RCC2 Promotes Esophageal Cancer Growth by Regulating Activity And

Published OnlineFirst August 14, 2020; DOI: 10.1158/1541-7786.MCR-19-1152

MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS

RCC2 Promotes Esophageal Cancer Growth by Regulating Activity and Expression of the Sox2 Transcription Factor A C Ali Calderon-Aparicio1, Hiroyuki Yamamoto1, Humberto De Vitto1, Tianshun Zhang1, Qiushi Wang1, Ann M. Bode1, and Zigang Dong1,2

ABSTRACT ◥ Regulator of chromosome condensation 2 (RCC2) is a protein RCC2 increased the transcriptional activity and promoter bind- located in the centrosome, which ensures that cell division ing of Sox2. In vivo studies indicated that RCC2 and Sox2 were proceeds properly. Previous reports show that RCC2 is over- overexpressed in esophageal tumors compared with normal expressed in some cancers and could play a key role in tumor tissue, and this upregulation occurs in the esophageal basal cell development, but the mechanisms concerning how this occurs layer for both proteins. In conditional knockout mice, RCC2 are not understood. Furthermore, no evidence exists regarding deletion decreased the tumor nodule formation and progression its role in esophageal cancer. We studied the relevance of RCC2 in the esophagus compared with wild-type mice. Proliferating cell in esophageal cancer growth and its regulation on Sox2, an nuclear antigen expression, a cell proliferation marker, was also important transcription factor promoting esophageal cancer. downregulated in RCC2 knockout mice. Overall, our data show RCC2 was overexpressed in esophageal tumors compared with for the ﬁrsttimethatRCC2isanimportantproteinforthe normal tissue, and this overexpression was associated with stabilization and transcriptional activation of Sox2 and further tumorigenicity by increasing cell proliferation, anchorage- promotion of malignancy in esophageal cancer. independent growth, and migration. These oncogenic effects were accompanied by overexpression of Sox2. RCC2 upregulated Implications: This study shows that RCC2 controls Sox2 expres- and stabilized Sox2 expression and its target genes by inhibiting sion and transcriptional activity to mediate esophageal cancer ubiquitination-mediated proteasome degradation. Likewise, formation.

Introduction addition, RCC2 is critical to localize the components of the chromosome passenger complex (CPC) to centromeres (5, 6). The CPC Esophageal cancer is the eighth most common cancer and one of is composed of Aurora B kinase, plus an activation module con- deadliest worldwide (1). Despite significant advances in treatment, sisting of inner centromere protein INCENP (Inner centromere the number of cases has increased over the last few years, with an protein), survivin and borealin (7). The complex regulates key incidence of 572,000 cases and 508,000 deaths worldwide in aspects of mitosis, including chromosome structure, cytokinesis, 2018 (2). Therefore, innovative therapeutic approaches targeting and spindle assembly. Aurora B kinase activation requires RCC2, new oncogenic markers for treatment of esophageal cancer are and its deletion blocks cells in prometaphase (4–6). These data urgently needed. indicate a key role of RCC2 in the process of cell division and Regulator of chromosome condensation 2 (RCC2), also known as maintenance of genetic stability of normal cells. In addition to its TD-60, is a protein required for mitosis to proceed uniformly. Cells function in spindle assembly and mitosis, RCC2 also has a role in with RCC2 suppression cease to proliferate and arrest either in the cell migration (8). G or G phase of the cell cycle (3). RCC2 exhibits several activities 1 2 RCC2 is overexpressed in a variety of different tumor tissues such as linked with chromatid segregation and cell division. RCC2 has lung (9), ovarian (10), gastric (11), and glioblastoma (12) and is also guanine exchange factor activity for the small GTPase RalA and its associated with increased malignancy. In lung cancer, RCC2 over- depletion causes spindle abnormalities in prometaphase (4). In expression correlates with poor prognosis and shorter overall survival as well as increased cell proliferation, migration, and invasion “in vitro” by activating JNK (9). Besides, RCC2 also may function as an oncogene 1The Hormel Institute, University of Minnesota, Austin, Minnesota. 2Department by regulating the RalA signaling pathway (13). Furthermore, RCC2 of Pathophysiology, School of Basic Medical Sciences, College of Medicine, influences resistance in cancer. Forced RCC2 expression significantly Zhengzhou University, Henan, China. decreases the sensitivity of tumor cells to apoptotic drugs by blocking Note: Supplementary data for this article are available at Molecular Cancer Rac1 signaling (10); and cisplatin-resistant ovarian cancer cells show Research Online (http://mcr.aacrjournals.org/). an increased expression of RCC2 compared with sensitive cells (13). A. Calderon-Aparicio and H. Yamamoto contributed equally to this article. Moreover, RCC2 promotes radioresistance and proliferation in glioblastoma through the transcriptional activation of DNMT1 (DNA Corresponding Author: Zigang Dong, Zhengzhou University, Zhenzhou, Henan, 450001, China. Phone: 371-6665-8803; Fax: 507-437-9606; E-mail: methyltransferase I) in a STAT3-dependent manner (12). Together, [email protected] these results strongly suggest that RCC2 may act as an oncogene in cancer. However, the mechanisms explaining how RCC2 functions in Mol Cancer Res 2020;18:1660–74 esophageal cancer and the role and association of this protein with doi: 10.1158/1541-7786.MCR-19-1152 activation of transcription factors important for the development of 2020 American Association for Cancer Research. esophageal tumors remain unclear.

