity of these STRIPAK-dependent cellular responses still remain entirely undefined, one may speculate a role for this module in either the structural regulation of the cytoskeletal network, in the control of membrane dynamics or perhaps even in orchestrating the tight coordination between these two processes.

Alternatively, it is possible that both STRIPAK assemblies function in distinct pathways, entirely independent from each other. Given that the components of these sub- complexes exhibit different localization patterns, they may recruit the STRIPAK module to these distinct compartments thereby putting its resident phosphatase and kinases within proximity to spatially-restricted substrates. In this way, these two STRIPAK populations may 87 modulate specific signals transmitted by the cascades of distinct cellular pathways. It is also important to take into consideration that these separate STRIPAK assemblies may not only function to modulate well-characterized pathways, but may also serve as novel signalling module on its own, representing a new pathway that regulate a particular response – perhaps in a cell type- or stimuli-dependent manner.

4.4 Conclusion

Altogether, I have shown that the novel PP2A-containing complex, STRIPAK, participates in at least two mutually-exclusive sub-complexes, one of which contains the putative actin-binding protein, CTTNBP2NL. The substrate specificity, sub-cellular localization and catalytic activity of PP2A are thought to be tightly controlled, at least in part, by its association with distinct regulatory subunits. It is therefore possible that the unique protein composition of these two assemblies may serve to differentially regulate

PP2A to generate a common or diverse response(s) within the cell. Moreover, the enrichment of CTTNBP2NL at the actin network and its association with the DYNLL protein presents the possibility that the STRIPAKCTTNBP2NL module may coordinate the intracellular signalling events required for the dynamic rearrangements of the cytoskeleton – an adaptive process that is imperative for both cell growth and survival. This work will therefore serve as a platform for further studies on the structural and functional characterization of STRIPAK and will ultimately assist in defining novel mechanisms of regulation and function for the human PP2A phosphatase.

Figure 4.1 STRIPAK associates mutually exclusively with two distinct sub- complexes. STRIPAK associates mutually exclusively with (A) CTTNBP2/CTTNBP2NL (blue) or with (B) SLMAP/TRAF3IP3 (purple) and SIKE/FGFR1OP2 (beige). This research was originally published in Molecular and Cellular Proteomics. Goudreault M, D'Ambrosio LM, Kean MJ, Mullin MJ, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Molecular and Cellular Proteomics. 2009. pp. 175-71. © The American Society for Biochemistry and Molecular Biology. 89

Extra/Intra-cellular signal

Recruitment of STRIPAK to Dynein (or Myosin)

Microtubule - +

Transport of STRIPAK to target sub-cellular location Actin

Dynein Myosin

STRIPAK CTTNBP2NL

DYNLL

Figure 4.2 Functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction: Model 1. STRIPAKCTTNBP2NL may be bind dynein or myosin motors through DYNLL either constituitively or in response to extra- or intra-cellular signals. The interaction of STRIPAKCTTNBP2NL with DYNLL may then facilitate the transport of STRIPAKCTTNBP2NL to distinct sub-cellular locations where it may then target spatial-restricted substrates to generate a desired cellular response. Figure adapted from Schliwa and Woehlke, 2003.

Extra/Intra-cellular signal

Modulation of STRIPAK activity

Recruitment of STRIPAK to actin by DYNLL

Actin

STRIPAK-mediated cellular response (Actin reorganization, cell motility, endocytosis)

DYNLL Actin binding protein

STRIPAK CTTNBP2NL

Figure 4.3 Functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction: Model 2. STRIPAKCTTNBP2NL may be localized to the actin network through DYNLL either constituitively or in response to extra- or intra-cellular signals. The interaction of STRIPAKCTTNBP2NL with DYNLL may modulate STRIPAK activity in order for it to mediate a cellular response such as reorganization of the actin network, cell motility or endocytosis. Figure adapted from Schliwa and Woehlke, 2003.

CHAPTER V

FUTURE DIRECTIONS

91 92

5. Future Directions:

5.1 Functional characterization of CTTNBP2NL

At this point, I have shown that STRIPAK can associate mutually exclusively with at least two sub-complexes – one containing SIKE/FGFR1OP2 and

SLMAP/TRAF3IP3 and one containing CTTNBP2/CTTNBP2NL. The functional characterization of the proteins in these sub-complexes will not only aid in identifying the cellular processes in which STRIPAK functions but will also assist in defining its mechanism(s) of action. With this objective in mind, I decided to further characterize the cellular properties of CTTNBP2NL. I have shown that CTTNBP2NL is enriched, almost exclusively, at the actin filaments. This may suggest, as previously discussed, that

CTTNBP2NL may mediate and/or regulate actin-dependent processes. To test this idea, a series of small-scale screens may be optimized to monitor defects in actin-dependent processes (i.e. cell motility, endocytosis, vesicle trafficking) in human cells with abnormal CTTNBP2NL expression. Human cells (i.e. HeLa, Fibroblasts) may be transfected with siRNAs targeted to the gene that encodes for CTTNBP2NL in order to deplete the cellular pool of the CTTNBP2NL protein. These CTTNBP2NL-deficient cells may then be monitored by live-cell imaging for defects in, for example, cell motility

(i.e. direction of migration, changes in migration rate) in response to specific cytokines relative to the motility of siRNA-treated control cells. Note that an alternative (or complement) to this experiment would be to transiently overexpress CTTNBP2NL in human cells and to then monitor for defects in the actin-dependent process of interest. In the event that these data reveal a function for CTTNBP2NL in any of the aforementioned processes, it would then be necessary to determine if CTTNBP2NL requires an 93 interaction with STRIPAK to perform its identified function(s). This may be done by transiently overexpressing cDNAs encoding for CTTNBP2NL truncation mutants that I have shown to either be sufficient for, or not capable of, interacting with components of the STRIPAK complex. Overall, the results gathered from these experiments will provide initial insight into the cellular role(s) of CTTNBP2NL in human cells which will serve as a foundation for studies of the functional characterization of the

STRIPAKCTTNBP2NL complex.

