[CANCER RESEARCH 57. 3526—3531.August 15, 19971 Expression of Neurogenic Basic Helix-Loop-Helix Genes in Primitive Neuroectodermal Tumors1

Robert C. Rostomily,2 Olivia Bermingham-McDonogh, Mitchel S. Berger, Stephen J. Tapscott, Thomas A. Reh, and James M. Olson3

Departments of Neurological Surgery (R. C. R., M. S. B.J, Biological Structure fR. C. R., 0. B-M., T. A. RI, and Neurology [S. .1. Ti, The University of Washington School of Medicine, Seattle, Washington 98195; Division of Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98109 (S. J. T., J. M. 0.1; and Divisions ofNeurological Surgery (R. C. R.] and Pediatric Hematology-Oncology fJ. M. 0.], The Children ‘sHospitaland Medical Center, Seattle, Washington 98105

ABSTRACT commit progenitors to a neural fate and induce terminal neuronal differentiation. The basic helix-loop-helix (bHLH) class of transcription factors plays a The NeuroD family, bike the myogenic MyoD family, consists of pivotal role in tissue-specific determination and differentiation. Moreover, members of class I bHLH transcription factors that regulate tissue dysregulated expression or loss of function of these factors contributes to specific differentiation (3—8).MyoD family members orchestrate leukemogenesis and solid tumor development. Neurogenesis is regulated by genes of the NEUROD/atonaland ACHAETESCUTE families. We myogenic differentiation and are universally expressed in rhab analyzed expression of human NEURODJ, NEUROD2, NEUROD3, and domyosarcomas, yet rhabdomyosarcomas evade terminal differen ACHAETE SCUTE 1 (HASHJ) in cerebellar and cerebral primitive neu tiationat beastinpartby inhibitingtheactivityof MyoD(9—12). roectodermal tumors (PNETs), gliomas, and cell lines derived from a On the basis of similarities between NeuroD and MyoD, we variety of neuroectodermal tumors by Northern analysis and in situ hypothesized that NeuroD family members may be expressed in hybridization. NEURODJ was expressed in each of the 12 medulloblas medubbobbastomas as markers of a neurogenic lineage. Because toma specimens, whereas NEUROD2 and NEUROD3/neurogenin were distinct populations of neurons express different neurogenic bHLH expressed in partly overlapping subsets of medulloblastomas. All of the transcription factors during development, we further hypothesized tumors that presented with distant metastases expressed NEUROD3. The that bHLH patterns would vary between PNETs arising from only other NEUROD3-positive tumor progressed early in treatment. Hu different neuronal lineages. manACHAETESCUTE homologue (HASHJ)was not expressed in medal loblastomas (infratentorial PNETs) but was expressed in three of five NEUROD and ACHAETE SCUTE genes are expressed in overlap supratentorial PNETs. Neuroectodermal tumor cell lines derived from ping but distinct populations of neuroblasts during neuronab develop other sites (e.g., neuroblastoma and retinoblastoma) expressed NeuroD ment. A population of immature proneurab cells that reside in the and ACHAETE SCUTE family members. No NEUROD message was ventricular zone first express NEUROD3/neurogenin at mouse em detected in glial tumors or cell lines. Neurogenic bHLH transcription bryonic day 9.5 (E9.5; Refs. 4 and 6). Ventricular zone cells migrate factor expression patterns suggest that specific family members may to the periventricubar zone, where NEURODJ is first expressed (3, 6). contribute to or reflect biological differences that arise during malignant NeuroD2 expression commences on Ell.5 (4). By E16, NEUROD3 transformation. can no longer be detected by Northern analysis of RNA derived from brain tissue (4). In contrast, NEURODJ and NEUROD2 are expressed throughout cerebeblar development and in adult cerebellum, primarily INTRODUCTION in the granule cell layer (3, 4). The importance of these genes in Molecular events associated with medulboblastoma and other child neuronal development was established by their ability to induce hood brain tumor development are very poorly understood. Currently, ectopic neurogenesis and premature neuronal differentiation when injected into Xenopus embryos (3, 4, 6). ACHAETE SCUTE homo no biological markers facilitate stratification of treatment groups, assist with prognosis, or serve as targets for therapeutic intervention bogues make up a distinct family of neurogenic bHLH transcription factors that share homology with the NEUROD family. Achaete scute (1). Medullobbastomas express neuronab intermediate filaments, synap null mutant mice failed to develop sympathoadrenal neural cells and olfactory neurons (13). Mammalian achaete scute (mashi) expression tic vesicle proteins, growth factor receptors, and adhesion molecules, suggesting that they arise from neurobbasts that escape terminal dif was reported in cerebellum, but it remains unclear whether it is ferentiation (2). The mechanisms by which cells escape terminal expressed in the same neural precursors as neuroD family members (14). differentiation can now be addressed because the NeuroD family of bHLH4 proteins was recently identified. NeuroD and the rebated achaete scute transcription factors regulate activation of genes that MATERIALS AND METHODS