AACRJournals.org | 1660

RCC2 Promotes Esophageal Tumor Growth through Sox2

Sox2 is a transcription factor containing a high-mobility 632183). Vector to overexpress Sox2 was obtained from Addgene group domain, which permits highly specificDNAbinding.Itis (Plasmid, #15919). The 6xO/S-luc reporter plasmid was a gift from Lisa aberrantly expressed in tumors (14) and has been associated with a Dailey (Addgene plasmid #69445). All vectors for protein overexpres- cancer stem cell state and with tumorigenesis by inhibiting apo- sion as well as short hairpin RNA (shRNA) were amplified in com- ptosis (15, 16). In addition, Sox2 has been shown to promote petent E. coli bacteria transformed by heat shock and selected with esophageal cancer development (17, 18). Amplification of SOX2 is ampicillin in agar plates. Colonies were picked and expanded in found in esophageal cancer, where it promotes proliferation in vitro ampicillin with LB medium. Plasmids were purified using the Nucle- and tumorigenesis in vivo by activating the AKT/mTOR complex 1 Bond Xtra Midi Kit (MACHEREY-NAGEL #740410) and quantified (mTORC1) signaling pathway (17, 18). Furthermore, esophageal by absorbance. squamous cell carcinomas show a positive correlation between expression levels of Sox2 and phosphorylated AKT (17). These sh knockdown experiments findings highlight an important role of Sox2 in esophageal tumor The lentiviral vector pLKO.1 puro containing sh sequences were growth. obtained from Dharmacon. shRNA and packaging vectors (pMD2.0G In this study, we aimed to investigate the role of RCC2 in the #12259 and psPAX2 #12260, Addgene) were transfected into development of esophageal cancer and to establish whether Sox2 293T cells by using iMFectin (GenDEPOT #I7200). To overexpress cooperates with RCC2 to promote oncogenesis. Our data showed that RCC2-HA with lentivirus, the pLVX-IRES-puro/RCC2-HA vector RCC2 was highly expressed in mouse and human tissues as well as was used with packaging vectors. At 18 hours after transfection, esophageal cancer cell lines and promoted proliferation, anchorage- the medium was changed. After 24 hours, the viral supernatant independent growth, transformation, and migration. RCC2 stabilized fractions were collected, filtered through a 0.45 mm syringe filter, and Sox2 expression, increased binding to promoter regions, and enhanced stored at 80C until use. Cells were infected for 8 hours with viral Sox2 transcriptional activity. Interestingly, RCC2 and Sox2 expression particles containing 10 mg/mL of polybrene. Infection was repeated colocalized in the basal cell layer of the esophagus in mice and both twice. Cells were then selected with puromycin (0.5 mg/mL) and proteins were overexpressed in esophageal cancer tissue. In knockout used for the specific experiment. shRCC2 sequences are: shRCC2#4: animals, RCC2 deletion decreased Sox2 expression and esophageal ATGAACTTCCCATCTGAGTTG (Clone ID: TRCN0000153686); tumor formation and progression. Our findings suggest that RCC2 and shRCC2#5: AACACAGAACAAGAGATGCGC (Clone ID: promotes Sox2 stability and transcriptional activation leading to TRCN0000154474). Vector for control sequence (scramble) was further promotion of tumor growth in the esophagus. Thus, the obtained from Sigma, catalog no. SHC016V. RCC2–Sox2 axis could be a new therapeutic target to improve prognosis in this cancer. Cell proliferation assay Cells (4,000) were seeded in 96-well plates and cultured for 18 to 24 hours. Resazurin (1.1 mg/10 mL of PBS; Sigma-Aldrich #R7017) Materials and Methods was added to reach 10% of culture volume in the well without changing Cell culture medium. Resazurin, a nontoxic, cell-permeable compound, can be Human embryonic kidney cells 293T from ATCC (CRL-3216, reduced by intracellular redox activity present in living cells and RRID: CVCL_0063) were cultured in DMEM supplemented with converted to the highly fluorescent compound, resorufin. Thus, the 10% FBS and penicillin-streptomycin 1X (GenDEPOT #CA005- fluorescence emission can be measured and correlated with active 010). Esophageal cancer cells obtained from Leibniz Institute DSMZ; metabolically and proliferating cells. Resazurin was incubated in the KYSE-30 (DSMZ #ACC 351, RRID: CVCL_1351), KYSE-410 (DSMZ dark for 3 hours. The fluorescence excitation/emission wavelengths #ACC 381, RRID:CVCL_1352), KYSE-450 (DSMZ #ACC 387, RRID: were measured at 545/595 nm with the Synergy Neo2 Multi-Mode CVCL_1353), KYSE-510 (DSMZ #ACC 374, RRID: CVCL_1354) Microplate Reader (BioTek). Results are shown as relative fluorescence were grown in RPMI-F12 medium (1:1 ratio) supplemented with intensity average SD. and experimental groups were compared with 2% FBS and antibiotics. RPMI 2% FBS was used for culturing SK-GT-4 control groups. cells (DSMZ #ACC-712, RRID: CVCL_2195). The HET-1A (ATCC #CRL-2692, RRID: CVCL_3702) cell line was cultured in Bronchial Soft agar assay Epithelial Cell Growth Medium (LONZA, catalog no. CC-3171). Cells Cells were seeded and treated as described previously (19). Briefly, fi were maintained at 37 C, 5% CO2 in a humidi ed atmosphere and cells were suspended in Basal Minimal Eagle medium and added to harvested with trypsin (0.25%; GenDEPOT #CA019-010). Cell 0.6% agar layer. Cells were treated with EGF (10 ng/mL) where authentication was commercially performed (by Genetica cell line indicated. Colony formation was observed and analyzed using a testing) through short tandem repeat analysis. Cells with less than LAICA DM IRB microscope (Nikon Corporation) and the ImagePro 10 passages were used for every experiment and kept in culture for Plus software (v.6.1) program (Media Cybernetics Inc.; RRID: no more than 1 month after thawing. After this time, cells were SCR_016879). discarded and a new vial thawed for further experiments. Myco- plasma negative testing were obtained from cell's provider and Migration assay performed by PCR assays. No further Mycoplasma testing was done. Esophageal cancer cells (4 105) were seeded in serum-free medium in the top chamber of Transwell polycarbonate membrane DNA plasmids cell culture inserts (Corning, CLS3422-48EA) and kept in culture for The vector for overexpression of RCC2 was obtained from 20 hours. The lower chamber was filled with medium and 10% FBS. Dharmacon (Lafayette; Clone ID: 6502476). cDNA was subcloned Transwells were washed twice by immersion in PBS, fixed with into the BamHI/KpnI sites of the pcDNA3 vector adding an HA-tag. methanol, and stained with 0.2% crystal violet. After washing twice For lentivirus overexpression, RCC2-HA was inserted into the XhoI/ with PBS, the nonmigrated cells were scraped off with a cotton swab. XbaI sites of the pLVX-IRES-puro vector (Clontech; catalog no. Photos were taken under a light microscopy at 20 magnification

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1661

Calderon-Aparicio et al.