5.2 Functional characterization of the DYNLL-STRIPAKCTTNBP2NL interaction

Another key question that extends from my studies is why, when and how human cells are required to establish the DYNLL-STRIPAKCTTNBP2NL interaction. In other words, what function(s) does the DYNLL-STRIPAKCTTNBP2NL interaction fulfill in the eukaryotic cell? As discussed, it is possible that the DYNLL subunits may recruit, or maintain, CTTNBP2NL at the actin filaments. This hypothesis is based on data from my microscopy and in vivo binding studies that shows that a CTTNBP2NL truncation mutant that is not capable of interacting with DYNLL1 is also not enriched at the actin cytoskeleton. To specifically determine if DYNLL1 is required for tethering

CTTNBP2NL to the actin network, human cells (i.e. HEK293) may be transfected with siRNAs targeted to the gene that encodes for DYNLL1 in order to deplete the cellular pool of the DYNLL1 protein. These cells may then be fixed, co-stained with an antibody that recognizes the endogenous CTTNBP2NL protein and with an actin-stain (Phalloidin) and then imaged by confocal microscopy. In the event that these results reveal that

CTTNBP2NL is not localized to the actin filaments in DYNLL1-depeleted cells, an

RNAi-resistant cDNA construct of DYNLL1 may be introduced into these DYNLL1 94 knockdown cells to see if the normal actin-localization of CTTNBP2NL is restored.

These experiments will therefore reveal if CTTNBP2NL is localized to the actin network specifically in a DYNLL1-dependent manner.

5.3 Determine if DYNLL is dependent on dynein for its function with

STRIPAKCTTNBP2NL

DYNLL, although initially identified as a light chain subunit for the

Chlamydomonas outer arm axonemal dynein, functions in a series of additional cellular processes independent of its role in microtubule motor complexes (Pfister et al. 2006;

King and Patel-King 1995; Piperno and Luck 1979). As discussed, the question that then arises is if the function of the DYNLL-STRIPAKCTTNBP2NL interaction (as identified in section 5.2) is dependent on an interaction with the dynein motor. In other words, is

CTTNBP2NL (and therefore STRIPAK) targeted to the dynein motor through the

DYNLL light chain? This question may be addressed by a series of co- immunoprecipitation experiments whereby alternative components of the dynein complex (i.e. the intermediate chain, light intermediate chain) are cloned into a vector containing a peptide tag and transiently expressed in HEK293T cells. The tagged dynein subunits may be immunopurified with the appropriate antibody and separated by gel electrophoresis. Any interaction between the dynein subunits with CTTNBP2NL (or

STRIPAK) may then be detected by immunoblotting with antibodies targeted to endogenous CTTNBP2NL (or other STRIPAK proteins). It is important to note that the appropriate controls must be included in this series of experiments. Specifically, as a positive control, this experiment should be conducted in parallel with cells transiently expressing tagged DYNLL. In addition, the immunoblots should be probed for DYNLL 95 and an unrelated protein as positive and negative controls respectively (again, reports show that DYNLL not only dimerizes, but also interacts with the other dynein subunits).

To complement this data and/or to circumvent possible artefacts associated with protein overexpression, the selected dynein subunits may be cloned into a vector containing a peptide tag, stably expressed in HEK293 and immunopurified for the specific tag of interest. The isolated samples may then be processed by liquid chromatography and tandem mass spectrometry and the acquired data may be analyzed for peptides corresponding to CTTNBP2NL (and/or STRIPAK proteins).

Another important issue to investigate is whether CTTNBP2NL interacts with other light chain subunits of the dynein complex (i.e. DYNLT, DYNLRB). This is important as it will either reveal if STRIPAKCTTNBP2NL (i) can discriminate between light chain subunits to establish its hypothetical interaction with dynein, (ii) if it associates specifically with DYNLL-containing dynein or (iii) if it associates specifically with a fraction of the dynein-independent pool of DYNLL. Answers to these issues may be addressed in parallel with the experiments mentioned above, but instead using the various tagged light chain subunits of the dynein complex for mass spectrometric analysis. Note that although peptides corresponding to these alternative dynein light chain subunits were not detected in FLAG-CTTNBP2NL AP-MS purifications, they still may be bona fide interactors for CTTNBP2NL. This is because the MS parameters have been optimized to identify proteins whose peptide fragments were the most abundant in the isolated sample. As a result, valid interactors for a bait of interest may not be detected if they either associate weakly, transiently or with a small fraction of the bait pool. Altogether, the data resulting from these studies will address the question if 96

STRIPAKCTTNBP2NL interacts specifically with DYNLL in a dynein-dependent or dynein- independent manner. This is significant as it will provide additional insight into the functional significance of the DYNLL-STRIPAKCTTNBP2NL interaction in human cells. Literature Cited