Received1/14/97;accepted6/10/97. Surgical specimens from 13 medulbobbastomas, 5 supratentorial PNEIs, and The costs of publication of this article were defrayed in part by the payment of page 6 pediatric gliomas and cell lines derived from 14 neuroectodermal tumors and charges. This article must therefore be hereby marked advertisement in accordance with 3 gliomas were evaluated for expression of NeuroD family members and 18 U.S.C. Section 1734 solely to indicate this fact. HASHJ by Northern analysis. Because surgicaltissue quantity was limited, not t This work was supported by NINDS NS 09458 (to R. C. R), NIH Grants ROl NS 28308 and NS 30304 (to T. A. R.), and the Seattle Children's Hospital, “Jesse'sPerfect all bHLH members were tested on each specimen. In situ analysis was used to Peach―NeurooncologyResearch Fund (to J. M. 0). R. C. R. was supported by the Charles confirm Northern data and determine whether expression was ubiquitous in A. Elsberg Fellowship in Neurological Surgery of the New York Academy of Medicine tumor cells. Studies were done in accordance with the Children's Hospital and by Neurosurgery Training Program Grant N07l44. S. J. T. was supported by an Human Subjects Institutional Review Board guidelines. Human tumor tissue American Cancer Society grant. J. M. 0. was supported by the Emily Dorfman Founda tion through the American Brain Tumor Association. samples were obtained at craniotomy. Samples were either snap frozen in 2 Present address: 59th Medical WingIMKFN, Department of Neurosurgery, Wilford liquid nitrogen and stored at —80°C,orthey were placed in tissue culture Hall Medical Center, 2200 Bergquist Drive, STE1, Lackland AFB, San Antonio, TX media and then mechanically dissociated and filtered, and the centrifuged cell 78246-5300. pellet was snap frozen and stored at —80°C. 3 To whom requests for reprints should be addressed, at the Fred Hutchinson Cancer Research Center, Mailstop C3-l68, 1100 Fairview Avenue, Seattle, WA 98109. Cell Culture. Thecell lines listedin Table2 wereobtainedfromAmerican 4 The abbreviations used are: bHLH, basic helix-loop-helix; PNET, primitive neuro Type Culture Collection with the following exceptions: NLF, NGP, and NMB ectodermal tumor. (G. Brodeur, University of Pennsylvania, Philadelphia, PA); UW228, I98G, 3526

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. NEURODAND HASHI IN NEUROECI'ODERMALTUMORS and SNB 19(J. Silber and M. Berger, University ofWashington, Seattle, WA). Y79, WERI, H209, and H82 were grown in RPM! 1640 (Life Technologies, MMMMM Inc.) with 10% FBS (Hyclone). The remainder were grown in Eagle's MEM with Earle's balanced salt solution, non-essential amino acids (Life Technol 1 2345 ogies, Inc.), 1 mist pyruvate (Life Technologies, Inc.), and 10% fetal bovine serum or bovine calf serum. A Northern Analysis. Total RNA was extracted from confluent cell lines and tissue specimens or cell pellets using Trizol reagent (Life Technolo -2.6 gies, Inc.). Northern analysis was performed according to published pro cedures with minor modifications (15, 16). Due to limited sample quantity, NEUROD2 and NEUROD3 expression was determined for some specimens on stripped membranes that had previously been used for NEURODI and HASHJ expression, respectively. Stripped filters exposed to film for 4 days were found to be negative for NEURODJ bands prior to reprobing. Human NEURODJ message was detected by either a full-length 1.6-kb cDNA probe or an 800-bp divergent probe (carboxyl to bHLH domain) isolated -2.6 with Kpn digestion (3). The human NEUROD2 probe spanned 500 bp in the 3' divergent region between Pst and Sac! excision sites (4). The human NEUROD3/neurogenin probe spanned 800 bp, from the Sma to the Pst 1.1-IL restriction sites of the clone SK2OA1 (4). HASHJ probe spanned the bHLH domain using the PCR primers GTCACAAGTCAGCGCCCAAG and C CGACGAGTAGGATGAGACCG.HASHJfindings were confirmed with a 0.9-kb fragment isolated from a human fetal cDNA library (Stratagene) that -1.9 was homologous to the published sequence in the 3' untranslated region (17). None of the divergent probes cross-reacted with RNA from other family members under the conditions used. In Situ Hybridization. Paraformaldehyde-fixed frozen tumor specimens S were sectioned at l2-g.@mintervals and then pretreated with 4% proteinase K, D acetic anhydride, and 0.1% Triton X-lOO (NEURODI) or 4% proteinase K and acetic anhydride (NEUROD2and NEUROD3).In situ analysis was performed according to a published procedure except that the concentration of NBT was -2.6 reduced 10-fold for NEUROD2 and NEUROD3 assays (18).