and then cells were counted. Data are expressed as mean SD in (Novus Biological, #110-40619; 1:300), a-Sox2 (CS-14962), a-keratin each condition. 5 (abcam, catalog no. 64081), and a-PCNA (CS-13110; 1:2,000) diluted in 10% goat serum–PBS were incubated with slides overnight Western blotting at 4C in humidified chamber. For detection, biotinylated secondary Cells were disrupted with lysis buffer (10 mmol/L Tris-HCL pH 7.4, antibodies were added (Vector Laboratories, 1:150) for 1 hour at 5 mmol/L EDTA, 150 mmol/L NaCl, 1% Triton X-100, 0.1% SDS, and room temperature. The signal was developed using the Vectastain protease inhibitor cocktail; GenDEPOT #P3100) on ice for 30 minutes. Elite ABC Kit (Vector Laboratories Inc, catalog no. PK-610) following Lysates were cleared by centrifugation at 16,000 g for 20 minutes at the manufacturer's recommendations. Slides were counterstained 4C. Twenty micrograms of protein were separated by electrophoresis with hematoxylin and photographed using a Zeiss Axio-observer in 10% SDS-polyacrylamide gels and then transferred onto polyviny- with Apotome microscope at 20 magnification. Quantitation of lidene difluoride membranes (EMD Millipore). For blocking, mem- images was performed using the Image-Pro Plus software program branes were incubated with TBS containing 0.1% Tween-20 and 5% (version 6.1). nonfat skim milk. Antibodies to detect a-RCC2 (Novus Biological, #32602), b-actin (Santa Cruz Biotechnology, catalog no. 47778), Real-time PCR a-FLAG (Sigma-Aldrich, catalog no. F1804), a-Sox2 (Cell Signaling RNA total was isolated using PureLink RNA Mini Kit (Thermo Technology, catalog no. 23064), a-GAPDH (Santa Cruz Biotechnol- Fisher scientific, catalog no. 12183025) according to the manufac- ogy, catalog no. 47724), a-cyclin D1 (Cell Signaling Technology, turer's protocol. cDNA was synthesized by using amfiRivert cDNA catalog no. 55506), a-Pea3 (abcam, catalog no. 189826) or a-HA Synthesis Platinum Master Mix from GenDEPOT (catalog no. R5600) (Biolegend, catalog no. MMS-101R) were added and incubated over- according to the manufacturer's protocol. For qPCR, Power SYBR night at 4C. The bound antibodies were visualized with a horseradish Green PCR Master Mix (Life Technologies, catalog no.4367659) was peroxidase–conjugated secondary antibody (dilution 1:4,000) by using used. PCR was performed on 7500 Real-Time PCR System (Applied chemiluminescence reagents. Membranes were photographed in an Biosystems). The primer sequences were for SOX2 forward: GCA- Amersham Imager 600 (GE Healthcare Life Sciences). CATGAACGGCTGGAGCAACG; SOX2 reverse: TGCTGCGAG- TAGGACATGCTGTAGG; CCND1 forward: GAGCAGCAGAG- Luciferase activity assay TCCGCACGCTC; CCND1 Reverse: TGTTCCATGGCTGGGGCT- Cells (2.5 105) were seeded into 12-well plates and cotransfected CTTC; ETV4 forward: TGGAAATCAGGAACAAACTGC; ETV4 with the plasmids to overexpress RCC2-HA and Sox2 detailed pre- Reverse: GCCCCTCGACTCTGAAGAT; GAPDH forward: AGCCA- viously in the DNA plasmid section. The signal was generated by CATCGCTCAGACAC; GAPDH REVERSE: GCCCAATACGAC- cotransfecting the 6xO/S-luc reporter plasmid (40 ng; Addgene plas- CAAATCC. Data were normalized to GAPDH and compared with mid, catalog no. 69445) and an internal control vector (pCMV-b-gal, respective controls. 20 ng). Transfections were performed as before using iMFectin (GenDEPOT #I7200). At 24 hours after transfection, cells were dis- Ubiquitination assay rupted with lysis buffer, and then the lysates were used for a reporter HEK 293T cells were transfected with the indicated plasmids. A assay utilizing the Luciferase Assay System (Promega Corporation). total of 8 hours before harvest, cells were treated with 10 mmol/L of Luciferase activities were measured by a luminometer (Monolight MG-132. Cells were lysed in buffer lysis (2% SDS, 150 mmol/L 2010, Analytical Luminescence Laboratory) with the substrate NaCl, 10 mmol/L Tris-HCl, pH 8.0, 2 mmol/L sodium orthovana- provided (Promega). Firefly luciferase activity was normalized to date, 50 mmol/L sodium fluoride, 20 mmol/L N-ethylmaleimide b-galactosidase activity. and protease inhibitors), boiled 10 minutes and sonicated. Volume was completed to 1 mL (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L Chromatin immunoprecipitation assay NaCl, 2 mmol/L EDTA, 1% Triton). A total of 500 mgofproteins Stable KYSE-30 cells overexpressing RCC2-HA or control were pulled down over night with 50 mL of A/G protein beads and sequences were seeded in 10 cm2 plates. Chromatin immunopre- 10 mLofa-Sox2 (CS-14962). Pellets were washed twice, and cipitation (ChIP) was performed using the One-Day Chromatin complexes were separated by SDS-PAGE. Antibodies a-FLAG Immunoprecipitation Kit (Magna ChIPG,Millipore,catalogno. (Sigma, catalog no. F3165) and a-Sox2 (CS-14962) were reacted 17-611) according to the manufacturer's protocol. Chromatin sam- against membranes and signal developed for Western blot analysis ples were immunoprecipitated with an HA antibody overnight as before. at 4C. The DNA fractions were analyzed by qPCR. Primer sequences were: CCND1 forward: GAGCAGCAGAGTCCGCA- Conditional knockout mice fl CGCTC, CCND1 reverse: TGTTCCATGGCTGGGGCTCTT; Mice RCC2 ox/ (C57BL/6 background; MRC Harwell Institute, ETV4 forward: ACACAGCTTCGTGGACACAT, ETV4 reverse: Oxfordshire, United Kingdom) were used to generate RCC2-floxed fl AGAGCTCAGCCCCCAATCTA. mice in combination with miceKRT5-CreERT2. Briefly, mice ox/ were fl fl fl crossed to obtain the phenotype RCC2 ox/ ox. RCC2 ox/ mice IHC Assay were bred with mice KRT5-CreERT2 (The Jackson Laboratory) to obtain Tissues were fixed in 10% buffered formalin and embedded in the flox/; KRT5-CreERT2/ genotype. Genotyping for each paraffin. Slide sections (5 mm) were baked at 60C for 1 hour, gene was performed with primers (Supplementary Table S1). fl fl fl deparaffinized in xylene, and rehydrated in serial amounts of alcohol. Mice ox/ ; KRT5-CreERT2/ were crossed with mice ox/ ox to obtain fl fl Antigenic retrieval and unmasking were performed by submerging the conditional ox/ ox; KRT5-CreERT2/ genotype. 4-Hydroxytamoxifen slides in sodium citrate buffer (10 mmol/L, pH 6.0) and then boiling for (4-OHT; Sigma-Aldrich, catalog no. H6278; 1 mg or 50–60 mg/kg 10 minutes. Slides were treated with 5% H2O2 in methanol and then body weight) dissolved in corn oil was injected intraperitoneally for 5 blocked with 50% goat serum albumin in 1 PBS in a humidified consecutive days to deplete the RCC2 gene. To induce esophageal chamber for 1 hour at room temperature. Antibodies to detect a-RCC2 tumors, 100 mg/mL of 4-nitroquinoline N-oxide (4-NQO; TCI

