Phylogeny of Rosa Sections Chinenses and Synstylae

Molecular Phylogenetics and Evolution 87 (2015) 50–64

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Phylogeny of Rosa sections Chinenses and Synstylae (Rosaceae) based on chloroplast and nuclear markers ⇑ Zhang-Ming Zhu a,b, Xin-Fen Gao a, , Marie Fougère-Danezan a,c a Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan 610041, China b University of Chinese Academy of Sciences, Beijing 100049, China c Key Laboratory of Tropical Forest Ecology, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Menglun, Mengla, Yunnan 666303, China article info abstract

Article history: Rosa sections Chinenses and Synstylae contain approximately 39 wild species mainly distributed in East Received 31 October 2014 Asia and are closely related according to previous studies. But the specific relationships within these Revised 4 March 2015 two sections were still obscure due to limited sampling, low genetic variation of molecular markers, Accepted 14 March 2015 and complex evolutionary histories. In this study, we used four chloroplast (ndhC-trnV, ndhF-rpl32, Available online 23 March 2015 ndhJ-trnF and psbJ-petA) and two nuclear (ribosomal ITS and GAPDH) markers with an extensive geo- graphic and taxonomic sampling to explore their evolutionary history. Our phylogenetic analyses sug- Keywords: gested that Rosa sections Chinenses and Synstylae defined in traditional taxonomic system are not Rosa monophyletic and close to sections Caninae and Gallicanae. Additionally, our results showed incongru- Section Chinenses Section Synstylae ence between chloroplast and nuclear markers, and the patterns of incongruence might be due to ancient Phylogeny hybridization (genetic introgression). One putative hybrid species and three samples identified as inter- Incongruence specific hybrids are further discussed in terms of topological incongruence, biological characters and dis- Hybridization tribution patterns. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction difficulties in the taxonomy of roses even since the early times (Crépin, 1889; Linnaeus, 1753). Hybridization has long been recognized as an important driving The genus Rosa comprises about 150–200 species widely dis- force in plant evolution (Abbott, 1992; Mallet, 2007; Paun et al., tributed in the temperate and subtropical regions of the northern 2009; Rieseberg, 1995, 1997), which can lead to high intraspecific hemisphere (Ku and Robertson, 2003; Yü et al., 1985). The widely genetic diversity, creation of new species or ecotypes, and reticu- adopted taxonomic system built by Rehder (1940) divided Rosa late evolution (Anderson, 1948; Linder and Rieseberg, 2004; species into four subgenera, i.e., Hesperhodos Cockerell, Hulthemia Whitham et al., 1994). As a result, it is particularly challenging to (Dumort.) Focke, Platyrhodon (Hurst) Rehder and Rosa. The first reconstruct species relationships for groups including hybrids. In three subgenera contain only one or two species, while species the genus Rosa L. (Rosaceae), interspecific hybrids are easily from the subgenus Rosa are further divided into ten sections, i.e., formed, which have contributed substantially to the diversity in Banksiae Lindl., Bracteatae Thory, Caninae (DC.) Ser., Carolinae this genus (Atienza et al., 2005; Rehder, 1940; Wissemann, Crép., Cinnamomeae (DC.) Ser., Gallicanae (DC.) Ser., Indicae Thory, 2003). Many hybridization events have been reported in wild roses Laevigatae Thory, Pimpinellifoliae (DC.) Ser., and Synstylae DC. We (Atienza et al., 2005; Joly et al., 2006; Matthews, 1920; Schanzer use R. sect. Chinenses (DC.) Ser. in this study instead of R. sect. and Kutlunina, 2010). The whole section Caninae seems to be of Indicae since the former is the oldest valid name while the latter hybrid origin (Fougère-Danezan et al., 2015; Ritz et al., 2005; is a synonym (Seringe, 1818; Thory, 1820). Because R. sect. Wissemann, 1999). Some species of Rosa sects. Rosa and Synstylae Cinnamomeae includes the type species (R. cinnamomea L.) of the were also shown to have undergone hybridization during their genus (Barrie, 2006; Jarvis, 1992), the section name Cinnamomeae evolutionary histories (Joly et al., 2006; Ohba et al., 2000). is invalid and should be replaced by the autonym (R. sect. Rosa; Indeed, hybridization has been recognized as one of the major Art. 22.1, McNeill et al., 2012). So we use R. sect. Rosa instead of R. sect. Cinnamomeae in this study. Many attempts were made to reconstruct the phylogeny of this

⇑ Corresponding author. genus, most of which suggested that the divisions of most subgen- E-mail address: [email protected] (X.-F. Gao). era and sections based on morphology were artificial (Bruneau http://dx.doi.org/10.1016/j.ympev.2015.03.014 1055-7903/Ó 2015 Elsevier Inc. All rights reserved. Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 51 et al., 2007; Koopman et al., 2008; Jan et al., 1999; Matsumoto 1986; Roberts et al., 2009; Ueda and Akimoto, 2001; Yokoya et al., et al., 1998, 2000; Millan et al., 1996; Wu et al., 2000, 2001; 2000). Thus, unlike R. sects. Caninae and Rosa (Joly et al., 2006; Ritz Wissemann and Ritz, 2005). And Rosa sects. Chinenses and et al., 2005), polyploidization does not seem to be an important Synstylae were resolved as closely related. For example, both factor in the evolution of R. sects. Chinenses and Synstylae. Matsumoto et al. (1998) and Wu et al. (2000) found that R. sect. However, hybridization seems to be at work in these two sections Chinenses was nested within R. sect. Synstylae, which is similar to as suggested by previous studies (Ohba et al., 2000; Meng et al., a recent phylogenetic study of 39 Chinese wild roses (Qiu et al., 2011) and numerous intermediate morphological characters from 2012). Both nuclear and chloroplast DNA data from Wissemann specimens and field observations. and Ritz (2005) and Bruneau et al. (2007) suggested that sections In this study, we used four chloroplast and two nuclear genetic Chinenses and Synstylae formed a clade with other sections, which markers to reconstruct the phylogeny of R. sects. Chinenses and may have been due to sparse taxon sampling, garden-grown sam- Synstylae. Our sampling covered the whole distribution area and ples that could be introgressed, and low variation in genetic mar- most wild species of these two sections. Species belonging to other kers. In an analysis of amplified fragment length polymorphism sections and subgenus were also sampled. The objectives of this (AFLP) by Koopman et al. (2008), two East Asian species (R. wichu- study are: (1) to reconstruct a more comprehensive and better-re- rana and R. multiflora Thunb.) from sect. Synstylae formed a clade, solved phylogeny of Rosa sections Chinenses and Synstylae, and (2) and two other species (R. arvensis Huds. and R. moschata Mill.) from to test the significance of species hybridization in these two sections. Europe were grouped with sections Rosa and Caninae. However, in these studies, both the sampling and the molecular markers used 2. Materials and methods were limited. Further research with more extensive taxon sampling and molecular data from both nuclear and chloroplast gen- 2.1. Taxon sampling omes is needed to solve the phylogenetic relationships within sections Chinenses and Synstylae. Samples for this study were obtained from various sources. Rosa sects. Chinenses and Synstylae are mainly distributed in Most of our samples were collected in the field and the voucher East Asia. And species from these two sections include most of specimens were deposited in the Herbarium of Chengdu Institute the wild ancestors of modern cultivated roses, such as R. multiflora, of Biology (CDBI) after identified with Flora of China (Ku and R. luciae Franch. & Rochebr. in R. sect. Synstylae and R. chinensis var. Robertson, 2003; Yü et al., 1985) and Flora Europaea (Tutin et al., spontanea (Rehder & E.H. Wilson) T.T. Yu & T.C. Ku, R. odorata var. 1978). Others were obtained from cultivated material or herbar- gigantea (Crép.) Rehder & E.H. Wilson in R. sect. Chinenses (Ku and ium specimens at the Royal Botanic Gardens Kew and Edinburgh, Robertson, 2003; Rehder, 1940; Yü et al., 1985). Species of R. sect. Wageningen University Botanical Garden, and Botanic Garden Synstylae can be distinguished by their exserted and columnated Meise in Belgium. In total, we sampled 126 individuals (including styles. This section contains approximately 36 wild species with three outgroups) of which 85 (representing 34 species) belonging about 31 distributed in East Asia (mainly in China), one in North to sect. Synstylae, ten (representing three species) belonging to America, three in Europe, and one in East Africa and South sect. Chinenses, and three putative hybrids related to these two sec- Arabian Peninsula (Ku and Robertson, 2003; Wissemann, 2003). tions. According to previous studies (Eriksson et al., 2003; Potter In Flora of China (Yü et al., 1985), R. section Synstylae has been et al., 2007, 2002), Potentilla parvifolia Fisch. and Rubus idaeopsis divided into two series (ser. Brunonianae Yu and Ku and Focke were chosen as outgroups. All samples with detailed infor- Multiflorae Yu and Ku). Species of ser. Multiflorae have pectinate mation are listed in Supplementary Table S1. or serrate stipules while those in ser. Brunonianae have entire ones. Rosa sect. Chinenses has similarly exserted styles, but the free styles and much bigger hips distinguish this section from sect. Synstylae. 2.2. Lab protocols R. section Chinenses contains three species that are all endemic to China (Ku and Robertson, 2003). The ploidy of approximately a Total genomic DNA was extracted from silica-gel dried or fresh third wild species of these two sections have been reported in pre- leaves using the Tiangen plant genome DNA extraction Kit vious studies, and nearly all of them are diploid (Cole and Melton, (Tiangen Biotech., Beijing, China).

Table 1 Primers used in this study.

Region Name Primer sequence (50–30) Source ndhC-trnV ndhCretF AAGTTTCTCCGGTCCTTTGC Timme et al. (2007) trnVretR TCTACGGTTCGAGTCCGTATAG Timme et al. (2007) ndhC-1F GAATGAAAATGCCAAAATAG This study trnV-1R TTTCGAGTCCGTATAGCC This study ndhF-rpl32 ndhF GAAAGGTATKATCCAYGMATATT Shaw et al. (2007) rpl32R CCAATATCCCTTYYTTTTCCAA Shaw et al. (2007) ndhF-1F ATTGTTTCTGATTCACCAGTT This study rpl32-2R CGGTTCATCGGTTGGATG This study ndhJ-trnF ndhJ ATGCCYGAAAGTTGGATAGG Shaw et al. (2007) tabE GGTTCAAGTCCCTCTATCCC Taberlet et al. (1991) psbJ-petA psbJ ATAGGTACTGTARCYGGTATT Shaw et al. (2007) petA AACARTTYGARAAGGTTCAATT Shaw et al. (2007) nrITS ITS-4 TCCTCCGCTTATTGATATGC White et al. (1990) ITS-A GGAAGGAGAAGTCGTAACAAGG White et al. (1990) GAPDH GPDX7F GATAGATTTGGAATTGTTGAGG Strand et al. (1997) GPDX11R GACATTGAATGAGATAAACC Joly et al. (2006) GAPDH_ZF CTCCATCACTGGTGAGTT This study GAPDH_ZR TGTCACCAATGAAGTCGG This study 52 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