1. Adams, D.G., et al., Positive regulation of Raf1-MEK1/2-ERK1/2 signaling by protein serine/threonine phosphatase 2A holoenzymes. J Biol Chem, 2005. 280(52): p. 42644-54. 2. Ahn, J.H., et al., The B''/PR72 subunit mediates Ca2+-dependent dephosphorylation of DARPP-32 by protein phosphatase 2A. Proc Natl Acad Sci U S A, 2007. 104(23): p. 9876-81. 3. Alonso, A., et al., Protein tyrosine phosphatases in the human genome. Cell, 2004. 117(6): p. 699-711. 4. Arino, J., et al., Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes. Proc Natl Acad Sci U S A, 1988. 85(12): p. 4252-6. 5. Asai, D.J., V. Rajagopalan, and D.E. Wilkes, Dynein-2 and ciliogenesis in Tetrahymena. Cell Motil Cytoskeleton, 2009. 66(8): p. 673-7. 6. Baillat, G., et al., Interactions of phocein with nucleoside-diphosphate kinase, Eps15, and Dynamin I. J Biol Chem, 2002. 277(21): p. 18961-6. 7. Baillat, G., et al., Molecular cloning and characterization of phocein, a protein found from the Golgi complex to dendritic spines. Mol Biol Cell, 2001. 12(3): p. 663-73. 8. Barbar, E., Dynein light chain LC8 is a dimerization hub essential in diverse protein networks. Biochemistry, 2008. 47(2): p. 503-8. 9. Bartoli, M., et al., Down-regulation of striatin, a neuronal calmodulin-binding protein, impairs rat locomotor activity. J Neurobiol, 1999. 40(2): p. 234-43. 10. Begley, M.J. and J.E. Dixon, The structure and regulation of myotubularin phosphatases. Curr Opin Struct Biol, 2005. 15(6): p. 614-20. 11. Begum, N. and L. Ragolia, Role of janus kinase-2 in insulin-mediated phosphorylation and inactivation of protein phosphatase-2A and its impact on upstream insulin signalling components. Biochem J, 1999. 344 Pt 3: p. 895-901. 12. Benison, G., P.A. Karplus, and E. Barbar, Structure and dynamics of LC8 complexes with KXTQT-motif peptides: swallow and dynein intermediate chain compete for a common site. J Mol Biol, 2007. 371(2): p. 457-68. 13. Benison, G., P.A. Karplus, and E. Barbar, The interplay of ligand binding and quaternary structure in the diverse interactions of dynein light chain LC8. J Mol Biol, 2008. 384(4): p. 954-66. 14. Bennin, D.A., et al., Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest. J Biol Chem, 2002. 277(30): p. 27449-67. 15. Borsotto, M., et al., PP2A-Bgamma subunit and KCNQ2 K+ channels in bipolar disorder. Pharmacogenomics J, 2007. 7(2): p. 123-32. 16. Bosch, M., et al., The PR55 and PR65 subunits of protein phosphatase 2A from Xenopus laevis. molecular cloning and developmental regulation of expression. Eur J Biochem, 1995. 230(3): p. 1037-45. 17. Brandenburg, J., et al., Multifunctional class I transcription in Trypanosoma brucei depends on a novel protein complex. Embo J, 2007. 26(23): p. 4856-66. 18. Burkhardt, J.K., et al., Overexpression of the dynamitin (p50) subunit of the dynactin

complex disrupts dynein-dependent maintenance of membrane organelle distribution. J Cell Biol, 1997. 139(2): p. 469-84. 19. Castets, F., et al., A novel calmodulin-binding protein, belonging to the WD-repeat family, is localized in dendrites of a subset of CNS neurons. J Cell Biol, 1996. 134(4): p. 1051-62. 20. Castets, F., et al., Zinedin, SG2NA, and striatin are calmodulin-binding, WD repeat proteins principally expressed in the brain. J Biol Chem, 2000. 275(26): p. 19970-7. 21. Caviston, J.P. and E.L. Holzbaur, Microtubule motors at the intersection of trafficking and transport. Trends Cell Biol, 2006. 16(10): p. 530-7. 22. Chen, J., B.L. Martin, and D.L. Brautigan, Regulation of protein serine-threonine phosphatase type-2A by tyrosine phosphorylation. Science, 1992. 257(5074): p. 1261-4. 23. Chen, J., B.L. Martin, and D.L. Brautigan, Regulation of protein serine-threonine phosphatase type-2A by tyrosine phosphorylation. Science, 1992. 257(5074): p. 1261-4. 24. Chen, J., S. Parsons, and D.L. Brautigan, Tyrosine phosphorylation of protein phosphatase 2A in response to growth stimulation and v-src transformation of fibroblasts. J Biol Chem, 1994. 269(11): p. 7957-62. 25. Cho, U.S. and W. Xu, Crystal structure of a protein phosphatase 2A heterotrimeric holoenzyme. Nature, 2007. 445(7123): p. 53-7. 26. Cohen, P., The origins of protein phosphorylation. Nat Cell Biol, 2002. 4(5): p. E127-30. 27. Cosen-Binker, L.I. and A. Kapus, Cortactin: the gray eminence of the cytoskeleton. Physiology (Bethesda), 2006. 21: p. 352-61. 28. Creyghton, M.P., et al., PR72, a novel regulator of Wnt signaling required for Naked cuticle function. Genes Dev, 2005. 19(3): p. 376-86. 29. Creyghton, M.P., et al., PR130 is a modulator of the Wnt-signaling cascade that counters repression of the antagonist Naked cuticle. Proc Natl Acad Sci U S A, 2006. 103(14): p. 5397-402. 30. Csortos, C., et al., High complexity in the expression of the B' subunit of protein phosphatase 2A0. Evidence for the existence of at least seven novel isoforms. J Biol Chem, 1996. 271(5): p. 2578-88. 31. Dadgostar, H., et al., T3JAM, a novel protein that specifically interacts with TRAF3 and promotes the activation of JNK(1). FEBS Lett, 2003. 553(3): p. 403-7. 32. Damuni, Z., H. Xiong, and M. Li, Autophosphorylation-activated protein kinase inactivates the protein tyrosine phosphatase activity of protein phosphatase 2A. FEBS Lett, 1994. 352(3): p. 311-4. 33. Dan, I., et al., Cloning of MASK, a novel member of the mammalian germinal center kinase III subfamily, with apoptosis-inducing properties. J Biol Chem, 2002. 277(8): p. 5929-39. 34. De Baere, I., et al., Purification of porcine brain protein phosphatase 2A leucine carboxyl methyltransferase and cloning of the human homologue. Biochemistry, 1999. 38(50): p. 16539-47. 35. Dick, T., et al., Cytoplasmic dynein (ddlc1) mutations cause morphogenetic defects

