Evaluation of Potential Indicators of Virus Removal During Advanced Physical Treatment of Wastewater

Home , Alphanecrovirus, Pbunavirus, Phasmaviridae, Polerovirus, Tevenvirinae

Item Type text; Electronic Dissertation

Authors Morrison, Christina

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction, presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 04/10/2021 01:15:42

Link to Item http://hdl.handle.net/10150/642154 EVALUATION OF POTENTIAL INDICATORS OF VIRUS REMOVAL DURING

ADVANCED PHYSICAL TREATMENT OF WASTEWATER

Christina Marie Morrison

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF ENVIRONMENTAL SCIENCE

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2020

ACKNOWLEDGEMENT

I would like to acknowledge my dissertation and comprehensive exam committees, my lab mates, my collaborators, my classmates, and my coursework professors for helping me throughout my PhD studies. I would also like to acknowledge my friends and family for their support through the good and that bad. I could not have accomplished this without the help of others.

DEDICATION

This work is dedicated to both my maternal and paternal grandmothers (Suzy and

Arlene). I am blessed to have such amazing women to look up to. I love you both dearly.

TABLE OF CONTENTS

ABSTRACT ...... 9

INTRODUCTION...... 13

1. Background ...... 13

2. Objectives ...... 14

3. Dissertation Format ...... 15

LITERATURE REVIEW ...... 17

1. Potable Water ...... 17

2. Microbial Water Quality of Wastewater: Viruses ...... 21

3. Virus Detection ...... 30

4. Virus Removal by Physical Treatment ...... 37

PRESENT STUDY...... 53

REFERENCES ...... 60

APPENDIX A ...... 95

Abstract ...... 96

1 Introduction ...... 97

2. Materials & Methods ...... 99

3. Results and Discussion ...... 104

4. Conclusions ...... 112

References ...... 113

Appendix A, Supplementary Material: ...... 124

APPENDIX B ...... 128

Abstract ...... 129

1. Introduction ...... 130

2. Materials and Methods ...... 134

3. Results ...... 138

4. Discussion ...... 141

5. Conclusions ...... 146

References ...... 148

APPENDIX C ...... 163

Abstract ...... 164

1. Introduction ...... 165

2. Materials and Methods ...... 166

3. Results & Discussion ...... 171

4. Conclusions ...... 178

References ...... 179

Appendix C, Supplementary Material I: ...... 196

Appendix C, Supplementary Material II: ...... 201

LIST OF FIGURES

Appendix A

Figure 1…………………………………………………………………………….120

Figure 2…………………………………………………………………………….121

Figure S1…………………………………………………………………………...126

Appendix B

Figure 1…………………………………………………………………………….157

Figure 2…………………………………………………………………………….158

Figure 3…………………………………………………………………………….159

Appendix C

Figure 1…………………………………………………………………………….186

Figure 2…………………………………………………………………………….187

Figure 3…………………………………………………………………………….187

Figure 4…………………………………………………………………………….188

Figure 5…………………………………………………………………………….189

Figure 6…………………………………………………………………………….190

Figure 7…………………………………………………………………………….191

Figure 8…………………………………………………………………………….192

Figure 9…………………………………………………………………………….193

Figure S1…………………………………………………………………………...197

Figure S2…………………………………………………………………………...198

Figure S3…………………………………………………………………………...199

LIST OF TABLES Literature Review

Table 1………………………………………………………………………………..22

Table 2………………………………………………………………………………..24

Table 3………………………………………………………………………………..49

Appendix A

Table 1………………………………………………………………………………122

Table 2………………………………………………………………………………122

Table 3………………………………………………………………………………122

Table 4………………………………………………………………………………123

Table S1……………………………………………………………………………..125

Table S2……………………………………………………………………………..125

Table S3……………………………………………………………………………..126

Appendix B

Table 1………………………………………………………………………………160

Table 2………………………………………………………………………………161

Table 3………………………………………………………………………………162

Appendix C

Table 1………………………………………………………………………………194

Table 2………………………………………………………………………………195

Table S1……………………………………………………………………………..201

ABSTRACT

The increasing threat of water scarcity throughout the world has led to the implementation of potable wastewater reuse. During potable wastewater reuse, final treated wastewater effluent is purified to drinking water quality. This is performed to augment current drinking water sources. However, treated wastewater effluent is of degraded quality when compared to conventional drinking water sources, therefore extensive treatment and quality monitoring is required for the protection of public health. Removal of pathogens, particularly viruses, is a major concern during wastewater reuse, as sewage is a significant source of enteric pathogens. Viruses are the smallest of enteric pathogens and have physical attributes which allow for persistence in the environment for extended periods of time while maintaining viability.

Therefore, strict requirements pertaining to virus removal during wastewater reuse are enforced.

Treatment facilities are required to demonstrate the capability of different treatment technologies implemented for virus removal. This is largely done by the spiking of laboratory propagated MS2 coliphage, which is recommended by the National Water Research Institution

Framework for Direct Potable Reuse (2015). Additionally, if membrane processes are implemented, they must undergo continual monitoring ensuring membrane integrity, which is performed by spike evaluations as well as the use of non-viral surrogates such as conductivity and total organic carbon. However, spiking coliphages can quickly become cumbersome at full- scale facilities. Advances in virus detection technology has facilitated the potential use of naturally occurring indicator viruses as a means of evaluating system performance. Wastewater is a rich reservoir of viruses, with non-human viruses greatly outnumbering viral pathogens.

These abundant non-human viruses can be utilized as indicators of viral pathogen fate, allowing

9 for continual monitoring of virus removal performance by a variety of different reuse technologies.

This dissertation summarizes three studies which evaluate the fate of different potential indicator viruses found abundantly in wastewater, and their potential use to model virus removal during wastewater reuse. Evaluated indicators include plant viruses Pepper Mild Mottle Virus

(PMMoV) and Cucumber Green Mottle Mosaic Virus (CGMMV), Bacteroides infecting crAssphage, human adenoviruses (HAdVs), as well as a recently discovered eukaryotic virus, wastewater circular rep-encoding single stranded (CRESS) DNA virus 2 (WCDV-2). Two physical treatment processes were evaluated: soil aquifer treatment (SAT) and integrated ultrafiltration (UF) and reverse osmosis (RO) membrane processes. Removal, persistence, and abundance of the different indicators across these two treatment processes was assessed.

Additionally, metagenomic techniques were utilized across an integrated membrane process to identify groups of viruses which may exhibit an increased propensity to pass through damaged membranes, and thus become a valuable tool in monitoring membrane integrity.

The first study evaluated removal by SAT using PMMoV, crAssphage, and HAdVs.

During SAT, water is infiltrated through the vadose zone and blended with natural groundwater where it can later be extracted. The physicochemical properties of soil allow for additional treatment of water, including pathogen removal. This study examined two SAT sites receiving treated wastewater effluent from the same wastewater treatment plant, yet implementing different operational parameters, including wetting drying cycles and infiltration rates. Both

PMMoV and crAssphage were found most prevalently (100%, n = 6) in the feed water, however greater concentrations of PMMoV were exhibited (6.6 ± 1.0 log10 gc per L). PMMoV also exhibited the highest prevalence in the groundwater (22%, n = 18), where it was frequently

10 detected from an SAT site which utilizes faster infiltration rates as well as shorter wetting drying cycles. Results from this study indicate that PMMoV is a valuable indicator of virus removal, revealing that parameters such as wetting-drying cycles might be influencing subsurface virus transport more than initially understood.

The second study evaluated PMMoV, CGMMV, WCDV-2, and HAdVs as potential indicators of membrane treatment performance. Two pilot-scale and one full-scale integrated UF and RO membrane processes at three different treatment facilities were evaluated. PMMoV and

CGMMV were found prevalently before and after treatment at all three facilities, and differences in their fate were largely indiscernible. WCDV-2 showed potential as a conservative indicator of membrane integrity, however, it exhibited a pattern of regional specificity, reducing the confidence that this novel CRESS virus could be utilized universally. The two pilot facilities exhibited greater log10 reduction values (LRVs) of potential indicators than full-scale, by as much as 2 LRVs. This discrepancy between pilot and full-scale highlights the need for integrity monitoring, as full-scale facilities utilize 100 times as many membranes as a pilot scale facility, increasing the chances of a non-integral membrane to go undetected and allow for the passage of pathogens.

The final study utilized next generation sequencing across a pilot-scale integrated UF and

RO membrane process, evaluating the presence of RNA and DNA viruses in the feed water, RO concentrate, and the final permeate. Over 6,000 individual operational taxonomic units (OTUs) were determined in this study, with the majority being prokaryotic viruses (bacteriophages).

CRESS viruses, which are among the smallest of eukaryotic viruses, were found to increase in relative abundance after treatment by UF and RO, providing further evidence that these small viruses have an increased propensity to pass through membrane damage and thus potentially

11 provide a sensitive estimator of membrane integrity. Interestingly, no members of Virgaviridae were present in RO permeate, likely due to lowered sensitivity of sequencing methods. However, the presence of OTUs belonging to Tombusviridae, a group of icosahedral, singe stranded RNA plant viruses, in permeate samples suggests that other plant viruses might be more resistant to physical removal than Virgaviridae members.

Overall, the conclusions of these studies have provided valuable information regarding the potential use of virus indicators that are found abundantly in wastewater. PMMoV has showed promising capabilities as an indicator of virus removal during both SAT and membrane processes. It allows for the evaluation of different parameters of SAT, as well as exposes the weaknesses of membrane processes at full-scale. The closely related CGMMV provides similar information, and metagenomic analysis performed found many abundant members of the genus

Tobamovirus in treated wastewater effluent, opening the possibility of exploring removal of

Tobamoviruses as a whole. However, neither of these Virgaviridae members were detected during metagenomic analysis of RO permeate. CRESS viruses have potential to play an important role regarding membrane integrity evaluation, as exhibited by their prevalence and diversity in membrane permeate streams, however more research determining CRESS viruses common to different water sources is required. Overall, naturally occurring viruses seem to provide an alternative method of evaluating LRVs and membrane integrity during wastewater reuse, without the need to spike coliphages.

INTRODUCTION

1. Background

It is projected that many regions throughout the world will experience freshwater shortages in the near-future (Veettil & Mishra, 2020). These shortages have already begun to take place within the United States, particularly in states such as California and Texas (Howitt et al., 2014; Steinle-Darling, 2015). In response to water shortages, lower-quality drinking water sources, such as treated wastewater effluent, have been utilized in an effort to augment current freshwater sources (Reznik et al., 2019). The use of treated wastewater effluent as a drinking water source, referred to as potable reuse, can be performed directly on treated effluent (direct potable reuse) or after passage through an environmental buffer (indirect potable reuse) (US

EPA, 2012).

Treated wastewater effluent has the potential to contain human pathogenic viruses, such as noroviruses and enteroviruses (Haramoto et al., 2018). The removal of such pathogens during potable reuse is imperative, as even low concentrations of pathogenic viruses can have a profound effect on human health risks (Haas et al., 1993). Rather than constantly monitoring final drinking water for viral pathogens, which will likely go undetected due to the increased quality of the water and current limits of detection, each treatment process is allocated a log10 reduction value (LRV) credit, based on recommendations set by state regulatory agencies as well as demonstrated capability. The total accumulated LRV credits must reach a target value which assures that the risk of infection is lower than 1 in 10,000 infections per year. (CCR, 2015;

Mosher & Vartanian, 2018; NWRI, 2013; TWDB; 2015).

Current methods for demonstrating LRV credit potential largely depend on the spiking of

MS2 coliphage, which resembles many enteric viruses and can be easily propagated and

13 enumerated (NWRI, 2013; US EPA 2005). However, certain treatment processes, such as membrane processes, require regular monitoring of membrane integrity to receive LRV allocation, making continuous spiking of MS2 impractical (Pype, Lawrence, et al., 2016).

Additionally, other physical treatment processes, such as full-scale soil aquifer treatment (SAT), treat large quantities of water, and the number of phages necessary to spike and demonstrate efficient removal can quickly become unmanageable. A non-spiked virus indicator which occurs naturally in treatment streams would be valuable for the demonstration of virus LRVs. There has been research conducted evaluating many potential indictor viruses, such as Pepper Mild Mottle

Virus and crAssphage, during wastewater and drinking water treatment (Farkas et al., 2019; Kato et al., 2018; Kitajima et al., 2014; Schmitz et al., 2016; Tandukar et al., 2020). However, there are fewer studies evaluating potential indicators of virus removal during wastewater reuse, particularly during physical removal treatments such as membranes or natural filters (SAT).

2. Objectives

The research presented in this dissertation aims to explore naturally occurring indicator viruses in the context of physical treatment of wastewater intended for reuse. There are three major objectives, evaluated in three separate manuscripts included in Appendices A-C.

2.1 Objective 1 The first objective was to evaluate naturally occurring virus indicators during full-scale soil aquifer treatment (SAT), directly comparing two sites receiving the same treated effluent.

Potential indicators Pepper Mild Mottle Virus (PMMoV), crAssphage, and human adenoviruses

(HAdVs) were evaluated along with enteroviruses. Different operational parameters of SAT were evaluated through the inclusion of two different sites which differed in wetting-drying cycles as well as infiltration rates. Groundwater was also collected downstream in the direction

14 of groundwater from the recharge facility, allowing to assess the impact large scale recharge operations have on the surrounding groundwater quality. The prevalence, groundwater concentration, and reduction of indicator viruses were determined to evaluate their potential as indicators of pathogenic virus removal.

2.2 Objective 2 The second objective was to evaluate naturally occurring indicator viruses during membrane treatment of treated effluent. Three different facilities implementing integrated ultrafiltration (UF) and reverse osmosis (RO) membrane processes were evaluated, including one full-scale facility. Potential indicators PMMoV, Cucumber Green Mottle Mosaic Virus

(CGMMV), wastewater circular rep-encoding single stranded (CRESS) DNA Virus 2 (WCDV-

2), and HAdVs were evaluated before and after membrane treatment. The prevalence, concentration, and reduction of indicator viruses was determined to evaluate their potential as use as indicators of membrane integrity, a factor that must be regularly monitored to receive

LRV credit attribution.

2.3 Objective 3 The third objective was to utilize next generation sequencing of viral genomes to determine viral groups which have potential to serve as indicators of membrane integrity and performance. Samples were collected across a pilot-scale integrated UF and RO system treating wastewater effluent, including the system feed, final permeate, and RO concentrate. RNA and

DNA viral genomes were sequenced and analyzed, with an emphasis on selecting viral groups present across all sampling locations. Viral groups which persist through membrane treatment can be further evaluated as potential virus indictors of membrane integrity.

3. Dissertation Format

The research utilized to meet the described objectives were prepared, separately, as manuscripts for submission to peer-reviewed journals and included in Appendices A, B, and C.

The overall results and conclusions of the three studies are summarized in section 4 (“Present

Study”). The samples were collected, when possible, and processed by the author (Christina

Morrison), with assistance by Justin Clark, Sarah Abney, Anna Gresham, and Dr. Walter

Betancourt. Bacteriophage assays which are summarized in Appendix C Supplemental

Information were conducted by the author (Christina Morrison), with assistance by Alex Ignell and Justin Clark. All nucleic acid extractions, reverse transcription, amplification, analysis, sequencing preparation, and statistical analysis were performed by the author. Major contributions in the form of bioinformatic pipeline assistance and processing in Appendix C is credited to collaborator and co-author, Dr. Karyna Rosario of University of South Florida, St.

Petersburg, College of Marine Science.

LITERATURE REVIEW

1. Potable Water

1.1 Water Scarcity Access to freshwater is necessary for society to flourish. It is required to support a populations consumption needs, grow food crops, raise food stock, as well support industrial production (Oki & Quiocho, 2020). Despite there being more than enough freshwater to currently sustain the global population, it is considered a limited resource in many regions due to its spatial and temporal variation across the globe (Mekonnen & Hoekstra, 2016). Additionally, extreme global population growth and increasing quality of life combined with global climate change and aging infrastructure has made access to freshwater even more limited (Ercin &

Hoekstra, 2014; Vörösmarty et al., 2000). It is estimated that over two billion people, globally, are living in water stressed environments (Kummu et al., 2016), and this number is likely to grow.

Even within more developed regions, such as the United States, there are ongoing water shortages (Veettil & Mishra, 2020). The lower Colorado river basin is predicted to have the highest scarcity in both surface water as well as soil moisture (Veettil & Mishra, 2020), yet despite this, it continues to be an agriculturally productive region (Berardy & Chester, 2017).

Agriculture is a water intensive industry, yet it is necessary for the prosperity of the region both economically as well as physically (i.e. access to food). As populations in many of these water scarce regions continue to grow, there will be a need for proper allocation of current water supplies (Joseph et al., 2020), as well as the potential to utilize new sources for potable drinking water production (Reznik et al., 2019).

1.2 Drinking Water Treatment

Within the United States, there are specific water quality criteria that any water distributed for potable purposes must meet to ensure the safety of consumers (US EPA, 2019a).

These criteria can vary depending on the source of the drinking water, as well as the contaminant of concern. Reduction or elimination of harmful chemicals and microorganisms is a primary concern during drinking water production (Davis, 2010). However, there are also many aesthetic concerns regarding odor, taste, and visibility of drinking water. The United States Environmental

Protection Agency (US EPA) sets enforced regulations for constituents which negatively affect human health (National Primary Drinking Water Regulations), as well as suggested standards for constituents which only affect aesthetic quality (Secondary Drinking Water Standards) (US EPA,

2019a; US EPA, 2019b). There are several conventional drinking water treatment processes that can be employed to accomplish these goals, and the necessity and implementation of such technologies is dependent on the quality of the source water (US EPA, 2017).

Conventional drinking water treatment processes include, but are not limited to, coagulation/flocculation with clarification, lime-soda ash treatment, ion exchange, pressure- driven membrane processes, and disinfection using chemical treatment or ultraviolet (UV) radiation (Alexander & Mcclanahan, 1975; Arar et al., 2014; Bruggen et al., 2003; Gyürek &

Frinch, 1998; Matilainen et al., 2010). A combination of several of these treatment processes are usually implemented to ensure that the final product water is fit for consumption (Davis, 2010).

Selection of treatment schemes is largely dependent on the source water quality and cost

(Crittenden et al., 2012; Hamouda et al., 2009).

Prior to disinfection, drinking water treatment mainly consists of a combination of chemical or physical treatments to reduce natural organic material (NOM), hardness, and any other chemical contaminants that might be present in the source water (Davis, 2010).

Disinfection is utilized primarily for reduction of pathogens (Gyürek & Frinch, 1998). There are multiple disinfectants that can be used for this purpose; however, the addition of chemical oxidants is largely the most common method (AWWA, 2000). Hypochlorous acid (HOCl), ozone (O3), chloramine (NH2Cl), and chlorine dioxide (ClO2) are commonly used chemical disinfectants (Crittenden et al., 2012). Non-chemical disinfection techniques include exposure to

UV radiation. Most disinfectants have a Ct (concentration x time) value which is associated with a specific removal of pathogens (Ellis, 1991; Gyürek & Frinch, 1998).

Many of these techniques (HOCl, NH2Cl, ClO2) can leave a residual disinfectant in the drinking water to control of bacterial growth in the distribution system and reduce contamination which may occur during distribution (LeChevallier, 1999). However, one of the drawbacks of utilizing chemical disinfectants is the potential for the formation of harmful disinfection by- products (DBPs) (Boorman et al., 1999). Many disinfectants can react with NOM to create chemicals which can be harmful to human health. Selection of a disinfectant is often a compromise between pathogen reduction capability, residual formation, and the risk of DBP formation (Chowdhury et al., 2007).

1.3 Potable Wastewater Reuse Increasing freshwater shortages have required water-scarce regions of the world to utilize non-traditional drinking water sources, such as treated municipal wastewater (Grant et al., 2012).

Municipal wastewater is primarily composed of human excreta and contains considerable amounts of nitrogen, phosphorous, organics, as well as pathogenic organisms (Butler et al., 1995;

Metcalf & Eddy, 2014). In the early 20th century, municipal wastewater was discharged directly into the environment without treatment, usually in a body of water (Lofrano & Brown, 2010).

However, untreated wastewater has a considerable biological oxygen demand (BOD), which can

19 deplete rivers and lakes of dissolved oxygen, causing wildlife such as fish to die (Balmat, 1957;

Lofrano & Brown, 2010). Additionally, major inputs of nitrogen and phosphorus can result in algal blooms, which can similarly reduce oxygen levels as well as produce toxins (Anderson et al., 2002; Carey & Migliaccio, 2009).

In response to increasing pollution of water sources, the United States government passed the Clean Water Act (CWA) in 1972, following the formation of the US EPA (US EPA, 2002).

The CWA established the National Pollution Discharge Elimination System (NPDES), which set minimum standards for any discharge of wastewater into surface water. Wastewater effluent must meet specific criteria for nutrients (nitrogen and phosphorous species), BOD, organics, chemicals, and pathogens to protect both human and environmental health. To meet these criteria, extensive treatment must be performed on the raw wastewater, particularly for removal of nutrients and BOD (Davis, 2010; Metcalf & Eddy, 2014).

Advances in wastewater treatment has resulted in high quality treated effluent, a small portion of which has been reused for both potable and non-potable purposes (Miller, 2006;

Reznik et al., 2019). Ghernaout (2017) estimated that the US produces 45 million cubic meters per day of treated effluent, a value which has likely grown larger in recent years. The total reuse of treated effluent could augment a significant portion of current freshwater reserves (Reznik et al., 2019). Potable wastewater reuse falls into two separate categories (US EPA, 2012): Direct potable reuse (DPR), which refers to directly performing drinking water treatment utilizing advanced treated wastewater effluent as a source; and indirect potable reuse (IPR), which is the discharge of wastewater effluent into the environment prior to drinking water treatment, which serves as an environmental buffer.