RESULTS E$j)S@ Neurogenic bHLH Genes in Human Tumor Specimens. Neu roDi was expressed in each of the 12 medulbobbastoma surgical specimens analyzed (Fig. 1; Table 1). Specimens 2—4,6, and 10 also expressed NEUROD2, and specimens 1, 3, 5, 8 and 9 ex pressed NEUROD3/neurogenin. Four of the patients whose tumors F@ftØ expressed NEUROD3/neurogenin presented with disseminated dis Fig. 1. Representative Northern analyses of NEURODI (A), NEUROD2 (B), NEU. ease, and the fifth developed clinical and radiographic progression ROD3/neurogenin (C), and HASH! (D) expression in medulloblastoma surgical speci in the 3-week interval between tumor resection and initiation of mens. E and F, loading variability of 20 @gofRNA as assayed by a probe to the human radiation therapy. Although the association between NEUROD3/ glyceraldehyde-3-phosphate deshydrogenase gene (GAPDH). Lanes (left to right), pa tients Mt—MS.These and other patient data are summarized in Table I. Molecular weight neurogenin expression and medulboblastoma dissemination is sig markers are indicated on the right. nificant using the Fisher exact test, a larger study will be necessary to conclusively evaluate the prognostic implications of NEUROD3/ neurogenin expression. histologically, they probably derive from distinct progenitor cell In situ hybridization using antisense probes for each NEUROD populations. gene revealed robust staining in the characteristically scant cytoplasm, Six pediatric gliomas, including cerebelbar pilocytic astrocytoma, whereas background hybridization with sense probes was minimal cerebral pilocytic astrocytoma, ependymoma, and malignant astrocy (Fig. 2 and data not shown). In an expressing tumor, nearly all of the toma specimens, and three human glioma cell lines failed to express cells were positive for the particular NeuroD mRNA, consistent with any of the neurogenic bHLH messages (Table 2 and data not shown). the homogeneous nature of medulboblastomas. Esthesioneuroblas Neurogenic bHLH Expression In Neuroectodermal Tumor Cell tomasamplesassayedbyinsituanalysisdemonstratedpatchyexpres Lines. We next evaluated cell lines derived from neuroectodermal sion of NEURODJ and NEUROD3/neurogenin, suggesting that cx tumors to determine the patterns of neurogenic bHLH expression. pression may be more heterogeneous in some tumors (data not Northern analysis was performed on thirteen cell lines derived from shown). tumors of presumed neuroectodermal origin. Consistent with patient Medulbobbastoma (infratentoriab PNET) samples probed with samples and developmental data discussed above, D283 and D34l sequence from a human clone of HASH! were uniformly negative metastatic medulloblastoma cell lines expressed NEURODI and (Fig. 1; Table 1). In contrast, three of five supratentorial PNETs NEUROD3/neurogenin (Table 2). Although the medulloblastoma cell expressed HASh (Fig. 3; Table 1). Conversely, all medulboblas lines did not express HASHI, it was notable that the neuroblastoma toma samples expressed NEURODJ, but only one of four supra cell lines SKN-SH, NGP, NMB, and 1MR32 expressed HASHJ, a tentorial PNETs expressed NEURODI . These results suggest that gene that is critical for sympathoadrenal lineage development (13). although medulboblastoma and supratentoriab PNET are similar SKN-SH, NGP, and 1MR32 coexpressed NEURODI, but NEUROD2 3527

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. NEURODAND HASH! IN NEUROECTODERMALTUMORS

medulloblastomaNorthern Table I NEUROD genes and HASH! in analysis was performed on 20 @sgofRNA from 12 patients with cerebellar PNETs and 5 patients with supratentorial PNETs using cDNA probes to NEUROD!, NEUROD2, NEUROD3. or HASH!. Data from patientsMI—MSare shown in Fig. I, and data from patientsMb, Ml3, and Sl—S5areshown in Fig. 3. Sampleswere scoredpositive if the appropriate—80°C.DistantPatient size band was present after ovemight hybridization under high-stringency conditions followed by 24—72hof film exposure at

