TURNER-DISSERTATION-2014.Pdf

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Elucidating the Etiology of Autism Using Genomic Methods by Tychele Naomi Turner A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy in Human Genetics and Molecular Biology Baltimore, Maryland November, 2013 © 2013 Tychele Naomi Turner All Rights Reserved ABSTRACT In 1943, Dr. Leo Kanner, at the Johns Hopkins Hospital, identified the childhood neuro-psychiatric disorder called autism. However, it was not until the 1970s that there was even one article mentioning both the words gene and autism. In 1989, a twin study provided the first evidence for a genetic element to this disorder. The 1990s brought about the initial comprehension of autism at a molecular level, in particular, through the identification of FMR1 in Fragile X Syndrome and MECP2 in Rett Syndrome. By 2003, when the human genome project was completed, the study of genetics in autism began to rapidly advance not only in the number of publications but also in the diversity of researchers involved around the world. Herein, I present my findings, at the Johns Hopkins University School of Medicine 70 years after Kanner's original discovery, on the genetics of autism etiology through a large epidemiological study and a detailed molecular genetic study of female-enriched multiplex families (FEMFs) with a particular focus on the gene delta catenin (CTNND2). In this dissertation, I show that second borns in families are more often affected then others, female affected containing families show linkage to 19p and Xq (encompassing the FMR1 gene), females cases are enriched for mutations in 18 different “candidate” autism genes, and CTNND2 is an autism gene based on genetics, gene expression, dysregulation of its function, and pathway analyses. Advisor: Aravinda Chakravarti, Ph.D. Reader: Sarah Wheelan, M.D., Ph.D. (Chair of Dissertation Committee) Other Thesis Committee Members: Dr. Edwin H. Cook, Jr., M.D. Dr. Richard Huganir, Ph.D. Dr. Victor Velculescu, M.D., Ph.D. ii PREFACE There are many people to recognize and thank for their contribution to my Ph.D. expedition. The largest and most significant thanks goes to my dissertation mentor Dr. Aravinda Chakravarti. Thanks Aravinda for taking a chance on the girl who wanted to investigate the etiology of autism. I’ll never forget the first time we met, which was during my Hopkins interview. At that time you discussed your perspective on research and as I recall you said you were like a mechanic who examines all the parts of a car and figures out how to work with and improve them. You utilized this example as an analogy for your own labor in genetics and this was the most unique response I remember from my graduate school interviews. Upon arrival at Johns Hopkins, I assimilated more knowledge about your lab and thought it would be beneficial to rotate there during my second rotation. Your encouragement during this rotation was fantastic as I did an entire copy number variation (CNV) project using excel and pencil and paper for the “computation” and a PCR based genotyping assay as a follow up at the bench. Thankfully my inexpertise with computation at the time did not prevent you from saying “yes” when I asked to join your laboratory. In my early days in the lab, you set forth a path for me to work towards your primary goal for me and my time in the lab. The goal was for me to master sequencing from both a bench and computational perspective and it was a very exciting endeavor. Over the past few years it has been intriguing to learn more about how you think of scientific questions; seemingly contrary to “popular” opinion. I’ve definitely learned how to be a skeptic and to require an immense amount of evidence before deeming something robust from a scientific point of view. I am very grateful for the opportunities you have given me to learn from a wide array of scientists both within iii their laboratories and also through attendance at conferences. In addition, I have enjoyed the chances I have had to improve my writing by working on grants, manuscripts, and through reviewing the research of other investigators. Thank you for always encouraging me to present aspects of this dissertation in various places, in particular, in Italy which was the first international trip of my life. Overall, I have had an amazing experience as a part of this awesome lab and I look forward to a notable future in the study of human disease thanks to you as my great mentor. Next, I acknowledge all the members of my doctoral dissertation committee: Dr. Aravinda Chakravarti, Dr. Edwin Cook, Dr. Richard Huganir, Dr. Victor