Currently, there are no federal regulations for potable wastewater reuse in the US

(Mosher & Vartanian, 2018), therefore individual states are required to form guidelines which meet the requirements and goals of the state. Texas and California were the first states in the US to set framework for potable reuse of wastewater, with additional states following suit (CCR,

2015; Mosher & Vartanian, 2018; TWDB, 2015). Regulations follow requirements set forth by the US EPA Safe Drinking Water Act. However, they also set stringent target removal values for pathogens, which are of high concern as wastewater is a reservoir of fecal-associated pathogens

(Gerba et al., 2017; Haramoto et al., 2018; Pype et al., 2016a). Each treatment process is awarded a specific log10 reduction value (LRV), and the entirety of the treatment process must meet the final log10 reduction goal, which varies both by pathogen of concern and state (CCR,

2015; Mosher & Vartanian, 2018; NWRI, 2013; TWDB; 2015).

2. Microbial Water Quality of Wastewater: Viruses

2.1 General Microbiology of Wastewater Human excreta (feces, urine) is a primary constituent of wastewater, and it contains high concentrations of microorganisms, including many human pathogens (Aw, 2018). Pathogens excreted in human feces (enteric pathogens) span a wide array of microbial taxonomical classifications, including bacteria, protozoan parasites, helminths, and viruses (Faust et al., 1939;

Fayer et al., 2004; Simmons & Xagoraraki, 2011; Viswanathan et al., 2009). Enteric pathogens are spread through the fecal oral route, usually resulting in gastroenteritis (Bosch, 1998;

Christensen, 1989; Guerrant & Bobak, 1991; Viswanathan et al., 2009). However, some fecal associated pathogens can cause more severe disease, including, but not limited to, typhoid fever, hepatitis, and hemolytic-uremic syndrome (Aw, 2018; Buckle et al., 2012; Krugman & Giles,

1970; Noris & Remuzzi, 2005). Fecal-oral pathogens are readily waterborne, allowing for potential widespread transmission (Leclerc et al., 2002). Common fecal pathogens of concern include Escherichia coli O157:H7, Cryptosporidium oocysts, Giardia lamblia cysts, enteroviruses, noroviruses, and many more. A list of fecal pathogens included in the EPA

Contaminants of Concern List (CCL) 4 are provided in Table 1 (US EPA, 2016).

Pathogen reduction was not a major goal of wastewater treatment in the US, historically, regulations were created for protection of environmental health (Lofrano & Brown, 2010).

However, in 1993, high concentrations of Cryptosporidium oocysts were discharged into surface water from a wastewater treatment plant in Milwaukee, WI. This plant was located upstream of the drinking water treatment facility, which had experienced a treatment failure which resulted in the largest waterborne disease transmission event in US history (Mac Kenzie et al., 1994).

Table 1: Microbial species included in the US EPA Contaminants of Concern List 4

Bacteria Viruses Protozoan Parasites Campylobacter jejuni Adenovirus Naegleria fowleri Escherichia coli (O157) Caliciviruses Helicobacter pylori Enterovirus Legionella pneumophila Hepatitis A Virus Mycobacterium avium Salmonella enterica

2.2 Viruses Of all microorganisms present in sewage, viruses are among the most challenging to remove during treatment due to their unique properties (Fong & Lipp, 2005). Viruses are the smallest replicating organisms and exist as obligate parasites of both eukaryotic and prokaryotic cells (Condit, 2013). They lack the ability to metabolize, and therefore are unable to perform any

22 energetic activities such as respiration, growth, or reproduction on their own. In fact, viruses are solely comprised of nucleic acid (DNA or RNA) protected by a protein capsid which in some cases is surrounded by a lipid envelope (Rossmann & Johnson, 1989). Despite this simplicity, they maintain the ability to enter host cells using a variety of physical and chemical mechanisms inherent to the structure of the virus and the cell and manipulate cellular functions to produce progeny viruses (Helenius, 2013).

Viruses spread through the fecal-oral route are otherwise known as enteric viruses. They exhibit an icosahedral geometry, range in size from 20 to 100 nm, and largely exhibit a negative charge at neutral pH (Fong & Lipp, 2005; Rusinol & Girones, 2017). Enteric viruses can cause a variety of both acute and chronic diseases, including gastroenteritis, hepatitis, poliomyelitis, and some, such as polyomaviruses, have been associated with cancer (Bodian, 1955; Coelho et al.,

2013; Feng et al., 2008; FitzSimons et al., 2010; Kaplan et al., 1982). They are particularly sufficient in surviving outside of the gut for extended periods of time, allowing them to easily spread through water sources (Xagoraraki et al., 2014).

2.3 Viruses & Wastewater Treatment/Reuse Historically, improper treatment and disposal of wastewater has resulted in viral contamination of recreational waters, shellfish consumed by humans, as well as fresh produce

(Bernard et al., 2014; Bosch, 1998; Sano et al., 2016). This is an ongoing issue in much of the developing world which lacks the resources for proper waste management (Naughton &

Mihelcic, 2017). Despite this, many wastewater treatment plants exhibit relatively low virus

LRVs from raw sewage to final effluent (Kitajima et al., 2014; Prado et al., 2019; Sano et al.,

2016; Schmitz et al., 2016; Scott et al., 2003).

It is unsurprising that when reusing wastewater for potable purposes, viruses require much larger removals than bacteria or protozoan parasites in current US frameworks (Table 2).

Target LRVs are estimated using a risk modelling approach, assuming worst case scenario (very high virus concentrations, as would occur during a major outbreak), and a final risk of less than one illness in 10,000 exposures, per year (CCR, 2015; Haas et al., 1993; NWRI, 2013).

Currently, states are opting to choose between one of these three previously established LRV schemes (Mosher & Vartanian, 2018). While it appears that Texas requires less removal than

California or National Water Research Institute (NWRI) guidelines, it should be noted that Texas attributes LRVs from treated effluent to final product water, not including wastewater treatment reduction. California and NWRI attribute LRVs from raw wastewater to final product water.

Prior to receiving an LRV attribution, the plant must demonstrate its capabilities of removing pathogens to the levels required by the state, usually through a pilot demonstration (CCR, 2015;

Mosher & Vartanian, 2018; NWRI, 2013; TWDB, 2015).

Table 2: LRV requirements from key entities in the United States

Minimum Log10 Reduction Values Enteric Cryprosporidium Total Coliform Entity Giardia Virus spp. Bacteria Texas Commission on 8 5.5 6 NA Environmental Qualitya State of Californiab 12 10 10 NA National Water Research 12 10 NA 9 Instituteb aLRV is calculated from directly after conventional wastewater treatment to final product water bLRV is calculated from raw wastewater to final product water

2.4 Indicators of Virus Removal

LRV attribution in reuse schemes requires validation of virus removal. However, concentrations of pathogenic viruses in sewage and treated effluent are variable, and often not at levels that could successfully validate an 8 – 12 LRV (Haramoto et al., 2018; Rosario, Symonds, et al., 2009). Spiking pathogenic viruses at each step to validate overall LRV is often not feasible, nor would it be safe. Therefore, non-pathogenic viruses are often utilized as a process indicator (Pepper, 2015).

A good process indicator should (i) be present in higher concentrations than human pathogenic viruses throughout treatment, (ii) be removed less efficiently than human pathogenic viruses (conservative estimation), (iii) correlate well with human pathogenic viruses, and (iii) be easy to detect, and applicable across many treatment processes (Ahmed et al., 2020; Pepper,

2015). Currently, there is a lack of available research which evaluates potential indicators during advanced treatment of wastewater; most examine conventional wastewater only (Ahmed et al.,

2020). Despite this, there are many potential candidates of virus removal process indicators.

2.4.1 Spiked Bacteriophages A common method to evaluate treatment performance is to spike feed water with MS2 bacteriophage. MS2 bacteriophage has a history of being utilized as a surrogate tracer for enteric viruses in studies examining subsurface travel of viruses (Anders & Chrysikopoulos, 2005;

Attinti et al., 2010; Betancourt et al., 2019; Chrysikopoulos & Syngouna, 2012; O’Luanaigh et al., 2012; Pang, 2009; Powelson et al., 1993; Syngouna & Chrysikopoulos, 2013). MS2 is an F+ specific single stranded, positive sense, RNA coliphage which infects particular strains of

Escherichia coli, a fecal coliform (Strauss & Sinsheimer, 1963). It physically resembles many enteric viruses, with a 24 – 36 nm diameter, non-enveloped capsid, and an isoelectric point

25 ranging from 2.2 to 3.6 (Kuzmanovic et al., 2003; Michen & Graule, 2010). It presents no health hazards to humans, and simple plaque assays exist to quantify infectious viruses.

Current NWRI Guidelines for Potable Reuse recommend the usage of spiked MS2 bacteriophage as an on-site LRV validation method (NWRI, 2013). Additionally, the US EPA recommends the use of MS2 as a direct integrity test for membrane processes (US EPA, 2005).

In a review comparing bacteriophage removal across various membrane processes, it was found that spiked MS2 bacteriophage outperformed T4 bacteriophage as well as indigenous bacteriophages as an indicator of virus removal, as it was removed more conservatively

(Amarasiri et al., 2017). Despite these promising recommendations, it is often not feasible to regularly perform spike studies at full scale, as this requires the propagation of large volumes of high titer phages, which can be cumbersome, time consuming, and costly (Pype, Lawrence, et al., 2016). Additionally, MS2 plaque assays assess infectious particles, and water quality characteristics can cause aggregation of virus particles, which can result in misleading plaque counts (Gerba & Betancourt, 2017).

Other bacteriophages which have been used as process indicators include, but are not limited to, φX174, PRD1, Qβ, Fr, and P22 (Amarasiri et al., 2017; Gerba et al., 1991; Heffron et al., 2019; Shirasaki et al., 2009; B. Wu et al., 2017), however none have been as thoroughly evaluated as MS2. At the bench and pilot scale level, there is support for the use of multiple bacteriophages with different physical characteristics, allowing for a more in-depth understanding of overall virus removal (Boudaud et al., 2012; ElHadidy et al., 2014; Heffron et al., 2019).

2.4.2 Indigenous Bacteriophages

Rather than spiking feedwater with high concentrations of MS2 or another bacteriophage, bacteriophages that are indigenous to wastewater have been evaluated as indicators of virus removal (Amarasiri et al., 2017; Funderburg & Sorber, 1985; Quanrud et al., 2003; US EPA,

2015; J. Wu et al., 2010; Zhang & Farahbakhsh, 2007). Using indigenous bacteriophages eliminates the need for cumbersome propagation, while also allowing for the evaluation of non- laboratory strain viruses. Specifically coliphages, which infect coliforms present in fecal material, have been of interest as an overall virus water quality indicator due to their prevalence in raw wastewater and their close association to fecal material (Havelaar et al., 1993; Nappier et al., 2019; Ogorzaly et al., 2009; Palmateer et al., 1991; Skraber et al., 2004; US EPA, 2015).

Coliphages can be separated into two categories: somatic coliphages which infect host cells through cell wall receptors, and F+ specific coliphages which infect the host F+ sex pili (US EPA,

2015). Each of these categories have standardized detection methods (US EPA, 2001). In a review conducted by Amarasiri et al., (2017), indigenous bacteriophages were found to have higher LRVs than pathogenic viruses, making them potentially less useful as a process indicator, however evaluation is limited to only a small sample of studies.

2.4.3 Pepper Mild Mottle Viruses & Other Members of Tobamoviridae Pepper Mild Mottle Virus (PMMoV) is a plant pathogen of the genus Tobamovirus. It contains a positive sense, single stranded, RNA genome, and infects members of the nightshade plant family (Fauquet et al., 2005). It is a non-enveloped, rod-shaped virus, approximately 300 nm in length and 18 nm in diameter, with an isoelectric point of ~3.7 (Michen & Graule, 2010;

Wetter et al., 1984). It was found to be the most abundant RNA virus in fecal material, with concentrations of 109 genomic copies (gc) per gram feces (Zhang et al., 2006). Unsurprisingly, it was found abundant in both treated and untreated wastewater, and quickly was recognized as a

27 potential indicator of fecal pollution in the environment, and eventually as a process indicator during water/wastewater treatment (Kitajima et al., 2018; Rosario et al., 2009; Rosario et al.,

2009; Symonds et al., 2018).

Since the realization of its abundancy in feces, it has been utilized in many virus removal studies across wastewater, drinking water, and wastewater reuse schemes (Betancourt et al.,

2014; Betancourt et al., 2019; Haramoto et al., 2013; Kitajima et al., 2014; Sangsanont et al.,

2016; Schmitz et al., 2016; Shirasaki et al., 2017; Tandukar et al., 2020). It has shown to be overall resistant to many treatments, often resulting in the lowest LRVs when compared to pathogenic enteric viruses and other indicators, making it useful as a conservative indicator.

There exist other plant pathogens of the genus Tobamovirus that are similarly found in high concentrations in fecal material and have similar properties to PMMoV (Zhang et al., 2006).

Tobacco Mosaic Virus (TMV) has been evaluated as a potential virus process indicator in a singular study (Tandukar et al., 2020), and there are no published studies evaluating Cucumber

Green Mottle Mosaic Virus (CGMMV), despite both of these members of Tobamovirus being among the most abundant plant RNA viruses in treated wastewater effluent (Bačnik et al., 2020).

However, the overall shape of plant viruses such as PMMoV and CGMMV are unlike enteric pathogenic viruses, and more research is needed to evaluate the correlation of LRVs of plant viruses and human pathogenic viruses (Ahmed et al., 2020; Kitajima et al., 2018).

2.4.4 CrAssphage CrAssphage is a novel, circular double stranded DNA bacteriophage, which was discovered using bioinformatic techniques and found to be highly abundant across gut metagenomes available from National Center for Biotechnology Information (NCBI) databases

(Dutilh et al., 2014). It is likely to infect members of Bacteroides spp., a highly abundant and

28 specific, anaerobic, gut bacterial species, making it very likely to be closely associated with fecal contamination (Shkoporov et al., 2018). It is found abundantly in human feces and wastewater

(Ahmed et al., 2018; Wu et al., 2020), and seemingly correlates well to pathogenic virus removal during wastewater treatment in the limited studies available (Farkas et al., 2019; Tandukar et al.,

2020). CrAssphage exhibits potential as a virus removal process indicator during wastewater and advanced wastewater treatment due to its abundance and closer resemblance to human pathogenic viruses, however more research is needed for a proper evaluation.

2.4.5 Single stranded DNA Viruses Circular, single stranded, DNA viruses, which are amongst the smallest viruses which infect mammals, make up a significant portion of sewage viromes (Kraberger et al., 2015).

Human bocavirus, a member of the family Parvoviridae, has been evaluated as a potential indicator of fecal pollution. It has exhibited variable presence in untreated wastewater (51-100%)

(Blinkova et al., 2009; Hamza et al., 2017; Iaconelli et al., 2016; Myrmel et al., 2015), however there insufficient research examining its removal during wastewater or water treatment and its relation to other human enteric viruses.

Members of a group of viruses referred to as circular rep encoding single stranded

(CRESS) DNA viruses have been found to be abundant in untreated wastewater (Blinkova et al.,

2009; Cantalupo et al., 2011; Kraberger et al., 2015). These viruses are largely undescribed, however those that are described range from 15-40 nm (Zhao et al., 2019). Eukaryotic CRESS

DNA viruses have recently unified to the virus phylum Cressdnaviricota (Krupovic et al., 2020), and they have been shown to infect a wide range of host species, from mammals to plants (Zhao et al., 2019). Despite the abundance of these very small viruses, there has been no research evaluating CRESS viruses as potential indicators of virus removal during treatment.

3. Virus Detection

3.1 Concentration Methods The historical neglect of virus monitoring in wastewater related contexts could largely be attributed to the lack of simple and reliable methods, particularly for highly treated waters.

Highly treated waters contain viruses at relatively low concentration. To overcome limits of detection associated with downstream detection techniques, viruses must first be concentrated from the sample. This can be performed using a variety of techniques that utilize the size and/or physicochemical properties of the viruses themselves, and oftentimes several concentration steps are utilized in series.

3.1.1 Primary Concentration Primary concentration usually consists of the passage of a large volume of water through a membrane. One method that is recommended by the US EPA for enteric virus detection in water is the use of an electropositive cartridge microporous filter (US EPA, 2014). The use of charged filters is referred to as a virus adsorption-elution (VIRADEL) method, and this type of method utilizes the surface chemistry of the virus and the filter, as well as the sample and elution buffer, to concentrate viruses from large volumes (Sobsey et al., 1979). Two microporous filters are recommended by the US EPA for electropositive filtration: 1MDS (Cuno Division, Meriden,

USA) and NanoCeram (Argonide Corporation, Sanford, FL) (US EPA, 2014). Despite the electropositive charge on both membranes, they are constructed with different materials and filter configurations, which result in significantly different costs (Ikner et al., 2011). Despite

NanoCeram being the less costly option, it has resulted in sufficient recoveries of various enteric viruses types (Betancourt et al., 2018; Cashdollar et al., 2013; Ikner et al., 2011).

At neutral pH, most enteric viruses exhibit a negative net capsid charge due to their low isoelectric point (Michen & Graule, 2010). Therefore, passage through the electropositive filter

30 allows for viruses to preferentially adhere. After the sample passage, the filter is soaked in a basic (pH ~9) buffer solution. Buffer solutions are often either 1.5-3% beef extract (BE), or multivalent anion solution such as 1% sodium polyphosphate (NaPP) (Cashdollar et al., 2013;

Ikner et al., 2011). The anions (NaPP) or charged organic material (BE) in the buffer solution have a stronger association to the positively charged filter than the viruses, effectively displacing them back into solution, where they can be collected and be concentrated further or directly analyzed after neutralizing the pH (Ikner et al., 2011).

Another VIRADEL method is the use of an electronegative filter. Despite most enteric viruses exhibiting a negative charge at neutral pH, proper sample pre-treatment can allow for virus adsorption to like-charge filters (Katayama et al., 2002; Sobsey et al., 1973; Wallis &

Melnick, 1967) .This method is applicable for medium sized sample volumes or 10 L or less,

(Katayama et al., 2002) as well as large sample volumes of 100 liters or more (Hata et al., 2014;

Sobsey et al., 1973). Briefly, pre-treatment consists of adding a divalent cation to solution

(MgCl2) which facilitates virus adhesion to negatively charged membranes through cation bridging, rinsing the filter with 200 mM H2SO4, followed by elution using a basic buffer solution. Variations of this method has exhibited a range of recoveries of spiked enteric viruses

(<0.01% to 77%) (Haramoto et al., 2009; Hata et al., 2014; Katayama et al., 2002), yet has been utilized in several studies examining virus reductions during wastewater and drinking water treatment (Asami et al., 2016; Kitajima et al., 2014; Schmitz et al., 2016).

Popular primary concentration methods which do not rely on surface chemistry properties include various forms of hollow-fiber ultrafiltration, including dead-end ultrafiltration (DEUF) and tangential flow ultrafiltration (TFUF). An added benefit of these methods is that they can be used for the simultaneous concentration of viruses, bacteria, and protozoan parasites, as it is

31 based solely on size exclusion mechanisms (Haramoto et al., 2018). For DEUF, samples are passed through the ultrafilter, leaving all particulate matter on the surface of the membrane

(Smith & Hill, 2009). Particulate matter, including viruses and bacterial species, are then eluted from the filter using a buffer comprised of salts and surfactants. TFUF operates on similar principles, however the flow is manipulated in such a way that the retentate is continuously recovered and re-circulated across the membrane (Shi et al., 2017). Sufficient recoveries of viruses and other microbes for both UF based methods has been previously demonstrated

(Francy et al., 2013; Kahler et al., 2015; Mull & Hill, 2012; Rhodes et al., 2011; Smith & Hill,

2009).

3.1.2 Secondary Concentration Due to inherent detection limits in downstream quantification, oftentimes a single concentration event is not enough to detect viruses in environmental samples, therefore secondary concentration techniques are implemented. Secondary concentration methods vary greatly in mechanisms, and no singular method is more sufficient than the rest. The secondary concentration method recommended by the US EPA for detection of enteric viruses in water is organic flocculation (US EPA, 2014). This method manipulates the pH of the eluted samples, so that the surface chemistry of the organic material in the solution form flocs and precipitate out of solution, which can be resuspended in a smaller volume of NaPP. This method has shown decreased recovery when compared to other methods (Betancourt et al., 2018).

Other methods which utilize pH changes or solution addition to manipulate the physical or chemical nature of the particulate matter to precipitate out of solution include skim milk flocculation (SMF) and polyethylene glycol precipitation (PEG). While SMF was originally developed to concentrate volumes of ~ 10 L (Calgua et al., 2008), it has recently been optimized

32 for smaller volumes with a higher overall recovery (Falman et al., 2019). PEG was originally developed to concentrate proteins from solution (Ingham, 1984), and was swiftly utilized for the recovery of viruses (Lewis & Metcalf, 1988). PEG and viruses interact in solution such that they adhere together and allow the viruses to obtain a high enough molecular weight to be precipitated out of solution. This method has been primarily utilized as a primary concentration for sewage (Lewis & Metcalf, 1988; Shieh et al., 1995), but has shown sufficient recoveries when utilized as a secondary concentration method (Falman et al., 2019).

Centrifugal ultrafiltration is another technique utilized as a secondary concentration method. Primary eluates are placed into the ultrafiltration unit, which is then centrifuged at high speed to produce enough pressure to pass the samples through the filter, leaving the viruses in the retentate. This method is simple and has demonstrated reliable recoveries (Betancourt et al.,

2018; Hata et al., 2014; Ikner et al., 2011; Katayama et al., 2002). Because it is a size exclusion technique based on molecular weight cutoffs much smaller than viruses, it suffers less biases which could occur when utilizing surface properties of viruses, as capsid charge can vary widely amongst viruses.

3.2 Virus Detection Methods Virus detection methods have evolved significantly throughout the history of environmental virology and is still the main limiting factor in our understanding of virus fate and transport in the environment. Each method provides different types of information and no singular method is perfect, the selection of the proper detection method largely depends on the goal of the study, i.e. whether virus viability, physical removal, or overall virus community is of interest.

3.2.1 Cultural Methods

For many years, before the advent and popularization of molecular techniques, infectivity assays using secondary cell lines were the gold standard in virus detection in water. Infectivity assays allow for the detection of infectious viruses by applying viruses to healthy cell lines and observing them in the following days for cytopathic effects (CPE), depending on the virus and cell line used (Gerba & Betancourt, 2019). This method only provides confirmation of infectious virus, however, different dilutions of the original sample can be analyzed and statistical methods used to estimate a probable original concentration, such as in a 50% tissue culture infectious dose

(TCID50) or most probable number (MPN) method, or in some cases a plaque assay can be performed in which distinct plaques are able to be counted to infer concentration, though this is largely dependent on virus and cell type (Morris, 1985).