and apoptotic cell death in Drosophila melanogaster. Mol Cell Biol, 1996. 16(5): p. 1966-77. 36. Dozier, C., et al., Regulation of Chk2 phosphorylation by interaction with protein phosphatase 2A via its B' regulatory subunit. Biol Cell, 2004. 96(7): p. 509-17. 37. Egloff, M.P., et al., Crystal structure of the catalytic subunit of human protein phosphatase 1 and its complex with tungstate. J Mol Biol, 1995. 254(5): p. 942-59. 38. Eichhorn, P.J., M.P. Creyghton, and R. Bernards, Protein phosphatase 2A regulatory subunits and cancer. Biochim Biophys Acta, 2009. 1795(1): p. 1-15. 39. Eichhorn, P.J., et al., A RNA interference screen identifies the protein phosphatase 2A subunit PR55gamma as a stress-sensitive inhibitor of c-SRC. PLoS Genet, 2007. 3(12): p. e218. 40. Espindola, F.S., et al., The light chain composition of chicken brain myosin-Va: calmodulin, myosin-II essential light chains, and 8-kDa dynein light chain/PIN. Cell Motil Cytoskeleton, 2000. 47(4): p. 269-81. 41. Fan, J., et al., Structural basis of diverse sequence-dependent target recognition by the 8 kDa dynein light chain. J Mol Biol, 2001. 306(1): p. 97-108. 42. Fan, J.S., et al., Protein inhibitor of neuronal nitric-oxide synthase, PIN, binds to a 17-amino acid residue fragment of the enzyme. J Biol Chem, 1998. 273(50): p. 33472-81. 43. Favre, B., et al., The catalytic subunit of protein phosphatase 2A is carboxyl- methylated in vivo. J Biol Chem, 1994. 269(23): p. 16311-7. 44. Firulli, B.A., et al., PKA, PKC, and the protein phosphatase 2A influence HAND factor function: a mechanism for tissue-specific transcriptional regulation. Mol Cell, 2003. 12(5): p. 1225-37. 45. Fuhrmann, J.C., et al., Gephyrin interacts with Dynein light chains 1 and 2, components of motor protein complexes. J Neurosci, 2002. 22(13): p. 5393-402. 46. Gaillard, S., et al., Striatin, a calmodulin-dependent scaffolding protein, directly binds caveolin-1. FEBS Lett, 2001. 508(1): p. 49-52. 47. Gee, M.A., J.E. Heuser, and R.B. Vallee, An extended microtubule-binding structure within the dynein motor domain. Nature, 1997. 390(6660): p. 636-9. 48. Gibbons, I.R., The role of dynein in microtubule-based motility. Cell Struct Funct, 1996. 21(5): p. 331-42. 49. Gibbons, I.R., et al., Photosensitized cleavage of dynein heavy chains. Cleavage at the "V1 site" by irradiation at 365 nm in the presence of ATP and vanadate. J Biol Chem, 1987. 262(6): p. 2780-6. 50. Gibbons, I.R. and A.J. Rowe, Dynein: A Protein with Adenosine Triphosphatase Activity from Cilia. Science, 1965. 149(3682): p. 424-426. 51. Gingras, A.C., R. Aebersold, and B. Raught, Advances in protein complex analysis using mass spectrometry. J Physiol, 2005. 563(Pt 1): p. 11-21. 52. Gingras, A.C., et al., Analysis of protein complexes using mass spectrometry. Nat Rev Mol Cell Biol, 2007. 8(8): p. 645-54. 53. Glatter, T., et al., An integrated workflow for charting the human interaction proteome: insights into the PP2A system. Mol Syst Biol, 2009. 5: p. 237. 54. Gohla, A., J. Birkenfeld, and G.M. Bokoch, Chronophin, a novel HAD-type serine

100

protein phosphatase, regulates cofilin-dependent actin dynamics. Nat Cell Biol, 2005. 7(1): p. 21-9. 55. Goldberg, J., et al., Three-dimensional structure of the catalytic subunit of protein serine/threonine phosphatase-1. Nature, 1995. 376(6543): p. 745-53. 56. Goudreault, M., et al., A PP2A phosphatase high density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Mol Cell Proteomics, 2009. 8(1): p. 157-71. 57. Grand, E.K., et al., Identification of a novel gene, FGFR1OP2, fused to FGFR1 in 8p11 myeloproliferative syndrome. Genes Chromosomes Cancer, 2004. 40(1): p. 78- 83. 58. Grissom, P.M., E.A. Vaisberg, and J.R. McIntosh, Identification of a novel light intermediate chain (D2LIC) for mammalian cytoplasmic dynein 2. Mol Biol Cell, 2002. 13(3): p. 817-29. 59. Groves, M.R., et al., The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs. Cell, 1999. 96(1): p. 99-110. 60. Guclu, B., et al., Mutations in apoptosis-related gene, PDCD10, cause cerebral cavernous malformation 3. Neurosurgery, 2005. 57(5): p. 1008-13. 61. Guo, H. and Z. Damuni, Autophosphorylation-activated protein kinase phosphorylates and inactivates protein phosphatase 2A. Proc Natl Acad Sci U S A, 1993. 90(6): p. 2500-4. 62. Guy, G.R., R. Philp, and Y.H. Tan, Activation of protein kinases and the inactivation of protein phosphatase 2A in tumour necrosis factor and interleukin-1 signal- transduction pathways. Eur J Biochem, 1995. 229(2): p. 503-11. 63. Guzzo, R.M., et al., A novel isoform of sarcolemmal membrane-associated protein (SLMAP) is a component of the microtubule organizing centre. J Cell Sci, 2004. 117(Pt 11): p. 2271-81. 64. Guzzo, R.M., et al., Regulated expression and temporal induction of the tail- anchored sarcolemmal-membrane-associated protein is critical for myoblast fusion. Biochem J, 2004. 381(Pt 3): p. 599-608. 65. Gygi, S.P., et al., Quantitative analysis of complex protein mixtures using isotope- coded affinity tags. Nat Biotechnol, 1999. 17(10): p. 994-9. 66. Habura, A., et al., Interaction mapping of a dynein heavy chain. Identification of dimerization and intermediate-chain binding domains. J Biol Chem, 1999. 274(22): p. 15447-53. 67. Hemmings, B.A., et al., alpha- and beta-forms of the 65-kDa subunit of protein phosphatase 2A have a similar 39 amino acid repeating structure. Biochemistry, 1990. 29(13): p. 3166-73. 68. Hendrix, P., et al., Analysis of subunit isoforms in protein phosphatase 2A holoenzymes from rabbit and Xenopus. J Biol Chem, 1993. 268(10): p. 7330-7. 69. Hodi, Z., et al., Alternatively spliced exon B of myosin Va is essential for binding the tail-associated light chain shared by dynein. Biochemistry, 2006. 45(41): p. 12582- 95.