HASH!MedulloblastomasAge Sex metastasis NEURODI NEUROD2 NEUROD3 PNETs)Ml (infrasentorial —M2 S M― Yes + — + —M3 7 M No + + — -M4 9 M Yes + + + 10 M No + + — — M?—M6 to M No― + — + —M7 I F No + + — -M8 7 M No + - - —M9 13 M Yes + ND + -MlO 7 F Yes ND ND + -Mll 9 M No + + ND -Ml2 8 M No + - ND -Ml3 6 M No + - ND -Supratentorial 3 M No + ND ND PNETs SI+52 17 M ND - ND ND +S3' 2 M ND - ND ND -54 2 M ND ND ND ND +S5 3 M ND + ND ND 7 F ND - ND ND - aM.male:F,female,ND,notdone. I, Tumor progressed early in treatment.

( Recurrent tumor specimen from patient 52. and NEUROD3 were absent in neuroblastoma cell lines. None of the other than those tested (e.g. , atonal homobogues) or that expression is NEUROD mRNAs were detectable by Northern analysis in DAOY below the limit of detection by Northern analysis. and UW228 medubboblastoma cells or NLF and SKN-MC neuroblas Retinoblastoma cell lines expressed NEUROD genes but did not toma cells. It is possible that these cell lines express bHLH proteins express HASh. Y79, a cell line derived from familial retinobbastoma,

;A

Fig. 2. In situ analysis of NEUROD!, NEUROD2, and NEUROD3 in medulloblastoma samples. Top row, patient samples Ml0 (A), M4 (B), and M3 (C) stained with H&E. Bottom row, in situ analysis using antisense digoxin-labeled riboprobes NEUROD! on sample MlO (D), NEUROD2 on sample M4 (E), and NEUROD3 on sample M3 (F). Ten-gsm markers are shown in bottom left comer of each specimen in the top row. 3528