While this method provides valuable information regarding the viability of the viruses being detected in water, there are several drawbacks as outlined in Gerba & Betancourt (2019).

Infectivity assays are very time consuming, as it takes several days to first prepare the cell line, and then up to two weeks for some cell lines to begin to see CPE (Cashdollar et al., 2016). The cells themselves can suffer cytotoxicity from other constituents in the environmental sample, which is particularly relevant when assessing wastewater related samples which may contain a wide variety of different contaminants. However, one of the largest drawbacks is the limitations as to which viruses can be detected (Dahling, 1991). Only a small percentage of enteric viruses can be detected using cell culture, and multiple cell lines would be needed to analyze this small percentage (Gerba & Betancourt, 2019). While there is considerable ongoing research for development of new cultural methods for detection of previously un-culturable viruses (Todd &

Tripp, 2019), the advent of new cultural methods is very slow and unlikely to keep up with newer molecular based technologies.

3.2.2 PCR-Based Methods The development of the polymerase chain reaction (PCR) (Mullis et al., 1986), as well as the process of utilizing reverse transcriptase prior to PCR (RT-PCR) (Rappolee et al., 1988), has greatly impacted detection and monitoring viruses in water. PCR and RT-PCR allow for the detection of viral nucleic acids in a matter of hours. PCR methods were further improved by the addition of a fluorescence probe, which allows the PCR to be monitored in real time, and also allows for quantification of the original genomic copies prior to amplification (Mackay et al.,

2002). This method is known as real-time quantitative PCR (qPCR), and is the most prominent method for quantification of viruses in water (Haramoto et al., 2018).

While the variety of viruses able be quantified via qPCR remains limitless, there are nonetheless drawbacks to this method. One major drawback is the inability to differentiate between viable and non-viable viruses (Bosch et al., 2011; Gerba & Betancourt, 2019; Haramoto et al., 2018). This can lead to overestimations of human-health risk associated to virus levels in water, as qPCR values are usually larger than actual infectious viruses (Pecson et al., 2011;

Rodríguez et al., 2009). There have been several methods developed to partially overcome this limitation, most of which make viruses with damaged capsids, or damaged genomes, unable to undergo amplification, assuming that a virus with either capsid or genome damage cannot be infectious (Leifels et al., 2019; Parshionikar et al., 2010; Pecson et al., 2011; Torrey et al., 2019).

In a different approach, PCR-based techniques and cell culture methods have been integrated together, allowing for more rapid detection of infectious viruses, as PCR allows for the detection of virus genomes in the early stages of replication (Reynolds et al., 1996). This method, however, is still limited by the number of viruses able to be propagated in cell culture.

An additional drawback to the use of qPCR for virus quantification in water, is its sensitivity to inhibitory substances that are often concentrated along with viruses. Inhibitors of

35 qPCR are not well understood, and only a few inhibitory substances, such as humic acids, have been identified (Gentry-Shields et al., 2013; Schrader et al., 2012). Without proper inhibition control, many samples analyzed by qPCR will appear as false negatives. Current inhibition monitoring consists of adding appropriate controls to samples and diluting with water until inhibitors no longer mask amplification (Gibson et al., 2012). However, this comes with the risk of diluting your sample until your target is below the limit of detection, thus producing a false negative. There are sample processing techniques that have been developed to reduce the presence of inhibitors, including addition of substances to the PCR reaction that interact with inhibitory substances (Wang et al., 2007), or sample pre-treatment prior to extractions (Asami et al., 2016; Canh et al., 2019), among others. None of these mitigation effects work effectively on every sample type, and some result in a loss of virus recovery which can, once again, result in a false-negative result. A more sophisticated PCR-based quantification method has been developed, known as digital droplet PCR (ddPCR) (Hindson et al., 2011), that has been shown to reduce the effect of inhibitors due to the nature of the technique (Racki et al., 2014; Sedlak et al.,

2014; Taylor et al., 2017).

3.2.3 Metagenomics As molecular-based detection techniques continued to improve, the ability to determine the genetic sequences of organisms has grown immensely, to the point where we are now able to determine the majority of different sequences in a given environmental sample at once (Wooley et al., 2010). Next-generation sequencing technologies allow for high throughput, high coverage, reads across multiple genomes, allowing a non-targeted approach to exploring the total community of viruses in a sample (Nieuwenhuijse & Koopmans, 2017; Wooley et al., 2010).

These methods have been used to directly detect and monitor several pathogenic viruses at once

(Bibby et al., 2011; Bibby & Peccia, 2013), however there is evidence that for direct pathogen monitoring, targeted detection methods such as qPCR might still exhibit the greatest sensitivity

(Fernandez-cassi et al., 2018). However, it seems that a valuable application of these tools is for the detection of potential indicator viruses (Bibby et al., 2019). These approaches have already led to the discovery of several valuable viral indicators of fecal contamination, such as PMMoV and crAssphage (Dutilh et al., 2014; Rosario, Symonds, et al., 2009; Zhang et al., 2006).

Despite the ability to be able to rapidly discover new potential indicators through next generation sequencing, there are still many limitations to the techniques. Viromic analysis alone gives no indication as to the potential host of the newly discovered virus. Comparison to phylogenetically related viruses may give probable insight host identification (Greninger et al.,

2009), however it is not guaranteed that there will be enough of a shared lineage to other viruses to make concrete conclusions (Dutilh et al., 2014). This can be problematic for virus indicator identification, as correlation to fecal pollution is desirable (Ahmed et al., 2020). Additionally, as described in Bibby et al., (2019), developing PCR assays from genomes constructed with limited samples gives minimal insight into the diversity of that particular genome. The utilization of viromic techniques for the discovery of new virus indicators is still in its infancy, and it is likely that many of these issues will be resolved in the coming years.

4. Virus Removal by Physical Treatment

4.1 Physical Treatment Overview The primary mechanism for virus removal during water treatment or wastewater reuse is the addition of a chemical, or physical, disinfectant such as hypochlorous acid (HOCL) or UV radiation (Xagoraraki et al., 2014). However, there are many issues that are associated with the

37 use of disinfectants, such as the formation of DBPs which can be harmful to human health

(Boorman et al., 1999). UV radiation, which is a physical treatment that does not form DBPs, has been shown to be less effective for viruses such as human adenoviruses, which are highly abundant in wastewater effluent and therefore could potentially be an issue when considering potable reuse (Eischeid et al., 2009; Haramoto et al., 2018; Rames et al., 2016). Physical treatment processes, which rely on the physical removal of contaminants by utilizing a barrier that inhibits the transport of contaminants, are readily used in treatment schemes for removal of residual organic compounds as well as trace chemical contaminants (Drewes et al., 2003).

However, these processes also contain the ability for physical removal of pathogens, such as viruses, through an assortment of both size exclusion and physical-chemical mechanisms (Asami et al., 2016). Despite this, virus removal through physical processes remains under-studied, particularly regarding wastewater reuse at full-scale.

4.2 Soil Aquifer Treatment Soil Aquifer Treatment (SAT) is a natural physical treatment process which is a major component in indirect potable reuse (Drewes et al., 2003). During SAT, treated wastewater effluent is spread into a recharge basin, where it percolates into the soil, through the vadose zone, until it eventually reaches the water table. The water mixes with natural groundwater and eventually is extracted for reuse purposes. The mixing with groundwater provides a natural buffer, which is a requirement of indirect potable reuse (US EPA, 2012). However, an added benefit of allowing the treated effluent to percolate through the vadose zone, is that the physicochemical properties of the soil allows for additional removal of contaminants such as residual organics, trace chemical compounds, as well as pathogens (Bitton & Harvey, 1992;

Drewes et al., 2003; Schijven & Hassanizadeh, 2000; Wilson et al., 1995).

Virus transport in the subsurface environment has been well characterized, particularly at the bench and pilot scale. To efficiently remove viruses during SAT, their transportation through the subsurface must be inhibited. There are several mechanisms which limit transport, however the two most prominent are filtration and adsorption (Gerba & Goyal, 1985). The efficiency of these processes for removal is highly dependent upon pathogen type (bacteria, protozoa, virus, etc.) as well as properties of the soil and source water.

Filtration, also referred to as straining, is a prominent factor limiting transport of both bacteria and protozoan parasites. Filtration through porous media, such as soil, is largely dependent on size-exclusion mechanisms. Pathogens which are small enough to enter the porous media, but are larger than the media pore size, will likely become entrapped in pores

(McDowell-Boyer et al., 1986). Entrapped microorganisms effectively reduce media pore sizes, allowing for straining of even smaller microorganisms and particles (Gerba & Goyal, 1985).

Because the mechanism of straining is largely dependent on the pathogen being larger in size than soil pores, this mechanism is more effective for larger pathogens such as bacteria or protozoan parasites. Due to their small sizes, straining is virtually ineffective for viruses.

The prominent factor influencing virus transport through soil is adsorption. At environmental pH, many bio-colloids, such as viruses, exhibit a negative surface charge (Bitton

& Harvey, 1992). Virus adsorption behavior can be described by colloid interaction theory, known as Derjaguin Landau Verway and Overbeek (DLVO) theory (Derjaguin & Landau, 1941;

Verway & Overbeek, 1948). DLVO theory predicts that aggregation of oppositely charged particles happens instantaneously, with forces being so strong that the process is almost irreversible (Hermansson, 1999). For particles of similar charge, which is often the case in natural systems, aggregation can only occur when particles reduce the distance between one

39 another, allowing for attractive Van der Waal forces to increase. This is not easily attainable, as charged particles exhibit an electric double layer which acts repulsively when approaching a particle of similar charge. However, the size of the electric double layer is highly influenced by the ionic strength of the solution. Solutions at high ionic strengths, which often is the case for water traveling through soil, allow for compression of the electric double layer. Once this double layer is compressed, less energy is required for particles to approach one another and aggregate

(Hermansson, 1999).

There are many factors which may influence virus adsorption in the subsurface environment. One major influence are the inherent soil characteristics. There is a large variety of different soil types which exist throughout the world. Soil can be highly variable within the same region and can show a large amount of variation by depth (Gerba & Goyal, 1985).

Characteristics which distinguish one soil from another includes, but is not limited to: size distribution, ion-exchange capacity, surface roughness, organic matter content, and pH. These characteristics will influence how far microbes might be transported into the subsurface (Stevik et al., 2004).

There are three major size classifications of soils: sand, silt, and clay. The smallest soil particle is a clay particle, which also exhibits the largest surface area and cation exchange capacity. Because of this, clay tends to display the highest efficacy for microbe removal via adsorption (Gerba & Goyal, 1985). However, soils with a large clay composition tend to retain more water and are more prone to clogging, thus allowing for less efficient flow to groundwater.

It has been found that a good compromise between water flow and microbial retention is through the use of sandy loam, which has soil particles small enough for adsorption to occur, but large enough to discourage clogging and channeling (Quanrud et al., 2003).

The presence of organic matter as well as pH levels can also influence the transport of pathogens through soil. The surface charge of many clay particles can be affected by changing pH levels (Stevik et al., 2004). Surface charge can affect the ability of the clay to adsorb colloidal particles, as described by DLVO theory. It has been found that soils with a pH < 5 are more efficient at removing various microbes (Gerba & Goyal, 1985). Organic matter is oftentimes charged and can also be adsorbed to clay particles, affecting the space available for pathogens to adsorb (Zhuang & Jin, 2003). Because soil features dictate the transport abilities of the pathogen, it is imperative to understand the soil composition of the proposed SAT site.

Similarly, to soil, both effluent pH and organic matter content will affect pathogen transport through the soil subsurface. However, there are other factors which need to be taken into consideration. As previously described, the ionic strength of the solution plays a significant role in determining the rate of adsorption to soil particles. Ionic strength of effluent, while percolating through the soil, tends to be high due to high concentrations of salt in the soil.

However, there are events which can dilute the soil, such as extreme rainfall (Hermansson,

1999). A decrease in ionic strength can potentially allow for pathogens to desorb from soil particles and move further in depth. Additionally, the rate at which effluent is infiltrated through the recharge basin plays a significant role in pathogen transport. The application of effluent at low flow or infiltration rates, tends to allow for microorganisms to more readily be strained or adsorbed to soil particles (Gerba & Goya, 1985). Effluent applied at infiltration rates which allow for flooding (i.e. saturated flow), allows for greater movement of pathogens through soil depths (Lance & Gerba, 1984).

Much of the information on pathogen removal by SAT comes from bench scale soil column studies and field studies of fully operational and pilot SAT sites. Soil column studies are

41 bench scale studies in which a column of a specified length and volume is packed with a soil of the researcher’s choice. Water with specific characteristics, depending on the goal of the study, is fed through the column. Water samples are usually collected at various distances down the columns, with column effluent continuously measured until breakthrough occurs. One of the benefits of conducting a study on this scale is that the column design parameters, such as soil type, infiltration rate, and flow saturation level, can be controlled by the researcher. A drawback of column studies is that scaling up is not always directly translational.

Lance & Gerba (1984) examined the effect of saturated versus unsaturated flow in a 250 cm soil column. Poliovirus was spiked to sewage effluent and administered to the column at a low flow rate for three days, to represent an unsaturated flow. Thereafter, the effluent-poliovirus mixture was administered at a much higher flow rate, and the column was allowed to flood for three days. Lance & Gerba (1984) found that with unsaturated flow, virus reached depths of 40 cm, and at saturated flow viruses reached depths of 160 cm. This indicates that to prevent breakthrough of virus to groundwater, SAT sites should operate below the maximum infiltration rate, resulting in unsaturated flow.

Quanrud et al. (2003) similarly spiked treated effluent with poliovirus and infiltrated the mixture through a 1.3 m column. However, removal of naturally occurring coliphages were also assessed. The spiked effluent was infiltrated below the maximum (unsaturated flow), and two types of soils, a sand and a sandy loam (finer grained), were assessed for virus removal. Both viruses exhibited greater removal in the finer grained soil than the sand, as was expected. They found a maximum of 2 log10 removal of coliphage in this study. Additionally, Quanrud et al.

(2003) simulated rainfall using a water with low ionic strength and found that adsorbed coliphage were detached and transported further down the column.

Zhuang & Jin (2003) examined the influence of organic matter in the applied water source on the transportation of two bacteriophages, MS2 and φX174. They found that both mineral associated organic matter and dissolved humic acid allowed for greater transportation down the column for MS2, but minor variation for φX174. However, the surface properties of the two phages are different, highlighting the fact that there is not one solution for every organism.

Soil column studies generally agree with theory and models regarding pathogen transportation during SAT. However, it is important to understand how well results from bench- scale column studies scale to fully operational SAT sites which contain heterogenous substrata that is not easily replicated at bench scale. To accomplish this, field studies must be performed.

There are two major categories of field studies: studies in which effluent is spiked with a known value of a surrogate organism, and studies which evaluate the removal of pathogens, or indicators of pathogens, which naturally occur in the treated wastewater effluent. In general, there are few field studies which examine pathogen removal by SAT.

Field studies in which non-pathogenic surrogate organisms are spiked into effluent are limited to pilot scale studies prior to construction of the fully operational SAT site. Gerba et al.

(1991) spiked bacteriophages MS2 and PRD1 to treated effluent which was subsequently applied to a pilot scale (3.6m x 3.6m) recharge basin and assessed for removal at different depths. They found 1 to 2 log10 removals for both phages at saturated flow, and higher removals for unsaturated flow. In a similar study performed by the same group at the same sight, concentration profiles of MS2 and PRD1 were determined which indicated preferential flow of virus through the soil (Powelson et al., 1993).

There are also very few field studies which evaluate the removal of pathogens common to treated wastewater effluent at fully operational SAT sites. Betancourt et al. (2014) detected viruses in groundwater associated with a 5-day SAT retention time but did not detect any viruses in the groundwater associated with a 14-day SAT retention time. They found 2-6 log10 removal depending on virus type. Elkayam et al. (2015) reviewed monitoring data from the Shafdan wastewater treatment system in Israel, which has been implementing SAT of treated wastewater effluent for over 30 years. Between the years 1995 and 2015, well water continuously tested negative for fecal coliforms. Between 2001 and 2015, well water continuously tested negative for enterovirus by cell culture, examining volumes of 400 L. The authors postulate that the few positives that do occur, are within the expected rate of false positives. The recharge basins which facilitate infiltration of treated effluent have an aquifer retention rate of 960 days, which likely accounts for their high rate of non-detects.

4.3 Integrated Membrane Processes Membrane processes refer to the implementation of semi-permeable membranes that physically separate contaminants and other constituents from water based on either the size, molecular weight, or diffusive properties of the contaminant (Davis, 2010). They are broadly categorized into two groups of processes: low pressure and high-pressure membrane processes.

Low pressure membrane processes include micro- and ultrafiltration (MF, UF), which are designed to remove suspended particulate matter from solution. MF and UF differ from each other in membrane pore size. MF refers to a membrane pore size greater than 0.1 µm, and is not efficient for removal of viruses using size-exclusion alone, though interactions with membrane material may offer some removal (Antony et al., 2012; US EPA, 2005). High pressure membrane processes include nano-filtration (NF) and reverse osmosis (RO). These membranes

44 are designed for removal of dissolved material, down to the ionic scale, and their mechanism of exclusion is based on the ability of a material to dissolve through the membrane, rather than pass through pores (Peters, 2010). High pressures must be applied to allow water molecules to act against osmotic forces and dissociation with ions and other solution constituents.

UF membranes have been increasingly implemented for water treatment and wastewater reuse (Al Aani et al., 2020; Ferrer et al., 2013). They are usually designed as hollow fibers with a nominal pore size of 0.01 µm and MWCOs ranging from 10,000 to 50,000 Daltons (US EPA;

2005). This MWCO should not allow for the passage of large microbes (bacteria, protozoan parasites), as well as most viruses, based on average sizes (Pepper, 2015). RO membranes have historically been implemented in drinking water treatment facilities for either desalination or water softening purposes (Ghernaout, 2017a), and it was not until the early 1990’s when its ability for pathogen reduction was utilized (US EPA, 2006). It is understood that due to the nature of RO membranes, pathogens of concern such as protozoan parasites, bacteria, and viruses are unable to diffuse through the membrane, and thus should be efficiently removed from the permeate. The combination of these two membranes (UF followed by RO) is often implemented in reuse schemes, as it allows for greater membrane performance and reduces the biofouling potential of RO membranes (Ang et al., 2015; Tang et al., 2018).

Despite the inherent ability of both UF and RO membranes to reject viruses, there is thorough evidence that significant breakthrough of viruses can occur (Adham et al., 1998;

Kruithof et al., 2001; Mi et al., 2004; Pype et al., 2016b; Vickers et al., 2019). Imperfections during manufacturing can allow the passage of contaminants, which limits the ability of membrane processes to act as a perfect barrier. In addition, there are many connectors and O-ring seals which can cause leaks (Pype et al., 2016a; US EPA 2005), as well the membranes

45 themselves can be damaged during operation (Ferrer et al., 2013; Vickers et al., 2019). This has been shown to reduce the effectivity membrane processes to remove pathogens, particularly viruses (Lee et al., 2019).

Due to these limitations, LRVs are only attributed for viruses on the basis of membrane integrity monitoring (Antony et al., 2012a; US EPA 2005). Current integrity monitoring tests are separated into two categories: direct and indirect. Direct testing usually occurs when the system is off-line and measures the integrity of the membrane itself, using a vacuum decay test or direct spiking of a specific marker. Indirect testing is largely a monitoring effort which evaluates the quality of the permeate, rather than the membrane itself, and uses this information to infer the integrity of the membrane. This is usually performed using surrogates for virus removal such as conductivity or total organic carbon (TOC) (Pype et al., 2016a). LRVs of these surrogates are conservative when compared to viruses. Additionally, they can be monitored online, without a disruption of process. Removal credit attribution for viruses is still limited when monitoring for either of these surrogates, as detection methods for conductivity and TOC are not yet sensitive enough to intuit minor membrane damage that may allow for the passage of viruses (Pype et al.,

2016a). However, it has been shown that integral membranes can remove viruses at much higher levels, therefore the lack of an accurate and affordable integrity monitoring test is the major hurdle in receiving a higher attribution of credits (Antony et al., 2012; Ferrer et al., 2013; Pype et al., 2016a; Vickers et al., 2019).

The spiking of MS2 coliphage has largely been used as a direct integrity challenge test to validate the membrane process, and its use has been recommended in the US EPA Membrane

Filtration Guidance Manual (US EPA, 2005). Most of our current knowledge of virus rejection by RO or UF membranes is through MS2 challenge testing at the bench and pilot scale (Adham

& Jacangelo 1994; 1995; Antony et al., 2016; Ferrer et al., 2015; Hornstra et al., 2019; Hu et al.,

2003; Jacangelo et al., 1991; Kitis et al., 2003; Kreißel et al., 2012; Madireddi et al., 1997; Mi et al., 2004; Pype et al., 2016b) with only a handful of published studies that examine virus removal at full scale (Kruithof et al., 2001; Regel et al., 2012; Vickers et al., 2019). The lack of data at full scale is likely a symptom of the impracticality of spiking with MS2 in general, which is described in Pype et al., (2016a). Briefly, while the techniques to culture MS2 are simple, they are time intensive and require high cost and effort at full scale, due to the need to propagate such large volumes and concentrations of phages to be able to determine goal LRVs. Another drawback, as was noted in Hornstra et al., (2019), is that some countries do not allow for the spiking of any microbiological substance into facilities used to produce drinking water.