Four chloroplast regions (ndhC-trnV, ndhF-rpl32, ndhJ-trnV, and Model selection was performed in jModelTest v2.1.1 (Darriba psbJ-petA), nuclear ribosomal internal spacers (nrITS) and a single et al., 2012) with the default setting to select the best-fit DNA sub- copy nuclear gene coding for glyceraldehyde-3-phosphate dehydro- stitution model for each dataset. The best-fit models and parame- genase (GAPDH) were used in this study. Primers used in this study ter values determined by Akaike Information Criterion (AIC) are listed in Table 1. Polymerase chain reaction (PCR) amplification (Akaike, 1974) are presented in Supplementary Table S2. were performed in 25 lL volumes containing Taq DNA polymerase ML analyses were performed using RAxML-HPC2 on XSEDE buffer (Tiangen, Beijing) with 2 mM MgCl2,20lM of dNTP, 0.2 lM v8.0.24 (Stamatakis, 2014) in The Cipres Science Gateway (Miller of each primer, 5 U of Taq DNA polymerase and 0.5 lL of genomic et al., 2010). All parameters were set according to the best-fit mod- DNA (20–100 ng). Conditions for amplification consisted of an initial els or the most similar ones available in Cipres. ML bootstrap sup- denaturation at 95 °C for 4 min, followed by 34 cycles at 95 °C for port was summarized from 5000 bootstrap trees. 45 s, then at 53 °C (49 °C for GAPDH) for 45 s and at 72 °C for BI analyses were conducted using MrBayes v3.2.1 (Ronquist 1 min, with a final extension at 72 °C for 10 min. Amplifications were et al., 2012). All parameters were set according to the best-fit or conducted using a PTC-0200 thermocycler (Bio-rad, Beijing). the most similar model available in MrBayes v3.2.1. The Markov Amplification products were purified using the Universal DNA chain Monte Carlo (MCMC) algorithm was run for 30,000,000 Purification Kit (Tiangen, Beijing, China) after gel-separation. (50,000,000 for GAPDH) generations with one cold and three Purified products were directly sequenced at Invitrogen Biotech. heated chains, starting with a random tree and sampling one tree (Shanghai, China). every 1000 generations. The first 7,500,000 (12,500,000 for Heterozygous (double) peaks were observed in chromatograms GAPDH) generations were treated as burn-in. An adequate burn- of most nuclear (ITS and GAPDH) sequences, which might be caused in value for each analysis was assessed using the software Tracer by different alleles. A strategy similar to Joly et al. (2006) was used 1.5 (Rambaut and Drummond, 2009) and a 50% majority-rule con- to sample all the alleles. Sequences with reliable chromatograms sensus tree was then computed. were used directly. When heterozygous peak occurred at only Phylogenetic networks were constructed for the nuclear data- one site, cloning was not considered necessary since the alleles sets using SplitsTree v4.13.1 (Huson and Bryant, 2006). could be easily distinguished. If sequences had more than one Phylogenetic network analyses were performed using the heterozygous peak or could not be directly sequenced, cloning NeighborNet algorithm with Kimura 2-parameter (K2P) distances was performed. Amplification and purification were performed as and Ordinary Least Square Method. previously described except that the PCR volume was 50 lL. The purified PCR products were cloned with pEASY-T1 Cloning Kit 2.5. Molecular dating analysis (Transgen, Beijing, China) following the manual provided by the manufacturer. Finally, five to twenty positive clones were Since topologies obtained from the nuclear dataset were weakly sequenced. supported, we selected the concatenated chloroplast dataset to perform molecular clock analyses in BEAST v 1.7.5 (Drummond 2.3. Sequence treatment, alignment and gap coding et al., 2012) to estimate divergence times. We used the GTR+I+G model that is similar to the best-fit model to execute the analysis Sequences were edited and assembled using Sequencher v4.1.4 with an uncorrelated lognormal relaxed clock model and a Yule (GeneCodes Inc., Ann Arbor, MI, USA). For nuclear sequences, the process of speciation. Two independent Markov chain Monte samples that had only one heterozygous peak were separated into Carlo (MCMC) runs were set to 80,000,000 generations with two sequences labeled as S1 and S2. Cloned sequences were trea- parameters sampled every 1000 generations and 25% burn-in. ted following the strategy of Yang et al. (2013). First, PCR errors Samples were combined and convergence of chains was checked were corrected by comparing the cloned sequences with the origi- in Tracer v 1.5 (Rambaut and Drummond, 2009). Although many nal sequences from direct sequencing. Second, if more than two fossils of Rosa were found, most of them were hard to assign to cloned sequences of one sample shared identical bases, they were an extant species. Thus, we chose the oldest fossil R. germerensis treated as one consensus sequence. Third, PCR-mediated (55.8–48.6 Ma; Idaho, USA) (Edelman, 1975) as the only calibration recombination and pseudogene sequences were excluded. point. We used this age to constrain the root node (separation of Sequences were aligned using ClustalW (Thompson et al., 1994) Rosa from outgroups) with a prior normal distribution centered in BioEdit v7.0.9.0 (Hall, 1999) and manually adjusted when neces- on 50.0 Ma and a 97.5% confidence interval between 51.0 and sary. Single base repeats as well as ambiguously aligned indels 49.0 Ma. were excluded. Other substitutions and indels were considered as variations. Indels in the regions of unambiguous alignment were coded following the modified complex indel coding (Müller, 2006; 3. Results Simmons and Ochoterena, 2000) for maximum parsimony (MP) analyses and simple coding (Simmons and Ochoterena, 2000) for 3.1. Phylogeny of concatenated chloroplast DNA regions Bayesian Inference (BI) using SeqState v1.4.1 (Müller, 2005). After removing ambiguous sites (e.g. single base repeats), our 2.4. Phylogenetic analysis aligned chloroplast ndhC-trnV, ndhF-rpl32, ndhJ-trnF, and psbJ- petA DNA regions contained 763 base pairs (bp), 1275 bp, The chloroplast genome are maternally inherited, and our pre- 1319 bp, and 1051 bp, respectively. The final concatenated liminary analyses did not show obvious incongruence among the cpDNA matrix was composed of 126 taxa and 4408 bp, of which four chloroplast DNA (cpDNA) regions, so we combined them to 755 (17.1%) were variable and 396 (9.0%) were potentially parsi- get better resolution of the phylogeny. All the concatenated chloro- mony informative. plast dataset and the nuclear datasets were analyzed using MP, The results of the MP, ML and BI analyses were congruent on maximum likelihood (ML) and BI. MP analyses were conducted major lineages. MP bootstrap supports (MPBS), ML bootstrap sup- with PAUP⁄ v4.0 b10 (Swofford, 2002). For each dataset we per- ports (MLBS) and BI posterior probabilities (PP) were shown on the formed a heuristic tree search using a set of 1000 random addition 50% majority-rule consensus tree from BI analysis (Fig. 1). The sequence. MP bootstrap support was summarized from 1000 boot- monophyly of Rosa was well supported by all analyses (100% strap trees. MPBS, 100% MLBS, 1.00 PP). In addition, two well-supported clades Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 53

R. anemoniflora 1 R. anemoniflora 2 0.93 - / - R. luciae 1 0.97 R. luciae 2 60/65 R. pricei 1 R. pricei 2 1.00 67/69 R. kwangtungensis

1.00 R. sambucina 1 55/62 R. transmorrisonensis R. maximowiczana 1.00 78/87 G R. multiflora 2 R. uniflorella R. henryi 1 R. henryi 2 R. henryi 5 R. rubus 5

1.00 R. hybrid 3 0.55 58/ - R. hybrid 2 - / - 1.00 R. multiflora var. cathayensis 1 99/97 R. multiflora 1 1.00 100/100 F R. multiflora var. cathayensis 3 R. multiflora 3 sect. Synstylae R. fujisanensis 1.00 R. paniculigera 1 95/97 E R. paniculigera 2

1.00 R. brunonii 1 64/70 R. brunonii 2 R. multiflora var. cathayensis 2

0.98 R. filipes 3 64/64 R. helenae 3 R. helenae 4 0.52 R. helenae 5 - / - R. shangchengensis 1 R. shangchengensis 2 R. helenae 2 0.52 - /53 R. filipes 1 R. filipes 2 R. helenae 1 R. helenae 6 1.00 95/87 D R. weisiensis 1 R. weisiensis 2 R. odorata var. gigantea 1 1.00 E. Asia 0.97 89/87 R. odorata var. gigantea 2 sect. Chinenses 74/46 R. odorata 1.00 R. deqenensis 64/70 R. soulieana 4 R. soulieana var. sungpanensis R. derongensis 1.00 65/67 R. duplicata 1 0.99 R. duplicata 2 60/63 R. soulieana 1 R. soulieana 5 1.00 99/98 C R. lichiangensis R. soulieana 2 R. soulieana 3 sect. Synstylae R. henryi 3 0.99 R. henryi 4 70/63 R. henryi 7 1.00 R. henryi 8 86/81 R. hybrid 1 R. rubus 1 R. rubus 2 1.00 B Asian 94/91 R. rubus 3 R. rubus 6 R. henryi 6 R. sambucina 2 0.89 R. chinensis var. spontanea 1 54/ - R. chinensis var. spontanea 2 R. chinensis var. spontanea 3 sect. Chinenses 0.52 - / - R. chinensis var. spontanea 4 R. odorata var. gigantea 3 R. longicuspis 2 R. longicuspis 3 R. rubus 4 R. lasiosepala 1 R. longicuspis var. sinowilsonii 1 sect. Synstylae R. lasiosepala 2 R. lasiosepala 3 R. longicuspis 1 R. longicuspis var. sinowilsonii 2 R. lucidissima 1 1.00 sect. Chinenses 0.83 100/100 A R. lucidissima 2 53/65 0.97 R. sempervirens 2 1.00 69/65 R. sempervirens 3 100/100 0.75 R. sempervirens 1 - /59 0.98 R. arvensis 2 Core Synstylae 61/ - sect. Synstylae European II 1.00 R. arvensis 4 70/ - 0.7 1.00 R. arvensis 3 83/73 - /26 R. arvensis 1 1.00 Europe 83/90 1.00 R. phoenicia 83/98 R. gallica sect. Gallicanae 0.59 - / - R. caesia 1.00 93/85 R. canina 0.85 sect. Caninae 59/ - R. montana R. elliptica European I 1.00 100/100 R. marginata North American R. setigera 1 sect. Synstylae N. America 1.00 R. cymosa sect. Banksianae 97/90 Synstylae and allies Clade R. roxburghii var. hirtula 1.00 subgen. Platyrhodon 0.94 100/99 R. roxburghii E. Asia 77/84 R. laevigata sect. Laevigatae R. omeiensis sect. Pimpinellifolia R. pimpinellifolia Europe & W. Asia 1.00 R. multibracteata 99/99 sect. Rosa E. Asia 0.71 R. davidii 77/ - R. caudata

1.00 1.00 R. abyssinica 3 1.00 61/51 93/91 R. abyssinica 4 100/100 1.00 E. Africa & S. Arabian Peninsula 93/97 R. abyssinica 2 0.82 0.94 sect. Synstylae - /34 99/95 R. abyssinica 1 R. glomerata 2 1.00 1.00 R. glomerata 1 - /41 100/100 R. glomerata 3 E. Asia R. graciliflora 1.00 sect. Rosa “Rosa” Clade 100/99 R. moyesii 0.99 1.00 R. palustris sect. Carolinae 70/83 N. America 94/91 R. arkansana 1.00 94/79 0.96 R. davurica E. Asia 0.99 87/ - R. jacutica 1.00 94/72 R. majalis Europe 91/92 sect. Rosa 1.00 R. pendulina 0.99 85/99 R. willmottiae var. glandulifera E. Asia R. laxa W. Asia

1.00 Rubus idaeopsis 1 100/100 Rubus idaeopsis 2 Outgroups E. Asia Potentilla parvifolia

0.02

Fig. 1. Phylogram resulting from Bayesian Inference of concatenated chloroplast dataset. Double slashes on branches indicate branch lengths not in proportion. Numbers above branches are posterior probability values; numbers below branches are bootstrap values from MP/ML analyses. Clades, subclades or lineages are indicated by labels on branches and gradual colors of boxes covered on taxa names. 54 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

