Loss of Id4 Promotes Stemness in Prostate Cancer Cells

ABSTRACT DEPARTMENT OF BIOLOGICAL SCIENCES

DHANUSHKA HEWABOSTANTHIRIGE MBBS, PERADENIYA, 2006

M.S., PGIS PERADENIYA, 2013

LOSS OF ID4 PROMOTES STEMNESS IN PROSTATE CANCER CELLS

Committee Chair: Jaideep Chaudhary, Ph.D.

Dissertation dated May 2019

Inhibitor of differentiation 4 (ID4), a member of the helix-loop-helix family of transcriptional regulators has emerged as a tumor suppressor in prostate cancer (PCa).

Recent studies have shown that Id4 is highly expressed in the normal prostate and decreases in prostate cancer due to epigenetic silencing. Id4 knockdown in androgen sensitive LNCaP cells has been shown to lead to castration resistant prostate cancer

(CRPC) in vitro and in vivo. Id4-/- mice leads to underdeveloped prostate with PIN like lesions without the loss of Androgen Receptor (AR) expression. In this study we demonstrate that the loss of ID4 expression in PCa cell line LNCaP and DU145 may promote tumorigenesis by promoting stemness.

LNCaP cells with stably silenced ID4 ((-)ID4) using retroviral based shRNA and LNCaP transfected with non-specific shRNA were used to perform colony forming assay and

i prostatosphere formation using matrigel. Expression of cancer stem cell markers was determined using western blotting and immunocytochemistry (ICC). FACS analysis was used to sort stem cells and determine the ID4 expression. Xenograft study was performed on SCID mice using CD133 positive LNCaP cells.

LNCaP(-)ID4 and DU145 cells lacking ID4 showed increased holoclone as well as decreased paraclone formation, which are believed to be derived from stem cells and differentiated cells respectively, as compared to non-silencing control in the colony forming assay. There was also an increase in prostatosphere development in the LNCaP

(-) ID4 cells indicating that the loss of ID4 is responsible for promoting the LNCaP cells towards cancer stem cells. The results were further validated via western blotting and

ICC using known cancer stem cell markers on the holoclones and paraclones formed by these cells. Xenograft study showed that 10,000 cells from CD133 positive LNCaP cells developed tumor on SCID mice.

This study reports for the first time that loss of ID4 increases holoclone and prostatosphere formation indicating that Id4 may contribute to promoting stemness in prostate cancer cells.

LOSS OF ID4 PROMOTES STEMNESS IN PROSTATE CANCER CELLS

A DISSERTATION

SUBMITTED TO THE FACULTY OF CLARK ATLANTA UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR

THE DEGREE OF DOCTOR OF PHILOSOPHY

DHANUSHKA HEWABOSTANTHIRIGE

DEPARTMENT OF BIOLOGICAL SCIENCES

ATLANTA, GEORGIA

MAY 2019

DHANUSHKA HEWABOSTANTHIRIGE

ACKNOWLEDGEMENTS

Completion of this doctoral dissertation was impossible without the support of several people. I would like to express my sincere gratitude to all of them. First of all, I am extremely grateful to my mentor and doctoral advisor, Dr. Jaideep Chaudhary for his kindness, dedication, invaluable support and advice during my matriculation at Clark

Atlanta University. I would also like to sincerely thank my committee members: Dr.

Valerie Odero-Marah, Dr. Joann Powell, Dr. James Lillard and Dr. Sanjay Jain for their accolades, affirmations, and criticisms required along this journey. I am really thankful to all members of Dr. Chaudhary’s laboratory, both current and former graduate students, and the faculty and staff in the Department of Biological Sciences. Their support in my research, as well as their involvement in different collaborative projects, have given me first-hand knowledge of the importance of collaboration to the scientific process. I would like to sincerely thank my entire family for their unconditional love, sacrifice, support and great encouragement at all times throughout my studies.

Lastly, I would also like to thank the financial, academic and technical support of the Clark Atlanta University and the chair and the staff of the Department of Biological

Sciences and Center for Cancer Research and Therapeutic Development. My research was funded by NIH/NCRR/RCMI grant #G12RR03062, NIH grant #R01CA128914 and the Department of Biological Sciences.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... iii

LIST OF FIGURES ...... vi

LIST OF TABLES ...... vii

LIST OF ABBREVIATIONS ...... viii

CHAPTER

I. INTRODUCTION ...... 1

II. LITERATURE REVIEW ...... 5 2.1 Prostate Gland ...... 5

2.2 Prostate Cancer Incidence ...... 7

2.2.1 Risk Factors ...... 8

2.2.2 PIN Lesions of Prostate Gland ...... 9

2.2.3 Diagnosis and Treatments ...... 10

2.2.4 Making the Diagnosis and Staging the Disease ...... 11

2.2.5 Treatment Options ...... 12

2.3 Mechanisms of Prostate Cancer Initiation ...... 13

2.4 Androgen and Androgen Receptor in Prostate Cancer ...... 15

2.5 Stem Cells ...... 16

2.5.1 Features of Stem Cells ...... 17

2.5.2 Molecular Mechanism that Maintains Stemness ...... 18

2.5.3 Roles of Stem Cells in Biological System ...... 19 iv

CHAPTER

2.5.4 Cancer Stem Cell Theory ...... 20

2.5.5 Features of Cancer Cells and Cancer Stem Cells ...... 21

2.5.6 Mechanism Involved in Maintaining Cancer Stem Cells ...... 24

2.5.7 Cancer Stem Cells Therapy ...... 26

2.6 Inhibitor of DNA Binding Protein ...... 27

2.6.1 Inhibitor of DNA Binding 4 (ID4) Proteins ...... 29

2.6.2 ID4 in Development ...... 31

2.6.3 ID Proteins and Stem Cells ...... 32

2.6.4 ID4 and Cancer Stem Cells ...... 32

2.6.5 ID4 Protein Interaction ...... 33

2.6.6 FOXO1 ...... 33

2.6.7 PRMT ...... 35

2.7 ID4 in Prostate Cancer: Tumor Promotor vs Tumor Suppressor ...... 37

2.7.1 ID4 is Epigenetically Silenced in Cancer ...... 40

2.7.2 ID4 and Epithelial Differentiation ...... 41

2.7.3 ID4 and Prostate Development ...... 43

2.8 Tumor Marker for IHC ...... 44

2.8.1 AMACR ...... 44

2.8.2 NKX3.1 ...... 45

2.8.3 Probasin ...... 45

2.8.4 Sca-1 ...... 45

CHAPTER

III. MATERIALS AND METHODS ...... 46 3.1 Prostate Cancer Cell Lines ...... 46

3.2 ID4 Silencing in Prostate Cancer Cell Lines ...... 46

3.3 RNA Extraction ...... 47

3.4 Reverse Transcription Polymerase Chain Reaction ...... 47

3.5 Quantitative Real Time PCR (qRT-PCR) ...... 47

3.6 Protein Extraction ...... 48

3.6.1 Nuclear Cytoplasmic Extraction ...... 49

3.7 Western Blot Analysis ...... 49

3.8 Colony Formation Assay ...... 51

3.9 FACS Analysis...... 52

3.10 Animal Studies ...... 53

3.10.1 Enrichment of Cancer Stem Cells ...... 53

3.10.2 Tumor Inoculation ...... 53

3.11 Immunohistochemistry ...... 54

3.12 Immunocytochemistry ...... 55

3.13 Co-Immunoprecipitation (Co-IP) Analysis...... 55

3.14 Statistical Analysis ...... 56

IV. RESULTS ...... 57 4. Id4 Knockout Mice Analysis of Prostate ...... 57

4.1 H&E Staining ...... 57

4.2.1 AMACR Expression ...... 58

4.2.2 NKX3.1, Probasin and AR Expression ...... 59 vi

CHAPTER

4.2.3 Sca1 ...... 60

4.2.4 Pten, Akt and P-Akt ...... 61

4.3 Colony Formation ...... 63

4.4 Anchorage Dependent Growth ...... 64

4.5 Characterization of Stem Cell Phenotypes of Cancer Cells...... 66

4.6 FACS Analysis for Stem Cells ...... 69

4.7 In Vivo Tumor Formation ...... 72

4.8 IHC on Xenograft ...... 73

4.9 Tissue Microarray Data on PRMT1, FOXO1and SOX2 Histology ...... 74

4.10 Molecular Mechanism of Action of ID4 ...... 75

V. DISCUSSION… ...... 80 VI. CONCLUSION ...... 83

REFERENCES…..………………………………………………………………………85

vii

LIST OF FIGURES

Figure

1. Adult Prostate, Zones and Stages of Prostate Cancer ...... 7

2 Prostate Cancer Progression ...... 14

3 ID4 Expression in Oncomine Data ...... 38

4 ID4 Expression on Mice Prostate ...... 38

5 ID4 expression in Prostate Cancer Microarray ...... 39

6 Expression of ID4 in Different Cell Lines ...... 40

7 Laser Capture Microdissection Cancer Tissue with their ID4 Promotor Methylation

...... 41

8 Microarray Data of Mouse Epithelial Differentiation ...... 42

9 Effect of Loss of Id4 on Mouse Prostate Development ...... 43

10 H & E Staining Mice Prostate...... 58

11 Expression of AMACR ...... 59

12 NKX3.1, Probasin and AR Expression ...... 60

13 Sca-1Eexpression ...... 61

14 Expression of Akt, P-Akt and Pten in Wt and Id4-/- Prostate Gland ...... 62

15 Microscopic appearance of Holoclone, Meroclone and Paraclones ...... 64

16 Colony Count Frequencies...... 65

17 ICC analysis of LNCaP and LNCaP (-) ID4 Holoclone, Meroclone, Paraclone ..... 67

viii

18 Du145 Cells with their Holoclones and Paraclones ...... 68

19 PC3 and PC3 (+) ID4 Holoclone, and Meroclone Expression of CD133 and CD44 69

20 FACS Analysis Based on CD133 Surface marker ...... 70

21 ICC of FACS Sorted cell with CD133 and ID4 ...... 71

22 Tumors of CD133 Positive Xenograft ...... 72

23 IHC on Xenograft ...... 73

24 Microarray data on PRMT1, FOXO1and SOX2 Histology ...... 75

25 Molecular Mechanism Pathway...... 76

26 Western blot analysis Expression of FOXO1 in LNCaP and LNCaP-ID4 cells ...... 78

27 Nuclear and Cytoplasmic Expression of ID4, and FOXO1 in DU145 cell with

PRMT1 Inhibitors and EZH2 Inhibitors ...... 79

LIST OF TABLES

Table

1. Primer Sequences for RT-PCR, and Real-time qRT-PCR ...... 48

2. Antibodies for Western Blotting, IP, IHC, and ICC Analysis ...... 50

LIST OF ABBREVIATIONS

ALL………………………………………………………Acute Lymphoblastic Leukemia

AR………………………………………………………………… …..Androgen Receptor

BCP-ALL………………………………….B cell precursor acute lymphoblastic leukemia bHLH…………………………………………………………… basic Helix-Loop-Helix

CDK2…………………………………………………………..Cyclin dependent Kinase 2

CLL………………………………………………………Chronic Lymphocytic Leukemia

CRPC………………………………………………. Castration-Resistant Prostate Cancer

CSCs……………………………………………………………………..Cancer stem cells

DRE……………………………………………………………Digital Rectal Examination

ESC…………………………………………………………………..Embryonic stem cells

FACS………………………………………………...Fluorescence-Activated Cell Sorting

FOXO1………………………………………………………………Forkhead box protein

F1SH…………………………………………………….Fluorescent in-situ Hybritization

H3K9 and H3K27……………………………………Lysine 9 and Lysine 27 of Histone 3

H&E………………………………………………………………Haematoxylin and Eosin

HGPIN……………………………………………………………………..High-grade PIN

ICC………………………………………………………………….Immunocytochemistry

ICM………………………………………………………………………....Inner cell mass xi

ID………………………………………………………………Inhibitors of DNA-binding

IHC…………………………………………………………………Immunohistochemistry

LSCs…………………………………………………………………. Leukemic stem cells

NANOG………………………………………………………Homeobox protein NANOG

OCT4………………………………………………Octamer-binding transcription factor 4

OPCs…………………………………………………….Oligodendrocyte progenitor cells

PIN………………………………………………………Prostate Intraepithelial Neoplasia

PTM………………………………………………………..post-translational modification pRb………………………………………………………………...Retinoblastoma protein

PRMT1……………………………………………………….Protein methyl Transferase1

PSA……………………………………………………………….Prostate specific antigen qRT-PCR………………………………Quantitative real-time Polymerase chain Reaction

SCID…………………………………………………Severe combined immunodeficiency

SOX2……………………………………………………..Sex determining region Y-box 2

TAC……………………………………………………………Transient Amplifying Cells

TICs…………………………………………………………………Tumor Initiating Cells

xii

CHAPTER I

INTRODUCTION

The basic helix-loop-helix (bHLH) proteins belong to a large family of transcription factors that consist of more than 200 members across species.1 The hetero or homo dimerizing of bHLH proteins play an essential role in regulating the transcription of genes that are involved in cell fate determination.2 These proteins also regulate critical developmental processes such as differentiation in various cell types including B and T- lymphocytes, muscle lineages, pancreatic B cells, neurons and osteoblasts. Within the bHLH family are a group of four proteins that lack basic domain but have intact HLH domain. These four proteins known as inhibitors of DNA-binding (ID) proteins, ID1,

ID2, ID3 and ID4 are considered as dominant negative regulators of bHLH family of transcription factors. Heterodimers of ID proteins with bHLH fail to bind DNA and prevent transcription factors to bind to the promoters through the E-box, where it regulates physiological homeostasis.3

The ID proteins negatively regulate differentiation and promote proliferation; hence the expression of specific subsets of ID proteins is significantly increased in many different types of cancers.4 Whereas ID1, ID2 and ID3 are generally considered as tumor promoters, ID4 has now emerged as a potential tumor suppressor.3, 5 In most of the cancers, the expression of ID proteins (ID1-ID3) is significantly elevated with aggressiveness of the disease including poor prognosis, metastasis, and angiogenesis.6 1 2

On the contrary, ID4 primarily acts as a tumor suppressor in most cancers as opposed to

ID1, ID2 and ID3.7 ID4 is epigenetically silenced in many different types of cancers including leukemia,8 AML,9 CLL,10 ALL,11 glial neoplasia,12 squamous cell carcinoma,12 gastric cancer,13 pancreatic cancer,14 prostate cancer,5, 15 colorectal adenocarcinoma,16 malignant lymphoma,17 cholangiocarcinoma,18 esophageal,19 and lung20 cancers. In prostate cancer, ID4 is also epigenetically inactivated due to promoter hyper-methylation.8, 21

Analysis of ID4 knockout (ID4-/-) mice model suggested that ID4 is required for expansion of the proliferative zone in developing brain cortex and hippocampus by proliferation of neural stem cells through normal G1-S transition.22 Also ID4 promotes mammary gland development by suppressing p38MAPK activity.23 Above evidence suggests that loss of ID4 can maintain stemness in developing organs. No studies have reported the relationship between prostate, prostate stem cells and ID4 expression.

Studies have shown that the response of prostate cancer after androgen ablation therapy, subsequent recurrences, and progression is due to resident prostate cancer stem cells in the tumor, which are resistant to androgen ablation therapy.24 Therefore, the mechanism involved in progression or maintaineance of cancer stem cell is a good platform to find a definitive treatment for cancer. Our studies suggest that loss of ID4 maintain prostate stem cell population. Therefore, understanding the mechanism by which loss of ID4 maintains stem cells in prostate cancer may lead to the development of therapeutic intervention in CRPC.

Multiple cellular transcriptional regulatory mechanisms are involved to maintain cellular stemness. Specifically, OCT4, NANOG, and SOX2 transcription factors play major roles in maintaining stemness.25 SOX2 heterodimerizes with OCT4 and regulates several genes that demonstrate autologous feedback and control reciprocal transcription in a regulatory circuit.26 Many other factors, for example sall4, Dax1, Tbx3, also play a role in maintaining stemness26 via protein-protein interaction. Many of the above genes are also targets of NANOG and OCT4 that indicate the transcription network might have a feedback mechanism. Early embryonic stem cells express many proteins in common with cancer stem cells, especially OCT4, NANOG, and SOX227 although the precise underlying mechanisms are poorly understood. One theory suggests that arginine methylation by protein arginine methyl transferase 1 (PRMT1) on FOXO1 molecule can act as a regulator for activation of stemness maintaining transcription factors.28

Usually within same species, stem cells and somatic cells contain identical genomic DNA. The epigenetic regulation mainly influences the differentiation potential and pluripotency in stem cells. Here chromatin is subjected to various forms of epigenetic regulation that modulate the transcriptional activity in specific genomic regions, including chromatin remodeling, histone modifications, histone variants and

DNA methylation. For example, trimethylation of lysine 9 and lysine 27 of histone 3

(H3K9 and H3K27) correlate with inactive regions of chromatin, whereas H3K4 trimethylation, and acetylation of H3 and H4 are associated with active transcription,29 and DNA methylation generally represses gene expression. Previous studies in our lab

4 demonstrated that ID4 promoter methylation is initiated by Enhancer of Zeste Homolog

2 (EZH2) dependent H3K27Me3 in DU145 and C81 prostate cancer cell lines compared to ID4 expressing LNCaP cell line.15

Loss of ID4 in LNCaP cells promotes high tumorigenic ability in xenograft models.30 ID4 -/- studies show attenuated prostate development and hyperplasia with

PIN like lesions.31 These results suggest that ID4 has a potential role in blocking the development of prostate cancer. We believe that Protein methyl Transferase1 (PRMT1) may play a major role in the regulation of ID4 expression at epigenetic level. Moreover,

PRMT1 promotes FOXO1 post translational methylation and retains FOXO1 in the nucleus which in turn promotes cancer stemness. I, therefore, hypothesize that loss of

ID4 promotes prostate cancer by maintaining stemness. This hypothesis will be investigated through the following specific aims:

1. Investigate whether ID4 selectively regulates the colony and sphere formation ability in prostate cancer cells.

2. Investigate the expression of stem cell markers in prostate cancer cell lines, xenografts and ID4 knockout mice models.