101

70. Holleran, E.A., et al., beta III spectrin binds to the Arp1 subunit of dynactin. J Biol Chem, 2001. 276(39): p. 36598-605. 71. Hoogenraad, C.C., et al., Mammalian Golgi-associated Bicaudal-D2 functions in the dynein-dynactin pathway by interacting with these complexes. Embo J, 2001. 20(15): p. 4041-54. 71. Huang, J., et al., SIKE is an IKK epsilon/TBK1-associated suppressor of TLR3- and virus-triggered IRF-3 activation pathways. Embo J, 2005. 24(23): p. 4018-28. 72. Huq Ronny, F.M., H. Igarashi, and N. Sakaguchi, BCR-crosslinking induces a transcription of protein phosphatase component G5PR that is required for mature B- cell survival. Biochem Biophys Res Commun, 2006. 340(1): p. 338-46. 73. Ikeda, F., et al., Involvement of the ubiquitin-like domain of TBK1/IKK-i kinases in regulation of IFN-inducible genes. Embo J, 2007. 26(14): p. 3451-62. 74. Jacob, Y., et al., Cytoplasmic dynein LC8 interacts with lyssavirus phosphoprotein. J Virol, 2000. 74(21): p. 10217-22. 75. Jaffrey, S.R. and S.H. Snyder, PIN: an associated protein inhibitor of neuronal nitric oxide synthase. Science, 1996. 274(5288): p. 774-7. 76. Janssens, V. and J. Goris, Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J, 2001. 353(Pt 3): p. 417-39. 77. Jia, Z., et al., Structural basis for phosphotyrosine peptide recognition by protein tyrosine phosphatase 1B. Science, 1995. 268(5218): p. 1754-8. 78. Jung, Y., et al., Dynein light chain LC8 negatively regulates NF-kappaB through the redox-dependent interaction with IkappaBalpha. J Biol Chem, 2008. 283(35): p. 23863-71. 79. Kaiser, F.J., et al., Nuclear interaction of the dynein light chain LC8a with the TRPS1 transcription factor suppresses the transcriptional repression activity of TRPS1. Hum Mol Genet, 2003. 12(11): p. 1349-58. 80. Kao, G., et al., C. elegans SUR-6/PR55 cooperates with LET-92/protein phosphatase 2A and promotes Raf activity independently of inhibitory Akt phosphorylation sites. Development, 2004. 131(4): p. 755-65. 81. Karki, S. and E.L. Holzbaur, Affinity chromatography demonstrates a direct binding between cytoplasmic dynein and the dynactin complex. J Biol Chem, 1995. 270(48): p. 28806-11. 82. Karki, S. and E.L. Holzbaur, Cytoplasmic dynein and dynactin in cell division and intracellular transport. Curr Opin Cell Biol, 1999. 11(1): p. 45-53. 83. Khew-Goodall, Y. and B.A. Hemmings, Tissue-specific expression of mRNAs encoding alpha- and beta-catalytic subunits of protein phosphatase 2A. FEBS Lett, 1988. 238(2): p. 265-8. 84. King, S.J. and T.A. Schroer, Dynactin increases the processivity of the cytoplasmic dynein motor. Nat Cell Biol, 2000. 2(1): p. 20-4. 85. King, S.M., Dynein-independent functions of DYNLL1/LC8: redox state sensing and transcriptional control. Sci Signal, 2008. 1(47): p. pe51. 86. King, S.M., et al., Brain cytoplasmic and flagellar outer arm dyneins share a highly conserved Mr 8,000 light chain. J Biol Chem, 1996. 271(32): p. 19358-66.

102

87. King, S.M. and R.S. Patel-King, The M(r) = 8,000 and 11,000 outer arm dynein light chains from Chlamydomonas flagella have cytoplasmic homologues. J Biol Chem, 1995. 270(19): p. 11445-52. 88. Kissinger, C.R., et al., Crystal structures of human calcineurin and the human FKBP12-FK506-calcineurin complex. Nature, 1995. 378(6557): p. 641-4. 89. Koonce, M.P. and M. Samso, Of rings and levers: the dynein motor comes of age. Trends Cell Biol, 2004. 14(11): p. 612-9. 90. Kuo, Y.C., et al., Regulation of phosphorylation of Thr-308 of Akt, cell proliferation, and survival by the B55alpha regulatory subunit targeting of the protein phosphatase 2A holoenzyme to Akt. J Biol Chem, 2008. 283(4): p. 1882-92. 91. Lee, K.H., et al., Dazl can bind to dynein motor complex and may play a role in transport of specific mRNAs. Embo J, 2006. 25(18): p. 4263-70. 92. Lee, W.J., et al., Identification of proteins interacting with the catalytic subunit of PP2A by proteomics. Proteomics, 2007. 7(2): p. 206-14. 93. Letourneux, C., G. Rocher, and F. Porteu, B56-containing PP2A dephosphorylate ERK and their activity is controlled by the early gene IEX-1 and ERK. Embo J, 2006. 25(4): p. 727-38. 94. Li, H.H., et al., A specific PP2A regulatory subunit, B56gamma, mediates DNA damage-induced dephosphorylation of p53 at Thr55. Embo J, 2007. 26(2): p. 402-11. 95. Li, X., et al., B56-associated protein phosphatase 2A is required for survival and protects from apoptosis in Drosophila melanogaster. Mol Cell Biol, 2002. 22(11): p. 3674-84. 96. Li, X., et al., Protein phosphatase 2A and its B56 regulatory subunit inhibit Wnt signaling in Xenopus. Embo J, 2001. 20(15): p. 4122-31. 97. Liang, J., et al., Structure of the PIN/LC8 dimer with a bound peptide. Nat Struct Biol, 1999. 6(8): p. 735-40. 98. Lightcap, C.M., et al., Biochemical and structural characterization of the Pak1-LC8 interaction. J Biol Chem, 2008. 283(40): p. 27314-24. 99. Lin, J.L., et al., MST4, a new Ste20-related kinase that mediates cell growth and transformation via modulating ERK pathway. Oncogene, 2001. 20(45): p. 6559-69. 100. Lipp, J.J., et al., Aurora B controls the association of condensin I but not condensin II with mitotic chromosomes. J Cell Sci, 2007. 120(Pt 7): p. 1245-55. 101. Lo, K.W., et al., The 8-kDa dynein light chain binds to p53-binding protein 1 and mediates DNA damage-induced p53 nuclear accumulation. J Biol Chem, 2005. 280(9): p. 8172-9. 102. Lo, K.W., et al., The 8-kDa dynein light chain binds to its targets via a conserved (K/R)XTQT motif. J Biol Chem, 2001. 276(17): p. 14059-66. 103. Ma, X., et al., PDCD10 interacts with Ste20-related kinase MST4 to promote cell growth and transformation via modulation of the ERK pathway. Mol Biol Cell, 2007. 18(6): p. 1965-78. 104. Makokha, M., et al., Interactions of cytoplasmic dynein light chains Tctex-1 and LC8 with the intermediate chain IC74. Biochemistry, 2002. 41(13): p. 4302-11. 105. Manning, G., et al., The protein kinase complement of the human genome. Science, 2002. 298(5600): p. 1912-34.