(‘‘Rosa’’ Clade, and Synstylae and allies Clade) were recovered to species of Rosa soulieana group. Seven accessions of R. abyssinica within Rosa. formed a clade and another one clustered with species of R. sou- ‘‘Rosa’’ Clade included sections Carolinae, Rosa, and one species lieana group. from section Pimpinellifoliae, as well as two species from section Synstylae (Fig. 1). All accessions of Rosa glomerata Rehder & E. H. 3.4. Phylogenetic networks Wilson and Rosa abyssinica R. Br. (Sect. Synstylae) were nested in ‘‘Rosa’’ Clade. The monophyly of R. abyssinica is strongly supported Phylogenetic networks of nuclear ITS and GAPDH regions (Figs. 4 by all analyses and sister to R. glomerata 2 from Ebian (Sichuan, and 5) were similar to the corresponding phylogenetic trees China). The other two samples of R. glomerata from Luding (R. glo- (Figs. 2 and 3) and showed clearer backbones of genus Rosa. merata 1) and Yingjing (R. glomerata 3) counties (Sichuan, China) Species from sections Chinenses, Gallicanae, and some sequences formed another subclade with high support values. from section Caninae were nested in Synstylae. Section Chinense Synstylae and allies Clade included most samples from section was split into different groups in both networks. Synstylae, all samples from section Chinenses, as well as samples from subgenus Platyrhodon and sections Banksianae, Caninae, 3.5. Divergence times Gallicanae, Laevigatae and Pimpinellifoliae (Fig. 1). Both sections Chinenses and Synstylae were not recovered as monophyletic. The maximum clade credibility (MCC) tree (Supplementary Asian species of sections Chinenses and Synstylae formed a Fig. S1) generated from divergence time analyses was congruent well-supported subclade (Asian) in which seven well-supported with the cpDNA phylogenetic tree (Fig. 1) in major clades. The lineages (A-G) were resolved. The only Synstylae species (R. setigera age of the first divergence event in Rosa, which is the divergence Michx.) distributed in North America formed another subclade time between ‘‘Rosa’’ Clade and Synstylae and allies Clade, was esti- (North American). European Synstylae species clustered with mated to be 40.9 Ma (95% highest posterior density (HPD): 30.0– Caninae species and formed the subclade European II while the 50.2 Ma). The crown age of Core Synstylae was estimated to be remaining Caninae species clustered in a subclade we named 24.2 Ma (95% HPD: 15.4–33.7 Ma), and the crown age of subclade European I. These four subclades formed a well-supported (83% Asian was 18.4 Ma (95% HPD: 11.2–26.4 Ma). MPBS, 90% MLBS, 1.00 PP) clade named Core Synstylae in this study. 4. Discussion 3.2. Phylogeny of ITS region 4.1. Low resolution and phylogenetic incongruence The final ITS dataset contained 224 accessions and 622 aligned nucleotides, of which 168 (27.0%) were variable and 103 (16.6%) Our results provided some significant information for the were parsimony informative. evolutionary history of genus Rosa, while resolution was limited The phylogenetic analyses of the ITS dataset using MP, ML, and between closely related species. Low resolution in phylogeny can BI methods showed similar topologies. The backbone of the be due to causes such as insufficient data, noisy sequences, rapid phylogenetic tree had weak support at many nodes (Fig. 2). The diversification, polyploidization, and reticulate evolution (Baurain genus Rosa was resolved as monophyletic and well supported. et al., 2007; Calvino et al., 2008; Campbell et al., 2007; Lo et al., But neither section Synstylae nor section Chinenses was resolved 2009; Xu et al., 2012). In this study, we sampled most species of as monophyletic (Fig. 2). Unlike cpDNA results, R. cymosa from sect. sections Chinenses and Synstylae covering the whole distribution Banksianae was sister to the remaining Rosa species. Additionally, area. The concatenated chloroplast dataset had much lower parsi- none of the clades identified by cpDNA was supported here except mony informative (PI) rate than nuclear markers (Table 2), while a R. setigera samples, the only Synstylae species endemic to North better resolved phylogeny was obtained. It seems that insufficient America. Most accessions of ‘‘Rosa’’ Clade in the chloroplast tree variation is not the key reason in this case. Many reticulate evolu- formed a clade. Moreover, R. glomerata and R. abyssinica showed tion events were indicated by the nuclear networks (Figs. 4 and 5). a closer relationship to species from Core Synstylae clade. Hybridization is easy for Rosa species because of overlapping distribution areas and flowering times, common generalist pollina- 3.3. Phylogeny of GAPDH region tors, and fertile crossbreeds (Jesse et al., 2006; Kevan et al., 1990; Matthews, 1920). Many studies have reported that hybridization PCR amplification of GAPDH region failed for five samples, and has occurred in this genus not only between closely related species one sequence (DQ091174, R. setigera) was obtained from but also between species from different sections (Matthews, 1920; GenBank (Joly et al., 2006). Finally, the GAPDH dataset included Mercure and Bruneau, 2008; Ritz et al., 2005; Schanzer and 272 accessions and 915 aligned nucleotides that contained 418 Kutlunina, 2010; Uggla and Carlson-Nilsson, 2005; Wissemann (45.7%) variable sites and 270 (29.5%) potential parsimony infor- and Hellwig, 1997). Most species from sections Chinenses and mative sites. Synstylae are diploid, but polyploidy is very common in other sec- Phylogenetic analyses of GAPDH dataset using three methods tions especially Caninae and Rosa. A lot of studies have documented (MP, ML and BI) did not show obvious incongruence except sup- polyploidization events and evaluated its significance for the evo- port values (Fig. 3). The monophyly of the genus Rosa was well- lution of the genus Rosa (Erlanson, 1938; Joly et al., 2006; supported, while the phylogenetic relationships within Rosa were Wissemann, 2002). Therefore, we attribute the low resolution of very different from the chloroplast and ITS trees. Two early-diverg- nuclear phylogenies to the complex evolutionary history of this ing clades (One included species from subgenus Platyrhodon, sec- genus rather than insufficient data. tions Banksianae and Laevigatae, and another included species Although the resolution was low in nuclear phylogenies, some from section Pimpinellifoliae.) were sister to the remaining species moderately to strongly supported clades were recovered. forming a polytomy. The positions for species of section Synstylae Numerous inconsistencies (R. glomerata, R. abyssinica and R. rubus from Europe and North America, and species from sections group) were revealed between the chloroplast and nuclear Caninae, Carolinae, Rosa, and Gallicanae were unresolved. Other phylogenies (Figs. 1–3). Either abiotic (stochastic errors and sys- species (mainly Asian) from sections Chinenses and Synstylae tematic errors) or biological factors (convergent evolution, genetic showed a little more resolution. R. glomerata formed a clade sister introgression following hybridization, incomplete lineage sorting, Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 55

R. anemoniflora 1 R. anemoniflora 2

0.94 R. filipes 2 - / - R. multiflora 2 R. kwangtungensis B 0.63 “Rosa” Clade - / - R. kwangtungensis C R. luciae 1 C Synstylae and allies Clade R. luciae 2 A Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia R. maximowiczana R. hybrid 2 D Core Synstylae R. kwangtungensis A 0.99 R. luciae 1 A Subclade North American 0.74 65/ - R. luciae 2 B - / - R. pricei 1 Subclade European I R. pricei 2 R. kwangtungensis D Subclade European II R. luciae 1 B

Subclade Asian 0.8 R. transmorrisonensis S1 - / - R. transmorrisonensis S2 Lineage A R. hybrid 2 C R. weisiensis 1 C R. longicuspis group 0.88 - /57 R. weisiensis 1 B R. chinensis group R. multiflora 3 S2 R. multiflora 3 S1 Lineage B R. multiflora var. cathayensis 3 R. hybrid 1 S1 Lineage C R. multiflora var. cathayensis 1 0.97 R. multiflora 1 Lineage D - /64 0.71 55/ - R. multiflora var. cathayensis 2 D Lineage E R. multiflora var. cathayensis 2 B R. multiflora var. cathayensis 2 A Lineage F 0.83 53/ - R. multiflora var. cathayensis 2 C Lineage G R. davidii C 0.94 56/60 R. paniculigera 1 S2 R. paniculigera 2 A R. paniculigera 1 S1 R. paniculigera 2 B R. fujisanensis R. brunonii 2 R. filipes 1 R. filipes 3 A R. filipes 3 B 0.99 R. helenae 1 S1 sect. Synstylae 0.94 64/91 R. helenae 1 S2 68/62 0.99 R. helenae 2 68/64 R. weisiensis 2 R. uniflorella B 0.71 - / - R. uniflorella A 0.97 - /53 R. helenae 3 R. helenae 4 R. helenae 5 R. helenae 6 R. shangchengensis 1 R. shangchengensis 2 R. longicuspis var. sinowilsonii 1 R. longicuspis 2 R. henryi 7 A R. henryi 7 B R. rubus 1 S1 R. rubus 1 S2 1.00 R. rubus 2 62/56 R. rubus 6 B R. henryi 1 0.54 - / - R. hybrid 3 R. hybrid 2 A R. rubus 5 B R. henryi 5 R. henryi 2 R. hybrid 2 B R. rubus 5 A R. henryi 3 R. henryi 4 R. henryi 6 R. henryi 7 C 0.97 - /50 R. hybrid 1 S2 0.55 R. rubus 3 A - / - R. rubus 3 B R. rubus 3 C R. rubus 3 D R. rubus 3 E R. rubus 3 F R. rubus 6 A R. sambucina 1 S1 R. sambucina 1 S2 R. rubus 4 R. odorata A R. odorata B sect. Chinenses R. odorata F R. brunonii 1 R. henryi 8 R. sambucina 2

0.98 R. lasiosepala 1 S1 55/63 R. lasiosepala 3 0.93 R. longicuspis 3 S1 63/66 R. lasiosepala 1 S2 R. longicuspis 1 R. longicuspis 3 S2

0.99 R. longicuspis var. sinowilsonii 1 S1 61/66 R. longicuspis var. sinowilsonii 1 S2

1.00 R. lichiangensis A 60/76 R. lichiangensis B sect. Synstylae R. deqenensis R. derongensis R. duplicata 1 R. duplicata 2 R. soulieana 1

0.77 R. soulieana 2 A 52/62 R. soulieana 2 B R. soulieana 3 R. soulieana 4 0.86 R. soulieana 5 - / - R. soulieana var. sunpanensis R. weisiensis 1 A

Fig. 2. Phylogram resulting from Bayesian Inference of nrITS dataset. Numbers above branches are posterior probability values; numbers below branches are bootstrap values from MP/ML analyses. Taxa colors corresponding to Fig. 1 indicate their position in chloroplast phylogeny. 56 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

1.00 R. abyssinica 1 S1 63/68 R. abyssinica 2 S2 R. abyssinica 2 S2 1.00 R. abyssinica 2 S1 99/99 R. abyssinica 3 sect. Synstylae “Rosa” Clade R. abyssinica 4 S1 R. abyssinica 4 S2 Synstylae and allies Clade R. glomerata 1 Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia 1.00 R. glomerata 2 81/93 R. glomerata 3 Core Synstylae R. lasiosepala 2 R. lucidissima 1

Subclade North American 0.97 R. lucidissima 2 51/77 R. chinensis var. spontanea 3 C Subclade European I 0.99 1.00 70/72 R. chinensis var. spontanea 4 C 65/70 sect. Chinenses Subclade European II R. chinensis var. spontanea 3 D R. odorata var. gigantea 3

Subclade Asian 1.00 R. odorata var. gigantea 1 82/85 R. odorata var. gigantea 2 Lineage A 0.77 R. odorata C - / - 0.86 0.99 R. setigera 1 B R. longicuspis group - /59 62/73 0.97 R. setigera 1 C R. chinensis group 62/65 R. setigera 1 A 1.00 92/95 R. setigera 1 D Lineage B R. setigera 1 E sect. Synstylae Lineage C R. arvensis 4 B 0.97 53/73 R. arvensis 1 Lineage D 0.89 R. arvensis 2 - /52 R. arvensis 3 S1 Lineage E 0.98 77/ - R. arvensis 3 S2 Lineage F R. davidii D sect. Rosa 0.85 R. caesia A Lineage G - / - R. caesia B

0.81 R. elliptica E 0.71 - / - R. caesia C - / - R. montana B R. caesia D R. caesia E R. canina A 0.71 0.79 R. canina B - / - - / - R. canina C R. canina D R. montana A sect. Caninae R. montana C R. montana D R. canina E 0.82 R. canina F - / - 1.00 R. elliptica A 70/82 R. elliptica C

0.85 R. marginata C - / - R. marginata D R. elliptica D 0.51 - / - 0.59 R. marginata A 0.60 - / - - / - R. marginata E R. marginata B R. chinensis var. spontanea 1 R. chinensis var. spontanea 2 R. chinensis var. spontanea 3 A R. chinensis var. spontanea 3 B 1.00 sect. Chinenses - /67 R. chinensis var. spontanea 4 A R. chinensis var. spontanea 4 B R. odorata D R. odorata E R. weisiensis 1 D R. arvensis 4 A R. phoenicia 0.65 - / - 0.65 R. sempervirens 2 sect. Synstylae - / - R. sempervirens 3 1.00 0.81 72/79 R. sempervirens 1 S1 52/ - 0.99 0.97 - /59 53/ - R. sempervirens 1 S2 0.59 R. gallica A - / - sect. Gallicanae R. gallica B R. caesia H 0.69 R. montana E sect. Caninae - / - 1.00 R. caesia F 97/97 R. caesia G R. roxburghii var. hirtula A 1.00 subgen. Platyrhodon 0.60 94/96 R. roxburghii var. hirtula B - / - R. roxburghii R. pendulina sect. Rosa R. pimpinellifolia sect. Pimpinellifoliae R. laevigata sect. Laevigatae R. palustris S1 0.98 sect. Carolinae 55/ - R. palustris S2 0.96 R. arkansana S1 55/540.98 60/68 R. arkansana S2 1.00 R. jacutica 100/100 0.52 - / - R. davurica 0.51 R. laxa - / - R. majalis S1 R. majalis S2 R. caudata R. davidii A sect. Rosa R. davidii B 0.63 R. davidii E - / - R. davidii F 0.96 65/62 R. davidii G R. davidii H R. davidii I 0.79 - / - R. multibracteata R. graciliflora R. moyesii A R. moyesii B R. willmottiae var. glandulifera R. elliptica B sect. Caninae R. omeiensis sect. Pimpinellifoliae 0.76 R. cymosa A sect. Banksianae 68/74 R. cymosa B