Velculescu, and Dr. Sarah Wheelan. Thank you Dr. Cook for agreeing to be on my dissertation committee and for flying from Chicago to Baltimore for every one of my yearly meetings. From a scientific perspective, I have truly valued all of your advice especially on the utilization of phenotypic features to parse autism at a genetic level. I have also truly appreciated the guidance you have given me over the years regarding my graduate education as a whole. Thank you Dr. Huganir for opening your lab for me to come and acquire more knowledge about neuroscience. The ability to perform experiments using rat hippocampal neurons and ultimately advanced neuron imaging techniques and analysis was a real boon to my dissertation. Dr. Velculescu thank you for helpful discussions on next generation sequencing, in particular in strategies for improving bench (wet lab) and statistical analysis of the resulting data. To the chair of my committee, Dr. Wheelan, thank you for providing useful input on statistical and computational analysis including details on how to license software! Also, I’m very grateful for positive feedback on my yearly reviews and for you allowing me to come to the Next Generation Sequencing Center at the Sidney iv Kimmel Comprehensive Cancer Center to prepare the libraries and perform the exome capture as part of my exome sequencing experiments. Finally, thank you kindly for agreeing to be the reader of this dissertation and for many beneficial comments. I am very appreciative of all the members of the Chakravarti lab who made my experience a fantastic one over the last 5 years. Thank you to Dr. Ashish Kapoor for giving a splendid presentation on hearing loss at one of our departmental journal clubs, during my first year, reaffirming my excitement to rotate in the Chakravarti lab. In addition, I am thankful to you and Betty for being the only 2 people in the lab to take me to lunch on the last day of my rotation. Riding in Betty’s Lexus made me think it might be the standard in the Chakravarti lab. It’s not as I found out (!) but this was definitely a good recruiting strategy. Discussing my dissertation with you has been one of the joys of my Ph.D. I really treasure you making me learn protocols and experiments in detail and for performing your own experiments with such care and excellence. You lead by example in the lab. Thank you Dr. Vasyl Pihur for teaching “this kid” how to program. I started knowing nothing of this foreign universe called “computation” and frankly the command line at first seemed like only something people use in those really impressive spy movies (I’m thinking Q in James Bond here!). I’ll never forget when Hopkins only had the “yellow school buses” running as their daily shuttle and we sat the whole ride with you trying to explain a for loop to me. I don’t know why this was so difficult at first but I’m so happy that you were able to help me figure it out. Thank you for always encouraging me and for being on my first paper and also for you and Ashok Sivakumar for taking me to Ruth’s Chris to celebrate this accomplishment. Thanks also for working at Google. I try to drop that line as much as I can: “I have a friend who works at Google.” v Look I’m even doing it in my dissertation. Thank you to Dr. Betty Doan for finally saying “hi” to me in the lab after about a month of rotation where I would say “hi” and bug you about your project. Your helpful advice during the first few years of my Ph.D. has been very beneficial during my time in the lab. Thank you to Dr. KD Nguyen for being my friend and fellow graduate student in the lab for almost the entire duration of my Ph.D. I delighted in our lunches together at work and occasional excursions to the movies, for frozen yogurt, or dinner. It has been very fun and thanks also for inviting me to attend your Miami Beach wedding. Thank you to Dr. Qian Jiang for involving me in your 454 project and for offering me a job in China someday. Thank you to Maria X. Sosa for working on some aspects of the autism projects in the lab. Thank you to Dallas Auer for daily conversations and for taking care of those new delta-catenin mice. I think they really like you and they couldn’t ask for a better “parent” to take care of them. Thank you also to all the laboratories that let me come and visit their labs to learn new techniques. First, thanks to Dr. Nicholas Katsanis at Duke University for allowing me to visit and pick up some experience in zebrafish experiments as well as in their application to the understanding of human disease.
Recommended publications
  • Oxidative Stress-Induced Chromosome Breaks Within