The use of viruses that are naturally occurring in treatment systems for integrity testing has largely been considered unfeasible due to likely low concentrations in source water (Antony et al., 2012). However, membrane processes have more recently been implemented into wastewater reuse schemes (Bartels et al., 2005; Tang et al., 2018), in which the source water will have greater concentrations of naturally occurring viruses, as wastewater treatment usually does not provide a large reduction of viruses (Haramoto et al., 2018; Kitajima et al., 2014; Schmitz et al., 2016; Scott et al., 2003). The use of a natural indicator virus would allow for integrity monitoring to be performed on-line, and advances in detection technologies, i.e. the use of molecular detection techniques such as quantitative polymerase chain reaction, allow for quicker quantification methods as well as the evaluation of total physical removal. There have been few studies evaluating naturally occurring viruses during either UF or RO. Indigenous phage removal in river water was evaluated during pilot-scale treatment by UF with LRVs ranging from less than one to three (Ferrer et al., 2015; Otaki et al., 1998). Removal of PMMoV and Noroviruses

GI and GII during pilot-scale UF treatment of treated effluent was found to range from less than one to four, depending on the damage level of the membranes (Lee et al., 2019). Hornstra et al.,

(2019) were able to demonstrate LRVs of greater than seven using indigenous novel viruses during pilot-scale RO treatment of surface water. All results of virus removal during either UF or

RO, at any scale, are summarized in Table 3.

Table 3: Summary of LRV studies examining UF or RO at various treatment scales

Membrane Scale Material/Parameters Solution Virus LRV Reference Hollow Fiber PES Tap water/DI UF Bench MS2 2.5-6 Kreißel et al., 2012 (0.02 um) water;Surface water Hollow Fiber PES Tap water/DI UF Bench phiX174 2.5-4.5 Kreißel et al., 2012 (0.02 um) water;Surface water UF Bench Hollow fiber PVDF UF Di with different pH MS2 3.7 Elhadidy et al., 2013 3.7 (pH 6.5), 2.5 UF Bench Hollow fiber PVDF UF Di with different pH phiX174 Elhadidy et al., 2013 (pH 9.4) Hollow Fiber PVDF UF Bench Surface Water MS2 3.5-6 ElHadidy et al., 2014 UF (2--56 nm) Hollow Fiber PVDF UF Bench Surface Water phiX174 3-5.9 ElHadidy et al., 2014 UF (2--56 nm) Hollow fibre CA (100 UF Bench Tap water MS2 5.7-6.4 Pierre et al., 2011 Kda) Hollow fibre CA (100 UF Bench Tap + NaCl MS2 5.6-5.7 Pierre et al., 2011 Kda) Hollow fibre CA (100 DI + 1 or 9 g/L NaCl UF Bench MS2 5-6 Pierre et al., 2011 Kda) or PBS UF Bench PA Tap water MS2 ~2 Hu et al., 2003 UF Bench PS Tap water MS2 ~1 Hu et al., 2003 UF Pilot 0.035 uM DI MS2 3.0 - 4.0 Jacangelo et al., 2005 UF Pilot 100 KDA Surface Water MS2 >7.0 Jacangelo et al., 1991 UF Pilot 100 KDA Surface Water MS2 >6.7 Jacangelo et al., 1991 UF Pilot 100 KDA Surface Water MS2 >6.5 Jacangelo et al., 1991 UF Pilot 100 KDA Surface Water MS2 >7.2 Jacangelo et al., 1991 UF Pilot 100 KDA (CE) Surface Water MS2 >6.0 Adham & Jacangelo, 1994 UF Pilot 100 KDA (CE) Surface Water MS2 >6.0 Adham & Jacangelo, 1994 UF Pilot 101 KDA (CE) Surface Water MS2 >6.0 Adham & Jacangelo, 1994

Membrane Scale Material/Parameters Solution Virus LRV Reference UF Pilot 500 Kda (PT) Surface Water MS2 6 Adham & Jacangelo, 1994 UF Pilot 500 Kda (PT) Surface Water MS2 3 Adham & Jacangelo, 1994 E.coli K12 Hollow fiber PE (0.1 UF Pilot River water indigineous <1 to 2 Otaki et al., 1998 um) phages E. coli C Hollow fiber PE (0.1 UF Pilot River water indigenous 2-3 Otaki et al., 1998 um) phages Hollow fiber PVDF UF Pilot (0.03 um 200 Kda) and River water MS2 >4 Boudaud et al., 2012 PES (100KDa) Hollow fiber PVDF UF Pilot (0.03 um 200 Kda) and River water QB >4 Boudaud et al., 2012 PES (100KDa) Hollow fiber PVDF UF Pilot (0.03 um 200 Kda) and River water GA 1.6 Boudaud et al., 2012 PES (100KDa) Indigenous Hollow fiber PVDF UF Pilot River water somatic 2.8 Ferrer et al., 2015 (0.04 um) coliphages Indigenous Hollow fiber PVDF UF Pilot River water F-specific 3 Ferrer et al., 2015 (0.04 um) coliphages < 1 to > 1 UF Pilot ND Reclaimed water NoVGI depending on Lee et al., 2019 damage 1 to > 3 UF Pilot ND Reclaimed water NoVGII depending on Lee et al., 2019 damage ~1 to ~4 UF Pilot ND Reclaimed water PMMoV depending on Lee et al., 2019 damage

Membrane Scale Material/Parameters Solution Virus LRV Reference

UF Pilot ND Surface Water GA 3.02 Ferrer et al., 2015

UF Pilot ND Surface Water MS2 2.81 Ferrer et al., 2015 UF Pilot ND Surface Water PRD1 >5.0 Ferrer et al., 2015 UF Pilot UFG10 Secondary Effluent MS2 5.3 Madireddi et al., 1997 Hollow fiber PVDF UF Full Secondary Effluent MS2 1.18-3.96 Regel et al., 2012 (0.04 um) UF Full ND Surface Water MS2 5.4 Kruithof et al., 2001 RO Bench CA Tap water MS2 ~4 Hu et al., 2003 5-6 (intact RO Bench Composite PA Saline solution MS2 Mi et al., 2004 membrane) ~4.6 to >6 depending on Synthetic salt water / RO Bench ND MS2 module set up Pype, Donose, et al., 2016 filtered effluent and membrane age

RO Bench PA Tap water MS2 ~5 Hu et al., 2003

RO Bench PA-TFC DI MS2 >6.7 Madireddi et al., 1997 RO Bench PA-TFC DI MS2 5.6 Madireddi et al., 1997 RO Bench PA-TFC DI MS2 2.7 Madireddi et al., 1997 Polyamide, new and >6.3 (new), 2.8- RO Bench Saline solution MS2 Antony et al., 2016 aged 4.1 aged RO Bench RO CA DI MS2 >4.9 Madireddi et al., 1997 RO Bench RO CA DI MS2 4.6 Madireddi et al., 1997 Novel RO Pilot ND Surface Water > 7.0 Hornstra et al., 2019 viruses RO Pilot ND Surface Water MS2 >7.0 Hornstra et al., 2019

Membrane Scale Material/Parameters Solution Virus LRV Reference Filtered secondary RO Pilot ND MS2 ~3 to > 6 Kitis et al., 2003b, 2003a effluent RO Pilot ROSG/Ag4040 Secondary Effluent MS2 6.7 Madireddi et al., 1997

RO Full ND Surface Water MS2 3.0-4.8 Kruithof et al., 2001 4-6 depending RO Full ND Effluent MS2 on membrane Vickers et al., 2019 integrity Disc filter, biotreatment, Full ND Effluent HAdV 2.65 Prado et al., 2019 MBR, RO, ClO2 Disc filter, biotreatment, Full ND Effluent JCPyV 2.3 Prado et al., 2019 MBR, RO, ClO3 Disc filter, biotreatment, Full ND Effluent RVA 2.9 Prado et al., 2019 MBR, RO, ClO4

PRESENT STUDY

The overall goal of this research was to evaluate viruses that are found naturally in wastewater as potential indicators of virus removal during physical treatment of wastewater for reuse purposes. A natural indicator would allow for regular monitoring of treatment process performance without the need of spiking bacteriophages or relying on non-biological surrogates which might not accurately reflect the fate and transport of viruses during advanced wastewater treatment. Three studies were conducted evaluating potential indicator viruses during various treatment processes as well as utilizing different approaches. The major findings will be summarized in this section, and more detailed information regarding methods, analyses, and discussion is provided in Appendices A-C.

The first study (Appendix A), evaluated a suite of potential indicator viruses during full- scale soil aquifer treatment (SAT). Potential indicators include Pepper Mild Mottle Virus, crAssphage, and human adenoviruses (HAdVs). Additionally, enteroviruses (EVs) were included in the study to represent human pathogenic viruses. Two SAT sites within the Sweetwater

Recharge Facility (SWRF), which receive tertiary treated wastewater effluent from the same wastewater treatment plant, were evaluated for virus removal. Additionally, groundwater downstream in the direction of ground water flow from the recharge facility was collected to assess viral water quality of the surrounding areas. The two SAT sites had various differences between them, including: length of operation, infiltration rates, and wetting-drying cycles.

Six groundwater samples were collected over the duration of one year from wells EW-

008A, WR-069B, and WR-398A. EW-008A is a production well associated with a set of recharge basins that has been in operation for less than 10 years. This set of basins exhibited infiltration rates of 0.5 meters per day and were operated with wetting-drying cycles of one day

53 of infiltration followed by four days of drying. WR-069B is a monitoring well associated with the oldest set of recharge basins at SWRF, operating for over 30 years. Infiltration rates are slower at this set of basins, nearly half the rate of basins associated with EW-008A. Additionally, wetting-drying cycles are much longer at this site, consisting of one day of infiltration followed by 14 dry days. WR-398A is a monitoring well directly downstream in the direction of groundwater flow from SWRF.

Potential viral indicators were detected by either quantitative polymerase chain reaction

(qPCR) or reverse transcription qPCR (RT-qPCR), depending on genome composition, in treated effluent being fed to the basins, and in the groundwater, to determine log10 reduction values (LRVs). Prevalence of indicators as well as correlation of the two non-human viruses to

HAdVs were also assessed. Groundwater from EW-008A, associated with the newest set of basins with faster infiltration rates and shorter wetting-drying cycles, had an increased prevalence in indicator viruses when compared to groundwater from the oldest set of basins.

PMMoV was detected in 33% of groundwater samples from this site, and crAssphage was detected in 17% of groundwater samples. None of the target viruses were detected in groundwater from WR-069B. HAdVs and EVs were not detected in any groundwater samples.

Groundwater from WR-398A, downstream of SWRF, contained quantifiable PMMoV in 33% of samples, while crAssphage remained undetected.

Results from this study provide evidence that basin operational parameters, such as wetting- drying cycles, may influence virus transport through the vadose zone. Additionally, due to the detection of PMMoV in groundwater from the areas surrounding SWRF, it indicates that recharge of treated wastewater effluent may be impacting the groundwater quality outside of production regions. PMMoV exhibited the highest prevalence in feed water (100%) and

54 groundwater (22%) and exhibited LRVs ranging from 5.8 to greater than 6. However, its concentrations did not correlate well with HAdVs, a human pathogenic virus. Nonetheless, its prevalence and high abundance, as well as its propensity to be detected further downstream of recharge sites, provide evidence of its usefulness. CrAssphage displayed less prevalence in groundwater (6%) but was able to be detected in feed in 100% of the samples. It exhibited more conservative removal values when compared to PMMoV (3.4 to greater than 4.2) and correlated stronger with HAdVs. These results suggest that more investigation of crAssphage as a process indicator of virus removal is warranted. Overall, this study suggests that non-human indicator viruses display great potential for estimating virus removal performance, exploring methods to increase virus removal at full-scale, and evaluate the environmental impact of managed aquifer recharge practices.

The second study (Appendix B) evaluated a suite of potential indicator viruses during treatment by integrated ultrafiltration (UF) and reverse osmosis (RO) membrane processes. Virus targets included PMMoV, Cucumber Green Mottle Mosaic Virus (CGMMV), wastewater circular rep-encoding single stranded (CRESS) DNA virus 2 (WCDV-2), and human adenoviruses (HAdVs). This was the first study in which CGMMV and a CRESS virus were evaluated for their use as process indicators in any capacity. Three integrated membrane processes were evaluated, two pilot and one full-scale operations, each located in different cities and receiving treated wastewater effluent of various quality.

Facility A is a pilot-scale membrane process located at the University of Arizona Water

Energy & Sustainable Technology (WEST) Center which receives tertiary treated effluent from a nearby full-scale wastewater treatment plant. Facility B is a full-scale membrane process within an advanced wastewater treatment facility located roughly 170 km away from facility A. Facility

C is a pilot-scale membrane process which receives treated effluent from a man-made wetland structure developed to provide primary and secondary treatment to wastewater collected from a singular large office building. It is part of a small-scale reuse facility and is located over 1,000 km away from facility A. Facilities A and C are comparable in number of membrane units being employed, whereas facility B utilizes over 100 times as many membrane at once.

Virus targets were detected via qPCR/RT-qPCR before and after treatment by UF and RO to determine LRVs as well as prevalence in feed and permeate samples. Both pilot-scale facilities (A and C) exhibited higher LRVs than the full-scale facility B, for all detected viruses.

Removal during pilot-scale treatment at facility A ranged from greater than 2.6 to 5.8, and facility C LRVs ranged from 5.1 to 6.0, both dependent on virus targets examined. Full-scale facility B LRVs ranged from 2.8-3.4. The discrepancy in LRVs highlight the necessity for evaluation of virus removal at full-scale, where the multitude of different membrane processes being utilized simultaneously provides a higher chance of membrane damage to go undetected, allowing the passage of viruses present in feed water.

Both PMMoV and CGMMV exhibited the highest prevalence in both feed (50-100%) and permeate (43-100%). PMMoV and CGMMV concentrations were largely indistinguishable in both feed and permeate, with the exception being feed water from facility A, where PMMoV concentration was significantly higher than CGMMV (p < 8.3e-03). Nonetheless, both targets had similar concentrations in permeate samples at the same facility, indicating that CGMMV might be more resistant to treatment via membrane processes. Both PMMoV and CGMMV are members of the same viral genus, Tobamovirus, and the distinction between them, in this study, was negligible. Results from this study indicate that Tobamoviruses, in general, have great

56 potential as process indicators, and further research into the fate and transport of Tobamoviruses as a whole would be beneficial.

WCDV-2, which was discovered originally in the feed waters from facility A, exhibited prevalence similar to PMMoV and CGMMV at the same facility. However, it was only detected in one permeate sample collected at facility B, and was unable to be detected in the feed water from both facilities B and C. Due to its decreasing prevalence with increasing distance from facility A, it is suggested that this novel virus might exhibit regional specificity, and thus would not make a valuable candidate as a universal indicator of membrane integrity. However, its behavior at facility A suggests that it has an increased ability to pass through membrane damage.

Despite being detected at lower and more variable concentrations in the feed water, it was statistically indistinguishable from both PMMoV and CGMMV in the permeate. The results from this study suggest that further research into CRESS viruses which exhibit less regional specificity might be of use as a process indicator for membrane integrity.

Overall, this was the first study to evaluate CGMMV and CRESS viruses as potential viral process indicators, the first study to assess the removal of naturally occurring viruses at full- scale, and the first study to directly compare the use of potential viral indicators across membrane treatment facilities of varying scales and spatial distribution. Results from this study highlight the need for validation of potential indicators of membrane integrity at full-scale, as results can vary drastically. Both members of Tobamovirus evaluated in this study showed potential as a process indicator of membrane integrity, due to prevalence and ease of detection in both feed and permeate. The CRESS virus selected for this study exhibited regional specificity that made it less likely to be a valuable process indicator, however further research of this understudied group of viruses common to wastewater may provide better candidates. With

57 further evaluation, naturally occurring indicator viruses may provide a solution for an online integrity monitoring technique.

The third study (Appendix C) uses next generation sequencing techniques across a pilot- scale integrated UF and RO membrane process to determine viral groups which might benefit from further evaluation as potential indicators of membrane integrity. This is a non-targeted approach which allows for the determination of all abundant viral groups based on the presence of their genomes. Samples from the feed, RO concentrate, and permeate were collected on three separate dates and both viral RNA and DNA sequences were determined using Illumina technologies and extensive bioinformatic tools.

Over 6,000 individual operational taxonomic units (OTUs) were determined from the nine total samples. The majority of the OTUs were bacteriophages, with largely undetermined host species. Hosts of the bacterial class gammaproteobacteria were found to contribute the largest percentage of phages with a suspected host. Overall RNA diversity was low, with the majority of feed and concentrate RNA groups consisting of phages from the family Leviviridae. A major finding of the study is the increase in relative abundance of CRESS viruses in RO permeate when compared to feed and concentrate. Permeate streams are dominated by CRESS members as well as the ssDNA bacteriophages of the family Microviridae. These results indicate that the majority of viruses passing through both UF and RO membranes are small, icosahedral, ssDNA viruses.

Statistical analysis of the feed, concentrate, and permeate streams show low overlap in viral groups shared between each sampling location. This indicates a large portion of viruses detected in feed water may be lost during treatment by UF, however further research is needed to validate this. Interestingly, no members of Virgaviridae, which contains the genus Tobamovirus, were

58 detected in permeate samples. This contrasts with the second study (Appendix B), in which members of Tobamovirus were detected up to 62% of permeate samples at the same facility. This is likely due to lower sensitivity of sequencing processes, which may indicate that RNA and

DNA viruses detected in permeate streams from this study are more abundant than members of

Tobamovirus, including icosahedral plant viruses from the family Tombusviridae, which were detected in RO permeate.

Overall, results from this study narrowed down several virus groups for further evaluation as natural indicators of membrane integrity. This was the first study which utilized a non- targeted sequencing approach to screen for viral groups which have shown an increased facilitation to pass through membrane damage. This application of indicator selection has the potential to be used for other advanced wastewater treatment processes, where the use of natural indicators is limited due to the relatively high quality of the water.

REFERENCES

Adham, S. S., & Jacangelo, J. G. (1994). Assessing the reliability of low pressure membrane

systems for microbial removal. Paper presented at the National Conference on

Environmental Engineering on Critical Issues in Water and Wastewater Treatment, Boulder,

CO.

Adham, S. S., Jacangelo, J. G., & Laine, J. M. (1995). Low-pressure membranes: Assessing

integrity. Journal - American Water Works Association, 87, 62–75.

Adham, S. S., Trussell, R. S., Gagliardo, P. F., & Trussell, R. R. (1998). Rejection of MS-2 virus

by RO membranes. Journal / American Water Works Association, 90(9), 130–135.

https://doi.org/10.1002/j.1551-8833.1998.tb08505.x

Ahmed, W., Kitajima, M., Tandukar, S., & Haramoto, E. (2020). Recycled water safety: Current

status of traditional and emerging viral indicators. Current Opinion in Environmental

Science and Health, 16, 62–72. https://doi.org/10.1016/j.coesh.2020.02.009

Ahmed, W., Lobos, A., Senkbeil, J., Peraud, J., Gallard, J., & Harwood, V. J. (2018). Evaluation of

the novel crAssphage marker for sewage pollution tracking in storm drain outfalls in

Tampa, Florida. Water Research, 131, 142–150.

https://doi.org/10.1016/j.watres.2017.12.011

Al Aani, S., Mustafa, T. N., & Hilal, N. (2020). Ultrafiltration membranes for wastewater and

water process engineering: A comprehensive statistical review over the past decade. Journal

of Water Process Engineering, 35(December 2019), 101241.

https://doi.org/10.1016/j.jwpe.2020.101241

Alexander, H. J., & Mcclanahan, M. A. (1975). Kinetics of Calcium Carbonate Precipitation in

Lime-Soda Ash Softening. Journal - American Water Works Association, 67(11), 618–621.

Amarasiri, M., Kitajima, M., Nguyen, T. H., Okabe, S., & Sano, D. (2017). Bacteriophage removal

efficiency as a validation and operational monitoring tool for virus reduction in wastewater

reclamation: Review. Water Research, 121, 258–269.

https://doi.org/10.1016/j.watres.2017.05.035

Anders, R., & Chrysikopoulos, C. V. (2005). Virus fate and transport during artificial recharge with

recycled water. Water Resources Research, 41(10), 1–14.

https://doi.org/10.1029/2004WR003419

Anderson, D. M., Glibert, P. M., & Burkholder, J. M. (2002). Harmful Algal Blooms and

Eutrophication Nutrient Sources, Composition, and Consequences. Zestuaries, 25(4b), 704–

726.

Ang, W. L., Mohammad, A. W., Hilal, N., & Leo, C. P. (2015). A review on the applicability of

integrated/hybrid membrane processes in water treatment and desalination plants.

Desalination, 363, 2–18. https://doi.org/10.1016/j.desal.2014.03.008

Antony, A., Blackbeard, J., & Leslie, G. (2012). Removal efficiency and integrity monitoring

techniques for virus removal by membrane processes. Critical Reviews in Environmental

Science and Technology, 42(9), 891–933. https://doi.org/10.1080/10643389.2011.556539

Antony, A., Branch, A., Leslie, G., & Le-Clech, P. (2016). Impact of membrane ageing on reverse

osmosis performance – Implications on validation protocol. Journal of Membrane Science,

520, 37–44. https://doi.org/10.1016/j.memsci.2016.07.036

Arar, Ö., Yüksel, Ü., Kabay, N., & Yüksel, M. (2014). Various applications of electrodeionization

(EDI) method for water treatment-A short review. Desalination, 342, 16–22.

https://doi.org/10.1016/j.desal.2014.01.028

Asami, T., Katayama, H., Torrey, J. R., Visvanathan, C., & Furumai, H. (2016). Evaluation of virus

removal efficiency of coagulation-sedimentation and rapid sand filtration processes in a

drinking water treatment plant in Bangkok, Thailand. Water Research, 101, 84–94.

https://doi.org/10.1016/j.watres.2016.05.012

Attinti, R., Wei, J., Kniel, K., Thomas Sims, J., & Jin, Y. (2010). Virus’ (MS2, PdblX174, and

Aichi) attachment on sand measured by atomic force microscopy and their transport through

sand columns. Environmental Science and Technology, 44(7), 2426–2432.

https://doi.org/10.1021/es903221p

Aw, T. (2018). Environmental Aspects and Features of Critical Pathogen Groups. In Global Water

Pathogen Project Part One. The Health Hazards of Excreta: Theory and Control (pp. 1–

33).

AWWA. (2000). Committee report: disinfection at large and medium-sized systems. Journal -

American Water Works Association, 92, 32-43.

Bačnik, K., Kutnjak, D., Pecman, A., Mehle, N., Žnidarič, M. T., Aguirre, I. G., & Ravnikar, M.