1.00 Rubus idaeopsis 1 100/100 Rubus idaeopsis 2 Potentilla parvifolia 0.4

Fig. 2 (continued) Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 57

R. abyssinica 1 A 0.79 - / - R. abyssinica 1 B 0.85 - / - R. abyssinica 2 A “Rosa” Clade 1.00 R. abyssinica 1 D 76/81 R. abyssinica 1 F Synstylae and allies Clade 1.00 63/61 R. abyssinica 2 B R. abyssinica 1 E Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia sect. Synstylae R. arvensis 3 Core Synstylae R. arvensis 1 1.00 R. arvensis 4 A Subclade North American 99/100 R. arvensis 4 B 0.98 R. sempervirens 1 A Subclade European I 67/67 R. sempervirens 1 B 0.98 R. sempervirens 1 C Subclade European II 0.63 - /81 R. sempervirens 3 - / - 0.51 R. canina A Subclade Asian - / - 0.74 R. montana D - / - Lineage A 0.98 R. ellptica B 0.76 56/ - R. montana C - / - sect. Caninae R. longicuspis group 0.97 R. caesia C - /53 R. canina B R. chinensis group R. caesia B R. ellptica A Lineage B R. gallica C Lineage C R. gallica A sect. Gallicanae 0.97 R. gallica B Lineage D 59/63 R. gallica D R. lichiangensis A Lineage E 0.99 60/ - R. multiflora var. cathayensis 1 A 0.96 R. multiflora 1 A Lineage F 72/ - 1.00 R. multiflora var. cathayensis 2 A 74/65 Lineage G 1.00 R. multiflora 2 A 90/96 R. multiflora 2 B 0.85 R. multiflora var. cathayensis 1 B - / - R. multiflora 1 C 1.00 70/64 R. hybrid 2 E 0.91 R. multiflora 3 B 61/73 R. transmorrisonensis A R. multiflora 1 B R. luciae 1 A 1.00 73/64 R. luciae 2 A R. luciae 2 B 0.65 1.00 R. luciae 1 B 61/61 57/72 0.52 R. luciae 2 D - /54 R. luciae 2 C R. transmorrisonensis B R. kwangtungensis B 1.00 0.81 84/60 1.00 R. kwangtungensis A - / - 0.95 98/98 R. pricei 2 A 53/56 0.78 R. multiflora 3 A 52/54 R. multiflora var. cathayensis 2 B

1.00 R. multiflora var. cathayensis 3 A 0.88 72/81 - / - R. pricei 1 A R. multiflora var. cathayensis 3 B 1.00 R. helenae 3 B 98/98 R. hybrid 1 A 0.60 R. uniflorella - / - R. lichiangensis B 0.81 R. filipes 2 C - / - R. henryi 4 A R. helenae 6 A 0.70 R. helenae 6 B - / - R. henryi 4 B R. rubus 5 0.97 R. henryi 1 A - /57 R. henryi 1 B 1.00 R. henryi 2 0.82 86/88 R. henryi 5 B - / - R. henryi 5 A R. henryi 8 A R. henryi 8 B R. weisiensis 2 0.92 R. rubus 2 C - /54 0.99 R. rubus 2 A - /69 R. hybrid 2 D 0.99 R. hybrid 2 C 1.00 54/57 81/84 R. hybrid 2 B R. rubus 2 B R. henryi 6 A R. henryi 6 B R. hybrid 3 A 1.00 R. rubus 1 A 0.61 1.00 94/95 - / - 71/62 R. rubus 1 B R. rubus 3 C R. rubus 4 R. sambucina 1 A R. sambucina 1 B R. sambucina 2 R. hybrid 2 A sect. Synstylae 1.00 R. maximowiczana A 1.00 91/94 R. maximowiczana B 83/ - R. maximowiczana C 1.00 R. pricei 1 B 1.00 100/100 R. pricei 1 C 75/96 R. pricei 2 B 0.70 R. abyssinica 1 C 0.96 - /70 R. soulieana 2 - /54 R. duplicata 2 A R. brunonii 1 R. brunonii 2 R. helenae 1 B R. helenae 3 A 0.99 R. shangchengensis 2 A 1.00 57/72 R. shangchengensis 2 B 66/80 0.62 R. shangchengensis 1 A - / - 1.00 R. helenae 4 B 0.97 57/67 - /59 R. helenae 4 A 0.69 0.84 R. helenae 2 - / - 70/75 R. shangchengensis 1 B R. helenae 5 R. lasiosepala 1 D 0.97 66/71 R. lasiosepala 1 E 0.78 - /61 R. lasiosepala 2 B 0.70 R. lasiosepala 2 A - / - R. lasiosepala 3 A 1.00 87/88 R. longicuspis var. sinowilsonii 2 B 0.81 R. longicuspis var. sinowilsonii 2 C - / - R. longicuspis 1 A R. longicuspis var. sinowilsonii 1 D R. lasiosepala 1 C R. lasiosepala 1 B R. soulieana 4 B R. soulieana 1 0.88 R. soulieana 5 - / - R. lichiangensis C 0.97 R. duplicata 1 E - / - R. duplicata 1 D 0.91 R. derongensis B - / - R. derongensis A 0.91 R. deqenensis A - / - R. duplicata 1 C 0.86 R. duplicata 1 B - / - 0.66 R. duplicata 1 A - / - 0.95 R. soulieana 3 A - / - R. glomerata 1 R. glomerata 2 A 0.90 56/66 1.00 R. glomerata 2 B 95/99 R. glomerata 2 C R. glomerata 3

Fig. 3. Phylogram resulting from Bayesian Inference of GAPDH dataset. Double slashes on branches indicate branch lengths not in proportion. Numbers above branches are posterior probability values; numbers below branches are bootstrap values from MP/ML analyses. Taxa colors corresponding to Fig. 1 indicate their position in chloroplast phylogeny. 58 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

R. filipes 3 0.96 63/ - R. soulieana 4 A “Rosa” Clade 1.00 93/98 R. soulieana var. sunpanensis R. soulieana 4 C Synstylae and allies Clade 0.99 - / - R. deqenensis B 1.00 Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia 96/99 R. duplicata 2 B R. soulieana 3 B Core Synstylae R. longicuspis var. sinowilsonii 2 A R. longicuspis 1 B Subclade North American R. longicuspis 2 A sect. Synstylae 0.99 0.97 55/61 57/ - R. longicuspis 2 B Subclade European I R. longicuspis 3 S1 R. longicuspis 3 S2 Subclade European II 1.00 R. lasiosepala 1 A Subclade Asian 67/82 R. lasiosepala 3 B 1.00 R. longicuspis var. sinowilsonii 1 C 77/89 R. longicuspis var. sinowilsonii 1 B Lineage A 1.00 73/85 R. longicuspis var. sinowilsonii 1 A R. longicuspis group R. longicuspis 2 C 0.51 - / - 1.00 R. odorata var. gigantea 1 B R. chinensis group 0.63 96/99 R. odorata var. gigantea 3 - / - R. lucidissima 2 sect. Chinenses Lineage B R. odorata var. gigantea 1 A 0.94 1.00 Lineage C - / - 75/92 R. odorata var. gigantea 2 1.00 R. setigera 2 Lineage D 93/84 R. setigera 1 R. anemoniflora 1 A Lineage E 1.00 79/88 R. anemoniflora 1 B 1.00 Lineage F 83/92 R. anemoniflora 2 0.99 R. anemoniflora 1 C Lineage G - /63 R. anemoniflora 1 D R. deqenensis C sect. Synstylae 0.99 69/78 0.77 R. paniculigera 1 S1 - /65 R. paniculigera 2 S1 0.99 0.99 R. paniculigera 1 S2 - / - 72/94 R. paniculigera 2 S2 1.00 R. fujisanensis A 88/93 R. fujisanensis B R. rubus 3 A R. odorata B 1.00 87/92 R. lucidissima 1 R. chinensis var. spontanea 2 B R. chinensis var. spontanea 2 C R. chinensis var. spontanea 1 0.99 R. chinensis var. spontanea 2 A 60/61 R. chinensis var. spontanea 2 D

0.97 R. odorata A - /52 R. chinensis var. spontanea 2 E sect. Chinenses 0.84 R. chinensis var. spontanea 3 B - / - R. chinensis var. spontanea 3 C 1.00 R. chinensis var. spontanea 4 C 96/96 R. hybrid 3 B 0.68 - / - 1.00 R. chinensis var. spontanea 3 A 0.77 56/51 R. chinensis var. spontanea 3 D 0.78 - / - 0.76 - / - R. chinensis var. spontanea 4 B - / - 0.97 57/62 R. chinensis var. spontanea 4 A R. henryi 3 A R. henryi 3 B 1.00 R. henryi 4 C 65/66 1.00 R. henryi 4 D 98/96 R. henryi 7 R. hybrid 1 B R. rubus 3 B R. rubus 6 sect. Synstylae 0.94 R. filipes 1 A 54/64 R. filipes 2 A R. filipes 1 B 1.00 1.00 85/88 84/86 R. helenae 1 A R. weisiensis 1 R. filipes 2 B R. multibracteata B R. multibracteata A 1.00 R. moyesii A 0.95 94/97 R. moyesii B 62/66 R. moyesii C R. majalis R. graciliflora B 1.00 R. davurica B 98/99 R. jacutica D 0.99 sect. Rosa 58/66 0.99 R. jacutica A 0.99 1.00 57/89 R. jacutica B 64/71 93/98 R. jacutica C 0.64 R. davurica A - / - R. pendulina B 0.98 R. willmottiae var. glandulifera A - / - R. laxa A 0.55 R. willmottiae var. glandulifera B - / - R. davidii B 0.92 R. elliptica C 63/70 R. montana A sect. Caninae 0.80 R. marginata A 0.86 - / - R. marginata B 86/58 0.52 R. laxa D - / - R. graciliflora A R. davidii A R. caudata E

1.00 R. caudata D 84/87 R. caudata I 0.63 R. caudata C - / - R. caudata H 0.50 R. caudata B 0.56 - / - R. caudata G sect. Rosa - / - R. caudata F R. caudata A 1.00 R. pendulina A 0.77 89/90 R. pimpinellifolia B - /57 0.63 R. moyesii D 81/ - R. laxa B R. laxa C R. multibracteata C 0.99 R. arkansana 63/63 R. montana B

0.94 R. canina C - /59 R. elliptica D 0.59 R. caesia D sect. Caninae 0.51 - / - 0.96 R. canina D - / - 52/55 1.00 R. montana E 100/100 R. caesia A R. palustris S1 1.00 sect. Carolinae 93/92 R. palustris S2 1.00 R. omeiensis A 0.80 93/95 R. omeiensis B sect. Pimpinellifoliae 70/52 R. pimpinellifolia A 1.00 R. laevigata A 100/100 sect. Laevigatae 0.77 R. laevigata B - / - 1.00 R. cymosa A sect. Banksianae 1.00 93/80 R. cymosa B 94/80 1.00 R. roxburghii A 1.00 99/95 R. roxburghii B subgen. Platyrhodon 94/93 R. roxburghii var. hirtula 1.00 Rubus idaeopsis 1 1.00 100/100 Rubus idaeopsis 2 Outgroup 100/100 Potentilla parvifolia

0.9

Fig. 3 (continued) Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 59

Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia

2 1

S S

Rosa+Carolinae

3 3

s s

i i

p p

s s

u u

c c

i i

g g

n Caninae+Gallicanae n

o R. phoenicia o l R. sempervirens 2 l

R. sempervirens 1 S2

. R. sempervirens 3 . R. sempervirens 1 S1

R R. longicuspis 1 longicuspis R. R R. longicuspis var. sinowilsoniiR. 1longicuspis S2 var. sinowilsonii 1 S1 R. caesia H R. lasiosepala 3 R. lasiosepala 1 S1 R. gallica B R. lasiosepala 1 S2 R. gallica A R. sambucina 2 R. henryi 8 R. montana E R. brunonii 1 Synstylae R. arvensis A

R. chinensis var. spontanea 2 R. chinensis var. spontanea 3 A R R. chinensis var. spontanea 3 B R R. odorata D

R. odorata E . .

c c

h h

i i

n n

e R. roxburghii e

Chinenses n R. roxburghii var. hirtula A

s s R. roxburghii var. hirtula B R. lichiangensis A

i i

s R. lichiangensis B s R. soulieana 2 A

v R. soulieana 2 B v R. duplicata 2

a a R. soulieana 3

r R. soulieana var. sunpanensis

. .