1662 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

America#N0250) or vehicle (DMSO; nontumor control groups) was RCC2-HA to better support the role of this protein in tumor pro- dissolved in drinking water and given to animals ad libitum for gression. For this experiment, KYSE-410 and Het-1A cells were seeded 16 weeks. Then 4NQO was removed and animals were monitored in culture plates and cell density was measured by using an IncuCyte S3 for an additional 9 weeks. Mice were euthanized and samples collected. live-cell analysis system. We carried out those experiments on these Tumors were counted and presented as mean values SD. Mice different cell lines because they show different expression patterns for between 6 and 10 weeks old were used to begin the experiments. All RCC2; the normal cell line Het-1A (low endogenous expression of animal studies were performed following guidelines approved by the RCC2) and the cancer cell lines KYSE-410 (high RCC2 expression). University of Minnesota Institutional Animal Care and Use Commit- Besides, we conducted experiments using Alamar blue on the RCC2 tee (Minneapolis, MN; protocol number: 1501-32258A). high expression cancer cell line KYSE-450 to confirm our hypothesis. Our data consistently showed that RCC2-HA overexpression Statistical analysis increased proliferation in all cell lines, irrespective of their malignity All statistical analyses were conducted using GraphPad prism status, observed by cell density and fluorescence assays, consistent with 5.0 software (GraphPad Software). Data are shown as mean our previous data (Supplementary Fig. S1A–S1C). We further eval- values SD. Statistically significant differences between three uated the ability of esophageal cancer cells to grow under anchorage- or more groups were determined by a one-way ANOVA. Differ- independent conditions by using a soft agar assay, a method to ences between two groups were calculated using a Student t test and measure transformation of normal cells and oncogenic potential of P-values ≤ 0.05 were considered to be statistically significant tumor cells. The results demonstrate that RCC2 knockdown decreased between groups. Experiments were repeated a minimum three times the anchorage-independent growth of cancer cells (Fig. 2E–G). We or as otherwise indicated. For correlation analysis between Sox2 and also examined the ability of RCC2 to promote transformation of the RCC2, the database Xena from University of California (Santa Cruz, nonmalignant esophageal cell line Het-1A. Data show that EGF CA) was used. increased the anchorage-independent growth of Het-1A cells. How- ever, knockdown of RCC2 significantly decreased this effect. In addition, the overexpression of RCC2 increased transformation of Results Het-1A cells, both in the presence and absence of EGF, compared with RCC2 is upregulated in esophageal cancer controls (Fig. 2H and I). EGF treatment alone did not associated with We analyzed the expression of RCC2 in esophageal tumors at the an upregulation in the RCC2 expression in Het-1A cells (Supplemen- mRNA level by using the The Cancer Genome Atlas (TCGA) database. tary Fig. S1E). In addition, RCC2 downregulation also dramatically The data show that RCC2 is highly expressed in esophageal human decreased cell migration, a hallmark of malignancy in KYSE-30 cancer tissues compared with normal tissue (Fig. 1A). When RCC2 (Fig. 2J) and KYSE-450 (Fig. 2K) esophageal cancer cell lines. These expression in nontumor tissue is compared with adenocarcinoma and data overall indicate that RCC2 has a very important role in promoting squamous cell carcinoma (the two main subtypes of esophagus cancer) malignancy in esophageal cancer cells. individually, this upregulation is equally statistically significant for both cases (Fig. 1B and C). Significant differences were also found RCC2 regulates Sox2 protein stability between subtypes (Fig. 1D). In addition, we examined the expres- Sox2 has been reported to be an important transcription factor for sion of RCC2 at the protein level in human tissue array samples the growth and development of esophageal cancer (14, 17, 18). To from the esophagus (US Biomax #ES2081) and found that RCC2 determine whether the oncogenic effects of RCC2 in esophageal cancer expression is significantly upregulated in cancer compared with are associated with Sox2, we examined the effects of RCC2 on Sox2 both normal and cancer adjacent normal tissue (Fig. 1E and F). expression. First, we determined the basal Sox2 expression level in These data confirm that RCC2 is overexpressed at both the mRNA esophageal cancer cell lines and compared it with the esophageal and protein level in human esophageal cancer. Similarly, we deter- normal cell line Het-1A. We observed that Sox2 expression was mined the expression of RCC2 in esophagus from tumor-harboring significatively increased in esophageal cancer cells compared with and control mice. RCC2 expression was dramatically increased in normal Het-1A cells (Fig. 3A). Furthermore, the knocking down of esophageal tumors induced with 4-NQO compared with controls RCC2 expression with two different sequences of shRNA consistently (Fig. 1G). Similar results were obtained from cancer cell lines, decreased Sox2 expression in KYSE-30 and KYSE-450 cancer cells in where RCC2 was upregulated in esophageal cancer cells KYSE-30, both cases (Fig. 3B). To confirm this result, we used an opposite KYSE-410, KYSE-450, KYSE-510, and SGKT-4 compared with Het- approach by overexpressing RCC2-HA in esophageal cancer cell lines 1A, a nonmalignant esophageal cell line (Fig. 1H). These results and then examining Sox2 expression. As expected, forced RCC2 clearly show that RCC2 is overexpressed in esophageal tumors expression increased Sox2 protein levels in KYSE-30 and KYSE-450 compared with normal tissue, suggesting a potential role of RCC2 cancer cells (Fig. 3C). These data suggest that RCC2 influences Sox2 in esophageal cancer. expression. The upregulation of Sox2 was dose dependent, because the transfection of increasing amounts of RCC2-HA together with RCC2 is associated with malignancy in esophageal cancer cells Sox2 gradually increased Sox2 expression in 293T cells, while RCC2 We used shRNA to knock down RCC2 in cancer cell lines KYSE-30, overexpression alone had no effect (Fig. 3D). According to our data, KYSE-450, and KYSE-510. RCC2 expression was clearly downregu- the regulation of Sox2 is also observed at the RNA level, because the lated in these esophageal cancer cells lines expressing shRNA lentivirus knockdown of RCC2 decreases the transcription of Sox2 as observed compared with controls (scramble) (Fig. 2A). These cell lines were by qPCR experiments (Supplementary Fig. S1D). Why RCC2 has these then used to determine the effect of RCC2 knockdown on prolifer- two apparently redundant functions is unknown. However, the finding ation. Our data consistently showed that the downregulation of RCC2 that RCC2 has the same effects on Sox2 at both the RNA and protein decreased proliferation of all cancer cell lines tested compared with levels confirms its important role as a key player in the induction and controls (scramble sequence; Fig. 2B–D). We also evaluated the further oncogenic functions of Sox2. Thus, our data consequently proliferation of cancer and normal cell lines stably expressing showed an oncogenic role for RCC2 which was unknown and

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1663

Calderon-Aparicio et al.

Figure 1. RCC2 is overexpressed in esophageal cancer compared with normal tissue. Data from the TCGA from human samples at the mRNA level comparing nontumor tissue (normal) with general esophageal cancer (A), esophageal adenocarcinoma (B), and esophageal squamous cell carcinoma (C). D, Comparison of mRNA level between esophageal adenocarcinoma and esophageal squamous cell carcinoma. E, RCC2 IHC staining from human tissue array tumor samples and controls (US Biomax, Inc #ES2081). F, Quantiﬁcation of IHC staining of RCC2 from human tissue array tumor samples harboring tumors and controls. G, IHC staining of RCC2 from tumor- harboring and control mice (n ¼ 8). H, Expression of RCC2 in esophageal cancer and Het-1A cell lines evaluated by Western blot analysis. ns, nonsigniﬁcant. NAT, normal tissue adjacent to the tumor. Data are presented as mean values SD. , P ≤ 0.05; , P ≤ 0.01 or , P ≤ 0.001.

1664 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

Figure 2. RCC2 promotes malignancy in normal and esophageal cancer cell lines. A, Western blot analysis of lysates from esophageal cancer cell lines infected with sh-RCC2 or control (scramble) virus. Proliferation of KYSE-30 (B), KYSE-450 (C), and KYSE-510 (D) cell lines infected with RCC2 knockdown or no targeting shRNA detected by Alamar Blue (n ¼ 6). E–G, Soft agar assay of esophageal cancer cells lines infected with RCC2 knockdown or control virus. H, Soft agar assay of Het-1A cells with knockdown or (I) overexpression of RCC2 in presence or absence of EGF (left, Western blot analysis of RCC2; right, soft agar assay). Transwell migration assay of KYSE-30 (J) and KYSE-450 (K) cancer cells expressing RCC2 knockdown or control virus. Photos show representative images from the Transwell chamber. Data are presented as mean values SD. , P ≤ 0.05; , P ≤ 0.01 or , P ≤ 0.001.

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1665

Calderon-Aparicio et al.