(2020). Viromics and infectivity analysis reveal the release of infective plant viruses from

wastewater into the environment. Water Research, 177, 115628.

https://doi.org/10.1016/j.watres.2020.115628

Balmat, J. L. (1957). Biochemical Oxidation of Various Particulate Fractions of Sewage. Sewage

and Industrial Wastes, 29(7), 757–761.

Bartels, C. R., Wilf, M., Andes, K., & Iong, J. (2005). Design considerations for wastewater

treatment by reverse osmosis. Water Science and Technology, 51(6–7), 473–482.

https://doi.org/10.2166/wst.2005.0670

Berardy, A., & Chester, M. V. (2017). Climate change vulnerability in the food, energy, and water

nexus: Concerns for agricultural production in Arizona and its urban export supply.

Environmental Research Letters, 12(3). https://doi.org/10.1088/1748-9326/aa5e6d

Bernard, H., Faber, M., Wilking, H., Haller, S., Höhle, M., Schielke, A., Ducomble, T., Siffczyk,

C., Merbecks, S., Fricke, G., Hamouda, O., Stark, K., Werber, D., Askar, M.,

Gunsenheimer-Bartmeyer, B., Behnke, S., Breidenbach, J., Fiebig, L., Gilsdorf, A., …

Popp, A. (2014). Large multistate outbreak of norovirus gastroenteritis associated with

frozen strawberries, Germany, 2012. Eurosurveillance, 19(8). https://doi.org/10.2807/1560-

7917.ES2014.19.8.20719

Betancourt, W. Q., Abd-Elmaksoud, S., & Gerba, C. P. (2018). Efficiency of Reovirus

Concentration from Water with Positively Charged Filters. Food and Environmental

Virology, 10(2), 209–211. https://doi.org/10.1007/s12560-017-9332-2

Betancourt, W. Q., Kitajima, M., Wing, A. D., Regnery, J., Drewes, J. E., Pepper, I. L., & Gerba,

C. P. (2014). Assessment of virus removal by managed aquifer recharge at three full-scale

operations. Journal of Environmental Science and Health. Part A, Toxic/Hazardous

Substances & Environmental Engineering, 49(14), 1685–1692.

https://doi.org/10.1080/10934529.2014.951233

Betancourt, W. Q., Schijven, J., Regnery, J., Wing, A., Morrison, C. M., Drewes, J. E., & Gerba, C.

P. (2019). Variable non-linear removal of viruses during transport through a saturated soil

column. Journal of Contaminant Hydrology, December 2018, 0–1.

https://doi.org/10.1016/j.jconhyd.2019.04.002

Bibby, K, Viau, E., & Peccia, J. (2011). Viral metagenome analysis to guide human pathogen

monitoring in environmental samples. Letters in Applied Microbiology, 52, 386–392.

https://doi.org/10.1111/j.1472-765X.2011.03014.x

Bibby, Kyle, Crank, K., Greaves, J., Li, X., Wu, Z., Hamza, I. A., & Stachler, E. (2019).

Metagenomics and the development of viral water quality tools. Npj Clean Water, 2(1), 1–

13. https://doi.org/10.1038/s41545-019-0032-3

Bibby, Kyle, & Peccia, J. (2013). Identification of Viral Pathogen Diversity in Sewage Sludge by

Metagenome Analysis. Environmental Science & Technology, 47, 1945–1951.

https://doi.org/10.1021/es305181x

Bitton, G., & Harvey, R. W. (1992). Transport of pathogens through soils and aquifers.

Environmental Microbiology, 103–124.

Blinkova, O., Rosario, K., Li, L., Kapoor, A., Slikas, B., Bernardin, F., Breitbart, M., & Delwart, E.

(2009). Frequent detection of highly diverse variants of Cardiovirus, Cosavirus, Bocavirus,

and Circovirus in sewage samples collected in the United States. Journal of Clinical

Microbiology, 47(11), 3507–3513. https://doi.org/10.1128/JCM.01062-09

Bodian, D. (1955). American association for the advancement of science. Science, 122(3159), 105–

108.

Boorman, G. A., Dellarco, V., Dunnick, J. K., Chapin, R. E., Hunter, S., Hauchman, F., Gardner,

H., Cox, M., & Sills, R. C. (1999). Drinking Water Disinfection Byproducs : Review and

Approach to Toxicity Evaluation. Environmental Health Perspectives, 107(February), 207–

217.

Bosch, A. (1998). Human enteric viruses: minireview. International Microbiology, 1, 191–196.

http://revistes.iec.cat/index.php/IM/article/viewFile/39/38

Bosch, A., Sánchez, G., Abbaszadegan, M., Carducci, A., Poel, W. H. M. Van Der, Rutjes, S.,

Sano, D., & Taylor, M. B. (2011). Analytical Methods for Virus Detection in Water and

Food. Food Analytical Methods, 4, 4–12. https://doi.org/10.1007/s12161-010-9161-5

Boudaud, N., Machinal, C., David, F., Fréval-Le Bourdonnec, A., Jossent, J., Bakanga, F., Arnal,

C., Jaffrezic, M. P., Oberti, S., & Gantzer, C. (2012). Removal of MS2, Qβ and GA

bacteriophages during drinking water treatment at pilot scale. Water Research, 46(8), 2651–

2664. https://doi.org/10.1016/j.watres.2012.02.020

Bruggen, B. Van Der, Vandecasteele, C., Gestel, T. Van, Doyenb, W., & Leysenb, R. (2003).

Review of Pressure-Driven Membrane Processes. Environmental Progress, 22(1), 46–56.

Buckle, G. C., Walker, C. L. F., & Black, R. E. (2012). Typhoid fever and paratyphoid fever:

Systematic review to estimate global morbidity and mortality for 2010. Journal of Global

Health, 2(1), 1–9. https://doi.org/10.7189/jogh.02.010401

Butler, D., Friedler, E., & Gatt, K. (1995). Characterising the quantity and quality of domestic

wastewater inflows. Water Science and Technology, 31(7), 13–24.

Calgua, B., Mengewein, A., Grunert, A., Bofill-mas, S., Clemente-casares, P., Hundesa, A., Wyn-

Jones, A. P., Lopez-Pila, J. M., & Girones, R. (2008). Development and application of a

one-step low cost procedure to concentrate viruses from seawater samples. Journal of

Virological Methods, 153, 79–83. https://doi.org/10.1016/j.jviromet.2008.08.003

Canh, V. D., Osawa, H., Inoue, K., Kasuga, I., Takizawa, S., Furumai, H., & Katayama, H. (2019).

Ferrihydrite treatment to mitigate inhibition of RT-qPCR virus detection from large-volume

environmental water samples. Journal of Virological Methods, 263(October 2018), 60–67.

https://doi.org/10.1016/j.jviromet.2018.10.018

Cantalupo, P. G., Calgua, B., Zhao, G., Hundesa, A., Wier, A. D., Katz, J. P., Grabe, M., Hendrix,

R. W., Girones, R., Wang, D., & Pipas, J. M. (2011). Raw sewage harbors diverse viral

populations. MBio, 2(5), 1–11. https://doi.org/10.1128/mBio.00180-11

Carey, R. O., & Migliaccio, K. W. (2009). Contribution of wastewater treatment plant effluents to

nutrient dynamics in aquatic systems. Environmental Management, 44(2), 205–217.

https://doi.org/10.1007/s00267-009-9309-5

Cashdollar, J. L., Brinkman, N. E., Griffin, S. M., Mcminn, B. R., Rhodes, E. R., Varughese, E. A.,

Grimm, A. C., Parshionikar, S. U., Wymer, L., & Shay Fout, G. (2013). Development and

evaluation of EPA method 1615 for detection of enterovirus and norovirus in water. Applied

and Environmental Microbiology, 79(1), 215–223. https://doi.org/10.1128/AEM.02270-12

Cashdollar, J. L., Huff, E., Ryu, H., & Grimm, A. C. (2016). The influence of incubation time on

adenovirus quantitation in A549 cells by most probable number. Journal of Virological

Methods, 237, 200–203. https://doi.org/10.1016/j.jviromet.2016.09.002

CCR. (2015) Water Recycling Criteria, Title 22, Division 4, Chapter 3. California Code of

Regulations, Sacramento, CA, USA.

Chowdhury, S., Champagne, P., & Husain, T. (2007). Fuzzy risk-based decision-making approach

for selection of drinking water disinfectants. Journal of Water Supply: Research and

Technology - AQUA, 56(2), 75–93. https://doi.org/10.2166/aqua.2007.090

Christensen, M. L. (1989). Human viral gastroenteritis. Clinical Microbiology Reviews, 2(1), 51–

89. https://doi.org/10.1128/CMR.2.1.51

Chrysikopoulos, C. V., & Syngouna, V. I. (2012). Attachment of bacteriophages MS2 and ΦX174

onto kaolinite and montmorillonite: Extended-DLVO interactions. Colloids and Surfaces B:

Biointerfaces, 92, 74–83. https://doi.org/10.1016/j.colsurfb.2011.11.028

Coelho, T. R., R, G., Figueiredo, P., Mendonca, C., Lazo, P., & Almeida, L. (2013). Human JC

Polyomavirus in Normal Colorectal Mucosa, Hyperplastic Polyps, Sporadic Adenomas, and

Adenocarcinomas in Portugal. Journal of Medical Virology, 85, 2119–2127.

Condit, R. C. (2013). Principles of Virology, In Fields Virology, 6th Edition. Lippincott Williams

& Wilkens, Philadelphia, PA, USA.

Crittenden, J.C., Trussell, R. R., Hand, D. W., Howe, K. J., Tehobanoglous, G. (2012) Water

Treatment Principles and Design, 3rd edition. John Wiley & Sons, Inc., Hoboken, Jew

Jersey, USA.

Dahling, D. R. (1991). Technology Detection and enumeration of enteric viruses in cell culture

Detection and Enumeration of Enteric Viruses in Cell Culture. Critical Reviews in

Environmental Science and Technology, 21(3,4), 237–263.

https://doi.org/10.1080/10643389109388417

Davis, M. L. (2010). Water and Wastewater Engineering: Design, Principles, and Practice. The

McGraw-Hill Companies, Inc. ISBN: 978-0-07-171384-9.

Drewes, J. E., Reinhard, M., & Fox, P. (2003). Comparing microfiltration-reverse osmosis and soil-

aquifer treatment for indirect potable reuse of water. Water Research, 37(15), 3612–3621.

https://doi.org/10.1016/S0043-1354(03)00230-6

Dutilh, B. E., Cassman, N., McNair, K., Sanchez, S. E., Silva, G. G. Z., Boling, L., Barr, J. J.,

Speth, D. R., Seguritan, V., Aziz, R. K., Felts, B., Dinsdale, E. A., Mokili, J. L., & Edwards,

R. A. (2014). A highly abundant bacteriophage discovered in the unknown sequences of

human faecal metagenomes. Nature Communications, 5, 1–11.

https://doi.org/10.1038/ncomms5498

Eischeid, A. C., Meyer, J. N., & Linden, K. G. (2009). UV disinfection of adenoviruses: Molecular

indications of DNA damage efficiency. Applied and Environmental Microbiology, 75(1),

23–28. https://doi.org/10.1128/AEM.02199-08

Elhadidy, A. M., Peldszus, S., & Van Dyke, M. I. (2013). An evaluation of virus removal

mechanisms by ultrafiltration membranes using MS2 and φx174 bacteriophage. Separation

and Purification Technology, 120, 215–223. https://doi.org/10.1016/j.seppur.2013.09.026

ElHadidy, A. M., Peldszus, S., & Van Dyke, M. I. (2014). Effect of hydraulically reversible and

hydraulically irreversible fouling on the removal of MS2 and φX174 bacteriophage by an

ultrafiltration membrane. Water Research, 61, 297–307.

https://doi.org/10.1016/j.watres.2014.05.003

Elkayam, R., Michail, M., Mienis, O., Kraitzer, T., Tal, N., & Lev, O. (2015). Soil Aquifer

Treatment as Disinfection Unit. Journal of Environmental Engineering, 141(12), 05015001.

https://doi.org/10.1061/(ASCE)EE.1943-7870.0000992

Ellis, K. V. (1991). Water disinfection: A review with some consideration of the requirements of

the third world. Critical Reviews in Environmental Science and Technology, 20(5–6), 341–

407. https://doi.org/10.1080/10643389109388405

Ercin, A. E., & Hoekstra, A. Y. (2014). Water footprint scenarios for 2050: A global analysis.

Environment International, 64, 71–82. https://doi.org/10.1016/j.envint.2013.11.019

Falman, J. C., Fagnant-Sperati, C. S., Kossik, A. L., Boyle, D. S., & Meschke, J. S. (2019).

Evaluation of Secondary Concentration Methods for Poliovirus Detection in Wastewater.

Food and Environmental Virology, 11(1), 20–31. https://doi.org/10.1007/s12560-018-

09364-y

Farkas, K., Adriaenssens, E. M., Walker, D. I., McDonald, J. E., Malham, S. K., & Jones, D. L.

(2019). Critical Evaluation of CrAssphage as a Molecular Marker for Human-Derived

Wastewater Contamination in the Aquatic Environment. Food and Environmental Virology,

11(2), 113–119. https://doi.org/10.1007/s12560-019-09369-1

Fauquet, C. M., Mayo, M. A., Maniloff, J., Desselberger, U., and Ball, L. A. (2005). Virus

taxonomy. Eighth report of the International Committee on Taxonomy of Viruses. Elsevier

Academic Press, Amsterdam, The Netherlands

Faust, C. E., Sawitz, W., Tobie, J., Odom, V., Peres, C., & Lincicome, D. R. (1939). Comparative

Efficiency of Various Technics for the Diagnosis of Protozoa and Helminths in Feces

Published by : The American Society of Parasitologists All use subject to JSTOR Terms

and Conditions COMPARATIVE EFFICIENCY OF VARIOUS TECHNICS FOR THE

DIAGNOS. The Journal of Parisitology, 25(3), 241–262.

Fayer, R., Dubey, J. P., & Lindsay, D. S. (2004). Zoonotic protozoa: From land to sea. Trends in

Parasitology, 20(11), 531–536. https://doi.org/10.1016/j.pt.2004.08.008

Feng, H., Shuda, M., Chang, Y., & Moore, P. S. (2008). Clonal integration of a polyomavirus in

human Merkel cell carcinoma. Science, 319(5866), 1096–1100.

https://doi.org/10.1126/science.1152586

Fernandez-cassi, X., Timoneda, N., Martínez-puchol, S., Rusiñol, M., & Rodriguez-manzano, J.

(2018). Metagenomics for the study of viruses in urban sewage as a tool for public health

surveillance. Science of the Total Environment, 618, 870–880.

https://doi.org/10.1016/j.scitotenv.2017.08.249

Ferrer, O., Casas, R., Galvañ, C., Lucena, F., Vega, A., Gibert, O., Jofre, J., & Bernat, X. (2013).

Challenge tests with virus surrogates: an accurate membrane integrity evaluation system?

Desalination and Water Treatment, 51(25–27), 4947–4957.

https://doi.org/10.1080/19443994.2013.795339

Ferrer, O., Casas, S., Galvañ, C., Lucena, F., Bosch, A., Galofré, B., Mesa, J., Jofre, J., & Bernat,

X. (2015). Direct ultrafiltration performance and membrane integrity monitoring by

microbiological analysis. Water Research, 83, 121–131.

https://doi.org/10.1016/j.watres.2015.06.039

FitzSimons, D., Hendrickx, G., Vorsters, A., & Van Damme, P. (2010). Hepatitis A and E: Update

on prevention and epidemiology. Vaccine, 28(3), 583–588.

https://doi.org/10.1016/j.vaccine.2009.10.136

Fong, T., & Lipp, E. K. (2005). Enteric Viruses of Humans and Animals in Aquatic Environments:

Health Risks, Detection , and Potential Water Quality Tools. Microbiology and Molecular

Biology Reviews, 69(2), 357–371. https://doi.org/10.1128/MMBR.69.2.357

Francy, D. S., Stelzer, E. A., Brady, A. M. G., Huitger, C., Bushon, R. N., Ip, H. S., Ware, M. W.,

Villegas, E. N., Gallardo, V., & Alan Lindquist, H. D. (2013). Comparison of Filters for

Concentrating Microbial Indicators and Pathogens in Lake Water Samples. Applied and

Environmental Microbiology, 79(4), 1342–1352. https://doi.org/10.1128/AEM.03117-12

Funderburg, S. W., & Sorber, C. A. (1985). Coliphages as indicators of enteric viruses in activated

sludge. Water Research, 19(5), 547–555. https://doi.org/10.1016/0043-1354(85)90059-4

Geldreich, E. E. (1996). Microbial Quality of Water Supply Distribution Systems. CRC

Press, Boca Raton, Fl, USA.

Gentry-Shields, J., Wang, A., Cory, R. M., & Stewart, J. R. (2013). Determination of specific types

and relative levels of QPCR inhibitors in environmental water samples using excitation-

emission matrix spectroscopy and PARAFAC. Water Research, 47(10), 3467–3476.

https://doi.org/10.1016/j.watres.2013.03.049

Gerba, C. P., Powelson, D. K., Yahya, M. T., Wilson, L. G., & Amy, G. L. (1991). Fate of viruses

in treated sewage effluent during soil aquifer treatment designed for wastewater reclamation

and reuse. Water Science and Technology, 24(9), 95–102.

Gerba, Charles P., & Betancourt, W. Q. (2017). Viral Aggregation: Impact on Virus Behavior in

the Environment. Environmental Science and Technology, 51(13), 7318–7325.

https://doi.org/10.1021/acs.est.6b05835

Gerba, Charles P., & Betancourt, W. Q. (2019). Assessing the occurrence of waterborne viruses in

reuse systems: Analytical limits and needs. Pathogens, 8(3).

https://doi.org/10.3390/pathogens8030107

Gerba, Charles P., Betancourt, W. Q., & Kitajima, M. (2017). How much reduction of virus is

needed for recycled water: A continuous changing need for assessment? Water Research,

108, 25–31. https://doi.org/10.1016/j.watres.2016.11.020

Ghernaout, D. (2017a). Short Communication: Requiring Reverse Osmosis Membranes

Modifications – An Overview. American Journal of Chemical Engineering, 5(4), 81.

https://doi.org/10.11648/j.ajche.20170504.15

Ghernaout, D. (2017b). Water Reuse (WR): The Ultimate and Vital Solution for Water Supply

Issues. International Journal of Sustainable Development Research, 3(4), 36.

https://doi.org/10.11648/j.ijsdr.20170304.12

Gibson, K. E., Schwab, K. J., Spencer, S. K., & Borchardt, M. A. (2012). Measuring and mitigating

inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from

large-volume environmental water samples. Water Research, 46(13), 4281–4291.

https://doi.org/10.1016/j.watres.2012.04.030

Grant, S. B., Saphores, J. D., Feldman, D. L., Hamilton, A. J., Fletcher, T. D., Cook, P. L. M.,

Stewardson, M., Sanders, B. F., Levin, L. A., Ambrose, R. F., Deletic, A., Brown, R., Jiang,

S. C., Rosso, D., Cooper, W. J., & Marusic, I. (2012). Taking the “waste” out of

“wastewater” for human water security and ecosystem sustainability. Science, 337(6095),

681–686. https://doi.org/10.1126/science.1216852

Greninger, A. L., Runckel, C., Chiu, C. Y., Haggerty, T., Parsonnet, J., Ganem, D., & Derisi, J. L.

(2009). The complete genome of klassevirus – a novel picornavirus in pediatric stool.

Virology Journal, 9, 1–9. https://doi.org/10.1186/1743-422X-6-82

Guerrant, R. L., & Bobak, D. A. (1991). Bacterial and Protozoal Gasroenteritis. New England

Journal of Medicine, 325(5), 327–340.

Gyürek, L. L., & Frinch, G. R. (1998). Modeling Water Treatment Chemical Disinfection Kinetics.

Journal of Environmental Engineering, 124, 783–793.

Haas, C. N., Rose, J. B., Gerba, C., & Regli, S. (1993). Risk Assessment of Virus in Drinking

Water. Risk Analysis, 13(5), 545–552. https://doi.org/10.1111/j.1539-6924.1993.tb00013.x

Hamouda, M. A., Anderson, W. B., & Huck, P. M. (2009). Decision support systems in water and

wastewater treatment process selection and design: A review. Water Science and

Technology, 60(7), 1767–1770. https://doi.org/10.2166/wst.2009.538

Hamza, H., Leifels, M., Wilhelm, M., & Hamza, I. A. (2017). Relative Abundance of Human

Bocaviruses in Urban Sewage in Greater Cairo, Egypt. Food and Environmental Virology,

9(3), 304–313. https://doi.org/10.1007/s12560-017-9287-3

Haramoto, E., Katayama, H., Utagawa, E., & Ohgaki, S. (2009). Recovery of human norovirus from

water by virus concentration methods. 160, 206–209.

https://doi.org/10.1016/j.jviromet.2009.05.002

Haramoto, E., Kitajima, M., Hata, A., Torrey, J. R., Masago, Y., Sano, D., & Katayama, H. (2018).

A review on recent progress in the detection methods and prevalence of human enteric

viruses in water. Water Research.

Haramoto, E., Kitajima, M., Kishida, N., Konno, Y., Katayama, H., Asami, M., & Akiba, M.

(2013). Occurrence of pepper mild mottle virus in drinking water sources in Japan. Applied

and Environmental Microbiology, 79(23), 7413–7418. https://doi.org/10.1128/AEM.02354-

Hata, A., Matsumori, K., Kitajima, M., & Katayama, H. (2014). Concentration of Enteric Viruses

in Large Volumes of Water Using a Cartridge-Type Mixed Cellulose Ester Membrane.

Food and Environmental Virology, 7(1), 7–13. https://doi.org/10.1007/s12560-014-9169-x

Havelaar, A. H., Van Olphen, M., & Drost, Y. C. (1993). F-specific RNA bacteriophages are

adequate model organisms for enteric viruses in fresh water. Applied and Environmental

Microbiology, 59(9), 2956–2962. https://doi.org/10.1128/aem.59.9.2956-2962.1993

Heffron, J., McDermid, B., Maher, E., McNamara, P. J., & Mayer, B. K. (2019). Mechanisms of

virus mitigation and suitability of bacteriophages as surrogates in drinking water treatment

by iron electrocoagulation. Water Research, 163, 114877.

https://doi.org/10.1016/j.watres.2019.114877

Helenius, A. (2013). Virus Entry and Uncoating, In Fields Virology, 6th Edition. Lippincott

Williams & Wilkens, Philadelphia, PA, USA.