3. Investigate ID4 dependent molecular mechanism involved in the regulation of prostate stemness.

CHAPTER II

LITERATURE REVIEW

2.1 Prostate Gland

The prostate is a small gland, about the shape and size of a walnut, in men that is part of the reproductive system. The prostate resides below the bladder and in front of the rectum. It surrounds part of the urethra, the tube that carries urine from the bladder.32 The prostate helps make semen, which carries sperm from the testicles when a man ejaculates.

Above the prostate and behind the bladder are two seminal vesicles which are glands that make a fluid that is a part of semen.

The male gonad differentiates embryonically under the influence of the Y chromosome. Later, under the influence, the gonad-derived fetal testosterone acting through androgen receptors, a region of the urogenital sinus (UGS) mesenchyme differentiates to form the primordial prostate buds. After birth, the prostate keeps growing and reaches nearly full size during puberty.

There are three distinct zones found in the prostate gland: (a) the peripheral

6 zone, (b) the transitional zone and (c) the central zone. The peripheral zone, which is approximately 70% of the prostate, is the most common origin of carcinoma,33 chronic prostatitis,33 and post-inflammatory atrophy.33 The central zone covers 25% of the prostate gland. It is cone-shaped and is located at the base of the prostate adjacent to the seminal vesicles. Also, central zone surrounds the ejaculatory ducts that secrete fluid that helps create semen. The transition zone makes up to 5% volume of the gland and surrounds the urethra. The prostate gland is enclosed by a fibrous tissue layer and is named as the prostate capsule. Commonly, this capsule is destructed when prostate cancer spreads out of the gland and into surrounding tissues and organs.

A B

Figure 1. (A) General overview of the prostate gland. (B) Anatomy of the prostate gland. The three histologically distinct zones are shown: the central zone, the transitional zone, and the peripheral zone. (C) A schematic view of the different stages of prostate cancer.

2.2 Prostate Cancer Incidence

Prostate cancer is the second leading cause of cancer deaths in men.34 In the year

2015 there were about 220,800 new cases of prostate cancer and almost 27,540 deaths are in the United States.34 From all the cancer deaths, prostate cancer deaths account for approximately 5.1 percent with 15.3 percent of men who will be diagnosed with prostate cancer at some point during their lifetime. About 6 out of 10 cases are diagnosed in men aged 65 or older, and it is rare before age 40. The average age at the time of diagnosis is about 66 years.35 More than 2.9 million men, who have been diagnosed with prostate cancer at some point in their life, are still alive today in the United States.36

2.2.1 Risk Factors

Unlike other diseases and infections, most cancers do not have a single cause.

They initiate due to the interaction of multiple factors that range from genetic characteristics to personal lifestyle.

Only a few factors have been conclusively established as risk factors for prostate cancer, and none of them are readily modifiable aspects of a man’s lifestyle. Increasing age is one of the most well established risk factors for prostate cancer. The risk of prostate cancer begins to increase in the late forties, and it continues to increase with age.

More than 70% of all prostate cancers are diagnosed in men over the age of 65. African

American men have one of the highest prostate cancer rates in the world. They are 69% more likely than white American men to be diagnosed with prostate cancer, and they are more than twice as likely to die from it.

Having a family history of prostate cancer in close male relatives is also a major risk factor. This risk factor may reflect a combination of inherited characteristics and common lifestyles shared by family members. It is believed that approximately 9% of all prostate cancer cases result from genetic mutations and as many as half of all prostate cancer cases in younger men may result from inherited conditions.37 Normal growth and function of the prostate gland is regulated by male sex hormones (androgens). It is believed that androgens (testosterone) and androgen receptors may increase the risk of prostate cancer.37 Differences in androgen levels may explain the variation in prostate cancer rates among ethnic groups. For example, several studies have shown that androgen levels in African American men tend to be higher than those in men of other ethnic

9 groups, and this may partially explain the high susceptibility of African-American men to prostate cancer. Effects on androgens might also be a mechanism by which some lifestyle factors could influence prostate cancer risk, such as, changes in dietary habits may lead to changes in androgen levels and thus perhaps to changes in prostate cancer risk.

2.2.2 PIN Lesions of Prostate Gland

Histopathological analysis of prostate cancer tissue shows a specific type of lesion that is believed to represent the primary precursor of human prostate cancer, which is known as Prostate Intraepithelial Neoplasia (PIN).38 PIN lesion can be classified into four common types based on their microscopic appearance: tufting, micropapillary, cribiform, and flat. PIN is recognized as a continuum between low-grade and high-grade forms, with high-grade PIN thought to represent the immediate precursor of early invasive carcinoma.

According to the clinical evidence, high-grade PIN (HGPIN) is implicated as a pre-neoplastic lesion in humans. Initially, PIN lesions are mainly found in the peripheral zone, in proximity to invasive carcinoma.38 Gradually, the appearance of HGPIN lesions generally precedes the appearance of carcinoma by at least 10 years.

Allelic imbalance analysis has shown that PIN lesions are multifocal, as is the case for carcinoma; moreover, the chromosomal abnormalities found in PIN resemble those found in early invasive carcinoma, although they are less prevalent. Also, the architectural and cytological features of PIN closely resemble those of invasive carcinoma, including disruption of the basal layer.39 PIN lesions and early invasive

10 carcinoma can be differentiated based on the markers with reduced expression of the cell adhesion protein E-cadherin and increased cytoskeletal component vimentin. On the other hand, PIN differs from invasive carcinoma in having an intact basement membrane, that does not invade the stroma.39 Furthermore, PIN lesions do not produce high levels of

PSA. Therefore, PIN lesions can only be detected in biopsy samples, and not by serum testing.

2.2.3 Diagnosis and Treatments

The Prostate specific antigen (PSA) blood test and Digital Rectal Examination

(DRE) can be used to detect the presence of prostate cancer when no symptoms are present. They can help catch the disease at an early stage when treatment is thought to be more effective and potentially has fewer side effects. During a digital rectal examination, finding any irregularities in size, shape, and texture in the prostate is suggestive of prostate cancer. In PSA test, the level of PSA, a protein produced by the prostate, is measured. PSA levels less than 4 ng/mL are usually considered “normal,” results over 10 ng/ mL are usually considered “high,” and results between 4 and 10 ng/mL are usually considered “intermediate.” Some men with prostate cancer can have low levels of PSA.

Also, high PSA levels can be seen following certain medical procedures in the presence of infection or the non-cancerous overgrowth of the prostate known as benign prostatic hyperplasia (BPH). The American Urological Association recommends that both the PSA and DRE should be offered annually, beginning at age 40, for men who have at least a

10-year life expectancy. Men at high risk, such as African-American men and men with a

11 strong family history of one or more first degree relatives diagnosed at an early age, are encouraged to also begin testing at age 40.

2.2.4 Making the Diagnosis and Staging the Disease

Although the PSA and DRE tests cannot diagnose prostate cancer, they can guide the need for a biopsy to examine the prostate cells and determine whether they are cancerous. If prostate cancer is suspected, a biopsy will be performed. During a biopsy, needles are inserted into the prostate to take small samples of tissue. If prostate cancer is found during the histological examination, the pathologist assigns a Gleason score, on a scale from 2–10.

Normally, cancers with lower Gleason scores (2–4) tend be less aggressive while cancers with higher Gleason scores (7–10) tend to be more aggressive; cancers with intermediate Gleason scores (5–6) fall somewhere in the middle. Staging determines the extent of prostate cancer and provides an idea of how the cancer should be treated.

Localized prostate cancer means that the cancer is confined within the prostate. Locally advanced prostate cancer means that most of the cancer is confined within the prostate, even though some has started to escape to the immediate surrounding tissues. In metastatic disease, prostate cancer is growing outside the prostate and its immediate environs, possibly in the lymph nodes and more distant organs.

2.2.5 Treatment Options

Outcome of the treatment depends on multi team approach. Consultation with all three types of prostate cancer specialists—a urologist, a radiation oncologist, and a

12 medical oncologist—will offer the most comprehensive assessment of the available treatments and expected outcomes. Persons diagnosed with localized or locally advanced prostate cancer have three major treatment options, active surveillance, surgery, and radiation. Choosing the best treatment for localized or locally advanced prostate cancer is generally based on the age, the stage and grade of the cancer, the general health, and the evaluation of the risks and benefits of each therapy option.

A radical prostatectomy is the surgical removal of the entire prostate gland plus some surrounding tissue. The procedure can produce significant side effects that might affect the quality of life, including erectile dysfunction and urinary incontinence.

Radiation involves the killing of cancer cells and surrounding tissues with directed radioactive exposure. With external beam radiation, high-intensity beams of radiation are directed at the target area; with brachytherapy, tiny radioactive metal seeds or pellets are surgically inserted into the prostate. Hormone therapy is often given in conjunction with radiation, either before, during, or after treatment. Although high doses of radiation are needed to kill prostate cancer cells, higher doses can also increase the rate of side effects such as urinary problems, erectile dysfunction, and rectal bleeding. Improvements in technology have allowed for very precise targeting of radiation to enable skilled and experienced radiation oncologists to deliver higher doses to more focused areas while minimizing side effects

2.3 Mechanisms of Prostate Cancer Initiation

Chromosomal alterations are commonly observed in prostate cancer; therefore, the characteristic patterns of chromosome abnormalities in prostate carcinoma indicate

13 the stages of prostate cancer progression. Losses of allelic patterns reflect the reduction or loss-of-function of putative tumor suppressor genes in prostate cancer. In particular, losses of heterozygosity at chromosomes 8p, 10q, 13q, and 17p are frequent events, and losses of 6q, 7q, 16q, and 18q have also been reported, although they are not as well characterized (Figure 2).40

Figure 2. Pathways for Human Prostate Cancer Progression.

Although, allelic loss is responsible for prostate carcinogenesis, there is no single candidate tumor suppressor gene that has been definitively assigned a role in cancer progression. Several reasonable candidate genes (e.g., RB, p53, PTEN, NKX3.1) have been implicated, based on their localization to regions of allelic loss and their functional properties, but none of these have been shown to be mutated in a large percentage of prostate cancer specimens, such as mechanism other than a coding region mutation, including promoter methylation or mutations within regulatory sequences that may affect transcription, translation, or mRNA stability.40

Chromosomal abnormality detected using FISH shows loss of a specific region on chromosome 8p in 80% prostate tumors. The 8p1-21 locus represents the NKX3.1 gene and loss of this region is seen in prostate cancer. Occurrence of PIN lesions in NKX3.1-/- mice prostate supports the role of NKX3.1 in prostate cancer.41 Hence, NKX3.1 is likely to represent a regulatory gene whose loss is involved in prostate cancer initiation.

Tumor suppressor PTEN/MMAC1 maps to 10p23. Loss of PTEN leads to occurrence of prostate carcinoma and other carcinomas including glioblastoma, breast and endometrial carcinoma. PTEN encodes a lipid phosphatase whose main substrate is

PIP3. Loss of PTEN activity leads to activation of PKB/AKT kinase pathway, which is responsible for cellular differentiation and decrease sensitivity to cell death.42

Inhibitor of differentiation 4 (ID4) is a dominant – negative –loop –helix protein belongs to the basic helix –loop-helix family transcription factor has been recognized as a tumor suppressor based on the evidence that it is epigenetically silenced in many cancers.

According to our studies, loss of ID4 in LNCaP cells demonstrates high tumorigenic ability in xenograft Studies ID4-/- mice studies show that loss of ID4 attenuate prostate development and promotes hyperplasia with PIN like lesions suggesting ID4 has potential role in development of prostate cancer.

Large scale genome wide association studies of prostate cancer and other epithelial cancers show that chromosome locus at 8q24 region is amplified. This region represents the MYC oncogene and studies showed that MYC protein is upregulated in many PIN lesions and majority of carcinomas. Likewise many tumor suppressor genes have been downregulated in relation with tumor initiation, such as P53 and RB1.40

2.4 Androgen and Androgen Receptor in Prostate Cancer

Androgen and androgen receptor (AR) activity also play a major role in initiation and progression of prostate cancer. The mechanism of action on AR in prostate cancer is complicated, as some develop/get recurrence of prostate cancer even after androgen deprivation therapy.43 Androgen is independent stage of prostate cancer shows increase the level of PSA, indicating there are many mechanisms that activate AR, such as AR amplification/overexpression, gain of faction AR mutations (mostly in ligand binding domain), intracrine androgen production, over expression of androgen cofactors, ligand independent AR activation by cytokines or growth factors, and constitutively active splice variants of AR.44

Castration resistant prostate cancer produces intra-tumoral androgens as a result of de novo steroidogenesis, even though this mechanism of steroidogenesis is not established and is suggested that enzymes such as CYP17A1 may be involved.45

However in CRPC, AR will be in most case constitutively active and studying this mechanism would be important in treating prostate cancer.

2.5 Stem Cells

Stem cells are small subsets of cells found in all multicellular organisms that can either mitotically divide to self-renew and produce more stem cells or differentiate into mature cells in a particular tissue. Unlike somatic cells, stem cells can self-renew for a long time. There are mainly two types of stem cells depending on their occurrence: embryonic stem cells and adult stem cells. Embryonic stem cells (ESC) are obtained from the inner cell mass (ICM) of the blastocyst and are capable of giving rise to any cell type

16 of the body while the adult or somatic stem cells are restricted to a particular adult tissue.46 Adult stem cells, also known as somatic stem cells or tissue-specific stem cells are present in all kinds of tissues like, blood, bone marrow, brain, and fat, occupying a small portion in the adult tissue.

According to behavior, these stem cells can be divided into two different stem cell types called general stem cells and cancer stem cells.

2.5.1 Features of Stem Cells

1 Growth behavior of stem cells - unlimited proliferative potential (common feature for stem cells and cancer cells)

Although stem cells and cancer cells have a key feature called “Unlimited proliferation potential” as a common trait, a cell must acquire several key characteristics in order to become cancerous.47 Features that make a cell cancerous are unlimited proliferation (even in the absence of extracellular signals), resistance to apoptosis, evasion of anti-growth signals and immune destruction, and increased cellular motility, which give the added advantages to the cancer cells to metastasize.48

However, stem cells are not involved in biologically destructive phenomenon like immune destruction. Some of the stem cells, like mesenchymal stem cells, have increased cellular motility, and they can also assist other cell types to have an enhanced cellular motility.49 Furthermore, unlike the cancer cell motility behavior, the natural purpose of stem cell motility is secondary homing to contribute to cell and tissue regeneration. So, stem cells and cancer cells have many of the features in common, but the purpose of such features is constructive or regenerative.

2 Potency

Differentiation potential of the stem cell is called potency and five potency types can be identified in the body.

1. Totipotency is the ability of a single cell to divide and produce all of the differentiated cells in an organism. In the spectrum of cell potency, totipotency represents the cell with the greatest differentiation potential.

2. Pluripotency refers to a stem cell that has the potential to differentiate into any of the three germ layers: endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), or ectoderm (epidermal tissues and nervous system).50

3. Multipotency describes progenitor cells, which have the gene activation potential to differentiate into multiple, but limited cell types. For example, a multipotent blood stem cell is a hematopoietic cell and this cell type can differentiate itself into several types of blood cell types like lymphocytes, monocytes, neutrophils.51

4. Oligopotency is the ability of progenitor cells to differentiate into a few cell types.

5. The unipotent cell is the concept that one stem cell has the capacity to differentiate into only one cell type. Although general stem cells have a different type of potency, all cancer stem cells have pluripotency and can be differentiated into well-differentiated, partially differentiated or undifferentiated cancers.

2.5.2 Molecular Mechanism that Maintain Stemness

OCT4, NANOG, and SOX2 transcription factors play a major role in maintaining stemness. SOX2 heterodimerize with OCT4 and regulate several genes, demonstrating autologous feedback and control reciprocal transcription in a regulatory circuit.52

Apart from above transcription factors, many other factors (proteins) such as, sall4, Dax1,

Tbx3 play a role in maintaining stemness, via protein-protein interaction. Many of the genes encoding proteins in the interaction network are targets of NANOG and OCT4, indicating that the transcription network might have a feedback mechanism through the protein interaction network.

Usually given same species, stem cells and somatic cells contain identical genomic DNA. The epigenetic regulation mainly influences the differentiation potential and pluripotency in stem cells. Here chromatin is subjected to various forms of epigenetic regulation that modulate the transcriptional activity in specific genomic regions, including chromatin remodeling, histone modifications, histone variants, and DNA methylation. For example, trimethylation of lysine 9 and lysine 27 of histone 3 (H3K9 and H3K27) correlate with inactive regions of chromatin, whereas H3K4 trimethylation and acetylation of H3 and H4 are associated with active transcription53 and DNA methylation generally represses gene expression.

Recent studies demonstrated that micro RNA is also significant in maintaining stemness acting on transcription level.

2.5.3 Roles of Stem Cells in a Biological System

Although stem cells occupy a small percentage of an adult tissue, they have profound biological significance. The basic biological significance of adult stem cells is to act as a reservoir of progenitor cells which can in turn act as a repair system, primarily for that particular tissue or other tissues of that particular germline. It is also likely that in the post-natal period of mammalian development a very small portion of pluripotent stem cells reside in all the tissues in the form of very small embryonic/ epiblast-like stem cell, in addition to, the uni/multipotent adult or somatic stem cells.

It was thought that stem cells residing in the bone marrow could give rise only to blood cells. However, emerging evidence suggests that adult stem cells may be more versatile than previously thought and able to create unrelated types of cells, either from the same or different germ layer. For instance, bone marrow stem cells may be able to create muscle cells, beta islet cells etc.51

2.5.4 Cancer Stem Cell Theory

It has been suggested that CRPC recurrence takes place because of residing prostate cancer stem cells in the tumor without undergoing apoptosis/die during androgen ablation.42 According to the cancer stem cell theory, the behavioral pattern and heterogeneity of cancers can be explained, and the study of cancer stem cell is a good platform to find a definitive treatment for cancer.

In 1979 John Dick and co-workers showed that leukemic stem cells which have

CD43 (+) and CD38 (-) surface markers can be transplanted to SCID mice in linear passages and develop leukemia. Also, they have shown that these cells have the colony

20 formation ability.43 In 2003, Ul Hajj and co-workers performed a similar kind of experiment on solid tumor (Breast) to demonstrate the existence of cancer stem cells.44

Also, a cancer stem cell study on DU145 cells has shown that even 10,000 cancer stem cells were enough for the development of prostate cancer in xenograft within 40 days.46 It is believed that tumors have a hierarchy of cells headed by cancer stem cells which can self-renew and differentiate to different stages cell types in cancer (heterogeneity).