    Oxidative Stress-Induced Chromosome Breaks Within

    Tan et al. Human Genomics (2018) 12:29 https://doi.org/10.1186/s40246-018-0160-8 PRIMARY RESEARCH Open Access Oxidative stress-induced chromosome breaks within the ABL gene: a model for chromosome rearrangement in nasopharyngeal carcinoma Sang-Nee Tan1, Sai-Peng Sim1* and Alan Soo-Beng Khoo2 Abstract Background: The mechanism underlying chromosome rearrangement in nasopharyngeal carcinoma (NPC) remains elusive. It is known that most of the aetiological factors of NPC trigger oxidative stress. Oxidative stress is a potent apoptotic inducer. During apoptosis, chromatin cleavage and DNA fragmentation occur. However, cells may undergo DNA repair and survive apoptosis. Non-homologous end joining (NHEJ) pathway has been known as the primary DNA repair system in human cells. The NHEJ process may repair DNA ends without any homology, although region of microhomology (a few nucleotides) is usually utilised by this DNA repair system. Cells that evade apoptosis via erroneous DNA repair may carry chromosomal aberration. Apoptotic nuclease was found to be associated with nuclear matrix during apoptosis. Matrix association region/scaffold attachment region (MAR/SAR) is the binding site of the chromosomal DNA loop structure to the nuclear matrix. When apoptotic nuclease is associated with nuclear matrix during apoptosis, it potentially cleaves at MAR/SAR. Cells that survive apoptosis via compromised DNA repair may carry chromosome rearrangement contributing to NPC tumourigenesis. The Abelson murine leukaemia (ABL) gene at 9q34 was targeted in this study as 9q34 is a common region of loss in NPC. This study aimed to identify the chromosome breakages and/or rearrangements in the ABL gene in cells undergoing oxidative stress-induced apoptosis.
  • Keratins and Plakin Family Cytolinker Proteins Control the Length Of

    Keratins and Plakin Family Cytolinker Proteins Control the Length Of

    RESEARCH ARTICLE Keratins and plakin family cytolinker proteins control the length of epithelial microridge protrusions Yasuko Inaba*, Vasudha Chauhan, Aaron Paul van Loon, Lamia Saiyara Choudhury, Alvaro Sagasti* Molecular, Cell and Developmental Biology Department and Molecular Biology Institute, University of California, Los Angeles, Los Angeles, United States Abstract Actin filaments and microtubules create diverse cellular protrusions, but intermediate filaments, the strongest and most stable cytoskeletal elements, are not known to directly participate in the formation of protrusions. Here we show that keratin intermediate filaments directly regulate the morphogenesis of microridges, elongated protrusions arranged in elaborate maze-like patterns on the surface of mucosal epithelial cells. We found that microridges on zebrafish skin cells contained both actin and keratin filaments. Keratin filaments stabilized microridges, and overexpressing keratins lengthened them. Envoplakin and periplakin, plakin family cytolinkers that bind F-actin and keratins, localized to microridges, and were required for their morphogenesis. Strikingly, plakin protein levels directly dictate microridge length. An actin-binding domain of periplakin was required to initiate microridge morphogenesis, whereas periplakin-keratin binding was required to elongate microridges. These findings separate microridge morphogenesis into distinct steps, expand our understanding of intermediate filament functions, and identify microridges as protrusions that integrate actin and intermediate filaments. *For correspondence: [email protected] (YI); Introduction [email protected] (AS) Cytoskeletal filaments are scaffolds for membrane protrusions that create a vast diversity of cell shapes. The three major classes of cytoskeletal elements—microtubules, actin filaments, and inter- Competing interests: The mediate filaments (IFs)—each have distinct mechanical and biochemical properties and associate authors declare that no with different regulatory proteins, suiting them to different functions.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Systems Analysis Implicates WAVE2&Nbsp

    Systems Analysis Implicates WAVE2&Nbsp

    JACC: BASIC TO TRANSLATIONAL SCIENCE VOL.5,NO.4,2020 ª 2020 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/). PRECLINICAL RESEARCH Systems Analysis Implicates WAVE2 Complex in the Pathogenesis of Developmental Left-Sided Obstructive Heart Defects a b b b Jonathan J. Edwards, MD, Andrew D. Rouillard, PHD, Nicolas F. Fernandez, PHD, Zichen Wang, PHD, b c d d Alexander Lachmann, PHD, Sunita S. Shankaran, PHD, Brent W. Bisgrove, PHD, Bradley Demarest, MS, e f g h Nahid Turan, PHD, Deepak Srivastava, MD, Daniel Bernstein, MD, John Deanfield, MD, h i j k Alessandro Giardini, MD, PHD, George Porter, MD, PHD, Richard Kim, MD, Amy E. Roberts, MD, k l m m,n Jane W. Newburger, MD, MPH, Elizabeth Goldmuntz, MD, Martina Brueckner, MD, Richard P. Lifton, MD, PHD, o,p,q r,s t d Christine E. Seidman, MD, Wendy K. Chung, MD, PHD, Martin Tristani-Firouzi, MD, H. Joseph Yost, PHD, b u,v Avi Ma’ayan, PHD, Bruce D. Gelb, MD VISUAL ABSTRACT Edwards, J.J. et al. J Am Coll Cardiol Basic Trans Science. 2020;5(4):376–86. ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2020.01.012 JACC: BASIC TO TRANSLATIONALSCIENCEVOL.5,NO.4,2020 Edwards et al. 377 APRIL 2020:376– 86 WAVE2 Complex in LVOTO HIGHLIGHTS ABBREVIATIONS AND ACRONYMS Combining CHD phenotype–driven gene set enrichment and CRISPR knockdown screening in zebrafish is an effective approach to identifying novel CHD genes.
  • ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health

    ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health

    ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health Risks for Arthropod Repellents or Insecticides and Alternative Control Strategies. (Under the direction of Dr. R. Michael Roe). Protein-coding genes and environmental chemicals. New paradigms for human health risk assessment of environmental chemicals emphasize the use of molecular methods and human-derived cell lines. In this study, we examined the effects of the insect repellent DEET (N, N-diethyl-m-toluamide) and the phenylpyrazole insecticide fipronil (fluocyanobenpyrazole) on transcript levels in primary human hepatocytes. These chemicals were tested individually and as a mixture. RNA-Seq showed that 100 µM DEET significantly increased transcript levels for 108 genes and lowered transcript levels for 64 genes and fipronil at 10 µM increased the levels of 2,246 transcripts and decreased the levels for 1,428 transcripts. Fipronil was 21-times more effective than DEET in eliciting changes, even though the treatment concentration was 10-fold lower for fipronil versus DEET. The mixture of DEET and fipronil produced a more than additive effect (levels increased for 3,017 transcripts and decreased for 2,087 transcripts). The transcripts affected in our treatments influenced various biological pathways and processes important to normal cellular functions. Long non-protein coding RNAs and environmental chemicals. While the synthesis and use of new chemical compounds is at an all-time high, the study of their potential impact on human health is quickly falling behind. We chose to examine the effects of two common environmental chemicals, the insect repellent DEET and the insecticide fipronil, on transcript levels of long non-protein coding RNAs (lncRNAs) in primary human hepatocytes.
  • The Snakeskin-Mesh Complex of Smooth Septate Junction Restricts Yorkie to Regulate Intestinal Homeostasis in Drosophila

    The Snakeskin-Mesh Complex of Smooth Septate Junction Restricts Yorkie to Regulate Intestinal Homeostasis in Drosophila

    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2020-01-15 The Snakeskin-Mesh Complex of Smooth Septate Junction Restricts Yorkie to Regulate Intestinal Homeostasis in Drosophila Hsi-Ju Chen University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Cell Biology Commons, and the Genetics Commons Repository Citation Chen H. (2020). The Snakeskin-Mesh Complex of Smooth Septate Junction Restricts Yorkie to Regulate Intestinal Homeostasis in Drosophila. GSBS Dissertations and Theses. https://doi.org/10.13028/ 0r15-ze63. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/1059 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. The Snakeskin-Mesh Complex of Smooth Septate Junction Restricts Yorkie to Regulate Intestinal Homeostasis in Drosophila A Dissertation Presented by Hsi-Ju Chen Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester In partial fulfilment of the requirement for the requirements for the Degree of Doctor of Philosophy November 19, 2019 TABLE OF CONTENTS ABSTRACT CHAPTER I.....................................................................................................
  • Browsing Genes and Genomes with Ensembl