R. deqenensis

s s R. soulieana 1 R. glomerata 1

p p R. duplicata 1 R. glomerata 2 o

o R. derongensis

n R. weisiensis 1 A R. glomerata 3

t t

a R. soulieana 5 R. lasiosepala 2 a

n R. soulieana 4 n R. odorata C

e e R. odorata var. gigantea 1

a a 3 D

R. odorata var. gigantea 3

3 R. odorata var. gigantea 2 B R. chinensis 4 C R. arvensis 3 S1 R. chinensis R. arvensis 3 S2 R. chinensis 3 C R. weisiensis 1 B R. arvensis 1 R. lucidissima 1 R. arvensis 2 R. arvensis 4 B R. lucidissima 2

R. multiflora 3 S2 R. hybrid 2 C R. transmorrisonensis S1 R. anemoniflora 1 R. weisiensis 1 C R. kwangtungensis C R. filipes 2 R. luciae 1 C R. setigera A R. multiflora 2 R. setigera D R. hybrid 2 D R. setigera C R. maximowiczana R. setigera B R. anemoniflora 2 R. setigera E R. kwangtungensis B D 1 weisiensis R. R. kwangtungensis A R. luciae 2 A R. odorata F R. abyssinica 2 S1 R. luciae 1 A R. abyssinica 2 S2 R. luciae 2 B R. abyssinica 1 S1 R. pricei 2 R. abyssinica 1 S2 R. pricei 1 R. abyssinica 4 S2 R. pimpinellifolia R. odorata A R. pendulina R. abyssinica 4 S1 R. abyssinica 3 R. multiflora var. cathayensis 1 R. multiflora 1 R. multiflora var. cathayensis 2 B R. multiflora var. cathayensis 2 D R. multiflora var. cathayensis 2 C R. multiflora var. cathayensis 2 A R. transmorrisonensis S2 R. elliptica D R. fujisanensis R. marginata A R. multiflora 3 S1 R. marginata E R. marginata B R. multiflora var. cathayensis 3 R. elliptica C R. paniculigera 1 S1 R. elliptica A R. hybrid 1 S1 R. paniculigera 2 B R. kwangtungensis D R. paniculigera 1 S2 R. montana B R. luciae 1 B R. montana C R. paniculigera 2 A R. montana D R. montana A R. davidii C R. canina D R. canina A R. canina B

B R. canina C

t R. canina E

R. henryi 4 a

r R. canina F

R. henryi 3 o R. caesia C

R. rubus 3 D o R. caesia D

R. rubus 3 C . R. caesia E R. rubus 4 R R. marginata C R. rubus 5 A R. marginata D R. rubus 6 A R. davidii D R. caesia B R. sambucina 1 S1 R. caesia A R. hybrid 1 S2 R. elliptica E R. henryi 6 R. omeiensis R. henryi 7 C R. leavigata R. henryi 2 R. hybrid 2 B

R. rubus 3 B R. rubus 3 A

R. rubus 3 E R. caesia G R. caesia F R. rubus 3 F

R. davurica R. jacutica R. brunonii 2 R. palustris S2 R. shangchengensis 2 R. palustris S1 R. filipes 1 R. arkansana S2 R. arkansana S1 R. filipes 3 A R. laxa R. helenae 4 R. multibracteata R. majalis S2 R. helenae 6 R. moyesii B R. willmottiae R. davidii B R. shangchengensis 1 R. davidii A R. davidii F R. davidii H R. helenae 5 R. majalis S1 R. davidii E R. davidii G

R. davidii I

R. caudata R. longicuspis var. sinowilsonii 2 R. moyesii A R. graciliflora R. elliptica B R. uniflorella A R. helenae 3

R. helenae 2 2

R. weisiensis 2 S

R. helenae 1 S1 1

R. helenae 1 S2

R. uniflorella B a

R. filipes 3 B n

i c

s b

u m

b a

R. rubus 6 B u

R. henryi 7 A s

r R. rubus 1 S2

R. henryi 1 . R. hybrid 3 . R. longicuspis 2 R. rubus 1 S1 R. henryi 5

R. rubus 5 B R. hybrid 2 A R. henryi 7 B R R

0.002 R. cymosa A R. cymosa B

Fig. 4. Phylogenetic network from NeighorNet analysis of nrITS dataset. Different colors indicate subgenus or sections in traditional taxonomy.

and horizontal gene transfer) can cause these phylogenetic incon- Wissemann and Ritz, 2005). Though this study focused on sections sistencies (Cronn and Wendel, 2004; Linder and Rieseberg, 2004; Chinenses and Synstylae, our extensive sampling did help under- Maddison, 1997; Rieseberg and Soltis, 1991; Wendel and Doyle, standing relationships within the whole genus. As previous studies 1998; Zou and Ge, 2008). Among these causes, introgression and found (Bruneau et al., 2007; Wissemann and Ritz, 2005; Wu et al., incomplete lineage sorting have been frequently discussed as the 2000), none of our three phylogenies (Figs. 1–3) supported tradi- prominent factors of phylogenetic incongruence at lower taxo- tional taxonomy of subgenera and sections (Rehder, 1940; nomic levels (Cronn and Wendel, 2004; Joly et al., 2009; Wissemann, 2003). Our phylogenetic analyses suggested that the Maddison and Knowles, 2006). Hybridization/introgression plays sections Chinenses and Synstylae are not monophyletic since sec- a significant role in the evolutionary history of most plant taxa tions Caninae, Chinenses, Gallicanae and Synstylae showed very (Abbott, 1992; Barton, 2001; Hewitt, 1988; Whitney et al., 2010). close relationships in our phylogenies. Our nuclear phylogenetic As mentioned above, many species in genus Rosa were proved to networks (Figs. 4 and 5) also indicated significant interrelations have undergone hybridization events. Incongruent phylogenetic of these four sections in their evolutionary histories. These results relationships among our gene trees could be caused by introgres- were also consistent with a new worldwide study of the whole sion/hybridization. Incomplete lineage sorting does not seem a genus based on several markers (Fougère-Danezan et al., 2015). reasonable explanation in these cases. Incomplete lineage sorting Species of sections Chinenses and Synstylae are mainly dis- often corresponds to recent divergence events with insufficient tributed in China (Ku and Robertson, 2003). The Chinese species time to fully sort gene polymorphism from the ancestors of section Synstylae have been divided into two series (ser. (Knowles and Carstens, 2007). In our study, the divergence time Multiflorae and Brunonianae) in Flora of China (Yü et al., 1985) of those species (Fig. S1) seemed to be long enough for a full lin- according to the character of stipules. If the series definition is eage sorting. Therefore, we rather attribute the discordance to applied to the whole section, Japanese species (e.g., R. fujisanensis genetic introgression than incomplete lineage sorting in this case. Makino and R. paniculigera Makino ex Momiy.) should be assigned to ser. Multiflorae and others to ser. Brunonianae, but these series 4.2. Phylogeny of Rosa sections Chinenses and Synstylae have not been strictly recovered in our comprehensive molecular phylogenies (Figs. 1–3). The phylogenetic relationships within Our analyses all gave strong support to the monophyly of genus these two sections were not consistent with traditional taxonomy Rosa. This is consistent with previous molecular phylogenetic stud- in many clades either, but a lot of information on their relation- ies (Bruneau et al., 2007; Eriksson et al., 2003; Potter et al., 2007; ships was still provided by our molecular phylogenetic analyses. 60 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

Platyrhodon+Banksianae+Laevigatae+Pimpinellifolia

R. glomerata 2 A R. glomerata 2_C R. glomerata 1 R. glomerata 2 B R. glomerata 3 R. odorata R.var. odorata gigantea var. 1 gigantea B 3 R. lucidissima 2 R. odorata var. gigantea 1 A R. odorata var. gigantea 2

R. soulieana var. sunpanensis “Rosa”+Carolinae R. filipes 3 R. soulieana 4 C R. soulieana 4 A 2

S B A

R. duplicata 2 B R. soulieana 3 B

3 2 2

R. deqenensis B R. derongensis B

s s s

i i R. soulieana 4 B i

R. duplicata 1 E p p R. lichiangensis C p

s s R. soulieana 1 s

u u

R. deqenensis A u

c c

R. duplicata 1 D c

i i R. derongensis A i

g g R. duplicata 1 C g n n Caninae+Gallicanae n R. soulieana 5

o o o

l l l

. R. duplicata 1 B . R. duplicata 1 A .

R R. longicuspis 3 S1 R

R. lasiosepala 3 B 3 lasiosepala R. R. longicuspis 1 B R. longiscuspis var. sinowilsonii 2 A R. soulieana 3 A R. lasiosepala 1 A R. longiscuspisR. longicuspis var. sinowilsonii 2 C 1 A R. longiscuspis var. sinowilsonii 1 B R. longiscuspis var. sinowilsonii 1 C R. lasiosepala 1 B R. lasiosepala 1 C R. longiscuspis var. sinowilsonii 2 B R. shangchengensis 2 A R. lasiosepala 3 A R. sinowilsonii 2 C R. shangchengensis 2 B R. longiscuspis var. sinowilsonii 1 D R. shangchengensis 1 A R. longicuspis 1 A R. setigera 1 R. helenae 4 A Synstylae R. helenae 1 B R. helenae 4 B R. setigera 2 R. helenae 5 R. brunonii 1 R. helenae 3 A R. brunonii 2 R. shangchengensis 1 B R. helenae 2

R. fujisanensis B R. lasiosepala 1 E R. fujisanensis A R. lasiosepala 2 B R. lasiosepala 1 D Chinenses R. lasiosepala 2 A R. caudata A R. marginata A R. multibracteata B R. davidii B R. sempervirens 1 B R. graciliflora B R. sempervirens 1 A R. moyesii C R. moyesii A R. moyesii B R. canina B R. caesia C R. caudata H R. caesia B R. caudata F R. elliptica B R. caudata G R. canina A R. caudata C R. montana D R. caudata E R. montana C R. abyssinica 2 A R. sempervirens 1 C R. abyssinica 1 A R. montana A R. sempervirens 3 R. abyssinica 1 D R. elliptica C R. abyssinica 1 F R. majalis R. abyssinica 1 E R. abyssinica 2 B R. caudata B R. laxa A R. arvensis 1 R. willmottiae var. glandulifera A R. abyssinica 1 B R. davurica A R. pendulina B R. jacutica C R. willmottiae var. glandulifera B R. jacutica A R. jacutica B R. gallica A R. gallica C R. davurica B R. gallica D R. jacutica D R. elliptica A R. gallica B R. arvensis 3 R. arvensis 4 A R. caudata I R. arvensis 4 B R. caudata D R. soulieana 2 R. duplicata 2 A R. canina C R. abyssinica 1 C R. elliptica D R. marginata B R. maximowiczana. C R. maximowiczana. A R. laxa D R. maximowiczana. B R. davidii A R. graciliflora A R. multibracteata A

R. montana B R. canina D R. caesia D R. sambucina 1 A R. rubus 3 C R. montana E R. rubus 4 R. caesia A R. hybrid 3 A R. henryi 1 B R. laxa B R. henryi 1 A R. laxa C R. rubus 5 R. multibracteata C R. henryi 4 B R. arkansana R. helenae 6 A R. palustris S1 R. helenae 6 B R. sambucina 1 B R. palustris S2 R. sambucina 2 R. henryi 6 B R. moyesii D R. henryi 4 A R. filipes 2 C R. henryi 5 A R. pendulina A R. henryi 2 R. pimpinellifolia B R. henryi 5 B R. henryi 6 A R. rubus 2 B R. henryi 8 B R. hybrid 2 B R. henryi 8 A R. rubus 2 A R. hybrid 2 D R. weisiensis 2 0.01 R. hybrid 2 C R. rubus 2 C R. rubus 1 A R. rubus 1 B

R. hybrid 2 A

R. pricei 1 B R. pricei 1 C R. pricei 2 B

R. henryi 7 R. helenae 3 B R. henryi 3 A R. hybrid 1 A R. henryi 3 B R. henryi 4 D R. multiflora var. cathayensis 1 B R. henryi 4 C R. multiflora 3 B R. multiflora 1 C R. rubus 3 B R. transmorrisonensis A R. rubus 6 R. multiflora 1 B R. hybrid 1 B R. hybrid 2 E

R. lichiangensis B R. multiflora var. cathayensis 2 A R. lichiangensis A R. multiflora 1 A R_omeiensis_B R. multiflora var. cathayensis 1 A R. multiflora 2 A R_omeiensis_A R. multiflora 2 B

R_pimpinellifolia_A R. hybrid 3 B R. uniflorella R. multiflora var. cathayensis 3 A R. chinensis var. spontanea 4 C R. multiflora var. cathayensis 2 B R. chinensis var. spontanea 2 E R. pricei 1 A R. transmorrisonensis B R. chinensis var. spontanea 2 D R. luciae 2 D R. luciae 1 B R. luciae 2 A R. chinensis var. spontanea 1 R. luciae 1 A R. luciae 2 B R. luciae 2 C R. odorata A R. kwangtungensis B R. multiflora 3 A R. multiflora var. cathayensis 3 B R. kwangtungensis A R. chinensis var. spontanea 2 A R. pricei 2 A

B A

R. chinensis var. spontanea 2 B

1 1 2 R. chinensis var. spontanea 2 C 1

R. odorata B

a a a R. lucidissima 1 a r r r R. rubus_3 A r o o o R. chinensis var. spontanea 3 C o l l

l l

f f f R. chinensis var. spontanea 3 B f i i i R. leavigata A R. chinensis var. spontanea 3 A i

n R. chinensis var. spontanea 3 D n n R. chinensis var. spontanea 4 B n

o R. chinensis var. spontanea 4 A o o R. leavigata B o

m m m R. weisiensis 1 m R. filipes 1 B e e e R. cymosa B R. helenae 1 A e R. filipes R.2 B filipes 2 A

R. filipes 1 A n n

n n

R. paniculigera 2 S2 a a a

R. paniculigera 1 S2 a R. paniculigera 1 S1 R. paniculigera 2 S1 R. cymosa A

. R. anemoniflora 1 D .