2.5.5 Features of Cancer Cells and Cancer Stem Cells

Cancer cells are cells having unlimited proliferation potential divide at an unregulated fast pace leading to failure of regulation of tissue growth. In order to transform a normal cell into a cancer cell, the genes which regulate cell growth and differentiation must be altered. The development of cancer is a complex multistep process that requires the accumulation of mutations resulting in a cell acquiring the essential hallmarks of cancer: evasion of apoptosis, self-sufficiency in growth signals, insensitivity to antigrowth signals, invasive and metastatic abilities, limitless replicative potential, and sustained angiogenesis.

Given that normal adult stem cells already exhibit limitless replicative potential, it is hypothesized that transformed stems cells may be the cells of origin for many cancers,53 and hence, can also be termed as cancer stem cells (CSCs). CSCs, also known as cancer initiating cells, are defined as the fraction of cells within a tumor that are long- lived, possess the potential to proliferate indefinitely, and can generate all heterogeneous lineages of the original tumor in xenograft models46-47. CSCs are expected to utilize characteristics commonly found in stem cell populations such as differential metabolic

21 activity, specific signaling pathway activity, and regulation of cell cycling characteristics with aberrant regulation.2b, 48

One of the major characteristic features of CSC is that the ability to form a sphere and colonies. CSC sphere can be developed in matri-gel and even 500 cells from CSC sphere have the ability to develop cancer on xenograft.49 Apart from the sphere, researchers have shown that stem cells have the ability to form colonies in normal culture media. There are different morphological colonies that can be seen under the microscope.

Colonies that are large and round have a smooth perimeter and mostly contain small cells, which can be passaged many times and has significant growth potential called

“Holoclone.” Transplantation experiments have demonstrated the ability of these clones to form tumors with a very small amount of cells suggesting high stemness. Also, they express other characteristic features of stem cells.49

Aborted colonies that are small, have an irregular shape and contain large flattened differentiated square like cells called “paraclone.” These colonies cannot be passaged and are formed by cells with restricted growth potential.47 Mixed colonies usually have jagged perimeter and contain intermingled areas of small and large differentiated cells. These colonies can only be passaged a limited number of times and are formed by cells with limited potentials. These colonies are called “Meroclone.”47

Since cancer stem cells are the small aggressive population within the entire population of cancer cells, it is important to identify and target such population of CSC for successful cancer therapies, thereby avoiding a cancer relapse. CSCs of various origins have been reported to express different marker proteins like ABCG2, ALDH1,

CD44, CD24 and CD133, Thy-1, Sca-1.54 Such marker proteins have a great potential to be harnessed as biomarkers for CSCs. Also, some of the proteins are commonly shared amongst various cancers/ CSCs. Furthermore, these marker molecules are also known to play roles in various biological processes, in addition to, their respective roles in cancer stem cells.

The hierarchical model assumes that cancer stem cells (CSCs) represent a biologically distinct subset within the total malignant cell population. It is the only model that is relevant to the designation of malignant tumor-propagating cells as CSCs, although it does not require that CSCs are functionally or genetically homogeneous.

According to this model, a pool of CSCs can only be maintained by cells that have both

CSC potential and, by definition, the ability to give rise to progeny with self-limited proliferative capacity. This model precludes the concept of reversibility between intrinsically determined states of unrestricted and limited proliferative potential.

However, it accommodates the possibility that CSCs, like their normal counterparts, may retain responsiveness to external cues to elicit their intrinsically determined potentialities for survival, growth, and differentiation, irrespective of how perturbed the process of differentiation. The clinical implication from this model is that the elimination of all

CSCs will inevitably terminate the growth of the tumor and that failure to do so leaves open the possibility of relapse.

By contrast, the stochastic model assumes that every cell within a tumor has the same potential to act as a CSC and that their variable activities are at least partially determined by some stochastically varying intrinsic factor. This means that their activities

23 are not totally determined by the environment in which the cells are found.

Experimentally, the stochastic model can mimic a hierarchy in which the CSCs are rare and produce cells with diminished proliferative capacity because only a proportion of cells at any given moment exhibits CSC activity.

2.5.6 Mechanism Involving in Maintaining Cancer Stem Cells

Oncogenic cellular reprogramming promotes the acquisition of uncontrolled self- renewal of cancer cells with the expressing of cancer stem cell genes. In reprogramming process, epigenetic mechanisms integrate the effect of cell-intrinsic and cell-extrinsic changes and establish intra-tumoral heterogeneity, either promoting or inhibiting the CSC state.55 Epigenetic mechanisms involving DNA methylation and chromatin play a diverse role in cancer by promoting, sustaining, enhancing, or inhibiting malignant phenotypes at various stages of the disease. Research over the past decade has revealed that both cell-intrinsic (i.e., mutations) and cell-extrinsic (i.e., environmental cues) mechanisms modulate the epigenome of cancer cells, and their combined effect determines which cells preserve the self-renewal capacity acquired during tumorigenesis.

These cells referred to as cancer stem cells (CSCs) or leukemic stem cells (LSCs) are those responsible for driving long-term cancer growth and disease progression.56

CSCs/LSCs evolve over time as a consequence of genetic heterogeneity that generates self-renewing subclones with diverse fitness, and environmental changes that modulate their phenotype.

Chromatin-Related Drivers Inducing CSC Formation

In leukemias, cancers are maintained by LSCs. Numerous studies have identified mutated epigenetic regulators that favor the acquisition of uncontrolled self-renewal ability and initiate the disease. A prominent example is offered by mixed lineage leukemia (MLL)-associated leukemia, which is characterized by chromosomal rearrangements involving the KMT2A/MLL gene. KMT2A/MLL encodes a histone methyltransferase that orchestrates several essential cellular processes through modification of chromatin, mainly regulating accessibility to enhancer regions.

Oncogenic MLL fusion proteins created by translocations induce LSC formation in acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL). Importantly, MLL fusion proteins can initiate the oncogenic process, both, in hematopoietic stem cells and in short-lived progenitors, suggesting that they are able to reprogram committed cells and actively confer de novo self-renewal capacity.

The primary mechanism leading to oncogenesis induced by the K27M mutation is inhibition of the Polycomb repressive complex 2 (PRC2), which results in a genome- wide reduction in the repressive histone H3 trimethylated lysine 27 (H3K27me3) mark and re-establishment of an earlier developmental program in precursor cells and consequent acquisition of oncogenic self-renewal ability.

Proteins involved in the establishment and maintenance of DNA methylation have also been identified as drivers of CSC formation. CpG dinucleotides methylation

(epigenetic) depends on the action of DNA methyltransferases (DNMT1, DNMT3A, and

DNMT3B), which add the methyl-group to cytosines, and conversion of 5-

25 methylcytosine to 5-hydroxymethylcytosine is done by methylcytosine dioxygenases

(TET1 and TET2), which initiate a demethylation process.

Both processes histone methylation and DNA methylation play a major role in a reprograming cell into cancer stem cells.

2.5.7 Cancer Stem Cells Therapy

Conventional cancer therapies like chemo and radiotherapy are often unable to kill CSC. This will ultimately affect the patient by recurring cancer or via toxicity to healthy tissues. CSCs therapy indicates cancer therapy by targeting the CSCs population using various methods. Currently, CSCs therapy is gaining much attention from the researchers because of its ability to target CSCs, that are responsible for initiation, progression, and metastasis of cancer.57 Therefore, CSCs therapy is becoming an important focus of cancer research aiming to complete elimination of malignancies.

To target CSCs, various approaches can be taken.

1. Signaling pathways: Common signaling pathways shared between normal stem

cells and CSCs like Hedgehog (Hh), Notch, Wnt/b-catenin, high mobility group

AT-hook 2 (HMGA2), Bcl-2, Bmi-1, and etc. undergo aberrant activation or

dysregulation to give rise to CSCs 58. Targeting these signaling pathways can be

as a treatment method.

2. Targeting CSC markers-Certain cytotoxic drugs, short hairpin RNA molecules,

antibodies, which primarily target the cell surface markers of CSCs, can prove to

be useful methods to target CSCs.

3. Targeting drug detoxifying enzymes and drug efflux pumps present in CSCs. For

example, drugs against detoxifying enzymes like ALDH1 as described previous.

2.6. Inhibitor of DNA Binding (ID) Proteins:

ID proteins are typically expressed in highly proliferating cells and their expression levels decrease in differentiated cells. IDs are known to be positive regulators of cell growth and negative regulators of cell differentiation. ID proteins play key roles in the regulation of lineage commitment, cell fates decisions,59 and also have a role in cell signaling, DNA damage control, and apoptosis. They also act in the timing of differentiation during neurogenesis, lymphopoiesis, and neo-vascularisation

(angiogenesis) and are essential for embryogenesis and cell cycle progression.59-60 Helix

Loop Helix (HLH) proteins that positively regulate sets of genes during cell fate determination and cell differentiation, possess a region high in basic amino acids adjacent to HLH domain, that facilitates binding to DNA containing the canonical ‘E box’ recognition sequence, CANNTG and ‘N box’ sequence, CACNAG61 or Ets recognition sequence, and GGAA/T present in the promoter regions of regulated proteins,62 and thus, forms a large superfamily of transcription factors that regulate tissue-specific transcription.61 However, a distinct subfamily of HLH proteins, the ID proteins, lacks these basic DNA-binding region and instead function solely by dimerization with other transcriptional regulators. Principally, those of the bHLH type and such ID-bHLH heterodimers are unable to bind to DNA, and hence ID proteins act as dominant negative regulators of bHLH proteins.60 IDs are known to interact with other bHLH proteins such

27 as E2A, E2-2, or HEB, and also with factors such as RB (retinoblastoma) family members that have a role in cell cycle.6b

The ID family consists of four isoforms: ID1, ID2, ID3, and ID4 60structurally; the core HLH domain between ID and bHLH proteins is highly conserved. The interference of ID proteins with the key regulatory bHLH proteins is therefore an important interaction for proliferation and differentiation. In human, the ID1,ID2, ID3, and ID4 genes map to same chromosome at positions 20q11(75), 2p25 (76), 1p36 (78), and 6p21.3-22, 61 where all of them share considerable homology to one another and seem to have derived from a common ancestral gene.60

Widespread expression of ID1, ID2, and ID3 genes was demonstrated throughout from early gestation to birth during mouse development, with considerable overlap of

ID1 and ID3, and distinct ID4 expression limited to the nervous system.61 Deletion of

ID1 gene in mice, failed to generate phenotype, and ID2 null mice possessed defects in immunity due to lack of lymph nodes, while mice null for ID3 had defects in B cell proliferation and humoral immunity.4 Mice null for both ID1 and ID3 possessed embryonic lethality with aberrant neuronal differentiation and angiogenesis.63 ID1, ID2, and ID3 which are identified as mitogen responsive61 are further implicated in cell cycle progression when antisense ID constructs are introduced into serum stimulated NIH3T3 cells.61 ID1had shown to inhibit, E-protein and ETS mediated activation of the cdk inhibitor p16/INK4a.63 ID2 and ID3 have been shown to get phosphorylated in the late

G1 stage of cell cycle by cyclin dependent kinase 2 (CDK2),64 and ID2 by interacting via its HLH domain with retinoblastoma protein (pRb), p107 and p130, reverses cellular

28 growth inhibition. ID proteins induce apoptosis in accordance with their expression.

Expression of ID1 in dense mammary epithelial cell cultures, 82 ID3 in B-lymphocytes 64b and ID4 in astrocyte-derived cell line induces apoptosis.

In general, the expression of Id proteins is high in proliferating cells as ID proteins (ID1-ID3) promote cell proliferation65 and expression is down regulated during differentiation .105 ID1, ID2, and ID3 are upregulated are in pancreatic cancers66 , colorectal cancers67, astrocytic tumors67, and squamous cell carcinomas of head and neck.62 ID4 expression is reported to be decreased in many cancers68 due to promoter hyper methylation66 except in testicular seminomas where all ID genes are upregulated.68

As key regulators of cell cycle and differentiation, Id proteins have shown a vast regulatory function across diverse cellular functions including cell cycle, apoptosis, senescence and tumorigenesis in cancer.62

2.6.1 Inhibitor of DNA Binding 4 (ID4) Proteins:

ID4 proteins are dominant negative regulators of basic helix-loop-helix transcription factors. The human ID4 has two coding exons and produces a protein predicted to be approximately 17kDa. In mice, ID4 mRNA is expressed predominately in developing and mature neuronal tissue, bladder and bone marrow.

ID4 expression in prostate cancer is associated with an increased risk of metastasis.69 A more recent study (Carey et al) found ID4 promoter methylation in prostate cancer. Ectopic expression of ID4 results in cell cycle arrest. ID4 promoter methylation and loss of expression have also been documented in colorectal adenocarcinomas.70 ID4 expression has been linked to breast tumorigenesis and ID4

29 protein down-regulates BRCA1 expression71 and its expression is inversely correlated with estrogen receptor expression in breast cancer malignancies.16

The sub-cellular localization of the ID proteins is considered nuclear, but differs with cell type, differentiation stage and post translational modification.72 In normal rat breast tissue ID4 sub-cellular localization changes with the differentiation stage of the epithelia, with more nuclear staining in proliferating epithelia and in all other stages it is either mostly cytoplasmic or very weakly expressed.73 In prostate cancer cell lines ID4 protein has a different effect on the cell cycle. ID4 ectopically over-expressed in prostate cancer cell lines induced S phase arrest and apoptosis that was attributed to ID4 up- regulating the expression of E2A which in turn increased the levels of p21 and p27 expression. ID4 has also been demonstrated to increase cyclin E levels in cdkn2a -/- astrocytes, which drives their proliferation.74 In neural precursors, ID4 protein is required for the G1 to S phase transition in the cell cycle.22

ID4 plays an important role in the nervous system and particularly in oligodendrocyte differentiation by directly binding to OLIG1 and OLIG2 bHLH proteins responsible for neural progenitor cells.22, 75 The specific nature of ID4 protein expression in cancer has not been clarified, however, studies support that ID4 has both pro-tumor and anti-tumor activity. Epigenetic silencing of ID4 in leukemia76, breast 77, colorectal22 , mouse and human chronic lymphocytic leukemia (CLL)75, and gastric cancer8 tend to support its antitumor activity. It is highly expressed in bladder and rat mammary gland carcinomas suggesting that it may have pro-tumor activity.21 All knockout Id4 mice studies revealed that ID4 plays an essential role in neural stem cell proliferation and

30 differentiation and normal brain development.78 However, according to all previous data, it is highly suggestive that ID4 act as tumor suppressor in prostate cancer.

2.6.2 ID4 in Development

ID proteins are expressed by all cell lineages at some point during embryonic development. Unlike other ID proteins, ID4 is highly expressed during premature differentiation of early cortical stem cells.79 Accumulating evidence also suggest that ID4 expression is relatively high in undifferentiated, proliferating populations and is subsequently down-regulated as these cells begin to exit from cell cycle and get terminally differentiated.9 In adult human tissues, ID4 expression is observed in the brain, thyroid, testis, and pancreas.80 Moreover, ID4 is highly expressed in osteoblasts,80 adipocytes,81 prostate epithelial cells,82 neurons,71 testicular sertoli cells, and also in glial cells during differentiation,82 further supporting its role as a pro-differentiation factor.

ID4 plays an essential role in the development of different organs including neural compartments, normal mammary,83 and prostate gland.84 In oligodendrocyte progenitor cells (OPCs), overexpression of ID4 inhibits differentiation along with a subsequent decrease in the endogenous expression of all myelin genes.85 Moreover, OPC’s lacking

ID4 display early differentiation and increased apoptosis, further implicating the critical role of ID4 in the development of oligodendrocytes.86 In addition, ICC studies have shown that ID4 is localized to the nucleus in OPC’s and spermatids, but remains cytoplasmic in spermatocytes.87 The integration of various cellular events including response to specific ligands and cell specific protein-protein interactions could also possibly determine whether ID4 regulates proliferation and/or differentiation and cellular

31 localization. Collectively, these studies suggest that ID4 can act as pro- or anti- differentiation factor in a cell specific manner

2.6.3 ID Proteins and Stem Cells.

Previous studies have been shown that ID1, ID2, ID3 are primarily involved in maintaining tissue stemness in embryo development via inducing NANOG activity though dimerization with bHLH protein 71. Jung S, and co-workers show that Id1, Id2, and Id3 increase self-renewing and proliferation potential of cortical neural stem cells

(NSCs) while inhibiting neuronal differentiation. In electrophoretic mobility gel shift and luciferase assays, Id proteins interfered with binding of NeuroD/E47 complexes to the E- box sequences and inhibited E-box-mediated gene expression. Overexpression of Id proteins in NSCs increased both the number and the size of neurospheres in colony- forming assays.88

2.6.4 ID4 and Cancer Stem Cells

Studies on knockout mice revealed that ID4 is required for normal brain size and regulate neural stem cells proliferation and differentiation. Several different studies demonstrated that glioblastoma; increase ID4 expression level can maintain its cancer stemness, but no one has demonstrated that loss of ID4, maintain prostate cancer setmness. Studies on cancer stem cells in Stanford University suggested that there is link between ID4, FOXO1 and stem cell maintaining transcription factors NANOG, SOX2, and OCT4.54 Our previous studies on ID4 knockout mice, demonstrated that loss of ID4 attenuate normal prostate development and promote hyperplasia /dysplasia with subtle mPIN like lesions characterized by a gain of Myc and Id1 and loss of Nkx3.1 and Pten

32 expression. Also, our preliminary data show that loss of ID4 increases the expression of

Sca-1, which is a mouse stem cell marker.

2.6.5 ID4 Protein Interaction

HES1, TCF3/4 and TWIST1 are the main proteins that interact with ID4. Apart from that our lab has shown that ID4 may act as a co-chaperone and interact with Hsp90,

FKBP52 which are also important in the regulation of AR. Our preliminary data suggest that ID4 has interaction with FOXO1 to regulate the action of AR and FOXO1 action itself.