    Browsing Genes and Genomes with Ensembl

    The Bioinformatics Roadshow Tórshavn, The Faroe Islands 28-29 November 2012 BROWSING GENES AND GENOMES WITH ENSEMBL EXERCISES AND ANSWERS 1 BROWSER 3 BIOMART 8 VARIATION 13 COMPARATIVE GENOMICS 18 2 Note: These exercises are based on Ensembl version 69 (October 2012). After in future a new version has gone live, version 69 will still be available at http://e69.ensembl.org/. If your answer doesn’t correspond with the given answer, please consult the instructor. ______________________________________________________________ BROWSER ______________________________________________________________ Exercise 1 – Exploring a gene (a) Find the human F9 (coagulation factor IX) gene. On which chromosome and which strand of the genome is this gene located? How many transcripts (splice variants) have been annotated for it? (b) What is the longest transcript? How long is the protein it encodes? Has this transcript been annotated automatically (by Ensembl) or manually (by Havana)? How many exons does it have? Are any of the exons completely or partially untranslated? (c) Have a look at the external references for ENST00000218099. What is the function of F9? (d) Is it possible to monitor expression of ENST00000218099 with the ILLUMINA HumanWG_6_V2 microarray? If so, can it also be used to monitor expression of the other two transcripts? (e) In which part (i.e. the N-terminal or C-terminal half) of the protein encoded by ENST00000218099 does its peptidase activity reside? (f) Have any missense variants been discovered for the protein encoded by ENST00000218099? (g) Is there a mouse orthologue predicted for the human F9 gene? (h) If you have yourself a gene of interest, explore what information Ensembl displays about it! ______________________________________________________________ Answer (a) 8 Go to the Ensembl homepage (http://www.ensembl.org/).
  • Downloaded from [266]

    Downloaded from [266]

    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
  • Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare geneseyedoc 3 W.M. Lyle and T.D. Williams 15 Mar 04 This information has been gathered from several sources; however, the principal source is V. A. McKusick’s Mendelian Inheritance in Man on CD-ROM. Baltimore, Johns Hopkins University Press, 1998. Other sources include McKusick’s, Mendelian Inheritance in Man. Catalogs of Human Genes and Genetic Disorders. Baltimore. Johns Hopkins University Press 1998 (12th edition). http://www.ncbi.nlm.nih.gov/Omim See also S.P.Daiger, L.S. Sullivan, and B.J.F. Rossiter Ret Net http://www.sph.uth.tmc.edu/Retnet disease.htm/. Also E.I. Traboulsi’s, Genetic Diseases of the Eye, New York, Oxford University Press, 1998. And Genetics in Primary Eyecare and Clinical Medicine by M.R. Seashore and R.S.Wappner, Appleton and Lange 1996. M. Ridley’s book Genome published in 2000 by Perennial provides additional information. Ridley estimates that we have 60,000 to 80,000 genes. See also R.M. Henig’s book The Monk in the Garden: The Lost and Found Genius of Gregor Mendel, published by Houghton Mifflin in 2001 which tells about the Father of Genetics. The 3rd edition of F. H. Roy’s book Ocular Syndromes and Systemic Diseases published by Lippincott Williams & Wilkins in 2002 facilitates differential diagnosis. Additional information is provided in D. Pavan-Langston’s Manual of Ocular Diagnosis and Therapy (5th edition) published by Lippincott Williams & Wilkins in 2002. M.A. Foote wrote Basic Human Genetics for Medical Writers in the AMWA Journal 2002;17:7-17. A compilation such as this might suggest that one gene = one disease.
  • C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data

    C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234563 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCFC2 Synonyms: C2orf3; DNABF; GCF; TCF9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone – RG234563 ORF Nucleotide >RG234563 representing NM_001201334 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGAGAGAGCGAAGATGACCCTGAGAGTGAGCCTGATGACCATGAAAAGAGAATACCATTTACTC TAAGACCTCAAACACTTAGACAAAGGATGGCTGAGGAATCAATAAGCAGAAATGAAGAAACAAGTGAAGA AAGTCAGGAAGATGAAAAGCAAGATACTTGGGAACAACAGCAAATGAGGAAAGCAGTTAAAATCATAGAG GAAAGAGACATAGATCTTTCCTGTGGCAATGGATCTTCAAAAGTGAAGAAATTTGATACTTCCATTTCAT TTCCGCCAGTAAATTTAGAAATTATAAAGAAGCAATTAAATACTAGATTAACATTACTACAGGAAACTCA CCGCTCACACCTGAGGGAGTATGAAAAATACGTACAAGATGTCAAAAGCTCAAAGAGTACCATCCAGAAC CTAGAGAGTTCATCAAATCAAGCTCTAAATTGTAAATTCTATAAAAGCATGAAAATTTATGTGGAAAATT TAATTGACTGCCTTAATGAAAAGATTATCAACATCCAAGAAATAGAATCATCCATGCATGCACTCCTTTT
  • Table SI. Genes Upregulated ≥ 2-Fold by MIH 2.4Bl Treatment Affymetrix ID