1666 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

independent of its known functions in cell cycle. In addition, we approach, where we knocked down RCC2 and examined cyclin D1 determined whether RCC2 influences Sox2 expression through the and Pea3 expression. As expected, the downregulation of RCC2 inhibition of proteasome degradation pathways resulting in an decreased the expression of these Sox2 targets in both cell lines increased stabilization of its expression. We treated KYSE-30 cells (Fig. 4D). Furthermore, we investigated this regulation at the RNA with MG-132, a potent inhibitor of proteasome degradation. The level of ETV4 and CCND1.WeconductqPCRreal-timeexperi- treatment with MG-132 restored the Sox2 expression when RCC2 was ments to evaluate the genes ETV4 and CCND1 in RCC2 down- downregulated, even at shortest times (6 hours) of treatment with MG- regulated cells by shRNA. Our data confirm that RCC2 knockdown 132 (Fig. 3E). These data indicate that Sox2 is overexpressed in decreases RNA levels for ETV4 and CCND1 in KYSE-30 (Fig. 4E) esophageal cancer cell lines and its upregulation could be due to a and KYSE-450 (Fig. 4F). In addition, the overexpression of Sox2 in role for RCC2 in stabilizing Sox2 expression through a reduction in its RCC2 knocked down cells increases the cell survival, partially proteasome degradation. For that, we evaluated the effect of RCC2-HA reverting the negative role of RCC2 silencing on cell viability overexpression on ubiquitination of Sox2. We transfected Sox2, (Supplementary Fig. S2A and S2B). Thus, these results confirm RCC2-HA, or Flag-ubiquitin into 293T cells and Sox2 ubiquitination our previous findings showing that RCC2 influences Sox2 tran- changes were checked. RCC2 overexpression decreased Sox2 ubiqui- scriptional activation and further expression of its transcriptional tination in those cells compared with controls (Fig. 3F). Furthermore, targets, and this later promotes esophageal cancer progression. we performed a correlation analysis using the browser “UCSC Xena” (University of California, Santa Cruz, CA) to evaluate the correlation RCC2 and Sox2 colocalize in esophageal cancer and normal between the RCC2 and Sox2 expression using expression data from tissue patients with esophageal cancer. Our results indicated a moderate to Next, we determined whether the upregulation of RCC2 and Sox2 weak but still significant positive correlation between the mRNA occurs in in vivo models. First, we examined the expression of both transcription rate of RCC2 and Sox2 in patient samples (Pearson proteins in esophageal tumor-harboring and control mice. As correlation of r ¼ 0.2582; P ¼ 0.0009430; Fig. 3G). expected, the expression of RCC2 was upregulated in esophageal tumor tissue (Figs. 1G, 5A and C). Moreover, Sox2 also was substan- RCC2 increases transcriptional activity of Sox2 tially overexpressed in esophageal tumors compared with controls The importance of Sox2 in esophageal cancer development has been (Fig. 5B and D). Surprisingly, both upregulated proteins were colo- established trough promotion of transcription of several onco- calized in the basal cell layer in the esophagus (Fig. 5A and B). Thus, genes (14). Therefore, we aimed to investigate whether RCC2 influ- these data indicate that RCC2 and Sox2 are overexpressed together in ences the transcriptional activity of Sox2 to provide insights that will esophageal cancer in vivo and this upregulation occurs in the same allow us to explain whether the RCC2–Sox2 axis could be responsible place for both proteins, the basal cell layer of esophagus. In addition, to for promoting tumor growth in the esophagus. We conducted a evaluate the role of RCC2 on Sox2 in vivo, we analyzed the expression luciferase assay to evaluate the transcriptional activity of Sox2 by of Sox2 in RCC2 knockout mice and compared it with wild-type mice transfecting several amounts of RCC2 in combination with Sox2. (controls). For that, RCC2 was deleted after tumor induction (pro- Transfection of RCC2 increased the induction of relative luciferase gression model) and Sox2 expression evaluated by IHC. As expected, activity of Sox2 in a dose-dependent manner (Fig. 4A). This luciferase RCC2 deletion significatively decreases Sox2 expression in vivo, which signal was absent when RCC2 was transfected alone (controls), confirms our previous data showing the regulatory role of RCC2 on suggesting that RCC2 promotes the transcriptional activity of Sox2. Sox2 expression (Fig. 5E and F). Consequently, we performed a ChIP assay to determine whether RCC2 promotes the binding of Sox2 to the promoter regions of its target RCC2 deletion inhibits esophageal tumorigenesis genes, CCND1 and ETV4 and further activates its transcriptional We used an inducible knockout animal model to delete RCC2 and activity. Results show that RCC2 overexpression increased the occu- evaluate its role in the development of esophageal tumors. In our pancy of Sox2 for CCND1 and ETV4 promoter regions compared with model, the enzyme Cre, which is activated by tamoxifen, is associated controls (Fig. 4B). These results strongly suggest that RCC2 promotes with KRT5. KRT5 is expressed in the basal cell layer of the epidermis in the binding of Sox2 to the promoter regions of CCND1 and ETV4 and skin and esophagus (https://www.ncbi.nlm.nih.gov/gene/3852#gene- increases the Sox2 transcriptional activity. To confirm the role of expression; Supplementary Fig. S2C). Therefore, Cre-KRT5 is present RCC2 on Sox2 activation, we evaluated the protein expression of cyclin and is activated only in those organs. Thus, this animal model allowed D1 and Pea3, the protein products of CCND1 and ETV4, in RCC2- us to delete RCC2 specifically in the esophagus and as a side effect in HA stably overexpressing cells KYSE-30 and KYSE-450. The over- skin after tamoxifen injection without affecting other organs physi- expression of RCC2 consistently upregulated cyclin D1 and Pea3 ologically relevant as liver, lungs, or kidney. Thus, this model is expression (Fig. 4C). In the same manner, we used an opposite extremely valuable because it provides us with a more detailed

Figure 3. RCC2 stabilizes Sox2 expression by inhibiting proteasome-mediated degradation and ubiquitination. A, Basal Sox2 protein levels in normal (Het-1A) and esophageal cancer cells. B, Sox2 expression in esophageal cancer cells infected with scramble (Ctrl) or RCC2 knockdown virus. C, Protein level of Sox2 in cancer cell lines stably overexpressing RCC2-HA or control. D, Expression level of the Sox2 protein in response to transfection of increasing amounts of RCC2-HA overexpressing or control (mock) plasmids in 293T cells. pMXs-Sox2-IP vector (1 mg) was cotransfected with pcDNA3-RCC2-HA (0.5, 1, 2 mg) or mock and protein expression was evaluated by Western blot analysis. E, Sox2 expression in RCC2 knockdown or control KYSE-30 cells treated with MG-132 or vehicle at different time points. All experiments were analyzed by Western blot assays. F, Ubiquitination assay to detect Sox2 ubiquitination in 293T cells. Cells were transfected with the indicated plasmids. Cells were disrupted in lysis buffer and 500 mg of proteins were immunoprecipitated with an a-Sox2. Proteins were detected by Western blot analysis. G, Pearson correlation analysis using the browser UCSC Xena (University of California, Santa Cruz, CA) between the expression of Sox2 and RCC2 from patients with esophageal cancer (r ¼ 0.2582; P ≤ 0.01).

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1667

Calderon-Aparicio et al.

Figure 4. RCC2 increases transcriptional activation of Sox2. A, Luciferase assay to evaluate the transcriptional activation of Sox2 in 293T cells in response to transfection of increasing amounts of RCC2-HA overexpressing plasmid. Quantity (ng) of DNA transfected is indicated in parenthesis. B, qPCR- ChIP assay of KYSE-30 cells overexpressing RCC2-HA or scramble sequence (control). Data are presented as relative expression SD from triplicate experiments. , P ≤ 0.01; , P ≤ 0.001. C, Evaluation of expression of Sox2 transcriptional targets cyclin D1 and Pea3 in KYSE-30 and KYSE-450 esophageal cancer cells overexpressing RCC2- HA. D, Cyclin D1 and Pea3 expression in RCC2 knockdown cells. E and F, qPCR evaluation of transcription of theSox2targetgenesETV4 and CCND1 in KYSE-30 and KYSE-450 cancer cells with RCC2 knockdown.

fl fl examination of the oncogenic role of RCC2 specifically in the esoph- expression 3 weeks later. Our data indicated that RCC2 ox/ ox; agus. We conducted a pilot study to determine whether our genetically KRT5 CreERT2/ mice lost the expression of RCC2 in esophagus at modified animal model was working properly. We injected two dose of 50–60 mg/kg of body weight (Supplementary Fig. S3). Thus, we different doses of tamoxifen into the mice and evaluated the RCC2 used this dose for all animal experiments. Furthermore, the expression

1668 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

Figure 5. RCC2 and Sox2 are overexpressed and colocalize in the basal cell layer of the esophagus in mice. IHC staining of RCC2 (A) and Sox2 (B) in the esophagus from tumor- harboring mice treated with 4-NQO (right) and control mice (no-4NQO treatment; left). C and D, IHC staining quantiﬁcation for RCC2 and Sox2. Both proteins are upregulated in cancer compared with controls. , P ≤ 0.001, (n ¼ 8). E, IHC staining of Sox2 in RCC2 knockout mice and controls (wild type) after tumor induction (regression model, n ¼ 8). F, IHC staining quantiﬁcation for Sox2 expression. , P ≤ 0.01.

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1669

Calderon-Aparicio et al.