2.6.6 FOXO1

The forkhead transcription factor family is characterized by a winged-helix DNA binding motif and the forkhead domain.89 The mammalian forkhead transcription factors of the O class (FOXOs) have four members: FOXO1, FOXO3, FOXO4, and FOXO6.

FOXO1 and FOXO3 are expressed in nearly all tissues. Studies have demonstrated that

FOXOs play critical roles in a variety of cellular processes. FOXOs transcriptionally activate or inhibit downstream target genes, by playing an important role in proliferation, apoptosis, autophagy, metabolism, inflammation, and differentiation. Germline deletion of FOXO1 is lethal and it causes embryonic cell death due to incomplete vascular development.89 FOXO transcriptional activity is regulated by a complex array of posttranslational modifications, either activating or inactivating, results in alter nuclear import and export steps, modify the DNA binding affinity, and alter the pattern of transcriptional activity for a specific target.90 FOXOs share significant sequence homology and possess four distinct functional motifs that include a forkhead, nuclear

33 localization, nuclear export, and transactivation domains. FOXO proteins have both a nuclear localization sequence and a nuclear export sequence within the C-terminal DNA binding domain. AKT/SGK protein kinases phosphorylate FOXO1 and FOXO3 at well- defined sites, which increase the association with chaperone proteins results in the translocation of FOXO proteins from the nucleus to cytoplasm leading to their transcriptional inactivation.79 Phosphorylation of FOXO by AKT also disrupts FOXO interactions with DNA.

Acetylation, controlled by the histone acetyltransferase and histone deacetylases, has been shown to both promote and decrease FOXO transcriptional activity and to mediate different biological functions of FOXOs.91 In FOXO1, CREB binding protein induced acetylation at two basic residues, Lys242 and Lys245 located in the C-terminal region of the DNA binding domain, has been shown to reduce its DNA binding affinity and transcriptional activity.

Arginine is a positively charged amino acid known to mediate hydrogen bonding and amino-aromatic interactions. Studies showed, PRMT1 methylates FOXO1 primarily at

Arg248 and Arg250 that are conserved within the consensus Akt phosphorylation motif.

This arginine methylation directly abrogates Akt-induced phosphorylation of FOXO1 at

Ser253, which in turn results in increased nuclear localization and inhibition of subsequent degradation. This methylated FOXO1 mediate OCT4 and SOX2 gene expression through occupation and activation of their respective promoters to maintain somatic and cancer stem cells.91

2.6.7 PRMT

Arginine methylation is a common post-translational modification (PTM), with around 2% of arginine residues methylated in experimented with mouse liver.92 This arginine methylation in mammalian cells is carried out by a family of nine protein arginine methyltransferases (PRMTs). PRMTs are constitutively active and display basal activity without requiring processing or PTMs. However, mechanisms for fine-tuning

PRMT activity may be seen through PTMs, association with regulatory proteins, subcellular compartmentalization and through factors that affect enzyme-substrate interactions.93

Each addition of a methyl group to an arginine residue removes a potential hydrogen bond donor and changes its shape. For example, arginine dimethylation imparts bulkiness and hydrophobicity to a protein and can affect protein–protein interactions, both positively and negatively.94 Importantly, methylation does not neutralize the cationic charge of an arginine residue. There are 9 isotypes of PRMTs presence in cellular fiction and from them, PRMT1 and PRMT5 are the major asymmetric and symmetric arginine methyltransferases, respectively, and the complete loss of either of these enzymes is not compatible with the mouse or cell viability.95

Nevertheless, PRMT1 knockout studies demonstrate it is required for genome integrity and cell proliferation.

Alteration of PRMT1 expression, mostly upregulation, has been observed in various types of human cancers. PRMT1 is the founding member of the PRMT family

35 and its activity accounts for >90% of the methylarginine residues in mammalian cells.87

With regard to histone methylation, PRMT1 specifically deposits an asymmetric dimethylation arginine mark on histone H4 at arginine 3 (H4R3me2a). This histone methylation can either repress or activate transcription. In breast cancer, TDRD3 gene activate and progress to metastasis.94

Large numbers of non-histone substrates for PRMT1 have been identified.

PRMT1more directly regulate the AKT signaling pathway. They have shown that

PRMT1 mediated methylation of RxRxxS/T protein sequences blocks AKT phosphorylation at serine or threonine residues. A good example of this is FOXO1, which is methylated in vitro and in cells by PRMT1 at residues R248 and R250. PRMT1 mediated arginine methylation of R248 and R250 blocked FOXO1 S253 phosphorylation. The treatment of cells with hydrogen peroxide led to an increase in the

PRMT1 dependent methylation of FOXO1, which in turn blocked the AKT phosphorylation of S253 and nuclear export. As a result, the transcription of a number of

FOXO1 target genes was increased. Likewise, PTMT1 is very important in the regulation of many transcription factors either by histone methylation or non-histone protein methylation.94

2.7 ID4 in prostate Cancer: Tumor Promoter vs Tumor Suppressor

In comparison to other ID proteins, the function of ID4 is less understood and often conflicting. The specific nature of ID4 protein expression in cancer has not been clarified, however, studies support that ID4 has both pro-tumor and anti-tumor activity.96

ID4 appears to act primarily as a tumor suppressor in most cancers as opposed to ID1,

ID2, and ID3 which acts as tumor promoters or supporting oncogenes. In a small subset of cancers, ID4 also acts as a tumor promoter.97 For instance, high ID4 expression in a

B-cell acute lymphoblastic leukemia81 and B-cell precursor acute lymphoblastic leukemia (BCP-ALL)98 due to (6;14)(p22;q32) chromosomal translocation, breast,99 bladder,100 and in rat mammary gland carcinomas73 suggests that it may have pro-tumor activity as well. Overall, recent studies have concluded that ID4 is highly expressed in the normal prostate and decreased in prostate cancer primarily due to promoter hypermethylation at the epigenetic level.31

1. ID4 Expression in Normal Prostate

Oncomine database suggested that ID4 is highly expressed in the normal prostate and its expression decreases in prostate cancer (Figure 3). The ID4 expression in normal human prostate is also consistent with its expression in the mouse prostate (Figure 4).

Results from tissue microarray (TMA) also showed that ID4 is highly expressed in normal prostate whereas its expression decreases with increase in cancer progression

(Figure 5).

Figure 3. Oncomine Database Shows that ID4 Expression is Regulated in Prostate Cancer.

Figure 4. In Normal Mouse ID4 is Highly Expressed.

Figure 5. Prostate cancer tissue microarrays were used to investigate ID4 expression. ID4 was highly expressed in normal prostate (A) 200X and (B) 400X as seen by intense brown staining in the nuclei. Overall, ID4 expression decreased with increasing grade of prostate cancer (C) grade I (200X), (D) grade I (400X), (E) Grade II (200X), (F) grade II (400X), (G) Grade III (200X), and (H) Grade III (400X). The sections are also representative of scores used to quantify staining intensity: A and B – score 3; C and D – score 2; E – score 0. ID4 is mostly nuclear as seen by intense nuclear staining (brown, indicated by red arrow in D). At higher stages a clear large nucleus with no apparent brown staining is observed (yellow arrow in D and F). The sections were counterstained with hematoxylin that is reflected in the blue nuclei observed primarily in prostate cancer sections with undetectable Id4 expression. The 400X images in panels B, D, F, and H are corresponding images of boxed regions shown in panels A, C, E, and G (2009). The inset in panel G is the 4009 image of the region showing high Id4 expression in normal prostate adjacent to cancer (stage III).

2.7.1 ID4 is Epigenetically Silenced in Cancer:

Studies performed in cancers such as prostate, breast, colorectal and lymphoma have shown that ID4 is epigenetically silenced due to promoter hypermethylation. The specific nature of ID4 protein expression in cancer has not been clarified, however, studies support that ID4 has both pro-tumor and anti-tumor activity. Epigenetic silencing of ID4 in leukemia,101 breast,21 colorectal, mouse and human chronic lymphocytic leukemia (CLL), and gastric cancer tend to support its antitumor activity.101

ID4 Methylation in Prostate cancer cell lines with respect to its expression

Previous studies demonstrated that ID4 expression is high in LNCaP cells, low in PC3 cells and absent in DU145 cells. Methylation specific PCR indicate ID4 promoter methylation in DU145, PC3 cells No ID4 promoter methylation was observed in LNCaP cells, whereas the progressively castration resistant derivatives of LNCaP cells, the C81 and C33 showed increasing ID4 promoter methylation (Figure 6) ID4 was also methylated in majority of prostate cancer samples as opposed to benign prostate hyperplasia and adjacent normal epithelial cells as determined by methylation specific

PCR on Laser captured micro-dissected samples of human prostate cancer tissue (Figure

Figure 6. ID4 Promoter methylation status was seen in DU145, with no ID4 expression. In c-33, c-81 and PC3 there is partial methylation of Id4 promoter with no methylation observed in LNCaP.

Figure 7. Laser capture micro-dissection (LCMD) was used to examine ID4 methylation in 41 prostate cancer samples, 19 benign and adjacent normal regions and 4 benign stroma adjacent to prostate cancer regions.

2.7.2 ID4 and Epithelial Differentiation

According to microarray data set, in mouse stem cell differentiation pathway, prostate stem cells and transient amplifying cells (TAC) do not express ID4 (Stemness of these cells are confirmed by the expression of mouse stem cell marker “sca1”).102 ID4 expression gradually increases as TAC differentiates into prostate epithelial cells (Figure

8).

Sca-1 negative differentiated epithelial cells do not express CK14 and CK5, which are keratins that express in urogenital sinus stem cells and developing prostate and are considered as basl cell markers. This data suggest Id4 has a major effect on the differentiation of prostate stem cells to epithelial cells. The data also suggests that the expression of NKX3.1, a prostate epithelial cell marker also increases concomitantly with Id4 expression.

Interestingly, AR expression appears in Sca los TAC cells suggesting that AR expression is prior to ID4.

Figure 8. Microarray Data of Mouse Epithelial Differentiation.

2.7.3 ID4 and Prostate Development

Previous study on 6 weeks of ID4 knockout mice prostate showed that size of the prostate gland, tubular size and tubular area are decreased than in wild type mice. It is

44 clear that loss of ID4 attenuates prostate development by restricting total gland development and branching morphogenesis.

Figure 9. Effect of loss of Id4 on mouse prostate development. A and B – Immuno-histochemical analysis of Id4 expression in the wild type mouse prostate. Panel B is the enlarged version of the box represented in Panel A. Id4 expression is primarily localized to epithelial cell nuclei. Red, green and yellow arrow heads represent cells expressing high, low or no Id4 respectively. C: Lack of Id4 expression in Id4-/- prostates. The scale bars are 100um. D: The relative size of the genital tract (excluding testis and epididymis) of the wild type (Id4+/+) and mutant (Id4-/-) mice. The representative image of three different tracts demonstrating clear size differences is shown. The bottom panel represents the size of the seminal vesicle from the Id4+/+, Id4+/- and Id4-/- mice. E: Average number of tubules and tubule diameter per cross section in the wild type and Id4 -/- prostates. The number of tubules were counted in each section (n = 100 serial cross sections for Id4+/+, n = 76 for Id4+/- and n = 54 for Id4-/, proximal to distal) at 50× and their mean ± SEM is indicated as open bars. The black bars represent average tubule diameters (±SEM) of the number of tubules counted in each of the serial sections at 50×. (*** P < 0.001, NS: non-significant).

2.8 Tumor Markers

There are different proteins used to identify tumors in tissues to detect tumor grade, severity and treatment progression. These proteins are called tumor markers.

AMACR and NKX3.1 are the most common proteins which are used in immunohistochemistry in human prostate tissue. Apart from them probasin and Sca-1 are used to identify the stemness and AR activity in mice prostate tissues.

2.8.1 AMACR

Alpha-methylacyl-CoA racemase in humans is encoded by the AMACR gene. In mammalian cells, the enzyme is responsible for converting (2R)-methylacyl-CoA esters to their (2S)-methylacyl-CoA epimers and known substrates, including coenzyme A esters of pristanic acid (mostly derived from phytanic acid, a 3-methyl branched-chain fatty acid that is abundant in the diet) and bile acids derived from cholesterol. This transformation is required in order to degrade (2R)-methylacyl-CoA esters by β- oxidation, which process requires the (2S)-epimer.103 The enzyme is known to be localized in peroxisomes and mitochondria, both of which are known to β-oxidize 2- methylacyl-CoA esters. Increased levels of AMACR protein concentration and activity are associated with prostate cancer and the enzyme is used widely as a biomarker in biopsy tissues.103 Increased levels of AMACR are also associated with some breast, colon, and other cancers. According to literature, positive AMACR immunostaining along with negative basal cell markers (P63) is used in the differentiation of atrophic prostate cancer and benign atrophy

2.8.2 NKX3.1

NKX3-1 is an androgen-regulated, prostate-specific homeobox gene whose expression is predominantly localized to the prostate epithelium. It acts as a transcription factor that has a critical function in prostate development and tumor suppression. In humans, the NKX3-1 gene is located on chromosome 8p21.2 with 4 exons. Mouse studies demonstrated that at 15.5 dpc (days postcoitum), NKX3.1 mRNA is expressed in urogenital sinus whereas NKX3.1 protein expression starts at 17.5 dpc. This expression precedes formation of prostatic bud, indicating that NKX3.1 is responsible for prostate epithelial branching and morphogenesis. NKX3.1 -/- mouse showed that it has normal prostate with 40% less branching morphogenesis compared to wild type mouse. The12 months old NKX3.1-/- mouse developed histological features that resemble human PIN, which is thought to be the primary precursor of prostate cancer.

NKX3-1 has been established as a marker for identifying metastatic tumors.

Furthermore, anti-NKX3-1 antibodies are a more sensitive and specific method for diagnosing metastatic prostatic adenocarcinomas in distant sites.104

2.8.3 Probasin

The prostate gland will produce a number of tissue-restricted gene products.

Characterization of the regulation, expression, and function of genes encoding prostate- specific proteins is critical to our understanding of prostate biology. Probasin is a prostate-specific gene originally isolated from the rat and has been exploited as a marker of prostate differentiation and to elucidate androgen action.

2.8.4 Sca-1

Sca-1 stands for "Stem cells antigen-1". It consists of 18-kDa mouse glycosyl phosphatidylinositol-anchored cell surface protein (GPI-AP) of the LY6 gene family. It is the common biological marker used to identify prostate stem cells stem cell along with other markers.102

CHAPTER III

MATERIALS AND METHODS

3.1 Prostate Cancer Cell Lines

Human prostate cancer cell lines LNCaP, DU145 and PC3 were obtained from

American Type Culture Collection (ATCC, Rockville, MD) and cultured as per ATCC recommendations as described previously.5 PC3 and DU145 cells were cultured in Ham’s

F12 (Gibco, Carlsbad, CA) medium containing 10% bovine calf serum (Hyclone, Logan,

UT) with appropriate antibiotics (pen/strep, fungizone, and gentamycin). LNCaP cells were cultured in RPMI 1640 medium with 10% fetal bovine serum (FBS) and appropriate antibiotics. Cells were cultured at 37°C in a fully humidified atmosphere containing 5%

CO2.

3.2 ID4 Silencing in Prostate Cancer Cell Lines

The prostate cancer cell line LNCaP was used to stably silence ID4 using gene- specific short hairpin RNA retroviral vectors (Open Biosystems #RHS1764 -97196818, -

97186620 and 9193923 in pSM2c, termed as ID4shRNA A, B, and C respectively).

LNCaP cells transfected with non-silencing shRNA (RHS1707) (L+ns) was used as a control cell line. Transfections and selection of transfectants (puromycin) were performed as suggested by the supplier. 48

Successful silencing of ID4 gene was confirmed via qRT-PCR and western blot analysis.

3.3 RNA Extraction

Total RNA from L+ns, L(-)ID4, DU145 and DU145(+)ID4 cells were isolated by an E.Z.N.A. DNA/RNA kit (Omega Bio-tek). The final RNA pellet was re-suspended in diethyl pyrocarbonate (DEPC)-treated H2O, quantified as per the manufacturer’s instructions and then stored at -80°C until further analysis.

3.4 Reverse Transcription Polymerase Chain Reaction (RT-PCR)

RNA (2 µg) isolated from cells was reverse transcribed to a final volume of 25µl as per the standard protocol,15, 98 (RT Master Mix: 1.25 mM each of dNTP’s, 250 ng oligo DT (Promega, Madison, WI), 10 mM dithiothreitol, and 200U MMLV reverse transcriptase (In-vitro) in the MMLV first-strand synthesis buffer (Invitrogen). RNA previously suspended in DEPC water was first denatured for 10 minutes at 65ºC, and then cooled on ice for 2 minutes before addition of reverse transcriptase master mix. The reverse transcriptase reaction was carried out in a thermocycler at 42ºC for 1 hour and

95ºC for 5 minutes. The reverse transcribed RNA was stored at -20ºC until further analysis.

3.5 Quantitative Real Time PCR (qRT-PCR)

The reverse transcribed RNA from cell lines was used to perform RT-PCR and/or real-time qRT-PCR analysis using gene-specific primers (Table 1). The ΔCt values

(respective gene value - Ct value subtracted from GAPDH Ct) and ΔΔCt values (fold change as compared to the gene expression levels in L+ns samples) were used as a quantitative measure of gene expression.

Table 1. Primer Sequences for RT-PCR, and Real-time qRT-PCR

PCR Primers Forward ( 5’) Reverse ( 5’)

GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC

CD44 AACCACAAGGATGACTGATG TTCTGGGTAGCTGTTTCTTC

CD133 CTCCCTGTTGGTGATTTGTA ATTCAAGAGAGTTCGCAAGT

FOXO1 TGTCCTACGCCGACCT TGCTGTGTAGGGACAGATTA

NANOG AGGGATGCCTGGTGAAC AGAGATTCCTCTCCACAGTT

OCT4 AGGAAGCTGACAACAATGAA CACTGCAGGAACAAATTCTC

SOX2 CGGATTATAAATACCGGCCC CATGTGCGCGTAACTGT

3.6 Protein Extraction

Total cellular proteins were prepared from the cultured prostate cancer cell lines using M-PER (Thermo Scientific). Protein samples were quantitated using the BCA

Protein Assay Kit according to manufacturer’s protocol (Thermo Scientific). A standard curve was determined using BSA and the absorbance values of the unknown protein samples were determined at a wavelength of 562 nm. Respective protein samples

(20μg/μl) were then mixed 1:1 with 2X laemmli sample buffer for subsequent western blotting analysis

3.6.1 Nuclear Cytoplasmic Extraction

Approximately 4 x 107 cells were prepared and washed gently with PBS buffer.