Hermansson, M. (1999). The DLVO theory in microbial adhesion. Colloids and Surfaces B:

Biointerfaces, 14(1–4), 105–119. https://doi.org/10.1016/S0927-7765(99)00029-6

Hindson, B. J., Ness, K. D., Masquelier, D. A., Belgrader, P., Heredia, N. J., Makarewicz, A. J.,

Bright, I. J., Lucero, M. Y., Hiddessen, A. L., Legler, T. C., Kitano, T. K., Hodel, M. R.,

Petersen, J. F., Wyatt, P. W., Steenblock, E. R., Shah, P. H., Bousse, L. J., Troup, C. B.,

Mellen, C., … Colston, B. W. (2011). High-Throughput Droplet Digital PCR System for

Absolute Quantitation of DNA Copy Number. Analytical Chemistry, 83, 8604–8610.

https://doi.org/10.1021/ac202028g

Hornstra, L. M., Rodrigues da Silva, T., Blankert, B., Heijnen, L., Beerendonk, E., Cornelissen, E.

R., & Medema, G. (2019). Monitoring the integrity of reverse osmosis membranes using

novel indigenous freshwater viruses and bacteriophages. Environmental Science: Water

Research & Technology. https://doi.org/10.1039/C9EW00318E

Howitt, R., MacEwan, D., Medellín-Azuara, J., Lund, J., & Sumner, D. (2014). Economic Analysis

of the 2014 Drought for California Agriculture. Center for Watershed Sciences. University

of California, Davis, California, 20p. https://doi.org/10.1016/j.ijrobp.2014.05.013

Hu, J. Y., Ong, S. L., Song, L. F., Feng, Y. Y., Liu, W. T., Tan, T. W., Lee, L. Y., & Ng, W. J.

(2003). Removal of MS2 bacteriophage using membrane technologies. Water Science and

Technology, 47(12), 163–168. https://doi.org/10.2166/wst.2003.0642

Iaconelli, M., Divizia, M., Della Libera, S., Di Bonito, P., & La Rosa, G. (2016). Frequent

Detection and Genetic Diversity of Human Bocavirus in Urban Sewage Samples. Food and

Environmental Virology, 8(4), 289–295. https://doi.org/10.1007/s12560-016-9251-7

Ikner, L. A., Soto-Beltran, M., & Bright, K. R. (2011). New method using a positively charged

microporous filter and ultrafiltration for concentration of viruses from tap water. Applied

and Environmental Microbiology, 77(10), 3500–3506. https://doi.org/10.1128/AEM.02705-

Ingham, K. C. (1984). Protein Precipitation with Polyethylene Glycol. Methods, 104, 351–356.

Jacangelo, J. G., Madec, A., Schwab, K. J., Huffman, D. E., & Mysore, C. S. (2005). Advances in

the use of low-pressure, hollow fiber membranes for the disinfection of water. Water

Science and Technology: Water Supply, 5(5), 109–115.

https://doi.org/10.2166/ws.2005.0045

Jacangelo, Joseph G., Laine, J. M., Carns, K. E., Cummings, E. W., & Mallevialle, J. (1991). Low-

pressure membrane filtration for removing Giardia and microbial indicators. Journal /

American Water Works Association, 83(9), 97–106. https://doi.org/10.1002/j.1551-

8833.1991.tb07219.x

Joseph, N., Ryu, D., Malano, H. M., George, B., & Sudheer, K. P. (2020). A review of the

assessment of sustainable water use at continental-to-global scale. Sustainable Water

Resources Management, 6(2), 1–20. https://doi.org/10.1007/s40899-020-00379-7

Kahler, A. M., Johnson, T. B., Hahn, D., Narayanan, J., Derado, G., & Hill, V. R. (2015).

Evaluation of an Ultrafiltration-Based Procedure for Simultaneous Recovery of Diverse

Microbes in Source Waters. Water, 7, 1202–1216. https://doi.org/10.3390/w7031202

Kaplan, J. E., Gary, G. W., Baron, R. C., Singh, N., Schonberger, L. B., Feldman, R., & Greenberg,

H. B. (1982). Epidemiology of Norwalk gastroenteritis and the role of Norwalk virus in

outbreaks of acute nonbacterial gastroenteritis. Annals of Internal Medicine, 96(6 I), 756–

761. https://doi.org/10.7326/0003-4819-96-6-756

Katayama, H., Shimasaki, A., & Ohgaki, S. (2002). Development of a virus concentration method

and its application to detection of enterovirus and Norwalk virus from coastal seawater.

Applied and Environmental Microbiology, 68(3), 1033–1039.

https://doi.org/10.1128/AEM.68.3.1033-1039.2002

Kato, R., Asami, T., Utagawa, E., Furumai, H., & Katayama, H. (2018). Pepper mild mottle virus

as a process indicator at drinking water treatment plants employing coagulation-

sedimentation, rapid sand filtration, ozonation, and biological activated carbon treatments in

Japan. Water Research, 132, 61–70. https://doi.org/10.1016/j.watres.2017.12.068

Kitajima, M., Iker, B. C., Pepper, I. L., & Gerba, C. P. (2014). Relative abundance and treatment

reduction of viruses during wastewater treatment processes - Identification of potential viral

indicators. Science of the Total Environment, 488–489(1), 290–296.

https://doi.org/10.1016/j.scitotenv.2014.04.087

Kitajima, M., Sassi, H. P., & Torrey, J. R. (2018). Pepper mild mottle virus as a water quality

indicator. Npj Clean Water, 1(1). https://doi.org/10.1038/s41545-018-0019-5

Kitis, M., Lozier, J. C., Kim, J. H., Mi, B., & Mariñas, B. J. (2003a). Evaluation of biologic and

non-biologic methods for assessing virus removal by and integrity of high pressure

membrane systems. Water Science and Technology: Water Supply, 3(5–6), 81–92.

https://doi.org/10.2166/ws.2003.0153

Kitis, M., Lozier, J. C., Kim, J. H., Mi, B., & Mariñas, B. J. (2003b). Microbial removal and

integrity monitoring of RO and NF membranes. Journal / American Water Works

Association, 95(12), 105–119. https://doi.org/10.1002/j.1551-8833.2003.tb10515.x

Kraberger, S., Argüello-Astorga, G. R., Greenfield, L. G., Galilee, C., Law, D., Martin, D. P., &

Varsani, A. (2015). Characterisation of a diverse range of circular replication-associated

protein encoding DNA viruses recovered from a sewage treatment oxidation pond.

Infection, Genetics and Evolution, 31, 73–86. https://doi.org/10.1016/j.meegid.2015.01.001

Kreißel, K., Bösl, M., Lipp, P., Franzreb, M., & Hambsch, B. (2012). Study on the removal

efficiency of UF membranes using bacteriophages in bench-scale and semi-technical scale.

Water Science and Technology, 66(6), 1195–1202. https://doi.org/10.2166/wst.2012.299

Krugman, S., & Giles, J. P. (1970). Viral Hepatitis: New Light on an Old Disease. The Journal of

the American Medical Association, 212(6), 1019–1029.

Kruithof, J. C., Kamp, P. C., Folmer, H. C., Nederlof, M. M., & Van Hoof, S. C. J. M. (2001).

Development of a membrane integrity monitoring strategy for the UF/RO Heemskerk

drinking water treatment plant. Water Science and Technology: Water Supply, 1(5–6), 261–

271. https://doi.org/10.2166/ws.2001.0122

Krupovic, M., Varsani, A., Kazlauskas, D., Breitbart, M., Delwart, E., Rosario, K., Yutin, N., Wolf,

Y. I., Balazs, H., Zerbini, F. M., Dolja, V. V, Kuhn, H., & Koonin, E. V. (2020).

Cressdnaviricota: a virus phylum unifying 7 families of Rep-encoding viruses with single-

stranded, circular DNA genomes 3. Journal of Virology, April, 1–7.

https://doi.org/10.1128/JVI.00582-20

Kummu, M., Guillaume, J. H. A., De Moel, H., Eisner, S., Flörke, M., Porkka, M., Siebert, S.,

Veldkamp, T. I. E., & Ward, P. J. (2016). The world’s road to water scarcity: Shortage and

stress in the 20th century and pathways towards sustainability. Scientific Reports,

6(November), 1–16. https://doi.org/10.1038/srep38495

Kuzmanovic, D. A., Elashvili, I., Wick, C., O’Connell, C., & Krueger, S. (2003). Bacteriophage

MS2: Molecular weight and spatial distribution of the protein and RNA components by

small-angle neutron scattering and virus counting. Structure, 11(11), 1339–1348.

https://doi.org/10.1016/j.str.2003.09.021

Lance, J., & Gerba, C. (1984). Virus movement in soil during saturated and unsaturated flow.

Applied and Environmental Microbiology, 47(2), 335–337.

LeChevallier, M. W. (1999). Case for maintaining a disinfectant residual. Journal / American

Water Works Association, 91(1), 86–94. https://doi.org/10.1002/j.1551-

8833.1999.tb08573.x

Leclerc, H., Schwartzbrod, L., & Dei-Cas, E. (2002). Microbial agents associated with waterborne

diseases. Critical Reviews in Microbiology, 28(4), 371–409. https://doi.org/10.1080/1040-

840291046768

Lee, S., Yamashita, N., & Tanaka, H. (2019). How Fiber Breakage Reduces Microorganism

Removal in Ultrafiltration for Wastewater Reclamation. Food and Environmental Virology,

11(2), 167–177. https://doi.org/10.1007/s12560-019-09372-6

Leifels, M., Shoults, D., Wiedemeyer, A., Ashbolt, N. J., Sozzi, E., Hagemeier, A., & Jurzik, L.

(2019). Capsid Integrity qPCR — An Azo-Dye Based and Culture-Independent Approach

to Estimate Adenovirus Infectivity after Disinfection and in the Aquatic Environment.

Water, 11(1196), 1–15.

Lewis, G. D., & Metcalf, T. G. (1988). Polyethylene Glycol Precipitation for Recovery of

Pathogenic Viruses, Including Hepatitis A Virus and Human Rotavirus, from Oyster, Water,

and Sediment Samples. Applied and Environmental Microbiology, 54(8), 1983–1988.

Lofrano, G., & Brown, J. (2010). Wastewater management through the ages: A history of mankind.

Science of the Total Environment, 408(22), 5254–5264.

https://doi.org/10.1016/j.scitotenv.2010.07.062

Mac Kenzie, W. R., Hoxie, N. J., Proctor, M. E., Gradus, M. S., Blair, K. A., Peterson, D. E.,

Kazmierczak, J. J., Addiss, D. G., Fox, K. R., Rose, J. B., & Davis, J. P. (1994). A Massive

Outbreak in Milwaukee of Cryptosporidium Transmitted Through the Public Water Supply.

The New England Journal of Medicine, 331(3), 161–167.

Mackay, I. M., Arden, K. E., & Nitsche, A. (2002). Real-time PCR in virology. Nucleic Acids

Research, 30(6), 1292–1305.

Madireddi, K., Babcock, R. W., Levine, B., Huo, T. L., Khan, E., Ye, Q. F., Neethling, Suffet, I.

H., & Stenstrom, M. K. (1997). Wastewater reclamation at Lake Arrowhead, California: an

overview. Water Environment Research, 69(3), 350–362.

https://doi.org/10.2175/106143097x125551

Matilainen, A., Vepsäläinen, M., & Sillanpää, M. (2010). Natural organic matter removal by

coagulation during drinking water treatment: A review. Advances in Colloid and Interface

Science, 159(2), 189–197. https://doi.org/10.1016/j.cis.2010.06.007

Mcdowell-boyer, L. M., Hunt, J. R., & Itar, N. (1986). Particle Transport Through Porous Media.

22(13), 1901–1921.

Mekonnen, M. M., & Hoekstra, A. Y. (2016). Sustainability: Four billion people facing severe

water scarcity. Science Advances, 2(2), 1–7. https://doi.org/10.1126/sciadv.1500323

Metcalf & Eddy. (2014). Wastewater Engineering: Treatment and Resource Recovery, Fifth

Edition. McGraw-Hill Education, New York, NY, USA.

Mi, B., Eaton, C. L., Kim, J. H., Colvin, C. K., Lozier, J. C., & Mariñas, B. J. (2004). Removal of

biological and non-biological viral surrogates by spiral-wound reverse osmosis membrane

elements with intact and compromised integrity. Water Research, 38(18), 3821–3832.

https://doi.org/10.1016/j.watres.2004.07.004

Michen, B., & Graule, T. (2010). Isoelectric points of viruses. Journal of Applied Microbiology,

109(2), 388–397. https://doi.org/10.1111/j.1365-2672.2010.04663.x

Miller, W. G. (2006). Integrated concepts in water reuse: Managing global water needs.

Desalination, 187(1–3), 65–75. https://doi.org/10.1016/j.desal.2005.04.068

Morris, R. (1985). Detection of Enteroviruses: An Assessment of Ten Cell Lines. Water Science

and Technology, 17, 81–88.

Mosher, J., Vartanian, G. (2018). Final Report: Guidance framework for direct potable reuse in

Arizona. National Water Research Institute.

Mull, B., & Hill, V. R. (2012). Recovery of diverse microbes in high turbidity surface water

samples using dead-end ultra fi ltration. Journal of Microbiological Methods, 91(3), 429–

433. https://doi.org/10.1016/j.mimet.2012.10.001

Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., & Erlich, H. (1986). Specific Enzymatic

Amplification of DNA In Vitro: The Polymerase Chain Reaction. Cold Spring Harbor

Symposia on Quantitative Biology, LI, 263–273.

Myrmel, M., Lange, H., & Rimstad, E. (2015). A 1-Year Quantitative Survey of Noro-, Adeno-,

Human Boca-, and Hepatitis E Viruses in Raw and Secondarily Treated Sewage from Two

Plants in Norway. Food and Environmental Virology, 7(3), 213–223.

https://doi.org/10.1007/s12560-015-9200-x

Nappier, S. P., Hong, T., Ichida, A., Goldstone, A., & Eftim, S. E. (2019). Occurrence of coliphage

in raw wastewater and in ambient water: A meta-analysis. Water Research, 153, 263–273.

https://doi.org/10.1016/j.watres.2018.12.058

Naughton, C., & Mihelcic, J. (2017). Introduction to the Importance of Sanitation. In J.B. Rose and

B. Jiménez-Cisneros, (eds) Global Water Pathogen Project Part One. The Health Hazards

of Excreta: Theory and Control. Michigan State University. https://doi.org/.

https://doi.org/10.14321/waterpathogens.1

Nieuwenhuijse, D. F., & Koopmans, M. P. G. (2017). Metagenomic Sequencing for Surveillance of

Food- and Waterborne Viral Diseases. Frontiers in Microbiology, 8(February), 1–11.

https://doi.org/10.3389/fmicb.2017.00230

Noris, M., & Remuzzi, G. (2005). Hemolytic uremic syndrome. Journal of the American Society of

Nephrology, 16(4), 1035–1050. https://doi.org/10.1681/ASN.2004100861

NWRI. (2013). Examining the Criteria for Direct Potable Reuse. Independent Advisory Panel Final

Report prepared for Trussell Technologies, Inc. National Water Research Institute, Fountain

Valley, CA, USA.

O’Luanaigh, N. D., Gill, L. W., Misstear, B. D. R., & Johnston, P. M. (2012). The attenuation of

microorganisms in on-site wastewater effluent discharged into highly permeable subsoils.

Journal of Contaminant Hydrology, 142–143, 126–139.

https://doi.org/10.1016/j.jconhyd.2011.12.003

Ogorzaly, L., Tissier, A., Bertrand, I., Maul, A., & Gantzer, C. (2009). Relationship between F-

specific RNA phage genogroups, faecal pollution indicators and human adenoviruses in

river water. Water Research, 43(5), 1257–1264.

https://doi.org/10.1016/j.watres.2008.12.011

Oki, T., & Quiocho, R. E. (2020). Economically challenged and water scarce: identification of

global populations most vulnerable to water crises. International Journal of Water

Resources Development, 36(2–3), 416–428.

https://doi.org/10.1080/07900627.2019.1698413

Otaki, M., Yano, K., & Ohgaki, S. (1998). Virus Removal in a Membrane Separation Process.

Water Science and Technology, 37(10), 107–116.

Palmateer, G. A., Dutka, B. J., Janzen, E. M., Meissner, S. M., & Sakellaris, M. G. (1991).

Coliphage and bacteriophage as indicators of recreational water quality. Water Research,

25(3), 355–357. https://doi.org/10.1016/0043-1354(91)90017-K

Pang, L. (2009). Microbial Removal Rates in Subsurface Media Estimated From Published Studies

of Field Experiments and Large Intact Soil Cores. Journal of Environment Quality, 38(4),

1531. https://doi.org/10.2134/jeq2008.0379

Parshionikar, S., Laseke, I., & Fout, G. S. (2010). Use of Propidium Monoazide in Reverse

Transcriptase PCR To Distinguish between Infectious and Noninfectious Enteric Viruses in

Water Samples ᰔ. Applied and Environmental Microbiology, 76(13), 4318–4326.

https://doi.org/10.1128/AEM.02800-09

Pecson, B. M., Ackermann, M., & Kohn, T. (2011). Framework for Using Quantitative PCR as a

Nonculture Based Method To Estimate Virus Infectivity. Environmental Scie, 45, 2257–

2263. https://doi.org/10.1021/es103488e

Pepper, I. L., Gerba, C. P., Gentry, T. J. (2015). Environmental Microbiology. Academic Press,

San Diego, USA.

Peters, T. (2010). Membrane technology for water treatment. Chemical Engineering and

Technology, 33(8), 1233–1240. https://doi.org/10.1002/ceat.201000139

Pierre, G., Furiga, A., Berge, M., Roques, C., Aimar, P., & Causserand, C. (2011). Protocol for the

assessment of viral retention capability of membranes. Journal of Membrane Science,

381(1–2), 41–49. https://doi.org/10.1016/j.memsci.2011.07.017

Powelson, D. K., Gerba, C. P., & Yahya, M. T. (1993). Virus Transport and Removal in

Wastewater During Aquifer Recharge. Water Research, 27(4), 583–590.

Prado, T., de Castro Bruni, A., Barbosa, M. R. F., Garcia, S. C., de Jesus Melo, A. M., & Sato, M.

I. Z. (2019). Performance of wastewater reclamation systems in enteric virus removal.

Science of the Total Environment, 678, 33–42.

https://doi.org/10.1016/j.scitotenv.2019.04.435

Pype, M., Donose, B. C., Martí, L., Patureau, D., Wery, N., & Gernjak, W. (2016). Virus removal

and integrity in aged RO membranes. Water Research, 90, 167–175.

https://doi.org/10.1016/j.watres.2015.12.023

Pype, M., Lawrence, M. G., Keller, J., & Gernjak, W. (2016). Reverse osmosis integrity monitoring

in water reuse : The challenge to verify virus removal e A review. Water Research, 98, 384–

395. https://doi.org/10.1016/j.watres.2016.04.040

Quanrud, D. M., Carroll, S. M., Gerba, C. P., & Arnold, R. G. (2003). Virus removal during

simulated soil-aquifer treatment. Water Research, 37(4), 753–762.

https://doi.org/10.1016/S0043-1354(02)00393-7

Racki, N., Dreo, T., Gutierrez-aguirre, I., Blejec, A., & Ravnikar, M. (2014). Reverse transcriptase

droplet digital PCR shows high resilience to PCR inhibitors from plant , soil and water

samples. Plant Methods, 10(42), 1–10. https://doi.org/10.1186/s13007-014-0042-6

Rames, E., Roiko, A., Stratton, H., & Macdonald, J. (2016). Technical aspects of using human

adenovirus as a viral water quality indicator. Water Research, 96, 308–326.

https://doi.org/10.1016/j.watres.2016.03.042

Rappolee, D. A., Mark, D., Banda, M. J., & Werb, Z. (1988). Wound Macrophags Express TGF-a

and Other Growth Factors in Vivo : Analysis by mRNA Phenotyping TGF-0F. Science,

241, 708–241.

Regel, R., Heidenreich, C., Keegan, A. (2012). Full-scale MS2 testing of the Glenelg RWTP UF

membrane process. Water, 63-68.

Reynolds, K. A., Gerba, C. P., & Pepper, I. A. N. L. (1996). Detection of Infectious Enteroviruses

by an Integrated Cell Culture-PCR Procedure. Applied and Environmental Microbiology,

62(4), 1424–1427.

Reznik, A., Dinar, A., & Hernández-Sancho, F. (2019). Treated Wastewater Reuse: An Efficient

and Sustainable Solution for Water Resource Scarcity. In Environmental and Resource

Economics (Vol. 74, Issue 4). Springer Netherlands. https://doi.org/10.1007/s10640-019-

00383-2

Rhodes, E. R., Hamilton, D. W., Jean, M., & Wymer, L. (2011). Evaluation of hollow-fiber

ultrafiltration primary concentration of pathogens and secondary concentration of viruses

from water. Journal of Virological Methods, 176(1–2), 38–45.

https://doi.org/10.1016/j.jviromet.2011.05.031

Rodríguez, R. A., Pepper, I. L., & Gerba, C. P. (2009). Application of PCR-Based Methods To

Assess the Infectivity of Enteric Viruses in Environmental Samples ᰔ. Applied and

Environmental Microbiology, 75(2), 297–307. https://doi.org/10.1128/AEM.01150-08

Rosario, K., Nilsson, C., Lim, Y. W., Ruan, Y., & Breitbart, M. (2009). Metagenomic analysis of

viruses in reclaimed water. Environmental Microbiology, 11(11), 2806–2820.

https://doi.org/10.1111/j.1462-2920.2009.01964.x

Rosario, K., Symonds, E. M., Sinigalliano, C., Stewart, J., & Breitbart, M. (2009). Pepper mild

mottle virus as an indicator of fecal pollution. Applied and Environmental Microbiology,

75(22), 7261–7267. https://doi.org/10.1128/AEM.00410-09

Rossmann, M. G., & Johnson, J. E. (1989). ICOSAHEDRAL RNA VIRUS STRUCTURE. Annual

Review of Biochemistry, 58(5), 33–74.