. . R. deqenensis C

R R R R. roxburghii B R R. roxburghii A R. roxburghii var. hirtula

Fig. 5. Phylogenetic network from NeighorNet analysis of GAPDH dataset. Different colors indicate subgenus or sections in traditional taxonomy.

Table 2 Statistics of data partitions used in this study.

Region Number of Aligned nucleotide Variable sites (%) Parsimony informative sites (%) accessions length (bp) R+Oa Rb R+Oa Rb R+Oa Rb R+Oa Rb ndhC-trnV 126 123 763 703 139 (18.22) 61 (8.68) 68 (8.91) 34 (4.84) ndhF-rpl32 126 123 1275 1227 243 (19.06) 129 (10.51) 132 (10.35) 76 (6.19) ndhJ-trnF 124 121 1319 1269 206 (1319) 75 (5.91) 92 (6.97) 38 (2.99) psbJ-petA 124 121 1051 999 167 (15.89) 57 (5.71) 104 (9.90) 28 (2.80) Concatenated chloroplast data 126 123 4408 4198 755 (17.13) 322 (7.67) 396 (8.98) 176 (4.19) nrITS 224 221 622 616 168 (27.01) 108 (17.53) 103 (16.56) 67 (10.88) GAPDH 272 269 915 908 418 (45.68) 318 (35.02) 270 (29.51) 210 (23.13)

a Rosa plus outgroups. b Rosa.

4.2.1. Rosa section Chinenses monophyletic, and chloroplast phylogeny resolved R. lucidissima Rosa sect. Chinenses includes three wild taxa with coriaceous as the earliest divergent species in the Asian subclade. leaves and exserted free styles. Rosa chinensis var. spontanea and R. lucidissima H. Lev. have three to five leaflets per leaf while R. 4.2.2. Rosa abyssinica odorata var. gigantea has five to nine. In addition, Rosa lucidissima Rosa abyssinica is the only Synstylae species distributed in East has a unique character consisting of congested bristles on branch- Africa (Ethiopia) and the South Arabian Peninsula (Yemen and lets, pedicels and receptacles. Because this section includes impor- Saudi Arabia). There was some discordance regarding the position tant garden plants or wild ancestors of cultivated roses, research of this species between chloroplast and nuclear phylogenies. Its on this section has been prolific (see Meng et al., 2011; Scalliet exserted and columnated styles provide strong evidence for its et al., 2008; Scariot et al., 2006), but most studies focused on the inclusion in section Synstylae, while in our chloroplast tree, the four garden roses or double-petaled varieties. In this study, we sampled samples formed a well-supported lineage nested in ‘‘Rosa’’ Clade all three wild taxa and double-petaled R. odorata (Andrews) Sweet (Fig. 1). We attribute the abnormal position of R. abyssinica in var. odorata. All samples were nested within section Synstylae chloroplast phylogeny to hybridization/introgression instead of (Figs. 4 and 5). This relationship was also recovered in previous incomplete lineage sorting because the divergence time (40.9 Ma, studies (Bruneau et al., 2007; Fougère-Danezan et al., 2015; Fig. S1) seems to be long enough for a full lineage sorting as dis- Meng et al., 2011; Qiu et al., 2012; Wissemann and Ritz, 2005). cussed before. Most previous studies of Rosa did not include R. Our phylogenies showed that these species together are not abyssinica except the recent analyses of Fougère-Danezan et al. Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 61

(2015) in which the results were consistent with ours and sug- because lineage B and G diverged about 15 Mya (Fig. S1) which gested that R. abyssinica could have a hybrid origin. is long enough for a full lineage sorting.

4.2.3. North American Synstylae Only one species (Rosa setigera) from section Synstylae is dis- 4.2.7. Rosa soulieana group tributed in North America. It has pink flowers and three leaflets The Rosa soulieana group is distributed in Hengduan Mountains per leaf, which is relatively rare in sect. Synstylae. This species is (H-D Mountains) and eastern edge of Qinghai-Tibet Plateau (Q-T also the only rose that is dioecious (Focke, 1897; Kevan et al., Plateau) with about five species and varieties. Rosa soulieana 1990). R. setigera was recovered as monophyletic with a good sup- Crép. is the first described species of this group and occupies the port in our phylogenetic trees (Figs. 1–3). And its particular dis- whole distribution area. The other four species and varieties (R. tribution, morphological characters and sexual system match its deqenensis T.C. Ku, R. derongensis T.C. Ku, R. duplicata T.T. Yu & position in the chloroplast tree as sister to all the other species T.C. Ku, and R. soulieana var. sungpanensis Rehder) are morphologi- of Core Synstylae. cally similar, narrowly distributed, and sympatric with R. soulieana. They were documented according to their different characters of leaflets or flowers (Ku, 1990; Rehder, 1930; Yü et al., 1980). All 4.2.4. European Synstylae samples of this group clustered together in our chloroplast Eight samples representing three European species (Rosa arven- (Lineage C; Fig. 1) and ITS analyses (Fig. 2). Our molecular phyloge- sis, R. sempervirens L., and R. phoenicia Boiss) were investigated in nies did not show a deep divergence in contrast with the morpho- this study. They showed close relationships to the European spe- logical diversity exhibited by those species, and despite the fact cies from sections Caninae and Gallicanae rather than other species that H-D Mountains and Q-T Plateau have been suggested as the of sect. Synstylae. Previous studies (De Riek et al., 2013; Graham divergence center of many plant taxa because of their rich topogra- and Primavesi, 1993) have reported frequent hybridization phy and complex history (Gao et al., 2013; Sun et al., 2014; Wang between sections Synstylae and Caninae, which is an important rea- et al., 2009). son for the complexity of section Caninae. In our nuclear results (Figs. 2–5), some copies from these species clustered with Caninae species suggesting an interrelation in their evolutionary 4.2.8. Rosa helenae group history. However, those three European species separately formed The Rosa helenae group included five species (R. brunonii Lindl., good monophyletic lineages with obvious divergence in their R. filipes Rehder & E. H. Wilson, R. helenae Rehder & E. H. Wilson, R. chloroplast genomes (Fig. 1). shangchengensis T. C. Ku, and R. weisiensis T. T. Yu & T. C. Ku). They generally have seven (R. weisiensis has five to seven) leaflets per 4.2.5. Rosa glomerata leaf and corymb or compound corymb inflorescences. In the Rosa glomerata is widely distributed in Southwest China with chloroplast tree (Fig. 1) these species clustered as a subclade of typical exserted and columnated styles as well as white flowers. Lineage D that was sister to R. odorata and R. odorata var. gigantea But its leathery leaflets with abaxially dense pubescence and of sect. Chinenses (not recovered in nuclear phylogenies). Either prominent veins make it very different from other Synstylae spe- introgression or incomplete lineage sorting, or both of them could cies. Nuclear and chloroplast results for this species were inconsis- be the cause for this relationship. tent as mentioned above. R. glomerata has an overlapping distribution area with ‘‘Rosa’’ species (R. moyesii Hemsley & E.H. Wilson, R. gracilliflora Rehder & E.H. Wilson and R. multibracteata 4.2.9. Rosa multiflora group Hemsley & E.H. Wilson) and showed close relationships in chloro- The Rosa multiflora group corresponds to the series Multiflorae plast tree (Fig. 1). Considering the early divergence (40.9 Ma, including about 12 species and varieties in our study. Rosa multi- Fig. S1)of‘‘Rosa’’ Clade and Synstylae and allies Clade, together flora is naturally distributed in China and Japan but now consid- with the sympatric distribution with some ‘‘Rosa’’ species we sug- ered as an invasive species in other parts of the world (e.g. gest that R. glomerata has undergone some ancient hybridization Australia, Pakistan and USA). Other species and varieties occur at events. coastal regions of China and Japan. They formed a clade that further divided into three highly supported lineages (Lineage E, 4.2.6. Rosa rubus group Lineage F and Lineage G) in the chloroplast tree (Fig. 1). This group mainly corresponded to Lineage B in the chloro- Morphological characters are not consistent with our molecular plast tree and included three species (R. rubus, R. henryi results. For example, the white flowered R. multiflora and its pink Boulenger, and R. sambucina Koidz.) (Fig. 1). These species are flowered variety R. multiflora var. cathayensis did not segregate in highly similar with long climbing or repent branches, five leaflets two separate clades. Rosa anemoniflora has light pink flowers and per leaf, similar size and shape of leaflets, and white flowers in three leaflets per leaf which is rare in sect. Synstylae. However, corymbs. But R. rubus is densely pubescent or glandular on the despite this peculiarity, this species was not monophyletic in our abaxial side of leaflets while leaflets of R. henryi and R. sambucina molecular phylogenies. are glabrous on both sides. R. rubus and R. henryi share a large distribution area in central and south China while R. sambucina is distributed in Japan and Taiwan (China). In our phylogenetic 4.2.10. Rosa longicuspis group analyses, the boundaries between R. rubus, R. henryi, and R. sam- This group included two species (R. longicuspis and R. lasiose- bucina were very obscure. Additionally, in the chloroplast tree one pala) and a variety (R. longicuspis var. sinowilsonii (Hemsley) T.T. sample of R. rubus and three of R. henryi were recovered as closely Yu & T.C. Ku) distributed in South China. Rosa longicuspis and R. related to sympatric species of Rosa multiflora group in Lineage G longicuspis var. sinowilsonii are distributed in Yunnan, Guizhou (Fig. 1). Rechecking of specimens excluded misidentifying of these and Sichuan provinces. Rosa lasiosepala is endemic to Guangxi species. The non-monophyletic positions could be due to incom- and Yunnan provinces. They have shiny and coriaceous leaves with plete lineage sorting or genetic introgression as mentioned above. prominent veins that are particular in sect. Synstylae. Despite these Here, the incongruences are more likely the result of genetic species have different morphological characteristics, they did not introgression/hybridization than incomplete lineage sorting, exhibit obvious genetic divergences in our analyses. 62 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