Cells were obtained by centrifugation using a micro-centrifuge at 10,000 rpm and resuspended the pellet in 5 times pellet volumes of CE buffer (approximately 100 μl).

Cells were incubated on ice for 3 min and then centrifuged by a micro-centrifuge at

10,000 to 15,000 rpm for 4 min. To obtain cytoplasmic proteins, the supernatant was removed from the pellet to a clean tube, and the pellet was washed with 100 μl of CE buffer without detergent and centrifuged at 10,000 to 15,000 rpm for 4 min. Salt concentration was adjusted to 400 mM using 5 M NaCl (~35 μl). To obtain the nuclear proteins, 1 pellet volume of NE buffer was added to nuclear pellets (approximately 50 μl) and an additional pellet volume of NE buffer was added respectively. The protein extracts were incubated on ice for 10 min and vortexed periodically to re-suspend the pellet.

Lastly, the CE and NE proteins were centrifuged at maximum speed for 10 min to pellet any nuclear proteins and were transferred the contents of the CE tube and NE tube separately to clean tubes. Glycerol was added to the CE tube to 20%, and Stored at -

70°C.

3.7 Western Blot Analysis

20 μg of total proteins were size fractionated on 4-20% SDS-polyacrylamide gel.

The SDS-gel was subsequently blotted onto a nitrocellulose membrane (Whatman) and subjected to western blot analysis using protein specific antibodies (Table 2). After

52 washing with 1x PBS, 0.5% Tween 20, the membranes were incubated with horseradish peroxidase (HRP) coupled secondary antibody against rabbit/mouse IgG and visualized using the Super Signal West Dura Extended Duration Substrate (Thermo Scientific) on

Fuji Film LAS-3000 Imager.

Table 2. Antibodies for Western Blotting, IP, IHC, and ICC Analysis

3.8 Colony Formation Assay

The hierarchy of colony forming cells described by Barrandon and Green is recapitulated by certain types of normal cell in culture 47,104and consequently colony morphology is used routinely as a surrogate assay to identify and characterize stem cells.

Holoclones express survival and self-renewal genes associated with stem cell capacity.

Holoclones, meroclones, and paraclones were described in clones derived from human cancer cell lines of various types, including pancreatic47, head and neck58, breast105and prostate.106 Cancer cell holoclones can be passaged indefinitely107 and xenografted serially.108 The formation of holoclones has been adopted as a surrogate stem cell assay, particularly in the study of prostate cancer.109 An increased number of holoclones is regarded as enrichment for cancer stem cells (CSC) and has been used to study CSC marker expression. In prostate cancer, an increased number of holoclones is associated with the expression of the putative stem cell markers CD44, integrin a2b1, CD133,

PSAlo expression110and aldehyde dehydrogenase 1 (ALDH) activity.111 Holoclone formation has also been used to validate sphere formation from cell lines as a stem cell assay112 and to demonstrate the presence of cancer stem cells in samples from primary human prostate cancers.

Two hundred cells from prostate cancer cells were plated on 60mm petri dish and let cells to grow for two weeks and every day evaluates the morphology of cells. After two weeks’ cells form different colonies, holoclones, meroclones, and paraclones were

54 identified and counted. Using cloning cylinders, different colonies were selected and reculture them based on holoclone, meroclone, and paraclone.

3.9 FACS Analysis

Flow cytometry permits the visualization and sorting of cells according to the presence of antigens which are detected through fluorescently labeled antibodies, which when bound and excited with a laser can be detected. This allows a quantitative technique to compare protein expression between samples. A FACSCanto II flow cytometer (BD

Biosciences) was used for flow cytometry analysis and a FACSAria (BD Biosciences) was used for sorting. With the exception of apoptosis assays, viable cells were gated on using FSC and SSC. Unstained cells, single color controls, and fluorescence minus one

(FMO) controls were used for compensation analysis and to set appropriate gates for analysis. Data was acquired using BD FACSDiva (BD Biosciences) and analysis was performed using FlowJo (Tree Star Inc., Ashland,USA) software.

Antibody Staining

All antibodies were titrated for optimal concentration before use. Antibodies used in this study are described in Table 2. Controls consisted of an appropriate isotype matched antibody at the same concentration. Isotype controls were used for all human antibodies used.

Cell Surface Antibody Staining

An appropriate number of cells were centrifuged at 300 x g for 5 min and washed several times. Cells were resuspended in PBS/2% FCS with antibodies at an appropriate concentration and incubated for the period and temperature as per the manufacturer’s

55 protocol. After staining, cells were washed, resuspended in 200µl PBS/2% FCS and analyzed. Cells required for sorting were filtered using a 0.2µM filter prior to use.

3.10 Animal Studies

3.10.1 Preparation of Tumor Stem Cells

LNCaP cells were grown in complete medium (10% v/v FBS in RPMI-1640 medium). When cells were 70-80% confluent, 3-4 hours before harvesting, the medium was replaced with fresh medium to remove dead and detached cells. Then the medium was removed, and cells were washed with PBS. After adding an appropriate amount of trypsin-EDTA, cells were dispersed by adding complete medium (5:1), and then centrifuged immediately at 1500 rpm for 5 minutes. After re-suspending the cell pellet with complete medium (1:1), cells were counted using a Cellometer Vision Trio 5 system

(Nexcelon Bioscience). Cells were sorted with FACS based on CD133 surface marker.

3.10.2 Tumor Inoculation

The work area was prepared by disinfecting all hood surfaces with 70% ethanol.

The inoculation area of each mouse was cleaned and sterilized with an alcohol pad. A freshly prepared cell suspension was agitated to prevent the cells from settling and then mixed with matrigel. One hundred microliters of the mixture (containing 10000 LNCaP

CD133 positive cells) were injected subcutaneously into the lower flank of each of the 3

(4-weeks old) castrated C.B-17 SCID mice and control 10000 LNCaP CD133 negative cells in 3 mice (Taconic Biosciences) using a 27-gauge syringe. The C.B-17 SCID mice

56 were maintained at the Mercer University Vivarium. All studies were approved by the

Clark Atlanta and Mercer University Committee for the use and care of animals

(IACUC). Tumor diameters were measured with digital calipers. At the end of the experiments, the mice were laid to rest by asphyxiation, the tumors were surgically removed, weighed and the volume was measured. Harvested tumors were fixed in 10% buffered formalin. The fixed tumors were paraffin-embedded, sectioned (5 μm), and either stained with hematoxylin and eosin (H&E) or used for IHC. Images were captured using a Zeiss microscope with an Axiom Cam version 4.5 imaging system.

3.11 Immunohistochemistry

IHC protein localization studies in paraffin-embedded 5-μm tissue sections were performed using protein specific antibodies. Briefly, the slides were deparaffinized in xylene and re-hydrated through standard protocols. Following antigen retrieval (autoclave in 0.01 M sodium citrate buffer pH 6.0 at 121°C /20 psi for 30 minutes), the peroxidase activity was blocked in 3% H2O2 and nonspecific binding sites blocked in 10% goat serum. The blocked sections were incubated overnight at 4°C with protein specific primary antibodies followed by incubation with secondary antibody (Table 3) for 1 hour.

The slides were stained with DAB for 2 minutes, counterstained with hematoxylin, mounted with immuno-mount (Thermo Scientific), examined, and photo-micrographs were taken using the Zeiss microscope with an AxioVision version 4.5 imaging system.

All the antibodies were mono-reactive, that is a single reactive band was observed in western blot using whole cell lysates from prostate cancer cell lines LNCaP, DU1545 and

PC3. Non-specific binding of the secondary antibodies was evaluated using respective normal IgGs.

3.12 Immunocytochemistry

Cells were grown on glass chamber slides up to 75% confluency in a 6-well plate.

Twenty-four hours after plating, the complete medium with 10% FBS was replaced with

10% charcoal-stripped media (csFBS). The slides were then washed with PBS (3x) and fixed in ice-cold methanol for 10 minutes at room temperature and stored at 4°C until further use. Before use, the slides were equilibrated at room temperature, washed with

PBS (5 minutes x 3), blocked with 1% BSA in PBST for 30 minutes at room temperature and incubated overnight (4°C) with protein specific antibodies (1% BSA in PBST, Table

3). The slides were then washed in PBS and incubated with the secondary antibody with fluorochrome conjugated to DyLight (Table 3) in 1% BSA for 1 hour at room temperature in dark. The slides were subsequently washed again and stained in DAPI (1

µg/ml) for 1 minute and mounted with glycerol. Images were acquired by Zeiss fluorescence microscope through Axiovision software.

3.13 Co-Immunoprecipitation (Co-IP) Analysis

L+ns and L(-)ID4 cells were serum-starved for 24 hours, prior to treatment with

R1881 (10 nM) for additional 24 hours Next, co-immunoprecipitation (Co-IP) analysis was performed using protein A coupled to magnetic beads (Protein A Mag beads,

GenScript) as per manufacturer’s instructions. Briefly, protein specific IgG (anti-AR and

FOXO1) was first immobilized to Protein A Mag Beads by incubating overnight at 4°C.

To minimize the co-elution of IgG following immunoprecipitation, the immobilized IgG on protein A Mag beads was cross-linked in the presence of 20 mM dimethyl pimelimidate dihydrochloride (DMP) in 0.2 M triethanolamine, pH 8.2, washed twice in

Tris buffer (50 mM Tris pH 7.5) and 1x PBS followed by final re-suspension and storage in 1x PBS. The cross-linked protein specific IgG-protein A-Mag beads were incubated overnight (4°C) with freshly extracted total cellular proteins (500 µg/ml). The complex was then eluted with 0.1 M Glycine (pH 2-3) after appropriate washing with 1x PBS and neutralized by adding 10 μl of neutralization buffer (1 M Tris, pH 8.5) per 100 µl of elution buffer. Eluted proteins were subjected to SDS-PAGE, transferred to nitrocellulose membrane, and then immunoblotted with protein specific antibodies.

3.14 Statistical Analysis

The National Institutes of Health (NIH)ImageJ,110 was used for counting cells stained positive for respective antigens in the IHC studies.111 Quantitative real-time

(qRT-PCR) data were analyzed using the ΔΔCt method.112 Data is expressed as mean ±

SD from three different experiments. Within groups, statistical analyses were performed by Student’s t-test. P ˂ 0.05 was considered to be statistically significant.

CHAPTER IV RESULTS

4. Id4 Knockout Mice Analysis of Prostate

Previous studies on Id4 knockout mice (Sharma et al) prostate have shown attenuation of prostate development.31 Levels of androgen receptor were similar between wild type and Id4-/- prostate. Decreased NKX3.1 expression was in part due to decreased androgen receptor binding on NKX3.1 promoter in Id4-/- mice. The increase in the expression of Myc, Sox9, Id1, Ki67 was noted up to the age of 6 weeks. In this study, H&E and IHC were performed up to 6 months’ age prostate tissue.

4.1 H&E Staining

H&E staining of Id4 -/- mice prostate has less differentiation and fewer tubules formation compared to wild type prostate. At the age of 3 months and 6 months, Id4 -/- prostate shows initial tufting, micropapillary, and cribriform appearance suggesting PIN like lesions, without features of prostate cancer as seen in Pten +/-,105 Nkx3.1 -/- mice models,105 where they develop prostate cancer at the age of 3 months (Figure 10).

IHC staining on Id4 confirm that Id4 knockout mice prostate does not express Id4.

Figure 10. H & E Staining mice prostate at 25 days, 3months and 6 months.

4.2.1 AMACR Expression

AMACR tissue immunohistochemistry is widely used as a prostate cancer biomarker.106 The expression of AMACR has also been observed in high-grade prostatic intraepithelial neoplasia (PIN), a precursor lesion of prostate cancer. In 3 months and 6 months old Id4-/- mice prostate, AMACR is highly expressed while low expression

61 levels were observed in 25 days as compared to wild type mice prostate that do not express AMACR (Figure 11). This suggests the presence of lesions, but full blown cancer is not visible (except in some regions of hyperplasia).

Figure 11. Expression of AMACR.

4.2.2 NKX3.1, Probasin and AR Expression

AR expression is equal in both Id4-/- and wild type at the age 25days, 3 months and 6 months indicating AR has its transcriptional regulatory network intact throughout the life. AR behaves as pro-differentiation and meta-stably in normal prostate. Also, AR behaves as pro-survival, hyper-sensitive and hyper stable state in prostate cancer.

Although there is not much difference of AR expression in Id4-/- and wild type prostate,

AR driven tumor suppressor gene NKX3.1 expression is essentially undetectable in Id4-

/- mice at 6 months. NKX3.1 positive cells (nuclei and cytoplasmic) are occasionally observed at 3 months’ prostate. NKX3.1 expression is rarely observed at 25d old prostate with the exception of some staining in inter-tubular tracts (most likely background staining). These results suggested that ID4 regulates NKX3.1 and that its expression precedes NKX3.1 or ID4 loss blocks cellular differentiation pathway including expression of effectors that may be required for NKX3.1 expression (Figure

12).

There is no change in probasin, an androgen receptor driven gene specific for mice prostate (similar to PSA in human), expression in Id4-/- and wild type mouse prostate. These result suggested that ID4 has minimal or no effect on regulation of probasin expression in mouse prostate epithelial cells.

Figure 12. NKX3.1, Probasin and AR Expression.

4.2.3 Sca-1

Sca-1 is a "Stem cells antigen-1". Sca-1 is highly expressed in mouse prostate stem cells and is non-detectable in differentiated prostate epithelial cells. Sustained expression of Sca-1 in mouse prostate suggests that loss of Id4 block prostate epithelial cell differentiation. Sca-1 expression is essentially similar in wild type and ID4-/- mouse prostate at 25 days. Mouse prostate development is complete around 20 days after birth.

Sca-1 expression in wild type and ID4-/- mouse prostate is compatible with mouse prostate development. The 3 months and 6 months old wild type prostate do not express sca-1, while Id4-/- mice express sca-1, indicating ID4 has an effect on epithelial differentiation (Figure 13). This result is compatible with prostate development heat map data (Figure 8).

Figure 13. Sca-1 Expression.

4.2.4 Pten, Akt and P-Akt

Pten expression is not observed in 25 days, 3 months and 6 months Id4-/- mouse prostate. Loss of Pten faction results in accumulation of PIP3 and phosphorylation of its downstream target AKT that leads to cell proliferation. IHC data shows increased p-AKT expression in Id4-/- mouse prostate compared to wild type mouse prostate in 25 days, 3 months and 6 months. Previous study shows that Pten -/- mouse developed prostate adenocarcinoma at the age of 3 months whereas, the data from our study shows that it can develop only pin like lesions at the age 6 months. This indicates that Id4-/- has the potential to initiate prostate cancer without developing in to adenocarcinoma, that may be due to under development of prostate gland in Id4-/- mice ( Figure 14).

Figure 14. Expression of Akt, P-Akt and Pten in wild type and Id4-/- prostate gland in 25 days, 3 months and 6 months old.

Knockout mice studies suggest that loss of Id4 has the effect on prostate luminal epithelial differentiation by maintaining stemness and initiate lesions and has the potential to develop prostate carcinoma. Based on this strong evidence, the effect of ID4 on prostate cancer cells will be investigated to test my hypothesis and specifics aims.

4.3 Colony Formation

There is overwhelming evidence supporting the concept that only a specific group of cells, among the cellular heterogeneity of a tumor, possesses self-renewal and multilineage differentiation potential and is, therefore, responsible for tumor development. These cells, so called "tumor initiating cells" (TICs) or "cancer stem cells"

(CSCs), have been documented in most circulating and solid tumors as well as in numerous established cancer cell lines

Charlotte and coworkers studied the colony formation of prostate cancer cells lines, and based on the morphological appearance they were named as holoclone, meroclone, and paraclones.47 LNCaP, LNCaP (-) ID4, DU145 and DU145 (+) ID4 cells form all three kinds of colony in-vitro. Holoclone has denser cell aggregation, less aggregation on meroclone and very loose or discrete in paraclones (Figure 15 a).

Holoclone diameter is about 1 mm and it has about 1500 cells whereas microcline has about 750 cells and paraclone has about 250 cells in one colony. Prostatosphere formation on LNCaP and LNCaP (-) ID4 cells on matrigel demonstrate similar appearance of holoclone formed in normal media in the petri dish (Figure 15 b). Also

LNCaP (-) ID4 cells developed more prostatosphere compared to LNCaP cells. These

67 results suggest that cells that form holoclone and prostatosphere have similar stem cell properties.

Figure 15. a) Microscopic appearance of Holoclone , Meroclone and Paraclones in LNCaP, LNCaP(-) ID4, DU145 and DU145(+) ID4 cells. b) Microscopic appearance of Prostatosphere in matrigel on LNCaP and LNCaP(-) iD4 cells. c) Prostatosphere count frequency on LNCaP and LNCaP (-) ID4 cells.

4.4 Anchorage Dependent Growth

Using LNCaP, LNCaP (-) ID4, DU145 and DU145 (+I) D4 cellular models, 200 individual cells were plated in 60 mm petri dish to facilitate the colony formation. After 2 weeks of inoculation, colonies were counted based on their morphology: holoclone, meraclone, and paraclone. From each colony, re-culturing was performed for several generations and the subsequent colony were counts were recorded. In the first round of cloning, 80 holoclones, 32 meroclones and 27 paraclones were developed from 200

LNCaP cells (Figure 16 a). It developed 24 holoclones, 47 meroclones and 38 paraclones from holoclones. 21 holoclones, 67 meroclones and 31 paraclones were developed from meroclones whereas 3 holoclones, 34 meroclones and 47 paraclones were developed from paraclones in 2nd cloning. During 3rd cloning, it developed 18 holoclones, 63 meroclones and 36 paraclones . 14 holoclones, 61 meroclones and 62 paraclones were developed from meroclones whereas 2 holoclones, 34 meroclones and 63 paraclones were developed from paraclones. Similarly, LNCap (-) ID4 cells results demonstrate a significant increase in the ability of LNCaP (-) ID4 cells to form holoclones, further implicating an increased stemness in the LNCaP (-) ID4 generated holoclones. Further in

DU145 cells shows a similar pattern of holoclone formation in relation to ID4 expression

(Figure 16 b).