Figure 6. RCC2 knockout inhibits esophageal tumorigenesis in mice. A, Timeline to evaluate tumor growth in wild type (wt) and RCC2 knockout (KO) animals. Animals were injected with 4-OHT (4-hydroxitamoxifen) to deplete RCC2 and corn oil was injected in the control groups. At 3 weeks later, tumor induction was initiated with 4-NQO for 16 weeks as previously described. Control groups received vehicle alone (DMSO). After an additional 9 weeks, mice were euthanized for analysis. B, Representatives photos of esophageal tissue from animals with RCC2flox/flox genotype (þ 4-OHT, expressing RCC2, left), RCC2flox/flox; K5-Cre/ genotype (vehicle, expressing RCC2, middle) and RCC2flox/flox; K5-Cre/ genotype (þ 4-OHT, knockout RCC2: right). C, Quantitation of tumor nodules in esophageal tissue from wt and RCC2 KO mice. IHC staining of RCC2 (D) and PCNA (E) in esophageal tissue from mice (top: panels show quantitation of IHC staining; bottom show representative photos of IHC staining). Data are presented as mean values SD (n ¼ 12). , P ≤ 0.05 or , P ≤ 0.001.

1670 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

Figure 7. RCC2 knockout after tumor induction decreases esophageal cancer progression in mice. A, Timeline to evaluate tumor progression after RCC2 knockout. C57BL6 mice were given 4-NQO (100 mg/mL) or vehicle (DMSO) in drinking water for 16 weeks. Then, 4-OHT was intraperitoneally injected as described before. Animals were kept 9 weeks more with tap water and then euthanized for analysis. B, Representatives photos of esophageal tissue from animals with a RCC2flox/flox genotype (þ 4-OHT, expressing RCC2, left), RCC2flox/flox; K5-Cre/ genotype (vehicle, expressing RCC2, middle) and RCC2flox/flox; K5-Cre/ genotype (þ 4-OHT, knockout RCC2, right). C, Quantitation of visible tumor nodules in esophagus from mice. IHC staining of RCC2 (D) and PCNA (E) in esophageal tissue from mice (top, quantitation of IHC staining; bottom, representative photos of IHC). Wild type, wt; KO ¼ RCC2 knockout). Data are presented as mean values SD (n ¼ 12). , P ≤ 0.001.

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1671

Calderon-Aparicio et al.

of keratin 5 as a marker of basal cells was evaluated in knockout and RCC2 on esophageal cancer development have been conducted. Here, wild-type animals, to confirm that the deletion of RCC2 does not we demonstrated for first time that RCC2 is highly expressed affect or eradicate these cells in the esophagus. Keratin 5 expression in esophageal cancer in mice and humans compared with normal was similar in knockout and wild-type groups, even though at tissue (Fig. 1). The high expression of RCC2 is associated with 22 weeks after the deletion of RCC2 with 4-OHT (tumorigenesis aggressiveness and poor prognosis in lung cancer (24, 25). Further- model; Fig. 6A), indicating that those cells are not deleted after more, overexpression of ENST00000439577, a long noncoding RNA RCC2 genetic depletion and still can participate in the esophageal promoting cell proliferation and migration, is positively correlated oncogenesis by 4-NQO administration (Supplementary Fig. S4). with RCC2 overexpression and poor overall survival in patients with We performed two different animal experiments to examine how cancer (26). Moreover, the miRNAs miR-1247 and miR-29c inhibit RCC2 depletion affects tumor growth before and after inducing tumor growth and cell proliferation by decreasing RCC2 expression in esophageal cancer. In our first study, we examined the effect of RCC2 pancreatic and gastric cancer (11, 27). In addition, RCC2 promotes depletion on esophageal tumorigenesis, by investigating whether resistance to cancer treatments and inhibits sensitivity to apoptotic RCC2 depletion before tumor induction inhibits or reduces the drugs (10, 12, 13, 28). Here, our data show that RCC2 upregulation is formation of tumor nodules. Three weeks after the 4-OHT injection, linked with proliferation, anchorage-independent growth and migra- we induced tumors with 4-NQO for 16 weeks and then after an tion of esophageal cancer cells and promotes transformation of the additional 9 weeks of observation, we euthanized the animals for esophageal normal Het-1A cell line (Figs. 1 and 2). Thus, we report for analysis (Fig. 6A). Compared with control groups expressing RCC2 the first time an oncogenic role for RCC2 in esophageal cancer. (animals without the KRT5-Cre gene or 4-OHT injection), the deple- Sox2 is a transcription factor described as an essential embryonic tion of RCC2 significantly reduced tumor formation in the esophagus stem cell gene and a necessary factor for induced cellular reprogram- (Fig. 6B and C). Figure 6D shows that RCC2 was efficiently deleted in ming (14, 29). In cancer, the role of Sox2 has been well established. mice after 4-OHT injection. We also examined the expression of Sox2 overexpression in colorectal cancer cells induces several char- proliferating cell nuclear antigen (PCNA), a marker of cell prolifer- acteristics of cancer stem cells, such as spheroid growth pattern, loss of ation and results showed that RCC2 depletion reduced PCNA expres- differentiation, and increased expression of markers CD24 and sion compared with controls (Fig. 6E). CD44 (16). BRAF, a well-known oncogene, promotes Sox2 expression Next, we used an opposite approach that is clinically more relevant. and is associated with poor prognosis in cancer (30). In esophageal We performed a tumor regression study where we depleted RCC2 after cancer, Sox2 has been shown to have an important role promoting cancer induction with 4-NQO (Fig. 7A). Compared with controls, malignancy. SOX2 gene is amplified in esophageal squamous cell RCC2-depleted mice showed a reduction of tumor number in the carcinomas and is required for proliferation and anchorage- esophagus (Fig. 7B and C). As before, the reduction in tumor number independent growth (18). Sox2 promotes growth of esophageal cancer was associated with a reduction in PCNA expression only in RCC2- by activating the AKT/mTORC1 signaling pathway (17). Furthermore, depleted mice (Fig. 7D and E). These data overall suggest that RCC2 is a recent paper showed that AKT protects Sox2 expression from a very important oncogenic protein in the promotion of the formation ubiquitin-dependent protein degradation (31), suggesting a feedback and progression of esophageal cancer in vivo. between Sox2 and AKT that supports the transcriptional role of Sox2. Recent evidence shows that RCC2 regulates p-STAT3 activity, a transcription factor upregulating DNMT1 expression and increasing Discussion proliferation of glioblastoma (12). Therefore, we investigated whether A key stage for maintenance of genetic stability is chromosome RCC2 also exerts its tumor effects by influencing Sox2 activity. RCC2 segregation during mitosis. Instead, a hallmark of tumor cells is the loss enhanced and stabilized Sox2 expression by inhibiting proteasome- of their genomic stability. RCC2 is a centromeric protein that plays an mediated degradation, because MG132 treatment restores Sox2 important role in the regulation of chromosome segregation. Initially, expression when RCC2 is downregulated by shRNA. Furthermore, RCC2 was shown to function in the spindle midzone for centromeric RCC2 overexpression decreased Sox2 ubiquitination (Fig. 3). Thus, we targeting of CPC and to ensure that mitosis proceeds properly (5). In hypothesize that Sox2 upregulation by RCC2 might increase its addition, RCC2 is required in combination with microtubules for transcriptional activity and provide insights regarding the oncogenic Aurora B kinase activity, a key component of CPC encompassing role of RCC2 in esophageal tumor. Our results clearly show that Sox2 important cell-cycle events, such as chromosome segregation and transcriptional activity increased when RCC2 was overexpressed centrosome duplication (6, 20). Loss of RCC2 delocalizes Aurora B (Fig. 4A). Furthermore, our ChIP assay confirmed that forced RCC2 and other CPC members from centromeres affecting prolifera- expression enriched and increased the expression of CCND1 and tion (5, 6). In addition, Aurora B kinase is an important oncogene ETV4, both genes under the control of Sox2, at RNA and protein in cancer (21), which suggests that the RCC2–Aurora B complex could level (Fig. 4B–F). These data overall confirm that RCC2 stimulates the affect tumor cell proliferation. Furthermore, RCC2 depletion causes binding of Sox2 to promotor regions of its target genes and increases its spindle abnormalities in prometaphase and disrupts the regulation of transcriptional activity. In addition, the overexpression of Sox2 in kinetochore–microtubule interactions in early mitosis by inhibiting RCC2 knocking down cells positively regulate the survival in those the small GTPase RalA (3, 4). RCC2 also binds the GTPase ARF6 cells, antagonizing the inhibitory effect of RCC2 downregulation. This (ADP-ribosylation factor 6), which protects sister chromatid cohesion is a clear evidence that RCC2 regulates Sox2 activity to promote its allowing the establishment of stable kinetochore–microtubule attach- tumoral effects. Nevertheless, the mechanisms explaining how RCC2 ments and mitotic progression (22, 23). These types of evidence exerts this transcriptional control are not clear. Our experiments using highlight the importance of RCC2 in mitosis, cell proliferation, and IP showed that RCC2 does not bind directly to Sox2 (data not shown). its relevance in genomic stability. However, because IP assays only detect strong interactions between Previous reports suggest that RCC2 plays a potential role in several proteins, we cannot discard the idea that RCC2 and Sox2 are binding cancers (9–11); however, the mechanisms by which RCC2 exerts these transitorily. Therefore, whether RCC2 weakly and momentarily binds effects are underinvestigated and no studies investigating the role of Sox2 is unknown and will require further investigation. However, our