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. NEUROD AND HASH! IN NEUROECFODERMAL TUMORS

lines; (c) all of the medubbobbastomas from patients who presented MSMSSSS with early signs of biologically aggressive disease expressed NEU 1 ROD3/neurogenin; (d) NEUROD family members were also cx pressed in other neuroectodermal cell lines, including neuroblastomas, 312345 retinoblastomas, and small cell lung cancer; and (e) HASHJ was not expressed in medulloblastoma tumor samples or cell lines but was expressed in supratentorial PNETs and cell lines derived from periph eral nervous system neuroectodermal tumors, including neuroblas toma and small cell lung cancer. Preliminary experiments using an tisera reactive to neurod2 demonstrated that protein expression correlated with in situ and Northern analysis data.6 Every tumor sample derived from neuroectodermal tissue cx pressed one or more neurogenic bHLH genes, whereas no glial tumors -2 6 NEURODJ,NEUROD2,andNEUROD3/neurogenin,expressed NeuroD family members. Medulboblastomasallofwhichare expressed expressed in developing cerebellum or cerebellar precursors (3, 4, 6). Likewise, neuroblastomas expressed HASH] and NEURODI, both of which are expressed in the developing autonomic nervous system (3, 11 13, 14). In this study, HASH] expression distinguished some suprat C entorial PNETs from infratentonal PNETs (medubloblastoma). Cur rently, PNETs from both sites are classified together and treated •0Sa similarly, although they respond differently to therapy (1, 2 1—23). Thus, along with other genes expressed in restricted regions of the D,...@,.. developing nervous system, such as pax, homeobox, and zinc finger genes, bHLH genes may provide clues to the lineage of tumor origin (24—26). Transcription factors contribute to malignant transformation by Fig. 3. Northem analysis ofNEUROD! and HASH expression in supratentorial PNETs. A, NEUROD! expression in medulloblastoma samples MlO and Ml3 and in supratentorial either dysregulation of factors that enhance growth and loss of cell PNET samples S1-S5; B, HASH! expression in corresponding samples; C and D, GAPDH cycle control (oncogenes) or by inactivation of transcription factors expression on lanes represented in rows A and B, respectively. that normally regulate cell cycle or terminal differentiation (tumor suppressors or anti-oncogenes). bHLH family members have been described in each of these roles, although they have not traditionally expressed NEURODJ and NEUROD3/neurogenin. WERI, a sponta been called proto-oncogenes or tumor suppressors. For example, neous retinoblastoma cell line, expressed NEURODJ but no others. chromosomal translocations of the bHLH genes E2A and Ta! to the NEURODJ is expressed in developing and mature retina, and retinal DNA-binding domain of a homeobox gene and to the enhancer region expression of NEUROD2 and NEUROD3/neurogenin is not yet of a T-cell receptor, respectively, result in leukemic transformation, known.5 Achaete scute homobogues are expressed in late but not early presumably by inducing transcription of inappropriate target genes retinal progenitors (19, 20). (27—29).In contrast, MyoD normally maintains a tumor suppressor The lineage from which small cell lung cancers arise remains robe by orchestrating myogenic cell cycle control and terminal differ controversial. The H82 cell line expressed NEURODJ and NEU entiation, but its function is diminished in rhabdomyosarcomas by ROD3/neurogenin, and H209 cells expressed HASHJ and NEUROD3 (Table 2). Additional experiments are needed to determine whether expression of MyoD repressors and by limited availability of neces neurogenic bHLH factors are expressed because these tumors arise sary cofactors (1 1, 12). from neuroendocrine cells or whether NEUROD/ACHAETE SCUTE Within the limits of Northern analysis sensitivity, NEUROD3/ genes are deregulated in these tumors conferring a neuronal pheno neurogenin has been described in two populations: the immature type to cells derived from a nonneuronab lineage. proneural cells that reside in the mitotically active ventricular zone NeuroD2 was not expressed in any neuroectodermal tumor line and medulloblastoma samples from patients who presented with dis tested. It is possible that none of the cell lines tested were derived tant metastasis or who rapidly progressed (4, 7). This raises the from NEUROD2-expressing tumors. Alternatively, NeuroD2 expres question of whether NEUROD3/neurogenin serves a different role in sion might confer a growth disadvantage to cells so that they are normal development and malignancy than the other neurogenic bHLH selected against in culture. factors tested. We previously localized NEURODJ, NEUROD2, and NEUROD3/neurogenin to chromosome regions 2q32, 17ql2, and 5q23—31, respectively (30, 3 1). Comparative genomic hybridization DISCUSSION analysis of medulboblastoma samples demonstrated gain of distal 5q In this study, we examined the expression of neurogenic bHLH in 3 of 18 cases, consistent with the possibility that NeuroD3 is transcription factors in neuroectodermal tumors and cell lines by amplified or translocated in a subset of medulboblastomas (32). Northern analysis and in situ hybridization. We found the following: The more downstream neuronal differentiation factors, NEURODJ (a) NEUROD] was expressedin all medulboblastomatumorsandtwo and NEUROD2, are more reminiscent of MyoD in rhabdomyosar medublobbastoma cell lines; (b) NEUROD2 and NEUROD3/neuroge coma. Whether these transcription factors regulate terminal differen nm were expressed in subsets of medulboblastoma tumor specimens, tiation and induce cell cycle control in mammalian cells remains to be and NEUROD3/neurogenin was expressed in medulboblastoma cell determined. If so, then the paradoxical expression of these genes in

5 0. Bermingham-McDonogh and T. A. Reh, unpublished data. 6 J@ M. Olson, unpublished observations. 3529