Figure 16. d) Colony count frequencies of LNCaP and LNCaP (-) ID4 cells in colony formation assay. e) Colony count frequencies of DU145 and DU145 (+) ID4 cells in colony formation assay.

4.5 Characterization of Stem Cell Phenotype of Cancer Cells

In order to investigate the expression patterns of CD44 and CD133 surface markers and stemness maintaining transcription factors SOX2 and NANOG, ICC was performed on LNCaP, LNCaP(-)ID4, DU145, DU145(+)ID4, PC3, and PC3(+)ID4 cells.

PC3 cells are human prostate cancer cells, and they do not express ID4 due to promoter methylation. PC3 (+) ID4 cells stably express ID4.15

LNCaP (-)ID4 holoclones demonstrate increased expression of CD44 and CD133 as compared to the LNCaP holoclones (Figure 17a). This indicates that LNCaP (-) ID4 holoclone has more stemness. LNCaP (-)ID4 meroclones express less CD44 and CD133 compared to LNCaP cells, although both meroclones express less stem cells markers compare to holoclones. Both LNCaP and LNCaP (-) ID4 paraclones do not express stem cells markers. This result indicates that paraclones do not have stemness (Figure 17 a).

LNCaP (-) ID4 cells demonstrate more stemness. This is further confirmed by ICC results on stemness maintaining transcription factors, SOX2 and NANOG (Figure 17 b).

Western blot results on CD44 and CD133 in LNCaP and LNCaP (-) ID4 cells demonstrate LNCaP (-) ID4 has more stemness. Also LNCaP (-) ID4 cells express more stemness maintaining transcription factors SOX2 and NANOG (Figure 17c).

DU145 holoclones demonstrate significantly higher expression levels of cell- specific surface markers (CD44 and CD133) as compared to the paraclones (Figure 18 a).

Also DU145 cells express more SOX2 and NANOG compared to DU145 (+) ID4 cells

(Figure 18 b). Western blot results on CD44 and CD133 in DU145 and DU145 (+) ID4 cells demonstrate DU145 has more stemness. Also DU145 cells express more stemness maintaining transcription factor SOX2 and NANOG (Figure 18c). Above results indicates loss of ID4 can maintain prostate cancer stemness.

71 a

b c

Figure 17. a) ICC analysis of LNCaP and LNCaP (-) ID4 Holoclone, Meroclone, Paraclone expression of CD133 and CD44. b) ICC analysis of LNCaP and LNCaP (-) ID4 expression of SOX2 and NANOG. c) Westernblot of CD133, CD44, and NANOG in LNCaP and LNCaP(-)ID4 cell line.

Du145 Cells with their Holoclones and Paraclones

b c

Figure 18. a) ICC analysis of DU145 and DU145(+)ID4 Holoclone, and Paraclone expression of CD133 and CD44. b) ICC analysis of DU145 and DU145(+)ID4 expression of SOX2 and NANOG. c) Westernblot of CD133, CD44, SOX2 and NANOG in DU145 and DU145(+)ID4 cell line.

Figure 19. a) ICC Analysis of PC3 and PC3(+)ID4 Holoclone, and Meroclone expression of CD133 and CD44.

PC3 holoclone cells which are not express ID4 have more stem cell marker expression than PC3 (+) ID4 holoclones. Also, PC3 meraclone has less expression of

CD44 and CD133, whereas PC3+ID4 do not express these stem cell markers. Above result further implicate that holoclones which do not express ID4 has more stemness compare to holoclones which express ID4.

4.6 FACS Analysis for Stem Cells

Based on cancer stem cell surface marker CD133, cells were sorted out using

FACS. FACS analysis data indicate that LNCaP (-) ID4 cells have more stem cells that is

1.6% of the total cell population. This amount is fourfold higher than documented prostate stem cell population (0.1%) and in LNCaP cells (0.6%).

Figure 20. FACS Analysis Based on CD133 Surface Marker.

Sorted cells using FACS, showed that both LNCaP and LNCaP(-)ID4 cells express CD133 equally. Lower CD133 (+) LNCaP cells express ID4 (Figure 21), but sorted out LNCaP cells, which are believed to be cancer stem cells, do not express ID4.

Above results indicate that cancer stem cells do not express ID4.

Figure 21. ICC of FACS Sorted Cell with CD133 and ID4.

4.7 In vivo Tumor Formation

10,000 LNCaP cells sorted out based on CD133 surface marker from FACS, were inoculated on left side flank on 3 SCID mice and 10,000 LNCaP cells from CD133 negative were inoculated on the left side flank of another set of 3 SCID mice. CD133 positive cells xenograft developed tumor in 2 out of three mice within 43 days and

CD133 negative xenograft never developed a tumor. Fisher’s test on the tumor incidence indicated that it has p value of 0.01 with 90% confidence interval.

Figure 22. A) Left 3 mice xenograft with CD133 positive LNCaP cells and right 2 mice xenograft with CD133 negative LNCaP cells. B) Tumors of CD133 positive xenograft.

4.8 IHC on Xenograft

IHC analysis of CD133 positive LNCaP xenograft does not show ID4 expression, although they are LNCaP cells. Figure 23 A is H&E staining of LNCaP xenograft tumor.

Xenograft tissue does not express ID4 on IHC results (Figure 23 B). Figure 23 C and D show CD133 and CD44 expression of xenograft. Figure 23 G demonstrate SOX2

78 expression on xenograft. These results indicate that CD133 positive LNCaP cells readily forms tumors and still behave as stem cells in the xenografts.

Figure 23. A- H&E staining of LNCaP stemcell xenograft, B,C, D, E, F,G - IHC on xenograft tumor ID4, CD133,CD44, FOXO1, PRMT1 and SOX2 respectively.

4.9 Microarray Data on PRMT1, FOXO1and SOX2 Histology a

c 80

Figure 24. a) Microarray data on PRMT1, and SOX2 b) FOXO1 histology. c) Relative expression of PRMT1, FOXO1 and SOX2 in LNCaP and DU145 cell lines.

Tissue microarray IHC was performed on prostate cancer microarray slide T195b c147 on PRMT1, SOX2, and FOXO1. In normal prostate tissue PRMT1 and FOXO1 are expressed in physiological level. Increased expression of PRMT1 can be seen in prostate cancer which further increases with advancement of the cancer from stage 1 to stage 4

(Figure 24 a). FOXO1 expression also increased in prostate cancer with nuclear localization (Figure 23 b). SOX2 expression is very minimal in normal prostate and its expression is increased in advanced prostate cancer (Figure 23 a). Q-PCR result on

LNCaP, which express ID4, and DU145, which does not express ID4, cell lines demonstrate a similar result of the tissue microarray data: relative PRMT1 expression is higher in DU145 cells compared to LNCaP cells. FOXO1 expression is similar in both

DU145 and LNCaP cells. SOX2 is higher in DU145 cells compared to LNCaP cells

(Figure 23 c). FOXO1 activity is changed based on its nuclear or cytoplasmic localization. Similar expression of FOXO1 in LNCaP and DU145 cells might have different cellular localization.

4.10 Molecular Mechanism Pathway

Based on ID4, FOXO1, PRMT1 and AR expression and function in cancer stem cells in in our studies, I suggest a molecular mechanism model that maintains cancer stem cells (Figure 25). It is proposed that FOXO1 may play a major role in developing cancer and progression, while maintaining stemness. Although FOXO1 expression levels are not altered, its phosphorylation and methylation play a major role in the occurrence of prostate cancer and maintaining cancer stemness. PRMT1 expression keeps FOXO1 methylated and retains its action in the nucleus.19 Our data demonstrate that PRMT1 is expressed at higher levels in prostate cancer with lower expression of ID4. PRMT1 methylates proline on histones in chromatin. Here we hypothesized that PRMT1 methylates histone on ID4 gene promoter regulating histone and prevents its transcription resulting in reciprocal expression of ID4 and PRMT1. It is well known that ID4 acts as tumor suppressor. Our results suggest that in physiological conditions FOXO1 interacts with ID4 and regulate AR transcription as a complex. However, in cancer, either FOXO1

/ID4 complex is detached or not formed due to lack of ID4 on AR and allowing AR to behave as a tumor promoter. On the other hand, once FOXO1 gets methylated, FOXO1 can act itself acts as a transcription factor that can maintain cancer stemness.

Although many in vitro studies have been performed on ID4 molecule and its role in prostate cancer, no acceptable molecular mechanism has emerged to address the initiation of prostate cancer and progression to castrate resistant prostate cancer.

Therefore, it is important to have an ideal mouse model with prostate specific ID4 knockout, which mimic the real cancer occurrence sequence in human prostate cancer

Figure 25. As ID4 play major role in maintaining normal cellular faction with other co regulation proteins, once it expression is absence or less due to histone methylation prostate cancer initiate and lack of ID4 also do not complex with FOXO1 and initiate its action on stemness maintaining transcription factors.

Based on above molecular mechanisms, to identify the FOXO1, AR and ID4 interactions, an immunoprecipitation (IP) study was performed on LNCaP and LNCaP(-

)ID4 cell lines. IP on AR and western blotting on FOXO1 clearly demonstrate that there is an interaction between AR and FOXO1 in LNCaP cell line (Figure26 A). Also, IP on

FOXO1 and western blotting on AR demonstrate the similar results indicating that ID4 is important to make a complex between AR, and FOXO1.

Nuclear Cytoplasmic extraction and western blot analysis of LNCaP and LNcaP(-

)ID4 on FOXO1 show more nuclear expression in LNCaP(-)ID4 cell lines, which is compatible with our hypothesis. When both cell lines were treated with PRMT1 inhibitors, FOXO1 expression increased in cytoplasmic fraction indicating there is

83 cytoplasmic export which can be explained by our hypothesis (Figure 26 B). Also,

FOXO1 in cytoplasm indicates that there is increased phosphorylation and cytoplasmic export with PRMT1 inhibitors. Figure 26 C indicates relative FOXO1 expression in

LNCaP and DU145 cells. Their relative expression is similar, but their FOXO1 localization in nucleus and cytoplasm is different.

In DU145 cells ID4 is not expressed because of epigenetic promotor suppression

(Histone or DNA methylation or acetylation). DU145 cells were treated with PRMT1 and

EZH2 inhibitors. Enhancer of zeste homolog 2 (EZH2) is a histone-lysine N- methyltransferase enzyme encoded by EZH2 gene, that participates in histone methylation and, ultimately, transcriptional repression. Nuclear cytoplasmic extraction and western blot showed emergence of ID4 expression following PRMT1 inhibitor- treated DU145 cells. Although ID4 was also re-expressed with EZH2 inhibitor, this expression was comparatively lower than PRMT1 inhibitor (Figure27 A)

Figure 26. A) IP of AR and FOXO1 with western blot of FOXO1 and AR respectively. B) FOXO1 expression in LNCaP and LNCaP-ID4 cell with PRMT1 inhibitors. C) Q-PCR relative expression of FOXO1 in LNCaP and DU145 cell lines.

Figure 27. A) Nuclear and Cytoplasmic Expression of ID4, and FOXO1 in DU145 cell with PRMT1 inhibitors and EZH2 inhibitors. B and C) PCR results of ID4 expression on DU145 cell with PRMT1 and EZH2 treatments.

CHAPTER V DISCUSSION

Loss of ID4 Promotes Prostate Cancer Stemness

The aim of this study was to test the hypothesis that knockdown of ID4 promotes prostate cancer stemness with a gene signature that resembles stem cells. The specific aims investigated whether ID4 selectively regulates the colony and sphere formation ability in prostate cancer cells. Furthermore, we sought to investigate ID4 dependent molecular mechanisms involved in the regulation of prostate cancer stemness.

John Dick and co-workers showed that leukemic stem cells which are CD43+ and CD38-, can be transplanted to SCID mice in linear passages and develop leukemia.

Also, they have shown that these cells have the colony formation ability.107 In 2003 Ul

Hajj and co-workers did a similar experiment on solid tumor (Breast) to demonstrate the existence of cancer stem cells.108 Also, a cancer stem cell study on DU145 cells have showed that just 10,000 cancers stem cell are enough for the development of prostate cancer in xenograft within 40 days.47 Prostate cancer stem cells were first identified by Collins et al. (2005). Their studies showed that CD44+α2β1hiCD133+ cells isolated from prostate cancer patients have a high potential for self-renewal and proliferation; these cells were also able to differentiate to heterogeneous cancer cells in ex vivo culture (Collins et al., 2005). Since CSCs are conceptually considered to share similar self-renewal maintenance signals with normal stem cells, researchers intended

86 to adapt knowledge from normal stem cell studies to explain CSC regulation mechanisms, so they believed that tumors contained a hierarchy of cells headed by cancer stem cells which can self-renew and differentiate to different stages cell types in cancer (heterogeneity).109

The origin of CSCs is still controversial. Experimental evidence shows CSCs could originate from normal stem cells because CSCs share similar cell surface markers with normal stem cells. For example, in prostate, epithelial stem cells located in the basal layer of prostate gland have cell surface markers such as CD44, α2β1, and

CD133.109 Surprisingly, the CD44+α2β1hiCD133+ prostate cancer cells have been shown to be PCSCs.109It seems that during carcinogenesis, normal prostate stem cells gain mutations in oncogenes and tumor suppressor genes that drive them to become

PCSCs which is shown in our microarray data in figure 8.

Prostatosphere and colony formation are classic microscopic morphological features to identify stem cells and cancer stem cells. In this study, loss of ID4 demonstrates formation of more regenerative colonies (holoclones) and prostatosphere.

Regenerative colonies (holoclones) have the ability to develop colonies for many generations, and this result further confirms its stemness. Characterization of regenerative colonies (holoclones) demonstrates expression of CD133 and CD44 surface markers that are recognized surface marker for stem cells. Different cell specific activity such as ATP-binding cassette transport protein, analysis of ALDH activity has been used to sort out cancer stem using FACS. In our study, we used

CD133 surface marker to sort out 1.6% of total population of LNCaP (-) ID4 cells.

Also 0.6% of stem cells from LNCaP do not express ID4.

According to literature, 0.1% cell in a prostate cancer cell population maintains prostate cancer stemness at any given time. These stem cells are resistant to chemotherapy and are considered castration resistant.24 This may explain the recurrence of prostate cancer after treatment with castration, antiandrogen, chemotherapy or radiotherapy.110 Based on our results, it is evident that loss of ID4 can maintain the prostate cancer stemness.

In stem cell maintaining pathway different transcription regulatory mechanism will activate to keep their stemness and sometime they reprogram or transactivate stem cell regulatory pathways. OCT4, NANOG, and SOX2 transcription factors play major role in maintaining stemness.27 SOX2 heterodimerize with OCT4 and regulate several genes demonstrating autologous feedback and control reciprocal transcription in a regulatory circuit.111 Apart from above transcription factors, many other factors

(proteins) like sall4, Dax1, Tbx3 also play a role in maintaining stemness,112 via protein-protein interaction. Many of the genes are targets of NANOG and OCT4, indicating that the transcription network might have a feedback mechanism. Although above genes are responsible to maintain stemness, FOXO1 play a major role by methylating its arginine to activate itself as transcription factor for SOX2.

Tissue microarray data suggests that ID4 is not expressed in prostate cancer and that may be due to promoter hyper methylation or histone methylation.21 Different

88 studies suggested that in breast and prostate cancers, PRMTs play a major role to methylate histone in promotor region and regulate cancer promoting and suppressing genes like ID4 and FOXO1.94, 113 PRMT1 which is expressed 90% of all cells has the ability to asymmetrically demethylate Histone 4 Arginine 3 (H4R3) in promotor region of genes and increase hydrophobicity that prevents transcription. According to our results, PRMT1 methylates H4R3 in ID4 promotor and prevents its tumor suppressor activity. Also PRMT1 methylates FOXO1 and prevents it from getting phosphorylated and subsequent cytoplasmic export.114 DU145 cells, which do not express ID4 due to epigenetic regulation, express ID4 with PRMT1 inhibition indicating that PRMT1 has an effect on ID4 promoter by methylation on its proline. We have to confirm this by further investigations on chromatin histone methylation on ID4 promoter.

Prostate Development and Initiation of Prostate Cancer

Different knockout mouse models have been studied to investigate the prostate development, cancer initiation and progression. There are few developmental details on

Nkx3.1 and Pten knockout mouse models to have insight on prostate development and initiation of prostate cancer.

Id4 knockout mice model study supports a role for Id4 as a key regulator of male genital tract development. Although we focused on the prostate, the size and development of accessory sex glands (seminal vesicles) and testis are also severely impaired.31 Id4 may not be required to maintain fertility, but it could cooperate with other possibly overlapping regulatory genes to support normal development of various

89 organs within the genital tract. Genital tract development in general and prostate in particular are androgen dependent. Prostate fetal development and structural and functional maturation at puberty are strictly androgen regulated.31

Id4-/- mice display reduced ductal branching morphogenesis, epithelial hyperplasia, and dysplasia. According to previous study Nkx3.1 also regulate the prostate development and normal differentiation of the prostate epithelium with 40% less branching morphology observed in Id4-/-. Although Id4-/- shows attenuation of prostate development, Nkx3.1 -/- does not show any prostate size reduction.115

Nevertheless, loss of Nkx3.1, a marker of epithelial differentiation and androgen response is a significant observation that further supports the attenuation of androgen regulatory network post androgen receptor expression in the Id4-/- prostates. Nkx3.1 also regulates the rate at which proliferating luminal epithelial cells exit the cell cycle, and its loss extends the transient proliferative phase of luminal cells which is consistent with increased expression of ki67in Id4-/- prostate.

Observed in Id4-/- mice could also promote Myc dependent transactivation of pro-tumorigenic target genes. Mice expressing Myc in the prostate also develop PIN like lesions followed by invasive adenocarcinoma.116 Myc has an effect on activation of micRNA21 which has transcription interference for many proteins. MicRNA21 also has interference effect on Pten will initiate prostate carcinoma, which has been shown by

Pten-/- mice models.