1672 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Tumor Growth through Sox2

data clearly show that RCC2 promotes Sox2 transcriptional activity To further confirm the role of RCC2 as an oncogene in esoph- and suggest that the role of RCC2 in esophageal cancer is mediated agus, we conducted in vivo experiments using conditional knockout through Sox2 activity. This evidence supports other works where mice. Our results show that RCC2 depletion inhibited tumorigenesis RCC2 has also shown a regulator role on phosphorylation of Ser/Thr in the esophagus (Fig. 6). More relevant was the fact that RCC2 protein kinases and transcription factors (9, 12), evidencing new roles depletionpromotedareductioninthetumornumberevenwhen of RCC2 besides its previous known functions on cell-cycle regulation. tumor induction was donebeforeorafterRCC2 knockout (Figs. 6 For example, RCC2 was able to activate JNK which promoted onco- and 7). These effects were associated with a reduction of a prolif- genic hallmarks for lung adenocarcinoma cancer cells (9). In breast eration marker in esophageal cancer for both cases (Figs. 6E cancer, RCC2 promotes tumor progression by activating Wnt pathway and 7E). Interesting, the fact that Sox2 expression was dramatically through b-catenin transcriptional activity upregulation (32). Similarly, decreased when RCC2 was deleted confirms the regulation of Sox2 RCC2 promotes tumoral effects on glioblastoma via regulation of by RCC2 in vivo. DNMT1 expression in a p-STAT3 transcription factor–dependent In conclusion, we are the first group to demonstrate that RCC2 is manner (12). Furthermore, to our knowledge, we are the first to overexpressed in esophageal cancer and promotes tumor growth by demonstrate the fact that RCC2 controls Sox2 transcriptional activa- increasing proliferation, transformation, and migration. These effects tion and expression. This conclusion is supported by our in vivo data, are linked to Sox2 regulation because RCC2 influenced Sox2 expres- where overexpressed RCC2 and Sox2 colocalized in the cell basal layer sion by inhibiting its ubiquitination-mediated proteasome degrada- in the esophagus and the deletion of RCC2 in knockout mice strongly tion and increasing its transcriptional activity. RCC2 oncogenic roles decreases Sox2 expression (Fig. 5). were also observed in vivo, where RCC2 knockout mice showed a In our animal models, we used conditional knockout mice to reduction in tumor number and lower proliferation in the esophagus, evaluate the role of RCC2 deletion on tumor progression, specifically associated with a reduction of Sox2 expression. Thus, the RCC2–Sox2 in esophagus. In this model, mice expressing the recombinase Cre axis could be an important target to consider for the treatment of together with the mutated ligand-binding domain of estrogen receptor esophageal cancer clinically. fusion recombinase (CreERT) allow the inducible control of Cre activity after 4-OHT injection. The transgenic construct is driven by Disclosure of Potential Conflicts of Interest the keratin 5 promoter, which is active in the basal epithelial cell No potential conflicts of interest were disclosed. lineage (33). Because keratin 5 is only expressed in esophagus and skin, our model allowed us to activate CreERT and delete RCC2 only in Authors’ Contributions esophagus and as a side effect in skin after 4-OHT injection, allowing A. Calderon-Aparicio: Conceptualization,formalanalysis,investigation,method- us to avoid possible collateral effects of the RCC2 deletion in other ology, writing-original draft, writing-review and editing, A. Calderon-Aparicio organs like lung, liver, heart or pancreas. Even 22 weeks after RCC2 performs the most of the experiments. H. Yamamoto: Conceptualization, formal analysis, methodology. H. De Vitto: Methodology. T. Zhang: Support with animals. deletion, the expression of keratin 5 is not lost (Supplementary Fig. S4) Q. Wang: Support with animals. A.M. Bode: Resources, supervision, funding in knockout mice, which show that deleting RCC2 does not affect the acquisition, project administration, writing-review and editing. Z. Dong: Resources, esophageal basal cell integrity. This observation matches with the supervision, funding acquisition, project administration. findings that RCC1, but not RCC2, was listed as an essential gene in human (34). Essential genes are genes that are indispensable to support Acknowledgments cellular life. These genes constitute a minimal gene set required for a The authors thank Tara Adams for assistance in handling the animal living cell (35). Here, it could be possible that RCC1, a member of the colonies. We also thank The Hormel Foundation for the financial support of family of RCC2, with knows function in cell division, could compen- this work. sate for the RCC2 loss and help to keep the esophageal basal cell integrity. However, it needs to be confirmed. Nevertheless, the most The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance important fact here is that RCC2 deletion did not alter the capacity of with 18 U.S.C. Section 1734 solely to indicate this fact. the basal cells to participate in the formation of tumors in esophagus and it proves that our animal model is very valuable to study the effects Received November 29, 2019; revised June 29, 2020; accepted August 7, 2020; of RCC2 deletion in esophageal cancer progression. published first August 14, 2020.

References 1. Wald O, Smaglo B, Mok H, Groth SS. Future directions in esophageal cancer 6. Rosasco-Nitcher SE, Lan W, Khorasanizadeh S, Stukenberg PT. Centromeric therapy. Ann Cardiothorac Surg 2017;6:159–66. Aurora-B activation requires TD-60, microtubules, and substrate priming 2. GLOBOCAN 2012: Estimated cancer incidence, mortality, and prevalence phosphorylation. Science 2008;319:469–72. worldwide in 2018; 2018. Available from: http://globocan.iarc.fr/Pages/ 7. Adams RR, Carmena M, Earnshaw WC. Chromosomal passengers and the fact_sheets_population. (aurora) ABCs of mitosis. Trends Cell Biol 2001;11:49–54. 3. Yenjerla M, Panopoulos A, Reynaud C, Fotedar R, Margolis RL. TD- 8. Williamson RC, Cowell CA, Hammond CL, Bergen DJ, Roper JA, Feng Y, et al. 60 is required for interphase cell cycle progression. Cell Cycle 2013; Coronin-1C and RCC2 guide mesenchymal migration by trafﬁcking Rac1 and 12:837–41. controlling GEF exposure. J Cell Sci 2014;127:4292–307. 4. Papini D, Langemeyer L, Abad MA, Kerr A, Samejima I, Eyers PA, et al. TD- 9. Pang B, Wu N, Guan R, Pang L, Li X, Li S, et al. Overexpression of RCC2 60 links RalA GTPase function to the CPC in mitosis. Nat Commun 2015;6: enhances cell motility and promotes tumor metastasis in lung adenocarcinoma 7678. by inducing epithelial–mesenchymal transition. Clin Cancer Res 2017;23:5598– 5. Mollinari C, Reynaud C, Martineau-Thuillier S, Monier S, Kieffer S, Garin J, 610. et al. The mammalian passenger protein TD-60 is an RCC1 family member 10. Wu N, Ren D, Li S, Ma W, Hu S, Jin Y, et al. RCC2 over-expression in tumor cells with an essential role in prometaphase to metaphase progression. Dev Cell alters apoptosis and drug sensitivity by regulating Rac1 activation. BMC Cancer 2003;5:295–307. 2018;18:67.