103

106. Margolis, S.S., et al., Role for the PP2A/B56delta phosphatase in regulating 14-3-3 release from Cdc25 to control mitosis. Cell, 2006. 127(4): p. 759-73. 107. McCright, B., et al., The B56 family of protein phosphatase 2A (PP2A) regulatory subunits encodes differentiation-induced phosphoproteins that target PP2A to both nucleus and cytoplasm. J Biol Chem, 1996. 271(36): p. 22081-9. 108. Mitchell, D.R. and Y. Kang, Identification of oda6 as a Chlamydomonas dynein mutant by rescue with the wild-type gene. J Cell Biol, 1991. 113(4): p. 835-42. 109. Mocz, G. and I.R. Gibbons, Model for the motor component of dynein heavy chain based on homology to the AAA family of oligomeric ATPases. Structure, 2001. 9(2): p. 93-103. 110. Mok, Y.K., K.W. Lo, and M. Zhang, Structure of Tctex-1 and its interaction with cytoplasmic dynein intermediate chain. J Biol Chem, 2001. 276(17): p. 14067-74. 111. Moorhead, G.B., L. Trinkle-Mulcahy, and A. Ulke-Lemee, Emerging roles of nuclear protein phosphatases. Nat Rev Mol Cell Biol, 2007. 8(3): p. 234-44. 112. Moreno, C.S., W.S. Lane, and D.C. Pallas, A mammalian homolog of yeast MOB1 is both a member and a putative substrate of striatin family-protein phosphatase 2A complexes. J Biol Chem, 2001. 276(26): p. 24253-60. 113. Moreno, C.S., et al., WD40 repeat proteins striatin and S/G(2) nuclear autoantigen are members of a novel family of calmodulin-binding proteins that associate with protein phosphatase 2A. J Biol Chem, 2000. 275(8): p. 5257-63. 114. Naisbitt, S., et al., Interaction of the postsynaptic density-95/guanylate kinase domain-associated protein complex with a light chain of myosin-V and dynein. J Neurosci, 2000. 20(12): p. 4524-34. 115. Navarro, C., et al., Egalitarian binds dynein light chain to establish oocyte polarity and maintain oocyte fate. Nat Cell Biol, 2004. 6(5): p. 427-35. 116. Navarro-Lerida, I., et al., Proteomic identification of brain proteins that interact with dynein light chain LC8. Proteomics, 2004. 4(2): p. 339-46. 117. Neer, E.J., et al., The ancient regulatory-protein family of WD-repeat proteins. Nature, 1994. 371(6495): p. 297-300. 118. Neuwald, A.F., et al., AAA+: A class of chaperone-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res, 1999. 9(1): p. 27-43. 119. Nyarko, A., et al., Ionization of His 55 at the dimer interface of dynein light-chain LC8 is coupled to dimer dissociation. Biochemistry, 2005. 44(43): p. 14248-55. 120. Nyarko, A., et al., The intermediate chain of cytoplasmic dynein is partially disordered and gains structure upon binding to light-chain LC8. Biochemistry, 2004. 43(49): p. 15595-603. 121. Ogris, E., et al., A protein phosphatase methylesterase (PME-1) is one of several novel proteins stably associating with two inactive mutants of protein phosphatase 2A. J Biol Chem, 1999. 274(20): p. 14382-91. 122. Ohoka, Y. and Y. Takai, Isolation and characterization of cortactin isoforms and a novel cortactin-binding protein, CBP90. Genes Cells, 1998. 3(9): p. 603-12. 123. Okamoto, K., et al., p53-dependent association between cyclin G and the B' subunit of protein phosphatase 2A. Mol Cell Biol, 1996. 16(11): p. 6593-602.

104

124. Okamura, S.M., C.E. Oki-Idouchi, and P.S. Lorenzo, The exchange factor and diacylglycerol receptor RasGRP3 interacts with dynein light chain 1 through its C- terminal domain. J Biol Chem, 2006. 281(47): p. 36132-9. 125. Ong, S.E., et al., Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol Cell Proteomics, 2002. 1(5): p. 376-86. 126. O'Rourke, S.M., et al., Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants. PLoS Genet, 2007. 3(8): p. e128. 127. Osada, S., et al., YSK1, a novel mammalian protein kinase structurally related to Ste20 and SPS1, but is not involved in the known MAPK pathways. Oncogene, 1997. 14(17): p. 2047-57. 128. Ouspenski, II, O.A. Cabello, and B.R. Brinkley, Chromosome condensation factor Brn1p is required for chromatid separation in mitosis. Mol Biol Cell, 2000. 11(4): p. 1305-13. 129. Paschal, B.M., et al., Isolated flagellar outer arm dynein translocates brain microtubules in vitro. Nature, 1987. 330(6149): p. 672-4. 130. Paschal, B.M., H.S. Shpetner, and R.B. Vallee, MAP 1C is a microtubule-activated ATPase which translocates microtubules in vitro and has dynein-like properties. J Cell Biol, 1987. 105(3): p. 1273-82. 131. Paschal, B.M. and R.B. Vallee, Retrograde transport by the microtubule-associated protein MAP 1C. Nature, 1987. 330(6144): p. 181-3. 132. Pazour, G.J., B.L. Dickert, and G.B. Witman, The DHC1b (DHC2) isoform of cytoplasmic dynein is required for flagellar assembly. J Cell Biol, 1999. 144(3): p. 473-81. 133. Pazour, G.J., B.L. Dickert, and G.B. Witman, The DHC1b (DHC2) isoform of cytoplasmic dynein is required for flagellar assembly. J Cell Biol, 1999. 144(3): p. 473-81. 134. Pazour, G.J., C.G. Wilkerson, and G.B. Witman, A dynein light chain is essential for the retrograde particle movement of intraflagellar transport (IFT). J Cell Biol, 1998. 141(4): p. 979-92. 135. Pearse, B.M., Clathrin: a unique protein associated with intracellular transfer of membrane by coated vesicles. Proc Natl Acad Sci U S A, 1976. 73(4): p. 1255-9. 136. Pfister, K.K., R.B. Fay, and G.B. Witman, Purification and polypeptide composition of dynein ATPases from Chlamydomonas flagella. Cell Motil, 1982. 2(6): p. 525-47. 137. Pfister, K.K., et al., Cytoplasmic dynein nomenclature. J Cell Biol, 2005. 171(3): p. 411-3. 138. Pfister, K.K., et al., Genetic analysis of the cytoplasmic dynein subunit families. PLoS Genet, 2006. 2(1): p. e1. 139. Phillis, R., et al., Mutations in the 8 kDa dynein light chain gene disrupt sensory axon projections in the Drosophila imaginal CNS. Development, 1996. 122(10): p. 2955- 63. 140. Piperno, G. and D.J. Luck, Axonemal adenosine triphosphatases from flagella of Chlamydomonas reinhardtii. Purification of two dyneins. J Biol Chem, 1979. 254(8): p. 3084-90.