Rusinol, M., & Girones, R. (2017). Summary of Exceted and Waterborne Viruses. In J.B. Rose and

B. Jiménez-Cisneros, (eds) Global Water Pathogen Project Part One. The Health Hazards

of Excreta: Theory and ControlGlobal Water Pathogens Project. Michigan State

University. http://www.waterpathogens.org

Sangsanont, J., The Dan, D., Thi Viet Nga, T., Katayama, H., & Furumai, H. (2016). Detection of

pepper mild mottle virus as an indicator for drinking water quality in Hanoi, Vietnam, in

large volume of water after household treatment. Journal of Environmental Science and

Health - Part A Toxic/Hazardous Substances and Environmental Engineering, 51(13),

1100–1106. https://doi.org/10.1080/10934529.2016.1199650

Sano, D., Amarasiri, M., Hata, A., Watanabe, T., & Katayama, H. (2016). Risk management of

viral infectious diseases in wastewater reclamation and reuse: Review. Environment

International, 91, 220–229. https://doi.org/10.1016/j.envint.2016.03.001

Schijven, J. F., & Hassanizadeh, S. M. (2000). Removal of viruses by soil passage: Overview of

modeling, processes, and parameters. Critical Reviews in Environmental Science and

Technology, 30(1), 49–127. https://doi.org/10.1080/10643380091184174

Schmitz, B. W., Kitajima, M., Campillo, M. E., Gerba, C. P., & Pepper, I. L. (2016). Virus

reduction during advanced bardenpho and conventional wastewater treatment processes.

Environmental Science and Technology, 50(17), 9524–9532.

https://doi.org/10.1021/acs.est.6b01384

Schrader, C., Schielke, A., Ellerbroek, L., & Johne, R. (2012). PCR inhibitors – occurrence,

properties and removal. Journal of Applied Microbiology, 113, 1014–1026.

https://doi.org/10.1111/j.1365-2672.2012.05384.x

Scott, T. M., McLaughlin, M. R., Harwood, V. J., Chivukula, V., Levine, A., Gennaccaro, A.,

Lukasik, J., Farrah, S. R., & Rose, J. B. (2003). Reduction of pathogens, indicator bacteria,

and alternative indicators by wastewater treatment and reclamation processes. Water

Science and Technology: Water Supply, 3(4), 247–252.

https://doi.org/10.2166/ws.2003.0069

Sedlak, R. H., Kuypers, J., & Jerome, K. R. (2014). A multiplexed droplet digital PCR assay

performs better than qPCR on inhibition prone samples. Diagnostic Microbiology and

Infectious Disease, 80(4), 285–286. https://doi.org/10.1016/j.diagmicrobio.2014.09.004

Shi, H., Pasco, E. V., & Tarabara, V. V. (2017). Membrane-based methods of virus concentration

from water: a review of process parameters and their effects on virus recovery. Environ.

Sci.: Water Res. Technol., 3(5), 778–792. https://doi.org/10.1039/C7EW00016B

Shieh, Y. C., Wait, D. A., & Sobsey, M. (1995). Methods to remove inhibitors in sewage and other

fecal wastes for enteroviruses detection by polymerase chain reaction. Journal of

Virological Methods, 54, 51–66. https://doi.org/10.1016/0166-0934(95)00025-P

Shirasaki, N., Matsushita, T., Matsui, Y., Kobuke, M., & Ohno, K. (2009). Comparison of removal

performance of two surrogates for pathogenic waterborne viruses, bacteriophage Qβ and

MS2, in a coagulation-ceramic microfiltration system. Journal of Membrane Science,

326(2), 564–571. https://doi.org/10.1016/j.memsci.2008.10.037

Shirasaki, N., Matsushita, T., Matsui, Y., & Murai, K. (2017). Assessment of the efficacy of

membrane filtration processes to remove human enteric viruses and the suitability of

bacteriophages and a plant virus as surrogates for those viruses. Water Research, 115, 29–

39. https://doi.org/10.1016/j.watres.2017.02.054

Shkoporov, A. N., Khokhlova, E. V., Fitzgerald, C. B., Stockdale, S. R., Draper, L. A., Ross, R. P.,

& Hill, C. (2018). ΦCrAss001 represents the most abundant bacteriophage family in the

human gut and infects Bacteroides intestinalis. Nature Communications, 9(1), 1–8.

https://doi.org/10.1038/s41467-018-07225-7

Simmons, F. J., & Xagoraraki, I. (2011). Release of infectious human enteric viruses by full-scale

wastewater utilities. Water Research, 45(12), 3590–3598.

https://doi.org/10.1016/j.watres.2011.04.001

Skraber, S., Gassilloud, B., Schwartzbrod, L., & Gantzer, C. (2004). Survival of infectious

Poliovirus-1 in river water compared to the persistence of somatic coliphages,

thermotolerant coliforms and Poliovirus-1 genome. Water Research, 38(12), 2927–2933.

https://doi.org/10.1016/j.watres.2004.03.041

Smith, C. M., & Hill, V. R. (2009). Dead-End Hollow-Fiber Ultrafiltration for Recovery of Diverse

Microbes from Water ᰔ. Applied and Environmental Microbiology, 75(16), 5284–5289.

https://doi.org/10.1128/AEM.00456-09

Sobsey, Mark D, & Jones, B. L. (1979). Concentration of Poliovirus from Tap Water Using

Positively Charged Microporous Filters. Applied and Environmental Microbiology, 37(3),

588–595.

Sobsey, M. D., Wallis, C., Henderson, M., & Melnick, J. L. (1973). Concentration of enteroviruses

from large volumes of turbid estuary water. Applied Microbiology, 26(4), 529–534.

Steinle-Darling, E. (2015). The many faces of DPR in Texas. Journal - American Water Works

Association, 107(3), 16–20. https://doi.org/10.5942/jawwa.2015.107.0050

Stevik, T. K., Aa, K., Ausland, G., & Hanssen, J. F. (2004). Retention and removal of pathogenic

bacteria in wastewater percolating through porous media: A review. Water Research, 38(6),

1355–1367. https://doi.org/10.1016/j.watres.2003.12.024

Strauss, J. H., & Sinsheimer, R. L. (1963). Purification and properties of bacteriophage MS2 and of

its ribonucleic acid. Journal of Molecular Biology, 7(1), 43–54.

https://doi.org/10.1016/S0022-2836(63)80017-0

Symonds, E. M., Nguyen, K. H., Harwood, V. J., & Breitbart, M. (2018). Pepper mild mottle virus:

A plant pathogen with a greater purpose in (waste)water treatment development and public

health management. Water Research, 144, 1–12.

https://doi.org/10.1016/j.watres.2018.06.066

Syngouna, V. I., & Chrysikopoulos, C. V. (2013). Cotransport of clay colloids and viruses in water

saturated porous media. Colloids and Surfaces A: Physicochemical and Engineering

Aspects, 416(1), 56–65. https://doi.org/10.1016/j.colsurfa.2012.10.018

Tandukar, S., Sherchan, S. P., & Haramoto, E. (2020). Applicability of crAssphage, pepper mild

mottle virus, and tobacco mosaic virus as indicators of reduction of enteric viruses during

wastewater treatment. Scientific Reports, 10(1), 1–8. https://doi.org/10.1038/s41598-020-

60547-9

Tang, C. Y., Yang, Z., Guo, H., Wen, J. J., Nghiem, L. D., & Cornelissen, E. (2018). Potable Water

Reuse through Advanced Membrane Technology. Environmental Science and Technology,

52(18), 10215–10223. https://doi.org/10.1021/acs.est.8b00562

Taylor, S. C., Laperriere, G., & Germain, H. (2017). Droplet Digital PCR versus qPCR for gene

expression analysis with low abundant targets: From variable nonsense to publication

quality data. Scientific Reports, 7(1), 1–8. https://doi.org/10.1038/s41598-017-02217-x

Todd, K. V., & Tripp, R. A. (2019). Human norovirus: Experimental models of infection. Viruses,

11(2). https://doi.org/10.3390/v11020151

Torrey, J., von Gunten, U., & Kohn, T. (2019). Differences in Viral Disinfection Mechanisms as

Revealed by Quantitative Transfection of Echovirus 11 Genomes. Applied and

Environmental Microbiology, 85(14), 1–14. https://doi.org/10.1128/AEM.00961-19

TWDB. (2015). Final Report: Direct Potable Reuse Resource Document. Texas Water

Development Board, Forth Worth, TX, USA.

US EPA. (2001). Method 1602: Male-specific (F+) and Somatic Coliphage in Water by Single

Agar Layer (SAL) Procedure. EPA 821-R-01-029. Office of Water, Engineering and

Analysis Division, Washington, DC. United States Environmental Protection Agency,

Office of Water.

US EPA. (2005). Membrane Filtration Guidance Manual. United States Environmental Protection

Agency, Office of Water.

US EPA. (2006) Long Term 2 Enhanced Surface Water Treatment Rule. U.S. Environmental

Protection Agency, Office of Wastewater Management, Office of Water, Washington D.C.

USA.

US EPA. (2012) 2012 Guidelines for Water Reuse. U.S. Environmental Protection Agency, Office

of Wastewater Management, Office of Water, Washington D.C. USA.

US EPA. (2014). Method 1615: Measurement of Enterovirus and Norovirus Occurance by Culture

and RT-qPCR (Issue September).

US EPA. (2015). Review of Coliphages As Possible Indicators of Fecal Contamination. United

States Environmental Protection Agency, Office of Science and Technology: Health and

Ecological Critera Division.

US EPA. (2016) Drinking Water Contaminant Candidate List 4—Final . U.S. Environmental

Protection Agency, Office of Wastewater Management, Office of Water, Washington D.C.

USA.

US EPA. (2017). Drinking Water Regulations. U.S. Environmental Protection Agency, Office of

Wastewater Management, Office of Water, Washington D.C. USA. Retrieved May 8, 2020,

from https://www.epa.gov/dwreginfo/drinking-water-regulations

US EPA. (2019a). National Primary Drinking Water Regulations. U.S. Environmental Protection

Agency, Office of Wastewater Management, Office of Water, Washington D.C. USA.

US EPA. (2019b). Secondary Drinking Water Standards. U.S. Environmental Protection Agency,

Office of Wastewater Management, Office of Water, Washington D.C. USA.

Veettil, A. V., & Mishra, A. (2020). Water Security Assessment for the Contiguous United States

Using Water Footprint Concepts. Geophysical Research Letters, 47(7), 1–11.

https://doi.org/10.1029/2020gl087061

Vickers, J. C., Dummer, M., Le, T., & Zoba, J. B. (2019). Removal of MS‐2 coliphage in full‐scale

reverse osmosis systems. AWWA Water Science, 1(6), 1–10.

https://doi.org/10.1002/aws2.1158

Viswanathan, V. K., Hodges, K., & Hecht, G. (2009). Enteric infection meets intestinal function:

How bacterial pathogens cause diarrhoea. Nature Reviews Microbiology, 7(2), 110–119.

https://doi.org/10.1038/nrmicro2053

Vörösmarty, C. J., Green, P., Salisbury, J., & Lammers, R. B. (2000). Global water resources:

Vulnerability from climate change and population growth. Science, 289(5477), 284–288.

https://doi.org/10.1126/science.289.5477.284

Wallis, C., & Melnick, J. L. (1967). Concentration of Enteroviruses on Membrane Filters. Journal

of Virology, 1(3), 472–477. https://doi.org/10.1128/jvi.1.3.472-477.1967

Wang, M., Olson, B. H., & Chang, J. (2007). Improving PCR and qPCR detection of hydrogenase

A ( hyd A ) associated with Clostridia in pure cultures and environmental sludges using

bovine serum albumin. Applied Microbiology and Biotechnology, 77, 645–656.

https://doi.org/10.1007/s00253-007-1196-1

Wetter, C., Conti, M., Altschuh, D., Tabillion, R., & V, van R. M. H. (1984). Pepper Mild Mottle

Virus, a Tobamovirus Infecting Pepper Cultivars in Sicily. Phytopathology, 74(4), 405.

https://doi.org/10.1094/phyto-74-405

Wilson, L. G., Amy, G. L., Gerba, C. P., Gordon, H., Johnson, B., & Miller, J. (1995). Water

quality changes during soil aquifer treatment of tertiary effluent. Water Environment

Research, 67(3), 371–376. https://doi.org/Doi 10.2175/106143095x131600

Wooley, J. C., Godzik, A., & Friedberg, I. (2010). A primer on metagenomics. PLoS

Computational Biology, 6(2). https://doi.org/10.1371/journal.pcbi.1000667

Wu, B., Wang, R., & Fane, A. G. (2017). The roles of bacteriophages in membrane-based water

and wastewater treatment processes: A review. Water Research, 110, 120–132.

https://doi.org/10.1016/j.watres.2016.12.004

Wu, J., Li, H., & Huang, X. (2010). Indigenous somatic coliphage removal from a real municipal

wastewater by a submerged membrane bioreactor. Water Research, 44(6), 1853–1862.

https://doi.org/10.1016/j.watres.2009.12.013

Wu, Z., Greaves, J., Arp, L., Stone, D., & Bibby, K. (2020). Comparative fate of CrAssphage with

culturable and molecular fecal pollution indicators during activated sludge wastewater

treatment. Environment International, 136(January), 105452.

https://doi.org/10.1016/j.envint.2019.105452

Xagoraraki, I., Yin, Z., & Svambayev, Z. (2014). Fate of Viruses in Water Systems. Journal of

Environmental Engineering, 140(7), 04014020. https://doi.org/10.1061/(asce)ee.1943-

7870.0000827

Zhang, K., & Farahbakhsh, K. (2007). Removal of native coliphages and coliform bacteria from

municipal wastewater by various wastewater treatment processes: Implications to water

reuse. Water Research, 41(12), 2816–2824. https://doi.org/10.1016/j.watres.2007.03.010

Zhang, T., Breitbart, M., Lee, W. H., Run, J. Q., Wei, C. L., Soh, S. W. L., Hibberd, M. L., Liu, E.

T., Rohwer, F., & Ruan, Y. (2006). RNA viral community in human feces: Prevalence of

plant pathogenic viruses. PLoS Biology, 4(1), 0108–0118.

https://doi.org/10.1371/journal.pbio.0040003

Zhao, L., Rosario, K., Breitbart, M., & Duffy, S. (2019). Eukaryotic Circular Rep-Encoding Single-

Stranded DNA (CRESS DNA) Viruses: Ubiquitous Viruses With Small Genomes and a

Diverse Host Range. In Advances in Virus Research (1st ed., Vol. 103). Elsevier Inc.

https://doi.org/10.1016/bs.aivir.2018.10.001

Zhuang, J., & Jin, Y. (2003). Virus Retention and Transport as Influenced by Different Forms of

Soil Organic Matter. Journal of Environment Quality, 32(3), 816.

https://doi.org/10.2134/jeq2003.8160

APPENDIX A

POTENTIAL INDICATORS OF VIRUS TRANSPORT AND REMOVAL DURING SOIL

AQUIFER TREATMENT OF TREATED WASTEWATER EFFLUENT

Christina M. Morrison*1, Walter Q. Betancourt1, Daniel R. Quintanar2, Gerardo U. Lopez3, Ian

L. Pepper1, Charles P Gerba1

1 Department of Environmental Science, Water and Energy Sustainable Technology (WEST)

Center University of Arizona, Tucson, AZ

2 City of Tucson Water, Tucson, AZ

3 School of Animal and Comparative Biomedical Sciences, University of Arizona, Tucson, AZ

*Corresponding author

Published in: Water Research, Volume 177 (2020)

Abstract

Increased water demands have led to a notable interest in the use of treated wastewater for reuse.

Typically, this results from the implementation of advanced treatment of final effluent from wastewater treatment plants prior to reuse for potable or non-potable purposes.

Soil aquifer treatment (SAT) is a natural treatment process in which water from sources of varying quality is infiltrated into the soil to further improve its quality. The goal of this study was to determine the log10 reduction values (LRVs) of viruses naturally present in treated effluent and evaluate two potential indicators of virus removal and transport, pepper mild mottle virus

(PMMoV) and crAssphage, during SAT of treated effluent. Groundwater was sampled at three wells with different attributes within the Sweetwater Recharge Facility (SWRF) in Tucson, AZ.

These sites vary greatly in operational parameters such as effluent infiltration rates and wetting/drying cycles, which may influence virus removal efficiency. Detection of adenovirus, enterovirus, PMMoV, and crAssphage were determined by qPCR/RT-qPCR and log10 reduction values (LRVs) were determined. PMMoV and crAssphage were detected in groundwater associated with a set of recharge basins that exhibited shorter wetting/drying cycles and faster infiltration rates. LRVs for crAssphage and PMMoV at this site ranged from 3.9 to 5.8, respectively. Moreover, PMMoV was detected downflow of the SAT sites, indicating the potential degradation of microbial groundwater quality in the region surrounding managed aquifer recharge facilities. Overall, PMMoV and crAssphage showed potential as conservative process indicators of virus removal during SAT, particularly for attribution of LRV credits.

Moreover, the detection of these viruses indicated the potential influence of wetting/drying

96 cycles on virus removal by SAT, a parameter that has not yet been studied with respect to biological contaminants.

Key Words: Soil Aquifer Treatment, Recharge, Wastewater Reuse, Groundwater, Virus removal

1 Introduction

Water demand has continued to increase in the Southwestern United States and globally in response to population growth, despite the threat of drought and freshwater shortages (Scanlon,

2016). Increased demands have led to the implementation of advanced wastewater treatment systems in which final effluent is reused for potable or non-potable purposes. Advanced treatment systems generally consist of a multi-barrier approach, in which different treatment technologies are implemented in series to achieve an overall goal of reducing chemical and biological contaminants below thresholds specified by the intended downstream use (USEPA,

2012).

Soil aquifer treatment (SAT) represents a natural treatment process which is often implemented in advanced wastewater treatment schemes (Sharma & Kennedy, 2017). During advanced treatment by SAT, treated wastewater effluent is infiltrated into spreading basins and allowed to percolate through soil in the vadose zone, into the groundwater for long-term storage and/or subsequent usage. The physicochemical properties of the soil and vadose zone allow for the natural attenuation of chemical and biological contaminants (Bitton & Harvey, 1992; Schijven &

Hassanizadeh, 2000; Wilson et al., 1995).

SAT is a major component of indirect potable reuse schemes (CCR, 2015), and to receive proper attribution as a treatment process in states providing potable reuse guidelines, its ability to remove pathogens, such as viruses, must be demonstrated. Potable reuse guidelines emulate the

USEPA Safe Drinking Water Act, in which chemicals are regulated using a maximum

97 contaminant level (MCL) approach while pathogens are regulated by setting a target log10 reduction value (LRV) (EPA, 2019). Pathogen guidelines focus particularly on viruses, bacteria, and protozoan parasites due to their relevance in waterborne disease transmission, with viruses having the strictest requirements (CCR, 2015; TWDB, 2015).

Virus removal is of particular concern during SAT, as viruses are generally able to be transported further distances through the vadose zone and groundwater than bacterial species due to their small size and colloidal properties (Bitton & Harvey, 1992; Gupta et al., 2009). Additionally, viruses have been shown to persist from several months to years within the subsurface environment (Charles et al., 2009; Espinosa et al., 2008; Kauppinen et al., 2018).

Factors which have been shown influence virus transport during SAT include rate of infiltration, soil characteristics such as clay content and pH, degree of soil saturation, presence of organic matter, and the structural characteristics of viruses (Gerba et al., 1991; Gupta et al., 2009; Lance

& Gerba, 1984; Pang, 2009; Powelson et al., 1993; Quanrud et al., 2003; Van Cuyk & Siegrist,

2007; Woessner et al., 2001; Zhuang & Jin, 2003). Studies on virus occurrence and reduction in groundwater after SAT have largely focused on either enteroviruses, which can be found in human fecal matter, or spiked bacteriophages as virus surrogates (Elkayam et al., 2015; Gerba et al., 1991; Lance & Gerba, 1984; Powelson et al., 1993; Wilson et al., 1995).

There are limited studies which examine the use of viruses typically found in wastewater, despite the potential for these viruses to provide better insight to virus removal during full scale SAT

(Betancourt et al., 2014). Recently, a plant virus, Pepper Mild Mottle Virus (PMMoV), and a

DNA bacteriophage, crAssphage, have been proposed as water quality indicators due to their high level of excretion in human feces and prevalence in untreated and treated wastewater

(Bibby et al., 2019; Rosario et al., 2009; Symonds et al., 2019). Non-human viruses that are

98 found abundantly in wastewater systems, such as PMMoV, have the potential for utilization as a natural process indicator of pathogenic virus removal. These indicators can potentially be used to demonstrate the capacity of a treatment technology to remove pathogens prior to its attribution of

LRV credits (Gerba et al., 2018).

In order to provide a better understanding of the behavior of viruses during full scale SAT processes, we evaluated the presence and reduction of naturally occurring viruses in a managed aquifer recharge system for wastewater reclamation in Tucson, Arizona. The Sweetwater

Recharge Facility (SWRF) located in Tucson, AZ has been the subject of numerous studies regarding the attenuation of microbial and chemical contaminants in wastewater for further urban reuse ( Betancourt et al., 2014; Gerba et al., 1991; Powelson et al., 1993; Wilson et al., 1995).

The facility has been in operation for over 30 years with a recent expansion that includes a new set of recharge basins that have been in operation for less than 10 years. The presence and reduction of viruses at this newer SAT site had not yet been assessed.

The objectives of this study were: (1) determine the presence and physical removal of naturally occurring viruses in artificially recharged groundwater; (2) evaluate the performance of PMMoV and crAssphage as indicators of virus removal and transport during SAT; and (3) compare virus removal efficiency of basins with different years of operation as well as different operational parameters.

2. Materials & Methods

2.1 Site Description

Groundwater samples were collected from three sites within the Sweetwater Reclamation

Facility (SWRF) in Tucson, AZ during six sampling intervals that corresponded to changing weather conditions in the Southwestern US (fall, winter, spring, dry early summer, monsoon,

99 post-monsoon). The SWRF contains 11 recharge basins which receive tertiary effluent achieved through a combination of dissolved air flotation as primary treatment, followed by secondary treatment by two parallel modified 5-stage Bardenpho systems with secondary clarification.