4.3. Putative hybrids in Rosa sections Chinenses and Synstylae to the situation of R. lichiangensis mentioned above. As before, we attributed this pattern to homogenization of parental genetic infor- As mentioned above, hybridization occurred frequently among mation obscuring hybridization events. wild roses and driven the diversification of this genus (Joly et al., 2006; Matthews, 1920; Schanzer and Vagina, 2007; Uggla and 5. Conclusions and perspectives Carlson-Nilsson, 2005). Indeed, it generated a lot novel characters (e.g. intermediate characters) and promoted speciation in this This study presents phylogenies of Rosa sections Chinenses and genus. Synstylae based on three different kinds of genetic markers (chloro- Rosa lichiangensis T.T. Yu & T.C. Ku was first documented in 1981 plast DNA, nuclear ribosome DNA, and single copy nuclear DNA) (Tsue-Chih, 1981). It was supposed to be hybrid-origin from our with extensive taxon sampling. The two sections were not resolved field and specimen observations. And its hybrid origin was con- as monophyletic in any of our analyses. A lot of discordance was firmed by both molecular and morphological evidences in another observed between chloroplast and nuclear trees. And we conclude study (Zhu and Gao, unpublished). The results of cpDNA and that hybridization, rather than incomplete lineage sorting has been GAPDH in this study also displayed the hybrid scenario of R. the main driving force of the incongruence. The lack of resolution lichiangensis (Figs. 1 and 3). When documenting hybridization in phylogenies (especially nuclear phylogenies) definitely hindered events in plant using ITS sequences, it is necessary to consider con- the acquisition of accurate relationships among species. However, certed evolution. Some studies suggested that homogenization of we confirmed the hybrid origin of the species R. lichiangensis and ITS copies can eliminate one of the parents copies in few genera- other putative hybrids. tions (Hillis et al., 1991; Wendel et al., 1995; Aguilar et al., Chloroplast markers provided a better backbone for phyloge- 1999). Our ITS results support the same scenario in R. lichiangensis nies, but ignored hybridization because of their maternal inheri- (Fig. 2). The homogenization of parental alleles in the ITS sequences tance. Insufficient variation among close species was also a resulted in the display of maternal (R. soulieana) genetic informa- problem. The ITS region has been widely used as a nuclear mar- tion only and the ITS gene could not reveal the hybridization event ker in former studies of Rosa since it is of biparental inheritance in this case. However, although ten clones were sequenced, it is not and provides more variation than chloroplast markers. However, possible to completely rule out the possibility that all the ITS types concerted evolution and homogenization of parental polymor- were not completely collected. phism, as discussed above, definitely hampered our understand- Rosa rubus and R. multiflora have a wide distribution with a ing of evolution history. Single copy nuclear gene GAPDH large overlapping area. A few putative hybrids between these provided more variation than chloroplast and ITS genes. In addi- two species were observed in the field. Two samples (R. hybrid 1 tion, the GAPDH tree provided the most comprehensive and accu- and R. hybrid 2) respectively located in Enshi (Hubei, China) and rate knowledge of the reticulate evolution of Rosa although the Guiyang (Guizhou, China) were included in this study. In both resolution was low for some nodes. Further studies including localities, Rosa rubus and R. multiflora grow together and have the more low copy nuclear genes are necessary to better understand same flowering time from May to July. In morphology, the putative the complex evolutionary history of roses (e.g. hybridization and hybrids possessed lobed stipules that were intermediate between polyploidization). Additionally, population level studies seem those of R. rubus and R. multiflora. They had five to seven leaflets more effective for tracking evolutionary history and circumscrib- per leaf and the size of leaflet was intermediate between the ing close species (Joly et al., 2006; Liu et al., 2012; Sun et al., probable parents. In our chloroplast phylogeny (Fig. 1), the puta- 2014). Thus, studies focusing on population level could be critical tive hybrids were close to R. rubus in Clade B or G. Our nuclear to the further understanding of sections Chinenses and Synstylae phylogenies (Figs. 2–5) were consistent with the hybrid hypothesis and even the whole genus since a lot of close species (for exam- for these two individuals. Their nuclear accessions clustered into ple R. soulieana group, R. rubus group, R. multiflora group) have two different lineages of which one contained R. rubus and its close undergone a fast diversification, incomplete lineage sorting, or relatives and the other contained R. multiflora and its close rela- reticulate evolution. tives. All these results suggested that R. rubus and R. multiflora were probably the parents of the hybrids. Another putative hybrid (R. hybrid 3) that seemed to be mor- Acknowledgments phologically related to sections Synstylae (R. rubus) and Chinenses (R. lucidissima) was also sampled in this study. Several characters We are grateful to Dr. Liang Zhang, Dr. Yu-Lan Peng, Dr. Bing- seemed to be intermediate between the two possible parents. Qiang Xu, Wen-Bin Ju, Yu Zhang, Xue-Li Zhao, Xia Zheng, and Rosa lucidissima has bright coriaceous leaves and dark red flowers. Prof. Mark P. Simmons for their help in collecting samples; to Rosa rubus has pubescent herbaceous leaves and white flowers. Prof. Li-Bing Zhang, Dr. Yun-Dong Gao and Dr. Bo Xu for their This putative hybrid had slightly coriaceous leaves and light red suggestion and comment on data analysing and manuscript flowers. Moreover, Rosa lucidissima has long (app. 2 mm) glandular preparing. We thank the Royal Botanic Gardens Kew and bristles on pedicels and branchlets while R. rubus only has glands Edinburgh, Wageningen University Botanical Garden, and adhering to pedicels. The putative hybrid had short (app. 0.5– Botanic Garden Meise in Belgium for providing samples, and 1 mm) glandular bristles on pedicels and branchlets. In addition, Ya-Ling Cao, Yong-Hua He, and Jian Gu for collecting and this individual was located in the overlapping area of R. lucidissima cultivating roses for Maoxian Ecological Station. We are also and R. rubus. Although R. lucidissima flowers much earlier (April to grateful to Dr. Zhen-Xiang Xi and Prof. Kyle Tomlinson for some May) than R. rubus (late April to July), there is an overlap in their useful suggestion and English editing of the manuscript. flowering time from late April to early May. We obtained two Additionally, we would like to thank the curators and staff of GAPDH accessions for this putative hybrid with one close to sect. the herbaria A/GH, BM, CDBI, E, HNWP, IBSC, K, KATH, KUN, PE, Chinenses (R. lucidissima) and the other close to R. rubus group TUCH, and WUK for their help when Xin-Fen Gao visited their (Fig. 3). The GAPDH phylogeny confirmed our inference based on herbarium. Financial support was provided by The National morphology. The chloroplast tree (Fig. 1) suggested that R. rubus Natural Science Foundation of China (NSFC Grand Nos. might play the female parent, and R. lucidissima might be the male 31070173, 31110103911), Knowledge Innovation Program of parent. However, the ITS sequences of this sample did not show the Chinese Academy of Sciences (Grand Nos. KSCX2-EW-J-22, different copies (Fig. 2). This pattern in the ITS phylogeny is similar KSCX2-EW-Z-1), the Ministry of Science and Technology (Grand Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64 63

No. 2007FY110100), and Project of Platform Construction for Kevan, P.G., Eisikowitch, D., Ambrose, J.D., Kemp, J.R., 1990. Cryptic dioecy and Plant Resources of Sichuan Province to Xin-Fen Gao. insect pollination in Rosa setigera Michx (Rosaceae), a rare plant of Carolinian Canada. Biol. J. Linn. Soc. 40, 229–243. Knowles, L.L., Carstens, B.C., 2007. Delimiting species without monophyletic gene Appendix A. Supplementary data trees. Syst. Biol. 56, 887–895. Koopman, W.J.M., Wissemann, V., De Cock, K., Van Huylenbroeck, J., De Riek, J., Sabatlno, G.J.H., Visser, D., Vosman, B., Ritz, C.M., Maes, B., Werlemark, G., Supplementary data associated with this article can be found, in Nybom, H., Debener, T., Linde, M., Smulders, M.J.M., 2008. AFLP markers as a the online version, at http://dx.doi.org/10.1016/j.ympev.2015.03. tool to reconstruct complex relationships: a case study in Rosa (Rosaceae). Am. J. Bot. 95, 353–366. 014. Ku, T.C., 1990. Taxa nova Rosacearum Sinicarum (VI). Bull. Bot. Res. 10, 1–15. Ku, T.C., Robertson, K.R., 2003. Rosa Linnaeus. In: Wu, C.Y., Raven, P.H. (Eds.), Flora of References China, vol. 9. Science Press/Missouri Botanical Garden Press, Beijing/St, Louis, pp. 339–381. Linder, C.R., Rieseberg, L.H., 2004. Reconstructing patterns of reticulate evolution in Aguilar, J.F., Rossello, J.A., Feliner, G.N., 1999. Nuclear ribosomal DNA (nrDNA) plants. Am. J. Bot. 91, 1700–1708. concerted evolution in natural and artificial hybrids of Armeria Linnaeus, C.V., 1753. Species Plantarum, vols. 2. Salvius, Stockholm. (Plumbaginaceae). Mol. Ecol. 8, 1341–1346. Liu, J.Q., Sun, Y.S., Ge, X.J., Gao, L.M., Qiu, Y.X., 2012. Phylogeographic studies of Akaike, H., 1974. A new look at the statistical model identification. IEEE Trans. plants in China: advances in the past and directions in the future. J. Syst. Evol. Autom. Control 19, 716–723. 50, 267–275. Anderson, E., 1948. Hybridization of the habitat. Evolution 2, 1–9. Lo, E.Y.Y., Stefanovic´, S., Christensen, K.I., Dickinson, T.A., 2009. Evidence for genetic Atienza, S.G., Torres, A.M., Millan, T., Cubero, J.I., 2005. Genetic diversity in Rosa as association between East Asian and western North American Crataegus L. revealed by RAPDs. Agric. Conspec. Sci. 70, 75–85. (Rosaceae) and rapid divergence of the eastern North American lineages based Barrie, F.R., 2006. Report of the general committee: 9. Taxon 55, 795–800. on multiple DNA sequences. Mol. Phylogenet. Evol. 51, 157–168. Barton, N.H., 2001. The role of hybridization in evolution. Mol. Ecol. 10, 551–568. Maddison, W.P., 1997. Gene trees in species trees. Syst. Biol. 46, 523–536. Baurain, D., Brinkmann, H., Philippe, H., 2007. Lack of resolution in the animal Maddison, W.P., Knowles, L.L., 2006. Inferring phylogeny despite incomplete lineage phylogeny: closely spaced cladogeneses or undetected systematic errors? Mol. sorting. Syst. Biol. 55, 21–30. Biol. Evol. 24, 6–9. Mallet, J., 2007. Hybrid speciation. Nature 446, 279–283. Bruneau, A., Starr, J.R., Joly, S., 2007. Phylogenetic relationships in the genus Rosa: Matsumoto, S., Kouchi, M., Yabuki, J., Kusunoki, M., Ueda, Y., Fukui, H., 1998. new evidence from chloroplast DNA sequences and an appraisal of current Phylogenetic analyses of the genus Rosa using the matK sequence: molecular knowledge. Syst. Bot. 32, 366–378. evidence for the narrow genetic background of modern roses. Sci. Hortic. Calvino, C.I., Martinez, S.G., Downie, S.R., 2008. The evolutionary history of Eryngium (Amst.) 77, 73–82. (Apiaceae, Saniculoideae): rapid radiations, long distance dispersals, and Matsumoto, S., Kouchi, M., Fukui, H., Ueda, Y., 2000. Phylogenetic analyses of the hybridizations. Mol. Phylogenet. Evol. 46, 1129–1150. subgenus Eurosa using the ITS nrDNA sequence. Acta Hort. 521, 193–202. Campbell, C.S., Evans, R.C., Morgan, D.R., Dickinson, T.A., Arsenault, M.P., 2007. Matthews, J.R., 1920. Hybridism and classification in the genus Rosa. New Phytol. Phylogeny of subtribe Pyrinae (formerly the Maloideae, Rosaceae): limited 19, 153–171. resolution of a complex evolutionary history. Plant Syst. Evol. 266, 119–145. McNeill, J., Barrie, F.R., Buck, W.R., Demoulin, V., Greuter, D.L., Hawksworth, D.L., Cole, P., Melton, B., 1986. Self-and cross-compatibility relationships among Herendeen, P.S., Knapp, S., Marhold, K., Prado, J., Proud’Homme van Reine, W.F., genotypes and between ploidy of the rose. J. Am. Soc. Hortic. Sci. 111, 122–125. Smith, J.F. Wiersema, J.H. (Eds.), 2012. International Code of Nomenclature for Crépin, F., 1889. Sketch of a new Classification of Roses. Spottiswoode & Company, algae, fungi and plants (Melbourne Code): Adopted by the Eighteenth Printers. International Botanical Congress, Melbourne, Australia, July 2011. Regnum Cronn, R., Wendel, J.F., 2004. Cryptic trysts, genomic mergers, and plant speciation. Vegetable, vol. 154, pp. 1–274. New Phytol. 161, 133–142. Meng, J., Fougere-Danezan, M., Zhang, L.B., Li, D.Z., Yi, T.S., 2011. Untangling the Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. JModelTest 2: more models, hybrid origin of the Chinese tea roses: evidence from DNA sequences of single- new heuristics and parallel computing. Nat. Methods 9, 772. copy nuclear and chloroplast genes. Plant Syst. Evol. 297, 157–170. De Riek, J., De Cock, K., Smulders, M.J.M., Nybom, H., 2013. AFLP-based population Mercure, M., Bruneau, A., 2008. Hybridization between the escaped Rosa rugosa structure analysis as a means to validate the complex taxonomy of dogroses (Rosaceae) and native R. blanda in eastern North America. Am. J. Bot. 95, 597– (Rosa section Caninae). Mol. Phylogenet. Evol. 67, 547–559. 607. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogenetics Millan, T., Osuna, F., Cobos, S., Torres, A.M., Cubero, J.I., 1996. Using RAPDs to study with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. phylogenetic relationships in Rosa. Theor. Appl. Genet. 92, 273–277. Edelman, D.W., 1975. The Eocene Germer Basin Flora of South-Central Idaho [M.S. Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway Thesis], Moscow, University of Idaho, 142pp. for inference of large phylogenetic trees. Gateway Computing Environments Eriksson, T., Hibbs, M.S., Yoder, A.D., Delwiche, C.F., Donoghue, M.J., 2003. The Workshop (GCE), 2010. IEEE, pp. 1–8. phylogeny of Rosoideae (Rosaceae) based on sequences of the internal Müller, K., 2005. SeqState. Appl. Bioinformatics 4, 65–69. transcribed spacers (ITS) of nuclear ribosomal DNA and the trnL/F region of Müller, K., 2006. Incorporating information from length-mutational events into chloroplast DNA. Int. J. Plant Sci. 164, 197–211. phylogenetic analysis. Mol. Phylogenet. Evol. 38, 667–676. Erlanson, E.W., 1938. Phylogeny and polyploidy in Rosa. New Phytol. 37, 72–81. Abbott, R.J., 1992. Plant invasions, interspecific hybridization and the evolution of Focke, W.O., 1897. Neue Beobachtungen über Artenkreuzung und Selbsterilitat. new plant taxa. Trends Ecol. Evol. 7, 401–405. Abh. Natwiss. Ver. Brem. 14, 297–304. Ohba, H., Akiyama, S., Mikanagi, Y., 2000. Interspecific hybrids between the Fougère-Danezan, M., Joly, S., Bruneau, A., Gao, X.F., Zhang, L.B., 2015. Phylogeny Japanese species in Rosa section Synstylae (Rosaceae). J. Jpn. Bot. 82, 45–53. and biogeography of wild roses with specific attention to polyploids. Ann. Bot. Paun, O., Forest, F., Fay, M.F., Chase, M.W., 2009. Hybrid speciation in angiosperms: 115, 275–291. http://dx.doi.org/10.1093/aob/mcu245. parental divergence drives ploidy. New Phytol. 182, 507–518. Gao, Y.D., Harris, A.J., Zhou, S.D., He, X.J., 2013. Evolutionary events in Lilium Potter, D., Gao, F., Bortiri, P.E., Oh, S.H., Baggett, S., 2002. Phylogenetic relationships (including Nomocharis, Liliaceae) are temporally correlated with orogenies of the in Rosaceae inferred from chloroplast matK and trnL-trnF nucleotide sequence Q-T plateau and the Hengduan Mountains. Mol. Phylogenet. Evol. 68, 443–460. data. Plant Syst. Evol. 231, 77–89. Graham, G.G., Primavesi, A.L., 1993. Roses of Great Britain and Ireland. BSBI Potter, D., Eriksson, T., Evans, R.C., Oh, S., Smedmark, J.E.E., Morgan, D.R., Kerr, M., Handbook, No. 7 Botanical Society of the British Islas, London, p. 208. Robertson, K.R., Arsenault, M., Dickinson, T.A., Campbell, C.S., 2007. Phylogeny Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and and classification of Rosaceae. Plant Syst. Evol. 266, 5–43. analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Qiu, X.Q., Zhang, H., Wang, Q.G., Jian, H.Y., Yan, H.J., Zhang, T., Wang, J.H., Tang, K.X., Hewitt, G.M., 1988. Hybrid zones-natural laboratories for evolutionary studies. 2012. Phylogenetic relationships of wild roses in China based on nrDNA and Trends Ecol. Evol. 3, 158–167. matK data. Sci. Hortic. (Amst.) 140, 45–51. Hillis, D.M., Moritz, C., Porter, C.A., Baker, R.J., 1991. Evidence for biased gene Rambaut, A., Drummond, A.J., 2009. Tracer v1.5. . Huson, D.H., Bryant, D., 2006. Application of phylogenetic networks in evolutionary Rehder, A., 1930. New species, varieties and combinations from the herbarium and studies. Mol. Biol. Evol. 23, 254–267. collections of the Arnold arboretum. J. Arnold Arbor. XI, 161. Jan, C.H., Byrne, D.H., Manhart, J., Wilson, H., 1999. Rose germplasm analysis with Rehder, A., 1940. Manual of Cultivated Trees and Shrubs Hardy in North America, RAPD markers. HortScience 34, 341–345. second ed. Macmillan, New York. Jarvis, C., 1992. Seventy-two proposals for the conservation of types of selected Rieseberg, L.H., 1995. The role of hybridization in evolution – old wine in new skins. Linnaean generic names, the report of Subcommittee 3C on the lectotypification Am. J. Bot. 82, 944–953. of Linnaean generic names. Taxon 41, 552–583. Rieseberg, L.H., 1997. Hybrid origins of plant species. Annu. Rev. Ecol. Syst. 28, 359– Jesse, L.C., Moloney, K.A., Obrycki, J.J., 2006. Insect pollinators of the invasive plant, 389. Rosa multiflora (Rosaceae), in Iowa, USA. Weed Biol. Manage. 6, 235–240. Rieseberg, L.H., Soltis, D.E., 1991. Phylogenetic consequences of cytoplasmic gene Joly, S., Starr, J.R., Lewis, W.H., Bruneau, A., 2006. Polyploid and hybrid evolution in flow in plants. Evol. Trend. Plant 5, 65–84. roses east of the Rocky Mountains. Am. J. Bot. 93, 412–425. Ritz, C.M., Schmuths, H., Wissemann, V., 2005. Evolution by reticulation: European Joly, S., McLenachan, P.A., Lockhart, P.J., 2009. A statistical approach for dogroses originated by multiple hybridization across the genus rosa. J. Hered. distinguishing hybridization and incomplete lineage sorting. Am. Nat. 174, 96, 4–14. E54–E70. 64 Z.-M. Zhu et al. / Molecular Phylogenetics and Evolution 87 (2015) 50–64