Alpha-methylacyl-CoA racemase (AMACR) is strongly expressed in prostate cancer with variable expression in high-grade prostatic intraepithelial neoplasia (HGPIN) and low expression in normal prostate. In Id4-/-, high AMACR expression indicate that the presence of pre-PIN lesions, a significant observation. Why these cells do not demonstrate extensive PIN lesions remains to be investigated. We believe that with progressive age we may observe increased PIN lesions with significant penetration.

Although Id4-/- mice do not develop full-blown prostate carcinoma like in Pten -

/- mice, its alteration of tumor promoting genes suggest that it has the potential to generate prostate carcinoma. Sca-1 indicates there is a defect in epithelial differentiation into tubule by retaining their stemness. The defect in differentiation below a certain developmental threshold might not allow prostate to have full blown carcinoma.

CHAPTER VI

CONCLUSION

The Id4-/- knockout presents a complex prostate phenotype. Loss of Id4 results in altered prostate development but also leads to or promotes some PIN like lesions with maintaining its stem cells, that are supported both by morphological and specific marker studies.

In vivo studies on different prostate cancer cell lines, with stable ID4 knockdown demonstrated that loss of Id4 can selectively increase the colony and sphere formation ability in prostate cancer with expression of cell specific surface markers that are widely expressed in prostate cancer stem cells.

As ID4 is epigenetically silenced in prostate cancer, our result may explain that

PRMT1 high expression involved in histone methylation to prevent expression of ID4.

Also FOXO1, which is a transcription factor to regulate stemness maintain transcription and

92 co-chaperon to make complex with AR to regulate normal metabolism of the cellular level, is altered with arginine methylation by PRM1, and can changes its compartmentation and involvement in the maintaining of prostate cancer stemness.

Treatment with PRMT1 inhibitors on ID4 non expressing cells regains ID4 expression with suppression of stemness maintaining transcription factors like SOX2. This ID4 and its relationship with PRMT in maintaining cancer stem cells will be promising steps to work out to developing a new treatment pathway to prevent prostate cancer recurrence.

REFERENCES

1. Jones, S. An overview of the Basic Helix-Loop-Helix proteins. Genome biology. 2004, 5(6), 226.

2. Coppe, J. P.; Smith, A. P.; Desprez, P. Y. Id Proteins in Epithelial cells. Exp Cell Res. 2003, 285 (1), 131-45.

3. Asirvatham, A. J.; Schmidt, M. A.; & Chaudhary, J. Non‐redundant Inhibitor of Differentiation (Id) Gene Expression and function in Human Prostate Epithelial cells. The Prostate. 2006, 66(9), 921-935.

4. Sikder, H. A.; Devlin, M. K.; Dunlap, S.; Ryu, B.; Alani, R. M. Id Proteins in cell growth and Tumorigenesis. Cancer Cell. 2003, 3 (6), 525-30.

5. Carey, J. P.; Asirvatham, A. J.; Galm, O.; Ghogomu, T. A.; & Chaudhary, J. Inhibitor of Differentiation 4 (Id4) is a Potential Tumor Suppressor in Prostate Cancer. BMC cancer. 2009, 9(1), 173.

6. Yang, H. Y.; Liu, H. L..; Liu, G. Y.; Zhu, H.; Meng, Q. W.; Qu, L. D.; ... & Jiang, H. C. Expression and Prognostic values of Id-1 and Id-3 in Gastric Adenocarcinoma. Journal of Surgical Research. 2011, 167(2), 258-266.

7. Norton, J. D. ID helix-loop-helix proteins in Cell Growth, Differentiation and Tumorigenesis. Journal of cell science. 2000, 113(22), 3897-3905.

8. Yu, L.; Liu, C.; Vandeusen, J.; Becknell, B.; Dai, Z.; Wu, Y. Z.; ... & Liu, S. Global assessment of Promoter Methylation in a mouse model of cancer identifies ID4 as a putative tumor-suppressor Gene in Human Leukemia. Nature genetics. 2005, 37(3), 265.

9. Liu, F.; & Xu, R. R. Study on the correlation between Chinese Medical Syndrome Types and ID4 gene promoter methylation in human acute myeloid leukemia. Chinese journal of integrated traditional and Western medicine. 2012, 32(4), 471- 473.

10. Chen, S. S.; Claus, R.; Lucas, D. M.; Yu, L., Qian, J.; Ruppert, A. S.; ... & Plass, C. Silencing of the Inhibitor of DNA Binding Protein 4 (ID4) contributes to the Pathogenesis of Mouse and Human CLL. Blood. 2011, 117(3), 862-871.

11. Hu, H. B.; & Hu, Q. ID4 Methylation patterns in childhood T line and B line Lymphocytic Leukemia. Chinese journal of contemporary pediatrics. 2010, 12(12), 940-942.

12. Martini, M., Cenci, T.; D'alessandris, G. Q.; Cesarini, V.; Cocomazzi, A.; Ricci‐ Vitiani, L.; ... & Larocca, L. M. Epigenetic Silencing of Id4 Identifies a Glioblastoma subgroup with a better Prognosis as a Consequence of an Inhibition of Angiogenesis. Cancer. 2013, 119(5), 1004-1012.

13. Chan, A. S. W.; Tsui, W. Y.; Chen, X.; Chu, K. M.; Chan, T. L.; Chan, A. S. Y.; ... & Leung, S. Y. Downregulation of ID4 by Promoter Hypermethylation in Gastric Adenocarcinoma. Oncogene. 2003, 22(44), 6946.

14. Vincent, A.; Omura, N.; Hong, S. M.; Jaffe, A.; Eshleman, J. R.; & Goggins, M. Genome-wide analysis of Promoter Methylation Associated with Gene Expression profiles of Pancreatic Adenocarcinomas. Clinical cancer research. 2011, 17(13), 4351-54.

15. Chinaranagari, S.; Sharma, P.; Chaudhary, J. EZH2 Dependent H3K27me3 is involved in Epigenetic Silencing of ID4 in Prostate Cancer. Oncotarget. 2014, 5 (16), 7172-82.

16. Carvalho, B.; Sillars-Hardebol, A. H.; Postma, C.; Mongera, S.; Terhaar Sive Droste, J.; Obulkasim, A.; van de Wiel, M.; van Criekinge, W.; Ylstra, B.; Fijneman, R. J.; Meijer, G. A. Colorectal Adenoma to Carcinoma Progression is Accompanied by changes in Gene Expression associated with Ageing, Chromosomal instability, and Fatty acid Metabolism. Cell Oncol. 2012, 35 (1), 53-63. 17. Hagiwara, K.; Nagai, H.; Li, Y.; Ohashi, H.; Hotta, T.; Saito, H. Frequent DNA Methylation but not mutation of the ID4 gene in Malignant Lymphoma. J Clin Exp Hematop. 2007, 47 (1), 15-8.

18. Uhm, K. O.; Lee, E. S.; Lee, Y. M.; Kim, H. S.; Park, Y. N.; Park, S. H. Aberrant Promoter CpG islands Methylation of tumor suppressor Genes in Cholangiocarcinoma. Oncol Res. 2008, 17 (4), 151-7.

19. Smith, E.; De Young, N. J.; Pavey, S. J.; Hayward, N. K.; Nancarrow, D. J.; Whiteman, D. C.; Smithers, B. M.; Ruszkiewicz, A. R.; Clouston, A. D.; Gotley, D. C.; Devitt, P. G.; Jamieson, G. G.; Drew, P. A. Similarity of aberrant DNA Methylation in Barrett's Esophagus and Esophageal Adenocarcinoma. Mol Cancer. 2008, 7, 75.

20. Castro, M.; Grau, L.; Puerta, P.; Gimenez, L.; Venditti, J.; Quadrelli, S.; Sanchez- Carbayo, M. Multiplexed Methylation profiles of Tumor suppressor Genes and clinical outcome in Lung Cancer. J Transl Med. 2010, 8, 86.

21. Sharma, P.; Chinaranagari, S.; Patel, D.; Carey, J.; Chaudhary, J. Epigenetic Inactivation of Inhibitor of Differentiation 4 (Id4) correlates with Prostate Cancer. Cancer Med. 2012, 1(2), 176-86.

22. Yun, K.; Mantani, A.; Garel, S.; Rubenstein, J.; Israel, M. A. Id4 regulates Neural Progenitor Proliferation and Differentiation in vivo. Development. 2004, 131(21), 5441-8.

23. Dong, J.; Huang, S.; Caikovski, M.; Ji, S.; McGrath, A.; Custorio, M. G.; Creighton, C. J.; Maliakkal, P.; Bogoslovskaia, E.; Du, Z.; Zhang, X.; Lewis, M. T.; Sablitzky, F.; Brisken, C.; Li, Y. ID4 regulates Mammary Gland Development by suppressing p38MAPK activity. Development. 2011, 138 (23), 5247-56.

24. Yun, E. J.; Zhou, J.; Lin, C. J.; Hernandez, E.; Fazli, L.; Gleave, M.; Hsieh, J. T. Targeting Cancer Stem Cells in Castration-Resistant Prostate Cancer. Clin Cancer Res. 2016, 22 (3), 670-9.

25. Li, L.; Chen, Z.; Zhang, L.; Liu, G.; Hua, J.; Jia, L.; Liao, M. Genome-wide targets Identification of "core" Pluripotency Transcription Factors with integrated features in Human embryonic Stem Cells. Mol Biosyst. 2016, 12 (4), 1324-32.

26. Wang, Z. X.; Teh, C. H.; Kueh, J. L.; Lufkin, T.; Robson, P.; Stanton, L. W. Oct4 and Sox2 directly regulate expression of another Pluripotency Transcription Factor, Zfp206, in Embryonic Stem Cells. J Biol Chem. 2007, 282(17), 12822-30.

27. Liu, A.; Yu, X.; Liu, S. Pluripotency Transcription Factors and Cancer Stem Cells: small genes make a big difference. Chin J Cancer. 2013, 32 (9), 483-7.

28. Gao, Y.; Zhao, Y.; Zhang, J.; Lu, Y.; Liu, X.; Geng, P.; Huang, B.; Zhang, Y.; Lu, J. The dual function of PRMT1 in modulating Epithelial-Mesenchymal Transition and cellular senescence in Breast Cancer cells through regulation of ZEB1. Sci Rep. 2016, 6, 19874.

29. Vakoc, C. R.; Sachdeva, M. M.; Wang, H.; Blobel, G. A. Profile of Histone Lysine Methylation across transcribed Mammalian Chromatin. Mol Cell Biol. 2006, 26 (24), 9185-95.

30. Patel, D.; Knowell, A. E.; Korang-Yeboah, M.; Sharma, P.; Joshi, J.; Glymph, S.; Chinaranagari, S.; Nagappan, P.; Palaniappan, R.; Bowen, N. J.; Chaudhary, J. Inhibitor of Differentiation 4 (ID4) Inactivation Promotes de novo steroidogenesis and Castration-Resistant Prostate Cancer. Mol Endocrinol. 2014, 28 (8), 1239-53.

31. Ittmann, M. Anatomy and Histology of the Human and Murine Prostate. Cold Spring Harb Perspect Med. 2017.

32. Malvezzi, M.; Bertuccio, P.; Levi, F.; La Vecchia, C.; Negri, E. European Cancer Mortality Predictions for the year 2014. Ann Oncol. 2014, 25 (8), 1650-6.

33. Kilpelainen, T. P.; Pogodin-Hannolainen, D.; Kemppainen, K.; Talala, K.; Raitanen, J.; Taari, K.; Kujala, P.; Tammela, T. L. J.; Auvinen, A. Estimate of Opportunistic Prostate Specific Antigen Testing in the Finnish Randomized Study of Screening for Prostate Cancer. J Urol. 2017, 198 (1), 50-57.

34. McIntosh, H. Why do African-American men suffer more Prostate Cancer? J Natl Cancer Inst. 1997, 89 (3), 188-9.

35. Murtola, T. J.; Karppa, E. K.; Taari, K.; Talala, K.; Tammela, T. L.; Auvinen, A. 5-Alpha Reductase Inhibitor use and prostate cancer survival in the Finnish Prostate Cancer Screening Trial. Int J Cancer. 2016, 138 (12), 2820-8.

36. Bergner, E. M.; Cornish, E. K.; Horne, K.; Griffith, D. M. A qualitative Meta- synthesis examining the role of women in African American men's Prostate

Cancer Screening and treatment decision-making. Psychooncology. 2017. 27(3), 781-790.

37. Theodoratou, E.; Timofeeva, M.; Li, X.; Meng, X.; Ioannidis, J. P. A. Nature, Nurture, and Cancer Risks: Genetic and Nutritional Contributions to Cancer. Annu Rev Nutr. 2017, 37, 293-320.

38. McNeal, J. E.; Bostwick, D. G. Intraductal Dysplasia: a Premalignant lesion of the Prostate. Hum Pathol. 1986, 17 (1), 64-71.

39. Yadav, S. S.; Baghel, P.; Tomar, V.; Agarwal, N.; Dhakad, D. Prostatic Ductal Adenocarcinoma-A Rare Entity with Radiological Dilemma Demanding Endoscopic Biopsy. Urology. 2017, 108, e1-e2.

40. Latil, A.; Cussenot, O.; Fournier, G.; Driouch, K.; Lidereau, R. Loss of Heterozygosity at Chromosome 16q in Prostate Adenocarcinoma: Identification of three independent regions. Cancer Res. 1997, 57 (6), 1058-62.

41. O'Sullivan, A. G.; Eivers, S. B.; Mulvaney, E. P.; Kinsella, B. T. Regulated expression of the TPbeta isoform of the human T prostanoid receptor by the Tumour suppressors FOXP1 and NKX3.1: Implications for the role of Thromboxane in Prostate Cancer. Biochim Biophys Acta. 2017, 1863 (12), 3153- 3169.

42. Sun, H.; Lesche, R.; Li, D. M.; Liliental, J.; Zhang, H.; Gao, J.; Gavrilova, N.; Mueller, B.; Liu, X.; Wu, H. PTEN modulates Cell Cycle Progression and Cell survival by regulating Phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A. 1999, 96 (11), 6199-204. 43. Vaishampayan, U.; Hussain, M. Adjuvant Chemo-/Hormonal therapy trials for locally Advanced Prostate Cancer. Curr Oncol Rep. 2000, 2 (5), 402-8.

44. Buchanan, G.; Irvine, R. A.; Coetzee, G. A.; Tilley, W. D. Contribution of the Androgen Receptor to Prostate Cancer Predisposition and Progression. Cancer Metastasis Rev. 2001, 20 (3-4), 207-23.

45. Knudsen, K. E.; Penning, T. M. Partners in crime: Deregulation of AR activity and Androgen synthesis in Prostate Cancer. Trends Endocrinol Metab. 2010, 21 (5), 315-24.

46. Tan, L.; Sui, X.; Deng, H.; Ding, M. Holoclone forming cells from Pancreatic Cancer cells enrich tumor initiating cells and represent a novel model for study of Cancer Stem cells. PLoS One. 2011, 6 (8), e23383.

47. Beaver, C. M.; Ahmed, A.; Masters, J. R. Clonogenicity: Holoclones and Meroclones contain Stem Cells. PLoS One. 2014, 9 (2), e89834.

48. Littlewood, T. D.; Evan, G. I. Transcription Factors 2: Helix-Loop-Helix. Protein Profile. 1995, 2 (6), 621-702.

49. Cao, L.; Zhou, Y.; Zhai, B.; Liao, J.; Xu, W.; Zhang, R.; Li, J.; Zhang, Y.; Chen, L.; Qian, H.; Wu, M.; Yin, Z. Sphere-forming cell subpopulations with Cancer Stem Cell properties in Human Hepatoma Cell Lines. BMC Gastroenterol. 2011, 11, 71.

50. Garikipati, V. N. S.; Kishore, R. Induced Pluripotent Stem Cells Derived Extracellular Vesicles: A Potential Therapy for Cardiac Repair. Circ Res. 2018, 122 (2), 197-198.

51. Yu, J.; Vodyanik, M. A.; Smuga-Otto, K.; Antosiewicz-Bourget, J.; Frane, J. L.; Tian, S.; Nie, J.; Jonsdottir, G. A.; Ruotti, V.; Stewart, R.; Slukvin, II; Thomson, J. A. Induced Pluripotent Stem cell lines derived from Human Somatic Cells. Science. 2007, 318 (5858), 1917-20.

52. Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult Human Fibroblasts by Defined Factors. Cell. 2007, 131 (5), 861-72.

53. Enuwein, T.; Allis, C. D. Translating the Histone Code. Science. 2001, 293 (5532), 1074-80.

54. Gebauer, S.; Yu, A. L.; Omura-Minamisawa, M.; Batova, A.; Diccianni, M. B. Expression profiles and Clinical Relationships of ID2, CDKN1B, and CDKN2A in primary Neuroblastoma. Genes Chromosomes Cancer. 2004, 41 (4), 297-308.

55. Sottoriva, A.; Kang, H.; Ma, Z.; Graham, T. A.; Salomon, M. P.; Zhao, J.; Marjoram, P.; Siegmund, K.; Press, M. F.; Shibata, D.; Curtis, C. A Big Bang model of Human Colorectal Tumor Growth. Nat Genet. 2015, 47 (3), 209-16.

56. Nazari, F.; Pearson, A. T.; Nor, J. E.; Jackson, T. L. A mathematical model for IL-6-mediated, Stem cell driven Tumor Growth and Targeted Treatment. PLoS Comput Biol. 2018, 14 (1), e1005920.

57. Tudor, D.; Locke, M.; Owen-Jones, E.; Mackenzie, I. C. Intrinsic Patterns of Behavior of Epithelial Stem Cells. J Investig Dermatol Symp Proc. 2004, 9 (3), 208-14.

58. Harper, L. J.; Piper, K.; Common, J.; Fortune, F.; Mackenzie, I. C. Stem Cell patterns in cell lines derived from head and Neck Squamous Cell Carcinoma. J Oral Pathol Med. 2007, 36 (10), 594-603.

59. Heinlein, C. A.; Chang, C. Androgen Receptor in Prostate Cancer. Endocr Rev. 2004, 25 (2), 276-308.

60. Israel, M. A.; Hernandez, M. C.; Florio, M.; Andres-Barquin, P. J.; Mantani, A.; Carter, J. H.; Julin, C. M. Id Gene Expression as a key mediator of Tumor Cell Biology. Cancer Res. 1999, 59 (7 Suppl), 1726s-1730s.