AACRJournals.org Mol Cancer Res; 18(11) November 2020 1673

Calderon-Aparicio et al.

11. Matsuo M, Nakada C, Tsukamoto Y, Noguchi T, Uchida T, Hijiya N, et al. MiR- 24. Fujii K, Miyata Y, Takahashi I, Koizumi H, Saji H, Hoshikawa M, et al. 29c is downregulated in gastric carcinomas and regulates cell proliferation by Differential proteomic analysis between small cell lung carcinoma (SCLC) and targeting RCC2. Mol Cancer 2013;12:15. pulmonary carcinoid tumors reveals molecular signatures for malignancy in 12. Yu H, Zhang S, Ibrahim AN, Wang J, Deng Z, Wang M. RCC2 promotes lung cancer. Proteomics Clin Appl 2018;12:e1800015. proliferation and radio-resistance in glioblastoma via activating transcription of 25. Song C, Liang L, Jin Y, Li Y, Liu Y, Guo L, et al. RCC2 is a novel p53 target in DNMT1. Biochem Biophys Res Commun 2019;516:999–1006. suppressing metastasis. Oncogene 2018;37:8–17. 13. Gong S, Chen Y, Meng F, Zhang Y, Wu H, Li C, et al. RCC2, a regulator of the 26. Feng N, Ching T, Wang Y, Liu B, Lin H, Shi O, et al. Analysis of microarray data RalA signaling pathway, is identified as a novel therapeutic target in cisplatin- on gene expression and methylation to identify long non-coding RNAs in non- resistant ovarian cancer. FASEB J 2019;33:5350–65. small cell lung cancer. Sci Rep 2016;16:37233. 14. Weina K, Utikal J. SOX2 and cancer: current research and its implications in the 27. Yi JM, Kang EJ, Kwon HM, Bae JH, Kang K, Ahuja N, et al. Epigenetically altered clinic. Clin Transl Med 2014;3:19. miR-1247 functions as a tumor suppressor in pancreatic cancer. Oncotarget 15. Jia X, Li X, Xu Y, Zhang S, Mou W, Liu Y, et al. SOX2 promotes tumorigenesis and 2017;8:26600–12. increases the anti-apoptotic property of human prostate cancer cell. J Mol Cell 28. Chanukuppa V, Paul D, Taunk K, Chatterjee T, Sharma S, Kumar S, et al. XPO1 is Biol 2011;3:230–8. a critical player for bortezomib resistance in multiple myeloma: a quantitative 16.LundbergIV,EdinS,Eklof€ V, Oberg€ Å, Palmqvist R, Wikberg ML. proteomic approach. J Proteomics 2019;209:103504. SOX2 expression is associated with a cancer stem cell state and 29. Sussman RT, Stanek TJ, Esteso P, Gearhart JD, Knudsen KE, McMahon SB. The down-regulation of CDX2 in colorectal cancer. BMC Cancer 2016; epigenetic modifier ubiquitin-specific protease 22 (USP22) regulates embryonic 16:471. stem cell differentiation via transcriptional repression of sex-determining region 17. Gen Y, Yasui K, Nishikawa T, Yoshikawa T. SOX2 promotes tumor growth Y-box 2 (SOX2). J Biol Chem 2013;288:24234–46. of esophageal squamous cell carcinoma through the AKT/mammalian 30. Lundberg IV, Lofgren€ Burstrom€ A, Edin S, Eklof€ V, Oberg€ Å, Stenling R. SOX2 target of rapamycin complex 1 signaling pathway. Cancer Sci 2013;104: expression is regulated by BRAF and contributes to poor patient prognosis in 810–6. colorectal cancer. PLoS One 2014;9:e101957. 18. Bass AJ, Watanabe H, Mermel CH, Yu S, Perner S, Verhaak RG, et al. SOX2 is an 31. Wang Z, Kang L, Zhang H, Huang Y, Fang L, Li M, et al. AKT drives amplified lineage-survival oncogene in lung and esophageal squamous cell SOX2 overexpression and cancer cell stemness in esophageal cancer by carcinomas. Nat Genet 2009;41:1238–42. protecting SOX2 from UBR5-mediated degradation. Oncogene 2019;38: 19. Kim JE, Kim JH, Lee Y, Yang H, Heo YS, Bode AM, et al. Bakuchiol suppresses 5250–64. proliferation of skin cancer cells by directly targeting Hck, Blk, and p38 MAP 32. Chen Z, Wu W, Huang Y, Xie L, Li Y, Chen H, et al. RCC2 promotes breast cancer kinase. Oncotarget 2016;7:14616–27. progression through regulation of Wnt signaling and inducing EMT. J Cancer 20. Chieffi P. Aurora B: a new promising therapeutic target in cancer. 2019;10:6837–47. Intractable Rare Dis Res 2018;7:141–4. 33. Liang C, You R, Chang L, Tsai F, Chen M. Transgenic mice exhibiting inducible 21. Tang A, Gao K, Chu L, Zhang R, Yang J, Zheng J. Aurora kinases: novel therapy and spontaneous Cre activities driven by a bovine keratin 5 promoter that can be targets in cancers. Oncotarget 2017;8:23937–54. used for the conditional analysis of basal epithelial cells in multiple organs. 22. Bourmoum M, Charles R, Claing A. ARF6 protects sister chromatid cohesion to J Biomed Sci 2009;16:2. ensure the formation of stable kinetochore-microtubule attachments. J Cell Sci 34. Hart T, Tong AHY, Chan K, Van Leeuwen J, Seetharaman A, Aregger M, et al. 2018;131:jcs216598. Evaluation and design of genome-wide CRISPR/SpCas9 knockout screens. G3 23. Humphries JD, Byron A, Bass MD, Craig SE, Pinney JW, Knight D, et al. 2017;7:2719–27. Proteomic analysis of integrin-associated complexes identifies RCC2 as a dual 35. Zhang R, Ou HY, Zhang CT. DEG: a database of essential genes. Nucleic Acids regulator of Rac1 and Arf6. Sci Signal 2009;2:ra51. Res 2004;32:D271–2.

1674 Mol Cancer Res; 18(11) November 2020 MOLECULAR CANCER RESEARCH

RCC2 Promotes Esophageal Cancer Growth by Regulating Activity and Expression of the Sox2 Transcription Factor

Ali Calderon-Aparicio, Hiroyuki Yamamoto, Humberto De Vitto, et al.

Mol Cancer Res 2020;18:1660-1674. Published OnlineFirst August 14, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-19-1152

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2020/08/14/1541-7786.MCR-19-1152.DC1

Cited articles This article cites 34 articles, 7 of which you can access for free at: http://mcr.aacrjournals.org/content/18/11/1660.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/18/11/1660. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.