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. NEUROD AND HASH) IN NEUROECTODERMAL TUMORS

linesRNA Table 2 NEUROD genes and HASH! in cell 4. McCormick, M. B., Tamimi, R. M., Snider, L., Asakura, A., Bergstrom, D., and celllung was harvested from medulloblastoma, neuroblastoma, retinoblastoma, small Tapscott. S. J. NeuroD2 and neuroD3: distinct expression patterns and transcriptional byNorthemcancer, and glioma cell lines near confluence. Twenty @sgofRNA were analyzed activation potentials within the neuroD gene family. Mol. Cell. Biol., !6: 5792—5800, analysis and scored following ovemight hybridization at high stringency fol 1996. lowed by 24—72hfilm—80°C.NEURODI exposure at 5. Kume, H., Maruyama, K., Tomita, T., Iwatsubo, T., Saido, T. C., and Obata, K. Molecular cloning of a novel basic helix-loop-helix protein from the rat brain. HASH!MedulloblastomaD283 NEUROD2 NEUROD3 Biochem. Biophys. Rca. Commun., 2!9: 526—530, 1996. 6. Ma, Q., Kintner, C., and Anderson, D. J. Identification of neurogenin, a vertebrate neuronal determination gene. Cell, 87: 43—52,1996. —D34l + — + 7. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krause, M., Benezra, R., —UW228 + — + -DAOY - - - Blackwell, T. K., Tumer, D., Rupp, R., Hollenberg, S., Zhuang, Y., and Lassar, A. -NeuroblastomaSKN-SH- - - The myoD gene family: nodal point during specification of the muscle cell lineage. Science (Washington DC), 25!: 761—766,1991. 8. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P-F., Weintraub, H., and Lassar, +NLF + - - -NGP - - - A. B. MyoDl : a nuclear phosphoprotein requiring a Myc homology region to convert +NMB + - - fibroblasts to myoblasts. Science (Washington DC), 242: 405—411, 1988. +1MR32 - - - 9. Clark, J., Rocques, P. J., Braun, T., Bober, E., Arnold, H. H., Fisher, C., Fletcher, C., +SKN-MC + — — Brown, K., Gusterson, B. A., Carter, R. L., and Cooper, C. S. Expression of members -RetinoblastomaY79 - - - of the myfgene family in human rhabdomyosarcomas. Br. J. Cancer, 64: 1039—1042, 1988. —WERI + - + 10. Tonin, P. N., Scrable, H., Shimada, H., and Cavenee, W. K. Muscle-specific gene —Small + — — expression in rhabdomyosarcomas and stages of human fetal skeletal muscle devel cancerH82cell lung opment. Cancer Res., 5!: 5100—5106,1991. —H209 + — + I I. Tapscott, S. J., Thayer, M. J., and Weintraub, H. Deficiency in rhabdomyosarcomas +GliomaSNBI9 - - + of a factor required for MyoD activity and myogenesis. Science (Washington DC). 259: 1450—1453,1993. —T98G — — — 12. Fiddler, T. A., Smith, L., Tapscott, S. J., and Thayer, M. J. Amplification of MDM2 -SF767 - NDa ND inhibits MyoD-mediated myogenesis. Mol. Cell. Biol., 16: 5048—5057, 1996. —a — — — 13. Guillemot, F., La L-C., Johnson, J. E., Auerback, A., Anderson, D. J., and Joyner, A. L. Mammalian achaete-scute homolog-l is required for the early development of ND, not done. olfactory and autonomic neurons. Cell, 75: 463—476, 1993. 14. Guillemot, F., and Joyner, A. L. Dynamic expression of the murine Achaete-Scute homologue Mash-I in the developing nervous system. Mech. Dcv., 42: 171—185, neuroectodermal tumors suggests that these cancer cells may gain a 1993. 15. Bennahmias, S. An altemative to the water bath/plastic bag method for hybridization growth advantage by limiting the function of bHLH transcription of Southem and Northem blots. Am. Biotechol. Lab., 10—12,1989. factors. Prior to the isolation of NEURODJ, a study of MyoD function 16. Chen, M. S., Bermingham-McDonogh, 0., Danehy, F. T., Nolan, C., Scherer, S. S., Lucas, J., Gwynne, D., and Marchionni, M. A. Expression of multiple neuregulin in neuroblastoma and medulboblastoma cell lines suggested that rhab transcripts in postnatal rat brains. J. Comp. Neurol., 349: 389—400, 1994. domyosarcomas and neuroectodermal tumors may share mechanisms 17. Ball, D. W., Azzoli, C. G., Baylin, S. B., Chi, D., Dou, S., Donis-Keller, H., of evading bHLH transcription control (33). In addition, NEUROD2 Cumaraswamy, A., Borges, M., and Nelkin, B. D. Identification of a human achaete sautehomologhighlyexpressedin neuroendocrinetumors.Proc.Natl.Acad.Sci. expression or function might be affected by rearrangements associated USA, 90: 5648—5652,1993. with isochromosome 17q, the most common cytogenetic abnormality I8. Schaeren-Wiemers, N., and Gerfin-Moser, A. A single protocol to detect transcripts in medubboblastomas (32, 34). of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry. !00: 431— The study of mammalian neurogenic bHLH transcription factors 440, 1993. promises to be rather complex. Multiple