61. Yokota, Y.; Mansouri, A.; Mori, S.; Sugawara, S.; Adachi, S.; Nishikawa, S.; Gruss, P. Development of Peripheral Lymphoid Organs and Natural Killer Cells depends on the Helix-Loop-Helix Inhibitor Id2. Nature. 1999, 397 (6721), 702-6. 62. Hacker, C.; Kirsch, R. D.; Ju, X. S.; Hieronymus, T.; Gust, T. C.; Kuhl, C.; Jorgas, T.; Kurz, S. M.; Rose-John, S.; Yokota, Y.; Zenke, M. Transcriptional Profiling Identifies Id2 function in Dendritic Cell Development. Nat Immunol. 2003, 4 (4), 380-6.

63. Yokota, Y. Id and Development. Oncogene. 2001, 20 (58), 8290-8.

64. Deed, R. W.; Hara, E.; Atherton, G. T.; Peters, G.; Norton, J. D. Regulation of Id3 cell cycle function by Cdk-2-Dependent Phosphorylation. Mol Cell Biol. 1997, 17 (12), 6815-21.

100

65. Parrinello, S.; Lin, C. Q.; Murata, K.; Itahana, Y.; Singh, J.; Krtolica, A.; Campisi, J.; Desprez, P. Y. Id-1, ITF-2, and Id-2 comprise a network of Helix- Loop-Helix Proteins that regulate Mammary epithelial Cell Proliferation, Differentiation, and Apoptosis. J Biol Chem. 2001, 276 (42), 39213-9.

66. Alani, R. M.; Young, A. Z.; Shifflett, C. B. Id1 Regulation of Cellular Senescence through Transcriptional repression of p16/Ink4a. Proc Natl Acad Sci U S A. 2001, 98 (14), 7812-6.

67. Kee, B. L.; Rivera, R. R.; Murre, C. Id3 inhibits B Lymphocyte Progenitor Growth and Survival in Response to TGF-beta. Nat Immunol. 2001, 2 (3), 242-7.

68. Andres-Barquin, P. J.; Hernandez, M. C.; Israel, M. A. Id4 Expression Induces Apoptosis in Astrocytic Cultures and is Down-regulated by Activation of the cAMP-dependent signal Transduction Pathway. Exp Cell Res. 1999, 247 (2), 347- 55.

69. Wilson, J. W.; Deed, R. W.; Inoue, T.; Balzi, M.; Becciolini, A.; Faraoni, P.; Potten, C. S.; Norton, J. D. Expression of Id Helix-Loop-Helix Proteins in Colorectal Adenocarcinoma Correlates with p53 Expression and Mitotic index. Cancer Res. 2001, 61 (24), 8803-10.

70. Yuen, H. F.; Chua, C. W.; Chan, Y. P.; Wong, Y. C.; Wang, X.; Chan, K. W. Id Proteins Expression in Prostate Cancer: High-Level Expression of Id-4 in Primary Prostate cancer is Associated with Development of Metastases. Mod Pathol. 2006, 19 (7), 931-41. 71. Niola, F.; Zhao, X.; Singh, D.; Castano, A.; Sullivan, R.; Lauria, M.; Nam, H. S.; Zhuang, Y.; Benezra, R.; Di Bernardo, D.; Iavarone, A.; Lasorella, A. Id Proteins Synchronize Stemness and Anchorage to the niche of Neural Stem Cells. Nat Cell Biol. 2012, 14 (5), 477-87.

72. De Candia, P.; Akram, M.; Benezra, R.; Brogi, E. Id4 messenger RNA and Estrogen Receptor Expression: Inverse Correlation in Human Normal Breast Epithelium and Carcinoma. Hum Pathol. 2006, 37 (8), 1032-41.

73. Shan, L.; Yu, M.; Qiu, C.; Snyderwine, E. G. Id4 Regulates Mammary Epithelial Cell Growth and Differentiation and is Overexpressed in Rat Mammary Gland Carcinomas. Am J Pathol. 2003, 163 (6), 2495-502.

101

74. Jeon, H. M.; Jin, X.; Lee, J. S.; Oh, S. Y.; Sohn, Y. W.; Park, H. J.; Joo, K. M.; Park, W. Y.; Nam, D. H.; DePinho, R. A.; Chin, L.; Kim, H. Inhibitor of Differentiation 4 drives Brain Tumor-initiating cell genesis through cyclin E and notch signaling. Genes Dev. 2008, 22 (15), 2028-33.

75. Guo, S. J.; Hu, J. G.; Zhao, B. M.; Shen, L.; Wang, R.; Zhou, J. S.; Lu, H. Z. Olig1 and ID4 Interactions in living cells visualized by Bimolecular Fluorescence Complementation Technique. Mol Biol Rep. 2011, 38 (7), 4637-42.

76. Cheng, X.; Wang, Y.; He, Q.; Qiu, M.; Whittemore, S. R.; Cao, Q. Bone Morphogenetic Protein Signaling and olig1/2 interact to regulate the Differentiation and Maturation of adult Oligodendrocyte Precursor Cells. Stem Cells. 2007, 25 (12), 3204-14.

77. Trausch-Azar, J. S.; Lingbeck, J.; Ciechanover, A. Schwartz, A. L., Ubiquitin- Proteasome-mediated Degradation of Id1 is modulated by MyoD. J Biol Chem. 2004, 279 (31), 32614-9.

78. Noetzel, E.; Veeck, J.; Horn, F.; Hartmann, A.; Knuchel, R.; Dahl, E. Promoter methylation of ID4. A marker for Recurrence-free Survival in Human Breast Cancer. Pathologe. 2008, 29 Suppl 2, 319-27.

79. Xie, Q.; Chen, J.; Yuan, Z. Post-translational regulation of FOXO. Acta Biochim Biophys Sin. 2012, 44 (11), 897-901. 80. Kee, Y.; Bronner-Fraser, M. Id4 Expression and its Relationship to other Id genes during avian Embryonic Development. Mech Dev. 2001, 109 (2), 341-5.

81. Bellido, M.; Aventin, A.; Lasa, A.; Estivill, C.; Carnicer, M. J.; Pons, C.; Matias- Guiu, X.; Bordes, R.; Baiget, M.; Sierra, J.; Nomdedeu, J. F. Id4 is Deregulated by a t(6;14)(p22;q32) Chromosomal Translocation in a B-cell lineage Acute Lymphoblastic Leukemia. Haematologica. 2003, 88 (9), 994-1001.

82. Bedford, L.; Walker, R.; Kondo, T.; van Cruchten, I.; King, E. R.; Sablitzky, F. Id4 is Required for the correct timing of Neural Differentiation. Dev Biol. 2005, 280 (2), 386-95.

102

83. Best, S. A.; Hutt, K. J.; Fu, N. Y.; Vaillant, F.; Liew, S. H.; Hartley, L.; Scott, C. L.; Lindeman, G. J.; Visvader, J. E. Dual roles for Id4 in the Regulation of Estrogen Signaling in the Mammary Gland and Ovary. Development. 2014, 141 (16), 3159-64.

84. Francis, J. C.; Swain, A. Prostate Organogenesis. Cold Spring Harb Perspect Med. 2017.

85. Rigolet, M.; Rich, T.; Gross-Morand, M. S.; Molina-Gomes, D.; Viegas- Pequignot, E.; Junien, C., cDNA Cloning, Tissue Distribution and Chromosomal Localization of the Human ID4 gene. DNA Res 1998, 5 (5), 309-13.

86. Tokuzawa, Y.; Yagi, K.; Yamashita, Y.; Nakachi, Y.; Nikaido, I.; Bono, H.; Ninomiya, Y.; Kanesaki-Yatsuka, Y.; Akita, M.; Motegi, H.; Wakana, S.; Noda, T.; Sablitzky, F.; Arai, S.; Kurokawa, R.; Fukuda, T.; Katagiri, T.; Schonbach, C.; Suda, T.; Mizuno, Y.; Okazaki, Y. Id4, a New Candidate Gene for Senile Osteoporosis, acts as a molecular switch promoting Osteoblast Differentiation. PLoS Genet. 2010, 6 (7), e1001019.

87. Murad, J. M.; Place, C. S.; Ran, C.; Hekmatyar, S. K.; Watson, N. P.; Kauppinen, R. A.; Israel, M. A. Inhibitor of DNA binding 4 (ID4) Regulation of Adipocyte Differentiation and Adipose Tissue Formation in mice. J Biol Chem. 2010, 285 (31), 24164-73. 88. Jung, S.; Park, R. H.; Kim, S.; Jeon, Y. J.; Ham, D. S.; Jung, M. Y.; Kim, S. S.; Lee, Y. D.; Park, C. H.; Suh-Kim, H. Id Proteins Facilitate self-renewal and Proliferation of Neural Stem Cells. Stem Cells Dev. 2010, 19 (6), 831-41.

89. Wang, Y.; Zhou, Y.; & Graves, D. T. FOXO Transcription Factors: Their Clinical Significance and Regulation. BioMed research international. 2014.

90. Hosaka, T.; Biggs, W. H., 3rd; Tieu, D.; Boyer, A. D.; Varki, N. M.; Cavenee, W. K.; Arden, K. C. Disruption of Forkhead Transcription Factor (FOXO) family members in mice reveals their Functional Diversification. Proc Natl Acad Sci U S A. 2004, 101 (9), 2975-80.

103

91. Tikhanovich, I.; Cox, J.; Weinman, S. A. Forkhead box class O transcription factors in liver function and disease. J Gastroenterol Hepatol. 2013, 28 Suppl 1, 125-31.

92. Zee, B. M.; Garcia, B. A. Discovery of Lysine Post-translational Modifications through Mass Spectrometric Detection. Essays Biochem. 2012, 52, 147-63.

93. Bedford, M. T. Arginine Methylation at a glance. J Cell Sci. 2007, 120 (Pt 24), 4243-6.

94. Yang, Y.; Bedford, M. T. Protein Arginine Methyltransferases and Cancer. Nat Rev Cancer. 2013, 13 (1), 37-50.

95. Gui, S.; Gathiaka, S.; Li, J.; Qu, J.; Acevedo, O.; Hevel, J. M. A remodeled protein arginine methyltransferase 1 (PRMT1) Generates Symmetric Dimethylarginine. J Biol Chem. 2014, 289 (13), 9320-7.

96. Patel, D.; Morton, D. J.; Carey, J.; Havrda, M. C.; Chaudhary, J. Inhibitor of differentiation 4 (ID4): From Development to Cancer. Biochim Biophys Acta. 2015, 1855 (1), 92-103.

97. Ruchusatsawat, K.; Wongpiyabovorn, J.; Protjaroen, P.; Chaipipat, M.; Shuangshoti, S.; Thorner, P. S.; Mutirangura, A. Parakeratosis in Skin is Associated with loss of Inhibitor of Differentiation 4 via Promoter Methylation. Hum Pathol. 2011, 42 (12), 1878-87.

98. Ren, Y.; Cheung, H. W.; von Maltzhan, G.; Agrawal, A.; Cowley, G. S.; Weir, B. A.; Boehm, J. S.; Tamayo, P.; Karst, A. M.; Liu, J. F.; Hirsch, M. S.; Mesirov, J. P.; Drapkin, R.; Root, D. E.; Lo, J.; Fogal, V.; Ruoslahti, E.; Hahn, W. C.; Bhatia, S. N. Targeted Tumor-penetrating siRNA Nanocomplexes for Credentialing the Ovarian Cancer Oncogene ID4. Sci Transl Med. 2012, 4 (147), 147ra112.

99. Russell, L. J.; Akasaka, T.; Majid, A.; Sugimoto, K. J.; Loraine Karran, E.; Nagel, I.; Harder, L.; Claviez, A.; Gesk, S.; Moorman, A. V.; Ross, F.; Mazzullo, H.; Strefford, J. C.; Siebert, R.; Dyer, M. J.; Harrison, C. J. t(6;14)(p22;q32): a New Recurrent IGH@ Translocation involving ID4 in B-cell precursor Acute Lymphoblastic Leukemia (BCP-ALL). Blood. 2008, 111 (1), 387-91.

104

100. Branham, M. T.; Marzese, D. M.; Laurito, S. R.; Gago, F. E.; Orozco, J. I.; Tello, O. M.; Vargas-Roig, L. M.; Roque, M. Methylation Profile of Triple-negative Breast Carcinomas. Oncogenesis. 2012, 1, e17.

101. Wu, Q.; Hoffmann, M. J.; Hartmann, F. H.; Schulz, W. A. Amplification and Overexpression of the ID4 Gene at 6p22.3 in Bladder Cancer. Mol Cancer. 2005, 4 (1), 16.

102. Sharma, P.; Knowell, A. E.; Chinaranagari, S.; Komaragiri, S.; Nagappan, P.; Patel, D.; Havrda, M. C.; Chaudhary, J. Id4 Deficiency Attenuates Prostate Development and Promotes PIN-like lesions by Regulating Androgen Receptor Activity and Expression of NKX3.1 and PTEN. Mol Cancer. 2013, 12, 67.

103. Zhou, J. D.; Zhang, T. J.; Li, X. X.; Ma, J. C.; Guo, H.; Wen, X. M.; Zhang, W.; Yang, L.; Yan, Y.; Lin, J.; Qian, J. Epigenetic dysregulation of ID4 Predicts Disease Progression and Treatment Outcome in Myeloid Malignancies. J Cell Mol Med. 2017, 21 (8), 1468-1481.

104. Tudor, D.; Chaudry, F.; Harper, L.; Mackenzie, I. C. The in vitro Behaviour and Patterns of Colony Formation of Murine Epithelial Stem Cells. Cell Prolif. 2007, 40 (5), 706-20. 105. Locke, M.; Heywood, M.; Fawell, S.; Mackenzie, I. C. Retention of Intrinsic Stem Cell Hierarchies in Carcinoma-derived Cell Lines. Cancer Res. 2005, 65 (19), 8944-50.

106. Wei, C.; Guomin, W.; Yujun, L.; Ruizhe, Q. Cancer Stem-like cells in Human Prostate Carcinoma cells DU145: the seeds of the cell line? Cancer Biol Ther. 2007, 6 (5), 763-8.

107. Pfeiffer, M. J.; Schalken, J. A. Stem Cell Characteristics in Prostate Cancer Cell Lines. Eur Urol. 2010, 57 (2), 246-54.

108. Li, H.; Chen, X.; Calhoun-Davis, T.; Claypool, K.; Tang, D. G. PC3 Human Prostate Carcinoma Cell Holoclones Contain self-renewing Tumor-initiating Cells. Cancer Res. 2008, 68 (6), 1820-5.

105

109. Beaver, C. M. The Effect of Culture Conditions on Colony Morphology and Proliferative Capacity in Human Prostate Cancer Cell lines. Cell Biol Toxicol. 2012, 28 (5), 291-301.

110. Qin, J.; Liu, X.; Laffin, B.; Chen, X.; Choy, G.; Jeter, C. R.; Calhoun-Davis, T.; Li, H.; Palapattu, G. S.; Pang, S.; Lin, K.; Huang, J.; Ivanov, I.; Li, W.; Suraneni, M. V.; Tang, D. G.The PSA(-/lo) Prostate Cancer Cell Population harbors self- renewing long-term Tumor-propagating cells that Resist Castration. Cell Stem Cell. 2012, 10 (5), 556-69.

111. Zhang, L.; Jiao, M.; Li, L.; Wu, D.; Wu, K.; Li, X.; Zhu, G.; Dang, Q.; Wang, X.; Hsieh, J. T.; He, D. Tumorspheres Derived from Prostate cancer Cells possess Chemoresistant and Cancer Stem Cell Properties. J Cancer Res Clin Oncol. 2012, 138 (4), 675-86.

112. Guzman-Ramirez, N.; Voller, M.; Wetterwald, A.; Germann, M.; Cross, N. A.; Rentsch, C. A.; Schalken, J.; Thalmann, G. N.; Cecchini, M. G. In Vitro Propagation and Characterization of Neoplastic Stem/Progenitor-like cells from Human Prostate Cancer tissue. Prostate. 2009, 69 (15), 1683-93.

113. Dick, J. E. Normal and Leukemic Human Stem Cells assayed in SCID mice. Semin Immunol. 1996, 8 (4), 197-206. 114. Al-Hajj, M.; Wicha, M. S.; Benito-Hernandez, A.; Morrison, S. J.; Clarke, M. F. Prospective Identification of Tumorigenic Breast Cancer Cells. Proc Natl Acad Sci U S A. 2003, 100 (7), 3983-8.

115. Rich, J. N. Cancer stem cells: Understanding Tumor Hierarchy and Heterogeneity. Medicine. 2016, 95 (1 Suppl 1), S2-7.

116. Li, Y. Q. Networks of Transcription Factors for Oct4 Expression in Mice. DNA Cell Biol. 2017, 36 (9), 725-736.

117. Chen, L.; Daley, G. Q. Molecular Basis of Pluripotency. Hum Mol Genet. 2008, 17 (R1), R23-7.

118. Bao, B.; Ahmad, A.; Azmi, A. S.; Ali, S.; Sarkar, F. H. Overview of Cancer Stem Cells (CSCs) and Mechanisms of their Regulation: Implications for Cancer Therapy. Curr Protoc Pharmacol. 2013, Chapter 14, Unit 14 25.

106

119. Yu, Z.; Chen, T.; Hebert, J.; Li, E.; Richard, S. A mouse PRMT1 null Allele defines an Essential role for Arginine Methylation in Genome Maintenance and Cell Proliferation. Mol Cell Biol. 2009, 29 (11), 2982-96.

120. Yamagata, K.; Daitoku, H.; Takahashi, Y.; Namiki, K.; Hisatake, K.; Kako, K.; Mukai, H.; Kasuya, Y.; Fukamizu, A. Arginine methylation of FOXO Transcription Factors Inhibits their Phosphorylation by Akt. Mol Cell. 2008, 32 (2), 221-31.

121. Bhatia-Gaur, R.; Donjacour, A. A.; Sciavolino, P. J.; Kim, M.; Desai, N.; Young, P.; Norton, C. R.; Gridley, T. Cardiff, R. D.; Cunha, G. R.; Abate-Shen, C.; Shen, M. M., Roles for Nkx3.1 in Prostate Development and Cancer. Genes Dev. 1999, 13 (8), 966-77.