    Table SI. Genes Upregulated ≥ 2-Fold by MIH 2.4Bl Treatment Affymetrix ID

    Table SI. Genes upregulated 2-fold by MIH 2.4Bl treatment Fold UniGene ID Description Affymetrix ID Entrez Gene Change 1558048_x_at 28.84 Hs.551290 231597_x_at 17.02 Hs.720692 238825_at 10.19 93953 Hs.135167 acidic repeat containing (ACRC) 203821_at 9.82 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 1559509_at 9.41 Hs.656636 202957_at 9.06 3059 Hs.14601 hematopoietic cell-specific Lyn substrate 1 (HCLS1) 202388_at 8.11 5997 Hs.78944 regulator of G-protein signaling 2 (RGS2) 213649_at 7.9 6432 Hs.309090 serine and arginine rich splicing factor 7 (SRSF7) 228262_at 7.83 256714 Hs.127951 MAP7 domain containing 2 (MAP7D2) 38037_at 7.75 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 224549_x_at 7.6 202672_s_at 7.53 467 Hs.460 activating transcription factor 3 (ATF3) 243581_at 6.94 Hs.659284 239203_at 6.9 286006 Hs.396189 leucine rich single-pass membrane protein 1 (LSMEM1) 210800_at 6.7 1678 translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A) 238956_at 6.48 1943 Hs.741510 ephrin A2 (EFNA2) 242918_at 6.22 4678 Hs.319334 nuclear autoantigenic sperm protein (NASP) 224254_x_at 6.06 243509_at 6 236832_at 5.89 221442 Hs.374076 adenylate cyclase 10, soluble pseudogene 1 (ADCY10P1) 234562_x_at 5.89 Hs.675414 214093_s_at 5.88 8880 Hs.567380; far upstream element binding protein 1 (FUBP1) Hs.707742 223774_at 5.59 677825 Hs.632377 small nucleolar RNA, H/ACA box 44 (SNORA44) 234723_x_at 5.48 Hs.677287 226419_s_at 5.41 6426 Hs.710026; serine and arginine rich splicing factor 1 (SRSF1) Hs.744140 228967_at 5.37
  • Rationale for the Development of Alternative Forms of Androgen Deprivation Therapy

    Rationale for the Development of Alternative Forms of Androgen Deprivation Therapy

    248 S Kumari, D Senapati et al. New approaches to inhibit 24:8 R275–R295 Review AR action Rationale for the development of alternative forms of androgen deprivation therapy Sangeeta Kumari1,*, Dhirodatta Senapati1,* and Hannelore V Heemers1,2,3 1Department of Cancer Biology, Cleveland Clinic, Cleveland, Ohio, USA Correspondence 2Department of Urology, Cleveland Clinic, Cleveland, Ohio, USA should be addressed 3Department of Hematology/Medical Oncology, Cleveland Clinic, Cleveland, Ohio, USA to H V Heemers *(S Kumari and D Senapati contributed equally to this work) Email [email protected] Abstract With few exceptions, the almost 30,000 prostate cancer deaths annually in the United Key Words States are due to failure of androgen deprivation therapy. Androgen deprivation f androgen receptor therapy prevents ligand-activation of the androgen receptor. Despite initial remission f prostate cancer after androgen deprivation therapy, prostate cancer almost invariably progresses while f nuclear receptor continuing to rely on androgen receptor action. Androgen receptor’s transcriptional f coregulator output, which ultimately controls prostate cancer behavior, is an alternative therapeutic f transcription target, but its molecular regulation is poorly understood. Recent insights in the molecular f castration mechanisms by which the androgen receptor controls transcription of its target genes f hormonal therapy are uncovering gene specificity as well as context-dependency. Heterogeneity in the Endocrine-Related Cancer Endocrine-Related androgen receptor’s transcriptional output is reflected both in its recruitment to diverse cognate DNA binding motifs and in its preferential interaction with associated pioneering factors, other secondary transcription factors and coregulators at those sites. This variability suggests that multiple, distinct modes of androgen receptor action that regulate diverse aspects of prostate cancer biology and contribute differentially to prostate cancer’s clinical progression are active simultaneously in prostate cancer cells.