proneurab bHLH genes 19. Jasoni, C. L., Walker, M. B., Morris, M. D., and Reh, T. A. A chicken achaete-scute homolog (CASH-l) is expressed in a temporally and spatially discrete manner in the work combinatorialby with each other and with other devebopmen developing nervous system. Development (Camb.), 120: 769—783, 1994. tal transcription activators to orchestrate development of the rela 20. Jasoni, C. L., and Reh, T. A. Temporal and spatial pattem of MASH-I expression in tively simple neural structures in Drosophila (35—37). From the the developing rat retina demonstrates progenitor cell heterogeneity. J. Comp. Neu rol., 319—327,1996. more intricate vertebrate nervous system, a number of neurogenic 21. Rorke, L. B., Gilles, F. H., Davis, R. L., and Becker, L. E. Revision of World Health bHLH proteins have been described (3—6, 19, 38—44). Basic Organization classification of brain tumors for childhood brain tumors. Cancer information about these proteins, such as dimerization partners, (Phila.), 56: 1869—1886, 1996. 22. Packer, R. J., Sutton, L. N., Elterman, R., Lange, B., Goldwein, J., Nicholson, H. S., DNA binding preferences, and biological targets, remains to be Mulne, L., Boyets, J., Dangio, G., Wechslerjentzsch, K., Reaman, G., Cohen, B. H., elucidated. As that work progresses, the current study shows that Bruce, D. A., Rorke, L. B., Molloy, P., Ryan, J., Lafond, D., Evans, A. E., and Schut, NeuroD family members may be useful diagnostically and pro L. Outcome for children with medulloblastoma treated with radiation and cisplatin, CCNU, and vincristine chemotherapy. J. Neurosurg., 8!: 690—698,1994. vides a rationale for a study addressing the prognostic implications 23. Cohen, B. H., Zeltzer, P. M., Boyett, J. M., Geyer, J. R., Allen, J. C., Finlay, J. L., of NEUROD3/neurogenin expression. McGuire-Cullen, P., Milstein, J. M., Rorke, L. B., Stanley, P., Stehbens, J. A., Shurin, S. B., Wisoff, J., Stevens, K. R., and Albright, A. L. Prognostic factors and treatment results for supratentorial primitive neuroectodermal tumors in children using radiation ACKNOWLEDGMENTS and chemotherapy: a children's cancer group randomized trial. J. Clin. Oncol., 13: 1687—1696,1995. 24. Kozmik, Z., Sure, U., Ruedi, D., Busslinger, M., and Aguzzi, A. Deregulated We thank Jackie Lee, Anthony Gerber, Mary Beth McCormick, and Rulla expression of PAX5 in medulloblastoma. Proc. Nail. Acad. Sci. USA, 92: 5709— Tamimi for contributions to this work; Kathleen Patterson for pathology 5713, 1996. assistance; Wendy Leisenring for statistical assistance; and J. Russel Geyer for 25. Yokota, N., Aruga, J., Takai, S., Yamada, K., Hamazaki, M., Iwase, T., Sugimura, H., critical evaluation of the manuscript. and Mikoshiba, K. Predominant expression of human zic in cerebellar granule cell lineage and medulloblastoma. Cancer Res., 56: 377—383,1996. 26. Aruga, J., Yokota, N., Hashimoto, M., Furuichi, T., Fukuda, M., and Mikoshiba, K. REFERENCES A novel zinc finger protein, zic, is involved in neurogenesis, especially in the cell lineage of cerebellar granule cells. J. Neurochem., 63: 1880—1890, 1994. 1. Heideman, R. L., Packer, R. J., Albright, L. A., Freeman, C. R., and Rorke, L. B. 27. Nourse, J., Mellentin, J. D., Galili, N., Wilkinson, J., Stanbridge, E., Smith, S. D., and Tumors of the central nervous system. In: P. A. Pizzo and D. G. Poplack (eds.), Cleary,M.,L.Chromosomaltranslocationt(l;19)resultsinsynthesisofa homeobox Principles and Practice of Pediatric Oncology. ed. 2, pp. 633—682.Philadelphia:J. B. fusion mRNA that codes for a potential chimeric transcription factor. Cell, 60: Lippincott Co., 1993. 535—545,1990. 2. Trojanowski, J. Q., Tohyama, T., and Lee, V. M-Y. Medulloblastomas and related 28. Chen, Q., Yang, C., Tsan, J. T., Xia, Y., Ragab, A. H., Peiper, S. C., Carroll, A., and primitiveneuroectodennalbraintumorsofchildhood recapitulatemolecularmilestonesin Baer, R. Coding sequences of the tal-l gene are disrupted by chromosomal translo the maturationof neuroblasts.Mol. Chem. Neuropathol.,!7: 121—135,1992. cation in human T-cell leukemia. J. Exp. Med., 172: 1403—1408,1990. 3. Lee, J. E., Hollenberg, S. M., Snider, L., Tumer, D. L., Lipnick, N., and Weintraub, 29. Aplan, P. D., Begley, C. G., Bertness, V., Nussmeier, M., Ezquerra, A., Coligan, J., H. NeuroD, a new basic helix-loop-helix protein, can convert Xenopus ectoderm into and Kirsch, I. R. The SCL gene is formed from a transcriptionally complex locus. neurons. Science (Washington DC), 268: 836—844, 1995. Mol. Cell. Biol., !0: 6426—6435,1990. 3530