105

141. Pombo, C.M., et al., Activation of a human Ste20-like kinase by oxidant stress defines a novel stress response pathway. Embo J, 1996. 15(17): p. 4537-46. 142. Pombo, C.M., et al., The GCK II and III subfamilies of the STE20 group kinases. Front Biosci, 2007. 12: p. 850-9. 143. Porter, M.E., et al., Cytoplasmic dynein heavy chain 1b is required for flagellar assembly in Chlamydomonas. Mol Biol Cell, 1999. 10(3): p. 693-712. 144. Preisinger, C., et al., YSK1 is activated by the Golgi matrix protein GM130 and plays a role in cell migration through its substrate 14-3-3zeta. J Cell Biol, 2004. 164(7): p. 1009-20. 145. Puthalakath, H., et al., The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell, 1999. 3(3): p. 287- 96. 146. Puthalakath, H., et al., Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science, 2001. 293(5536): p. 1829-32. 147. Qian, Z., et al., Cloning and characterization of MST4, a novel Ste20-like kinase. J Biol Chem, 2001. 276(25): p. 22439-45. 148. Raux, H., A. Flamand, and D. Blondel, Interaction of the rabies virus P protein with the LC8 dynein light chain. J Virol, 2000. 74(21): p. 10212-6. 149. Revencu, N. and M. Vikkula, Cerebral cavernous malformation: new molecular and clinical insights. J Med Genet, 2006. 43(9): p. 716-21. 150. Ricotta, D., et al., Characterization of a protein phosphatase 2A holoenzyme that dephosphorylates the clathrin adaptors AP-1 and AP-2. J Biol Chem, 2008. 283(9): p. 5510-7. 151. Rodriguez-Crespo, I., et al., Identification of novel cellular proteins that bind to the LC8 dynein light chain using a pepscan technique. FEBS Lett, 2001. 503(2-3): p. 135-41. 152. Ruediger, R., et al., Molecular model of the A subunit of protein phosphatase 2A: interaction with other subunits and tumor antigens. J Virol, 1994. 68(1): p. 123-9. 153. Ruediger, R., et al., Identification of binding sites on the regulatory A subunit of protein phosphatase 2A for the catalytic C subunit and for tumor antigens of simian virus 40 and polyomavirus. Mol Cell Biol, 1992. 12(11): p. 4872-82. 154. Sakakibara, H., et al., Inner-arm dynein c of Chlamydomonas flagella is a single- headed processive motor. Nature, 1999. 400(6744): p. 586-90. 155. Sale, W.S. and P. Satir, Direction of active sliding of microtubules in Tetrahymena cilia. Proc Natl Acad Sci U S A, 1977. 74(5): p. 2045-9. 156. Samso, M., et al., Structural characterization of a dynein motor domain. J Mol Biol, 1998. 276(5): p. 927-37. 157. Schild, A., et al., Altered levels of PP2A regulatory B/PR55 isoforms indicate role in neuronal differentiation. Int J Dev Neurosci, 2006. 24(7): p. 437-43. 158. Schnapp, B.J., Trafficking of signaling modules by kinesin motors. J Cell Sci, 2003. 116(Pt 11): p. 2125-35. 159. Schnorrer, F., K. Bohmann, and C. Nusslein-Volhard, The molecular motor dynein is involved in targeting swallow and bicoid RNA to the anterior pole of Drosophila