Roberts, A.V., Gladis, T., Brumme, H., 2009. DNA amounts of roses (Rosa L.) and their Uggla, M., Carlson-Nilsson, B.U., 2005. Screening of fungal diseases in offspring from use in attributing ploidy levels. Plant Cell Rep. 28, 61–71. crosses between Rosa sections Caninae and Cinnamomeae. Sci. Hortic. (Amst.) Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Hohna, S., Larget, 104, 493–504. B., Liu, L., Suchard, M.A., Huelsenbeck, J.P., 2012. MrBayes 3.2: efficient bayesian Wang, Y.J., Susanna, A., Von Raab-Straube, E., Milne, R., Liu, J.Q., 2009. Island-like phylogenetic inference and model choice across a large model space. Syst. Biol. radiation of Saussurea (Asteraceae: Cardueae) triggered by uplifts of the 61, 539–542. Qinghai-Tibetan Plateau. Biol. J. Linn. Soc. 97, 893–903. Scalliet, G., Piola, F., Douady, C.J., Rety, S., Raymond, O., Baudino, S., Bordji, K., Wendel, J.F., Doyle, J.J., 1998. Phylogenetic incongruence: window into genome Bendahmane, M., Dumas, C., Cock, J.M., Hugueney, P., 2008. Scent evolution in history and molecular evolution. Molecular Systematics of Plants, vol. II. Chinese roses. Proc. Natl. Acad. Sci. USA 105, 5927–5932. Springer, pp. 265–296. Scariot, V., Akkak, A., Botta, R., 2006. Characterization and genetic relationships of Wendel, J.F., Schnabel, A., Seelanan, T., 1995. Bidirectional interlocus concerted wild species and old garden roses based on microsatellite analysis. J. Am. Soc. evolution following allopolyploid speciation in cotton (Gossypium). Proc. Natl. Sci. 131, 66–73. Acad. Sci. USA 92, 280–284. Schanzer, I.A., Kutlunina, N.A., 2010. Interspecific hybridization in wild roses (Rosa White, T.J., Bruns, T., Lee, S.J.W.T., Taylor, J.W., 1990. Amplification and direct L. sect. Caninae DC.). Biol. Bull. 37, 480–488. sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Schanzer, I.A., Vagina, A.V., 2007. ISSR (Inter Simple Sequence Repeat) markers Gefland, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods reveal natural intersectional hybridization in wild roses [Rosa L., sect. Caninae and Applications. Academic Press Inc., San Diego, pp. 315–322. (DC.) Ser. and sect. Cinnamomeae (DC.) Ser.]. Wulfenia 14, 1–14. Whitham, T.G., Morrow, P.A., Potts, B.M., 1994. Plant hybrid zones as centers of Seringe, N.C., 1818. Observations générales sur les Roses. In: Musée helvétique biodiversity: the herbivore community of two endemic Tasmanian eucalypts. d’histoire naturelle, (part Botanique). tome I. Genève: Chez l’auteur, Berne, p. 2. Oecologia 97, 481–490. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole Whitney, K.D., Ahern, J.R., Campbell, L.G., Albert, L.P., King, M.S., 2010. Patterns of chloroplast genome sequences to choose noncoding regions for phylogenetic hybridization in plants. Perspect. Plant Ecol. Evol. Syst. 12, 175–182. studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94, 275– Wissemann, V., 1999. Genetic constitution of Rosa sect. Caninae (R. canina, R. 288. jundzillii) and sect. Gallicanae (R. gallica). Angew. Bot. 73, 191–196. Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequence-based Wissemann, V., 2002. Molecular evidence for allopolyploid orign of the Rosa canina phylogenetic analyses. Syst. Biol. 49, 369–381. – complex (Rosaceae, Rosoideae). J. Appl. Bot. 76, 176–178. Stamatakis, A., 2014. RAxML version 8: a tool for phylogenetic analysis and post- Wissemann, V., 2003. Classification. In: Roberts, A., Debener, T., Gudin, S. (Eds.), analysis of large phylogenies. Bioinformatics 30, 1312–1313. Encyclopedia of Rose Science. Elsevier, London, pp. 111–135. Strand, A.E., Leebens-Mack, J., Milligan, B.G., 1997. Nuclear DNA-based markers for Wissemann, V., Hellwig, F.H., 1997. Reproduction and Hybridisation in the Genus plant evolutionary biology. Mol. Ecol. 6, 113–118. Rosa, Section Caninae (Ser.) Rehd. Rehd. Bot. Acta 110, 251–256. Sun, Y.S., Abbott, R.J., Li, L.L., Li, L., Zou, J.B., Liu, J.Q., 2014. Evolutionary history of Wissemann, V., Ritz, C.M., 2005. The genus Rosa (Rosoideae, Rosaceae) revisited: Purple cone spruce (Picea purpurea) in the Qinghai-Tibet Plateau: homoploid molecular analysis of nrITS-1 and atpB-rbcL intergenic spacer (IGS) versus hybrid origin and Pleistocene expansion. Mol. Ecol. 23, 343–359. conventional taxonomy. Bot. J. Linn. Soc. 147, 275–290. Swofford, D., 2002. PAUP 4.0 b10: Phylogenetic Analysis Using Parsimony. Sinauer Wu, S.Q., Ueda, Y., He, H.Y., Nishihara, S., Matsumoto, S., 2000. Phylogenetic analysis Associates, Sunderland, MA, USA. of Japanese Rosa species using matK sequences. Breed. Sci. 50, 275–281. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for Wu, S., Ueda, Y., Nishihara, S., Matsumoto, S., 2001. Phylogenetic analysis of amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. Japanese Rosa species using DNA sequences of nuclear ribosomal internal 17, 1105–1109. transcribed spacers (ITS). J. Hortic. Sci. Biotech. 76, 127–132. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the Xu, B., Wu, N., Gao, X.F., Zhang, L.B., 2012. Analysis of DNA sequences of six sensitivity of progressive multiple sequence alignment through sequence chloroplast and nuclear genes suggests incongruence, introgression, and weighting, position-specific gap penalties and weight matrix choice. Nucleic incomplete lineage sorting in the evolution of Lespedeza (Fabaceae). Mol. Acids Res. 22, 4673–4680. Phylogenet. Evol. 62, 346–358. Thory, C.A., 1820. Prodrome de la monographie des espèces et variétés connues du Yang, H.M., Zhang, Y.X., Yang, J.B., Li, D.Z., 2013. The monophyly of Chimonocalamus genre rosier, divisées selon leur ordre naturel. P. Dufart, Paris, p. 128. and conflicting gene trees in Arundinarieae (Poaceae: Bambusoideae) inferred Timme, R.E., Kuehl, J.V., Boore, J.L., Jansen, R.K., 2007. A comparative analysis of the from four plastid and two nuclear markers. Mol. Phylogenet. Evol. 68, 340–356. Lactuca and Helianthus (Asteraceae) plastid genomes: identification of divergent Yokoya, K., Roberts, A.V., Mottley, J., Lewis, R., Brandham, P.E., 2000. Nuclear DNA regions and categorization of shared repeats. Am. J. Bot. 94, 302–312. amounts in roses. Ann. Bot. 85, 557–561. Tsue-Chih, K., 1981. Taxa nova Rosacearum Sinicarum (III). Bull. Bot. Res. 1, 1–33. Yü, T.T., Lu, L.T., Ku, T.C., 1980. Taxa nova Rosacearum Xizangensium. Acta Phytotax. Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M., Sin. 18, 490–503. Webb, D.A., 1978. Roseaceae to Umbelliferae. Flora Europaea, vol. 2. Cambridge Yü, T.T., Lu, L.T., Ku, T.C., Kuan, K.C., Li, C.L., 1985. Rosaceae (2). Flora Reipublicae University Press, Cambridge, pp. 1–455. Popularis Sinicae, vol. 37. Science Press, Beijing, pp. 1–516. Ueda, Y., Akimoto, S., 2001. Cross-and self-compatibility in various species of the Zou, X.H., Ge, S., 2008. Conflicting gene trees and phylogenomics. J. Syst. Evol. 46, genus Rosa. J. Hortic. Sci. Biotechnol. 76, 392–395. 795–807.