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. NEUROD AND HASH) IN NEUROECTODERMAL TUMORS

30. Tamimi, R., Steingrimsson, E., Copeland, N. G., Dyer-Montgomery, K., Lee, J. E., 38. Johnson, J. E., Birren, S. J., and Anderson, D. J. Two rat homologues of Drosophila Hemandez,R.,Jenkins,N.A.,andTapscou,S.J. TheneuroDgenemapsto human achaete-scute specifically expressed in neuronal precursors. Nature (Land.), 346: chromosome 2q32 and mouse chromosome 2. Genomics, 34: 418—421,1996. 858—861. 1990. 31. Tamimi, R. M., Steingrimsson, E., Montgomery-Dyer, K., Copeland, N. G., Jenkins, 39. Sasai, Y., Kageyama, R., Tagawa, Y., Shigemoto, R.. and Nakanishi, S. Two N. A., and Tapscott, S. J. NEUROD2 and NEUROD3 genes map to human chromo mammalian helix-loop-helix factors structurally related to Drosophila hairs' and somes llql2 and 5q23—q31andmousechromosomes11 and 13, respectively. enhancer ofsplit. Genes Dcv., 6: 2620—2634, 1992. Genomics, 40: 355—357,1997. 40. Bartholoma, A., and Nave, K-A. Nex-l : a novel brain-specific helix-loop-helix 32. Schutz, B. R., Scheurlen, W., Krauss, J., du Manoir, S., Joos, S., Betas, M., and protein with autoregulation and sustained expression in mature cortical neurons. Lichter, P. Mapping of chromosomal gains and losses in primitive neuroectodermal Mech. Dcv.,48:217—228,1994. tumors by comparative genomic hybridization. Genes Chromosomes & Cancer, !6: 41. Akazawa, C., Ishibashi, M.. Shimizu, C., Nakanishi, S., and Kageyama, R. A 196—203,1996. mammalian helix-loop-helix factor structurally related to the product of Drosophila 33. Gerber, A. N., and Tapscott, S. J. Tumor cell complementation groups based on proneural gene atonal is a positive transcriptional regulator expressed in the devel myogenic potential: evidence for inactivation of loci required for basic helix-loop oping nervous system. J. Biol. Chem., 270: 8730—8738, 1995. helix protein activity. Mol. Cell. Biol., 16: 3901—3908,1996. 42. Shimizu, C., Akazawa, C., Nakanishi, S., and Kageyama, R. Math-2, a mammalian 34. Biegel, J. A., Rorke, L. B., Jansa, A. J., Sutton, L. N., and Parmiter, A. H. Isochro helix-loop-helix factor structurally related to the product of Drosophila proneural mosome 17q demonstrated by interphase fluorescence in situ hybridization in prim gene atonal, is specifically expressed in the nervous system. Eur. J. Biochem., 229: itive neuroectodermal tumors of the central nervous system. Genes Chromosomes & 239—248, 199S. Cancer, 14: 85—96,1995. 43. Naya, F. J., Stellrecht, C. M. M., and Tsai, M-J. Tissue-specific regulation of the 35. Ghysen, A., and Dambly-Chaudiere, C. From DNA to form: the achaete-scute insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dcv., 9: complex. Genes Dcv., 2: 495—501,1988. 1009—1019,1995. 36. Ghysen. A., Dambly-Chaudiere, C., Jan, L. Y., and Jan, Y. N. Cell interactions and 44. Yasunami., M., Suzuki, K., Maruyama. H., Kawakami, H., Nagai. Y.. Hagiwara, M., gene interactions in peripheral neurogenesis. Genes Dev., 7: 723—733,1993. and Ohkubo, H. Molecular cloning and characterization of a cDNA encoding a novel 37. Jan, Y. N., and Jan, L. Y. HLH proteins, fly neurogenesis, and vertebrate myogenesis. basic helix-loop-helix protein structurally related to NeuroDIBHFl . Biochem. Bio Cell, 75: 827—830, 1993. phys. Res. Commun., 220: 754—758, 1996.

3531

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research. Expression of Neurogenic Basic Helix-Loop-Helix Genes in Primitive Neuroectodermal Tumors

Robert C. Rostomily, Olivia Bermingham-McDonogh, Mitchel S. Berger, et al.

Cancer Res 1997;57:3526-3531.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/16/3526

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/57/16/3526. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1997 American Association for Cancer Research.