106

oocytes. Nat Cell Biol, 2000. 2(4): p. 185-90. 160. Schroer, T.A. and M.P. Sheetz, Two activators of microtubule-based vesicle transport. J Cell Biol, 1991. 115(5): p. 1309-18. 161. Schuuring, E., et al., Characterization of the EMS1 gene and its product, human Cortactin. Cell Adhes Commun, 1998. 6(2-3): p. 185-209. 162. Schuuring, E., et al., The product of the EMS1 gene, amplified and overexpressed in human carcinomas, is homologous to a v-src substrate and is located in cell- substratum contact sites. Mol Cell Biol, 1993. 13(5): p. 2891-98. 163. Seeling, J.M., et al., Regulation of beta-catenin signaling by the B56 subunit of protein phosphatase 2A. Science, 1999. 283(5410): p. 2089-91. 164. Shouse, G.P., X. Cai, and X. Liu, Serine 15 phosphorylation of p53 directs its interaction with B56gamma and the tumor suppressor activity of B56gamma-specific protein phosphatase 2A. Mol Cell Biol, 2008. 28(1): p. 448-56. 165. Simons, K. and D. Toomre, Lipid rafts and signal transduction. Nat Rev Mol Cell Biol, 2000. 1(1): p. 31-9. 166. Song, C., et al., Serine 88 phosphorylation of the 8-kDa dynein light chain 1 is a molecular switch for its dimerization status and functions. J Biol Chem, 2008. 283(7): p. 4004-13. 167. Song, Y., et al., Potential role for phosphorylation in differential regulation of the assembly of dynein light chains. J Biol Chem, 2007. 282(23): p. 17272-9. 168. Sontag, E., et al., Molecular interactions among protein phosphatase 2A, tau, and microtubules. Implications for the regulation of tau phosphorylation and the development of tauopathies. J Biol Chem, 1999. 274(36): p. 25490-8. 169. Srinivasan, M. and N. Begum, Regulation of protein phosphatase 1 and 2A activities by insulin during myogenesis in rat skeletal muscle cells in culture. J Biol Chem, 1994. 269(17): p. 12514-20. 170. Tan, G.S., et al., The dynein light chain 8 binding motif of rabies virus phosphoprotein promotes efficient viral transcription. Proc Natl Acad Sci U S A, 2007. 104(17): p. 7229-34. 171. Tanabe, O., et al., Molecular cloning of a 74-kDa regulatory subunit (B" or delta) of human protein phosphatase 2A. FEBS Lett, 1996. 379(1): p. 107-11. 172. Tanner, C.A., et al., Three members of the LC8/DYNLL family are required for outer arm dynein motor function. Mol Biol Cell, 2008. 19(9): p. 3724-34. 173. Tehrani, M.A., M.C. Mumby, and C. Kamibayashi, Identification of a novel protein phosphatase 2A regulatory subunit highly expressed in muscle. J Biol Chem, 1996. 271(9): p. 5164-70. 174. Traer, C.J., et al., SNX4 coordinates endosomal sorting of TfnR with dynein-mediated transport into the endocytic recycling compartment. Nat Cell Biol, 2007. 9(12): p. 1370-80. 175. Tynan, S.H., M.A. Gee, and R.B. Vallee, Distinct but overlapping sites within the cytoplasmic dynein heavy chain for dimerization and for intermediate chain and light intermediate chain binding. J Biol Chem, 2000. 275(42): p. 32769-74. 176. Tynan, S.H., et al., Light intermediate chain 1 defines a functional subfraction of cytoplasmic dynein which binds to pericentrin. J Biol Chem, 2000. 275(42): p.

107

32763-8. 177. Usui, H., et al., Activation of protein phosphatase 2A by cAMP-dependent protein kinase-catalyzed phosphorylation of the 74-kDa B'' (delta) regulatory subunit in vitro and identification of the phosphorylation sites. FEBS Lett, 1998. 430(3): p. 312-6. 178. Vadlamudi, R.K., et al., Dynein light chain 1, a p21-activated kinase 1-interacting substrate, promotes cancerous phenotypes. Cancer Cell, 2004. 5(6): p. 575-85. 179. Vale, R.D., The molecular motor toolbox for intracellular transport. Cell, 2003. 112(4): p. 467-80. 180. Vallee, R.B., et al., Microtubule-associated protein 1C from brain is a two-headed cytosolic dynein. Nature, 1988. 332(6164): p. 561-3. 181. Vaughan, P.S., J.D. Leszyk, and K.T. Vaughan, Cytoplasmic dynein intermediate chain phosphorylation regulates binding to dynactin. J Biol Chem, 2001. 276(28): p. 26171-9. 182. Virshup, D.M. and S. Shenolikar, From promiscuity to precision: protein phosphatases get a makeover. Mol Cell, 2009. 33(5): p. 537-45. 183. Wagner, W., et al., The binding of DYNLL2 to myosin Va requires alternatively spliced exon B and stabilizes a portion of the myosin's coiled-coil domain. Biochemistry, 2006. 45(38): p. 11564-77. 184. Wang, L., et al., Dynein light chain LC8 promotes assembly of the coiled-coil domain of swallow protein. Biochemistry, 2004. 43(15): p. 4611-20. 185. Wickstead, B. and K. Gull, Dyneins across eukaryotes: a comparative genomic analysis. Traffic, 2007. 8(12): p. 1708-21. 186. Wielowieyski, P.A., et al., Alternative splicing, expression, and genomic structure of the 3' region of the gene encoding the sarcolemmal-associated proteins (SLAPs) defines a novel class of coiled-coil tail-anchored membrane proteins. J Biol Chem, 2000. 275(49): p. 38474-81. 187. Williams, J.C., et al., Structural and thermodynamic characterization of a cytoplasmic dynein light chain-intermediate chain complex. Proc Natl Acad Sci U S A, 2007. 104(24): p. 10028-33. 188. Wilson, M.J., et al., Light chains of mammalian cytoplasmic dynein: identification and characterization of a family of LC8 light chains. Cell Motil Cytoskeleton, 2001. 49(4): p. 229-40. 189. Wu, H. and J.T. Parsons, Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J Cell Biol, 1993. 120(6): p. 1417-26. 190. Xing, Y., et al., Structure of protein phosphatase 2A core enzyme bound to tumor- inducing toxins. Cell, 2006. 127(2): p. 341-53. 191. Xu, Z. and B.R. Williams, The B56alpha regulatory subunit of protein phosphatase 2A is a target for regulation by double-stranded RNA-dependent protein kinase PKR. Mol Cell Biol, 2000. 20(14): p. 5285-99. 192. Yan, Z., et al., PR48, a novel regulatory subunit of protein phosphatase 2A, interacts with Cdc6 and modulates DNA replication in human cells. Mol Cell Biol, 2000. 20(3): p. 1021-9. 193. Yan, Z., et al., PR48, a novel regulatory subunit of protein phosphatase 2A, interacts

108

with Cdc6 and modulates DNA replication in human cells. Mol Cell Biol, 2000. 20(3): p. 1021-9. 194. Zhang, W., et al., PR55{alpha}, a Regulatory Subunit of PP2A, Specifically Regulates PP2A-mediated {beta}-Catenin Dephosphorylation. J Biol Chem, 2009. 284(34): p. 22649-56. 195. Zhou, T.H., et al., Identification of a human brain-specific isoform of mammalian STE20-like kinase 3 that is regulated by cAMP-dependent protein kinase. J Biol Chem, 2000. 275(4): p. 2513-9. 196. Zhu, T. et al., The interconversion of protein phosphatase 2A between PP2A1 and PP2A0 during retinoic acid-induced granulocytic differentiation and a modification on the catalytic subunit in S phase of HL-60 cells. Arch Biochem Biophys, 1997. 339(1): p. 210-7.