Secondary effluent is disc filtered, chlorinated, and dechlorinated prior to either recharge operations or discharge into the Santa Cruz River. The SWRF contains a suite of production and monitoring wells throughout the facility. The production wells extract groundwater from the site and distribute the water for park irrigation throughout the region. Monitoring wells are used for routine monitoring, when necessary, by the city of Tucson.

Figure 1 provides an overview of the SWRF and the sampling locations. Sampling sites consisted of two monitoring wells (WR-069B, WR-398A) and one production well (EW-008A).

Monitoring well WR-069B, associated with the oldest set of basins (one through four) at the

SWRF, is located west of the Santa Cruz River and southwest of the WWTP. EW-008A is a production well associated with the newest set of recharge basins (nine through eleven) and is located east of the Santa Cruz River and north east of the WWTP. Monitoring well WR-398A is not directly associated with a specific set of recharge basins, however it is in the direction of groundwater flow from the recharge facility. Characteristics of each site are provided in Table 1.

Additionally, tertiary effluent from the WWTP, representing the source water for recharge, was regularly collected from its distribution line to the basins at the SWRF.

2.2 Virus Selection

Adenoviruses and enteroviruses were the two human viruses selected for this study in combination with CrAssphage and PMMoV, representing a prokaryotic virus and a plant virus, respectively. All selected viruses are highly abundant in human feces and wastewater (Ahmed et al., 2018; Betancourt et al., 2014; Farkas et al., 2019; Haramoto et al., 2018; Kitajima, et al.,

100

2014; Schmitz et al., 2016; Wu et al., 2020). General characteristics of these viruses can be found in Table 2. Adenoviruses are a group of viruses that cause infections in the respiratory and intestinal tracts of humans. They are found abundantly in treated and untreated wastewater throughout the year and are highly resistant to inactivation by UV disinfection (Rames et al.,

2016). Enteroviruses are a group of viruses that infect the gastrointestinal tract and are known to circulate widely in human populations (Betancourt & Shulman, 2017). They are among the most studied viruses in wastewater and SAT. Both adenovirus and enterovirus are listed on the EPA’s

Contaminant Candidate List (CCL) 3 (USEPA, 2014).

Pepper Mild Mottle Virus (PMMoV) and CrAssphage have been proposed as conservative indicators of fecal contamination due to their abundance in human fecal matter

(Bibby et al., 2019). PMMoV is highly resistant to treatment processes and is found in wastewater effluents at 6 to 10 log10 genome copies (gc) per L (Haramoto et al., 2018).

CrAssphage, recently discovered through metagenomic data mining (Dutilh et al., 2014), is a dsDNA bacteriophage that is found in high abundance in sewage as well as in treated wastewater effluent. CrAssphage is thought to be potentially more specific to human fecal matter due to its host being a human enteric bacterial species (Bibby et al., 2019). While PMMoV has been assessed in groundwater associated with SAT (Betancourt et al., 2014), to our knowledge this is the first time in which crAssphage has been assessed as an indicator of virus removal and transport during SAT.

2.3 Sample Collection and Processing

Groundwater and treated effluent were collected six times throughout the duration of one year, resulting in 24 samples total (18 groundwater, 6 treated effluent). Sample volumes ranged from 50-100 and 1,000+ liters for treated effluent and artificially recharged or natural

101 groundwater, respectively. To overcome limits of detection associated with downstream molecular analysis, samples were concentrated by several orders of magnitude using methods described in Ikner et al. (2011). Primary concentration consisted of on-site filtration through electropositive NanoCeram filters (Argonide Corporation, Sanford, FL, USA). Filters were transported to the laboratory on ice and immediately eluted using 350 mL 1% (w/v) sodium polyphosphate amended with 1% (w/v) Ethylenediaminetetraacetic acid (EDTA) and 0.01%

(v/v) Tween 80. Within 24 hours of primary concentration, filter eluates were further concentrated to volumes of approximately one mL or less using Centricon Plus – 70 (Millipore

Sigma, Burlington, MA) 100,000 nominal molecular weight limit centrifugal ultrafiltration units.

Previous studies evaluating these methods have indicated recovery values for various enteric viruses and MS2 bacteriophage ranging from 17 to 83%, depending on the virus analyzed (Ikner et al., 2011). Extraction of nucleic acids from sample concentrates was performed using QIAamp

UltraSens Virus Kit (Qiagen, Hilden, Germany), per manufacturer’s instructions. Each nucleic acid extraction event included a 1 mL 0.01 M phosphate buffered saline blank which was used as a control to ensure that cross contamination did not occur during extractions.

2.4 Virus Detection

The presence of virus in samples was assessed by real time quantitative polymerase chain reaction (qPCR). One half of the examined nucleic acid extracts from each sample underwent reverse transcription (RT) with random primers using High Capacity cDNA Reverse

Transcription kit (Applied Biosystems, Foster City, CA, USA) for production of complimentary

DNA (cDNA) and subsequent detection of RNA viruses by qPCR. Real-time amplification was performed using a LightCycler 480 Instrument II (Roche Applied Science, Indianapolis, IN,

USA). Reactions contained 12.5 µL Lightcycler 480 Probes Master Mix (Roche Diagnostics), 5

102

µL template, and primers and probes as needed per specific assay, for a final volume of 25 µL.

Specific assay parameters are provided in Table S1.

Reaction reagents were prepared in a separated PCR clean room, containing a reagent preparation hood which was UV treated for 15 minutes before and after reagent preparation.

Template DNA was added to reaction mixtures in a separate room and hood dedicated to template addition. Target standards in the form of double-stranded DNA fragments (i.e., gBlock gene fragments) synthesized by Integrated DNA Technologies (Coralville, Iowa) were included in each run for absolute quantification. No template controls consisting of nuclease free water were also included in each run to assess for cross contamination during qPCR. Fluorescence data was analyzed using LightCycler 480 Software version 1.5.

qPCR inhibition was evaluated using 1X and 1:10 dilutions of the template spiked with

105 gc of a gBlock gene fragment internal control in tandem with spiked nuclease free water.

Triplicate wells of each spiked dilution and water were assessed by qPCR. If the 1X dilution spiked with an internal control was found to have a cycle threshold (Ct) significantly less than the water spike (greater than the value of the calibration curve slope, i.e. less than 10% of the spiked concentration), the sample was considered inhibited, and a 1:10 dilution of the template was performed prior to RT and/or qPCR. If the 1:10 dilution met the same criteria, a 1:100 dilution was performed.

2.5 Statistical Analysis

Statistical analyses were performed using R (version 3.6.1) with α = 0.05. One-way analysis of variance was used to determine significant differences in physicochemical data across different sampling locations. Tukey’s range test was performed to analyze which of the sampling locations exhibited significant differences in physicochemical parameters. Spearman’s

103 correlation coefficients were determined to assess the relationship between concentrations of potential indicator viruses and human pathogenic viruses.

3. Results and Discussion

From September 2017 to November 2018, samples were collected every two to four months from each location for a total of six sampling events, accounting for any differences in seasonality or recharge patterns. Treated effluent samples were also collected during each sampling event at a point prior to its distribution to the basins. Specific information regarding travel time from basin discharge to well head could not be estimated and implemented into the sampling scheme due to the complexities of the pumping configurations as well as the presence of impermeable clay lenses located throughout the vadose zone. The complexities of the infiltration patterns and groundwater flows at SWRF has been documented in previous studies

(Quanrud et al., 2003). The SWRF contains several production and monitoring wells, with many production wells pumping concurrently during peak months which can interfere with groundwater travel times and trajectories. Therefore, virus levels in the treated effluent were averaged for calculation of average LRVs at each well.

Three out of the four virus targets assessed in this study were detected in the treated effluent

(Table 3). Both PMMoV and crAssphage were detected in 100% of the samples, while adenoviruses were detected in nearly every sample. However, enteroviruses were not detected in any of the treated effluent samples, which was consistent with results found by Schmitz et al.

(2016) examining effluent in the same region. In groundwater associated with SAT, PMMoV and crAssphage were detected in 22% and 6% of samples, respectively. Adenovirus and enterovirus were not detected in any groundwater samples.

104

Average log10 concentrations broken down by sampling site are provided in Figure 2. The treated effluent, which is transported to the recharge basins, contained three of the four virus targets.

PMMoV was found at the highest levels in the effluent, at an average level of 6.6 Log10 gc per L.

Adenoviruses had an average concentration of 3.6 log10 gc per L. Both of these findings are consistent with previous studies (Betancourt et al., 2014; Schmitz et al., 2016). CrAssphage, which had not yet been assessed in wastewater effluents in Southern Arizona, was present at an average concentration of 4.4 log10 gc per L.

Samples collected from EW-008A, associated with recharge basins nine through eleven, were found positive for PMMoV (two of six samples) and crAssphage (one of six samples) with average concentrations of 0.8 and 0.5 log10 gc per L, respectively. PMMoV was also detected in two out of the six samples collected from WR-398A, located downstream of the direction of groundwater flow from the recharge facility, with an average concentration of 0.8 log10 gc per L.

None of the groundwater samples were found to contain adenoviruses.

None of the samples collected at WR-069B, a monitoring well associated with recharge basins one through four, were determined to contain any of the virus targets above the limit of quantification. Prior to this study, groundwater at this site was monitored for the duration of five months (Table S2). Eight samples were processed with sample volumes ranging from 500 to

1500 L. Only one of the eight samples collected from WR-069B indicated the presence of

PMMoV. None of the samples were found to be above the limit of quantification for either adenoviruses or enteroviruses, and crAssphage was not assessed as it had not yet been considered as an indicator of fecal pollution at the time of the study. Average concentrations of

PMMoV during the preliminary monitoring were found to be 0.5 log10 gc per L.

105

Table 4 displays the average LRVs for each virus target at each sampling location.

Greater than values indicated that none of the six samples were positive for the target virus, with groundwater values calculated using the limit of quantification divided by the square root of two.

Methods for handling left-censored data that did not involve substitution were unable to be utilized due to the low number of sampling events and high levels of censorship (66-100%).

Overall, LRVs ranged from greater than 3.4 to greater than 6.2. PMMoV regularly exhibited the greatest LRVs (5.8 to > 6.2) while crAssphage exhibited the lowest LRV (3.9).

Despite the presence of PMMoV at WR-069B during the preliminary study, viruses were not detected from this well for the duration of the longer-term study. Virus removal at the basins associated with this well has been documented since their construction. Pilot-scale mini-basins were originally constructed at this site, which were able to demonstrate removal of bacteriophages MS2 and PRD1 at least 2 logs within the first 15 feet of travel (Gerba et al.,

1991). Wilson et al. (1995) were unable to detect any infectious enteroviruses from groundwater in a three-year study conducted at this site, sampling during peak recharge season. Additionally,

Betancourt et al. (2014) were unable to detect any viruses by qPCR from this specific well, with

LRVs in agreement with the current study. However, average turbidity values at this well were significantly different from EW-008A (p=0.03, Tukey’s range test) and concentrates usually exhibited a bright red color, unlike groundwater from the other included sampling sites. This well was no longer in use for regular monitoring purposes, and it is likely the turbidity experienced at this site was due to eroding well casings. Therefore, it is unclear whether there may have been any interferences during sample collection and processing, particularly when considering the presence of PMMoV in the earlier preliminary study in which WR-069B was still being pumped more regularly. This specific sampling site has historical context due to the

106 numerous studies conducted there, as described previously. However, the extent of well performance and operation is worth considering in future groundwater studies for better interpretation of results.

In contrast to WR-069B, groundwater extracted at EW-008A was positive for both PMMoV and crAssphage. This well is associated with recharge basins 9 through 11, which have been in operation for less than 10 years. Basins 1 through 4, associated with WR-069B have been in operation for over 30 years. Interestingly, EW-008A extracts groundwater from depths twice as deep as WR-069B, which might imply this groundwater has been retained underground for a longer duration, and thus would allow for greater virus reduction. However, infiltration rates at basins 9 through 11 were almost twice as great as basins 1 through 4. Column studies have indicated that higher infiltration rates facilitate greater virus transport due to reduction in retention time, which may explain the increased detection at groundwater from this site

(Betancourt et al., 2019; Gerba et al., 1991; Powelson et al., 1993).

Additionally, both sets of basins are operated at different wet/dry cycles. Basins 1 through 4

(WR-069B) have a wet to dry ratio of 1 wet day followed by 14 dry days. Basins 9 through 11

(EW-008A) have a wet to dry cycle of 1 wet day followed by 4 dry days. This difference in wet/dry cycling could potentially have played a role in virus transport through the vadose zone.

Wetting and drying cycles have the ability to change the subsurface redox zonation (Dutta et al.,

2015), which could likely influence removal ability as adsorption to soil particles is a large factor in subsurface virus transport (Betancourt et al., 2019). To the best of our knowledge, the influence of wetting/drying cycles on pathogen or indicator removal has not yet been explored, however there is evidence that longer drying periods have shown an increased capacity for removal of other groups of compounds, such as dissolved organic carbon and total Kjeldahl

107 nitrogen (Ben Moshe et al., 2020). There is greater operational control over this factor during

SAT, therefore a better understanding of its influence on virus removal would be worthwhile.

While groundwater flow in this area is complex due to the number of production wells pumping at any given time, the overall flow of the groundwater in the region is southeast to northwest (Quanrud et al., 2003). WR-398A is located roughly 0.65 km northwest of basins 9 through 11 and is considered downstream in terms of groundwater flow. Samples from this well were collected at 40 m below ground on average, about half as deep as EW-008A. PMMoV was found in two samples from this well, indicating potential virus transport through the groundwater. However, this well is located approximately 150 m from the Santa Cruz River, and one km from a point at which tertiary effluent is discharged into the dry riverbed, resulting in an effluent dominant flow which might facilitate virus transport downstream. Betancourt et al.

(2014) examined an effluent dominated river in Colorado and were able to detect PMMoV in wells located 18 miles downstream of the discharge point, at distances up to 100 m adjacent to the riverbed. Therefore, we were unable to determine whether the PMMoV detected at WR-

398A was from groundwater flow directly associated with SAT or perhaps due to riverbank filtration along the Santa Cruz River. In either scenario, the presence of PMMoV at this well indicates the potential for managed aquifer recharge practices to impact the groundwater quality in the surrounding areas.

Throughout the study, PMMoV was consistently found in the highest concentrations in treated effluent by at least one order of magnitude compared to other virus targets. It was found in two instances at EW-008A as well as WR-398A, and one time in WR-069B during the preliminary study, or roughly a 19% prevalence in groundwater associated with SAT. The presence of any other virus in groundwater without the presence of PMMoV at a higher

108 concentration was not observed during this study. This is in agreement with numerous studies evaluating PMMoV as an indicator of fecal pollution in either wastewater or the environment

(Kitajima et al., 2018). The overall abundance of PMMoV in feed water as well as its persistence in recovered groundwater shown in this study provides evidence for the potential use of PMMoV as a conservative process indicator of virus removal during SAT for attribution of LRV credits.

PMMoV has been proven to be a useful process indicator for other wastewater treatment processes, including but not limited to activated sludge and 5-stage modified bardenpho systems

(Kitajima et al., 2014; Schmitz et al., 2016), as well as entire drinking water schemes (Kato et al.,

2018).

Additionally, due to its detection in groundwater in areas surrounding the recharge facility, it has shown potential as a conservative indicator of virus transport through groundwater associated with anthropogenic uses. Its potential for modeling the transport of pathogens, specifically, would depend largely on a correlation of its behavior to human pathogenic viruses. PMMoV has physical attributes unlike human enteric viruses that might facilitate its persistence, therefore it is of value to understand its behavioral relationship to pathogenic viruses. Spearman’s rank correlation of PMMoV and adenovirus was performed on treated effluent data collected in this study and found no correlation (ρ = 0.086). Due to the inability to detect human pathogenic viruses, this analysis could not be performed for groundwater samples. However, PMMoV has shown relatively strong correlations to human pathogenic viruses in other studies (Kato et al.,

2018; Schmitz et al., 2016; Shirasaki et al., 2017; Tandukar at al., 2020). Despite our inability to determine a relationship of PMMoV to adenovirus, the sheer abundance and persistence of

PMMoV may serve as valuable features to consider this virus as a conservative indicator of virus removal or transport.

109

CrAssphage was also evaluated as a potential indicator of virus removal by SAT. Similar to PMMoV, it appears to occur abundantly in wastewater effluents and therefore would allow for a non-spiked process indicator for LRV credit attribution (Farkas et al., 2019; Tandukar et al.,

2020). Despite its persistence through wastewater treatment and during SAT, as indicated by its presence in groundwater at EW-008A, crAssphage was not found as abundantly as PMMoV.

However, this study implemented a qPCR assay developed with Integrated DNA Technologies

(Coralville, Iowa) in mid-2017, targeting the phage tail collar fiber protein (Table S3), prior to the wide acceptance of qPCR assays CPQ64 and CPQ56 developed and evaluated in (Stachler et al., 2017). Preliminary research evaluating this assay in treated effluent in the Tucson region had shown promising potential (Figure S1), therefore it was originally included in the study. It is currently unclear whether or not the selection of a different assay might influence values detected by qPCR. Nevertheless, crAssphage did exhibit the lowest LRV in the study, 3.9, lower than

PMMoV, therefore it also has potential as a conservative indicator of virus removal.

Additionally, crAssphage exhibited a positive, but not statistically significant, correlation with adenovirus (ρ = 0.54). This is in agreement with studies that found statistical correlations between crAssphage and human viruses (Farkas et al., 2019; Tandukar et al., 2020). Further sampling events, and potentially the exploration of different crAssphage qPCR assays, might reveal further insights into the use of crAssphage as a process indicator during SAT.

The number of sampling events in this study was relatively low (n=6), therefore a more extensive sample set would provide more insight about these findings. It is particularly important to incorporate larger sample numbers into the evaluation of potential indicator organisms of SAT performance; however, the costs of analysis and coordination of sampling schemes with the corresponding personnel needs to be considered in future studies. The development of cost-

110 effective methods which can be utilized to effectively analyze large volumes of water (500+ L), necessary in groundwater studies, would greatly improve our ability to determine appropriate indicator organisms of virus transport during soil-based natural treatment processes. From an operational standpoint, a conservative indicator of virus removal which naturally occurs within the system alleviates any need to perform spiked tracer studies to evaluate system performance.

Further studies evaluating potential viral indicators would greatly benefit advanced treatment operations.

As the objective of this study was to evaluate physical removal of viruses, infectivity assays for human enteric viruses were not included. The use of qPCR allows for rapid quantification of target nucleic acid sequences in various sample types. Its use in this study allowed for quantification of newly discovered viruses, such as crAssphage, which currently is not culturable. While this has proved to be an extremely useful tool for virus detection, it is unable at this time to assess infectivity. Previous studies have indicated that molecular techniques such as qPCR are often correlated with infectious virus values in groundwater, and are thus suited for such studies (Espinosa et al., 2008).

In addition to its inability to assess infectivity, qPCR is also sensitive to inhibition by many different substances found in environmental samples, such as humic acids (Gentry-Shields et al.,

2013). Because of this, necessary quality control steps were included in this study which allowed for management of inhibited samples, namely, diluting the nucleic acids until a signal was determined. However, diluting the sample can inadvertently lead to results that fall beneath the assay limit of detection. Every groundwater sample in this study exhibited qPCR inhibition, which was alleviated by a 10-fold dilution of the final sample prior to analysis by qPCR.

However, this also reduced the equivalent volume assayed 10-fold, reducing the utility of a 1,000

111

L sample volume. Concentration and extraction methods which might reduce the amount/number of inhibitors present in the final concentrated sample volume would increase the quality of virus reduction studies which require large sample volumes to overcome detection limits inherent to qPCR.

4. Conclusions

Two viral indicators, PMMoV and crAssphage, were detected in groundwater more frequently from an SAT site that exhibited both increased infiltration rates as well as shorter wetting/drying cycles. This is the first evaluation of the effect of wetting/drying cycles on virus removal by

SAT, revealing an operational parameter that would benefit from further study. Human pathogenic viruses were not detected in any of the groundwater associated with SAT. PMMoV was consistently detected in the highest concentrations in both treated effluent and groundwater yet did not correlate well with the adenovirus. Despite this, its abundance and persistence make this virus a valuable candidate as a process indicator for log removal attribution in reuse schemes, as it represents a case conservative to human health. CrAssphage also showed promising potential as a conservative process indicator during SAT due to its prevalence in treated wastewater and stronger correlation to adenovirus concentrations. This is the first study to utilize crAssphage as a tool for assessing virus removal during SAT. Additionally, PMMoV was found downstream of the recharge facility, indicating the potential of managed aquifer recharge of treated wastewater to impact the microbial water quality of surrounding areas.

Funding

This work was supported by the National Science Foundation Water and Environmental

Technology Center Grant IIP-1361505.

112

References

Ahmed, W., Lobos, A., Senkbeil, J., Peraud, J., Gallard, J., & Harwood, V. J. (2018). Evaluation

of the novel crAssphage marker for sewage pollution tracking in storm drain outfalls in

Tampa, Florida. Water Research, 131, 142–150.

https://doi.org/10.1016/j.watres.2017.12.011

Ben Moshe, S., Weisbrod, N., Barquero, F., Sallwey, J., Orgad, O., & Furman, A. (2020). On the

role of operational dynamics in biogeochemical efficiency of a soil aquifer treatment

system. Hydrology and Earth System Sciences, 24(1), 417–426.

https://doi.org/10.5194/hess-24-417-2020

Betancourt, W. Q., Kitajima, M., Wing, A. D., Regnery, J., Drewes, J. E., Pepper, I. L., & Gerba,

C. P. (2014). Assessment of virus removal by managed aquifer recharge at three full-

scale operations. Journal of Environmental Science and Health. Part A, Toxic/Hazardous

Substances & Environmental Engineering, 49(14), 1685–1692.

https://doi.org/10.1080/10934529.2014.951233

Betancourt, W.Q., & Shulman, L.M. (2017). Polioviruses and other Enteroviruses. In J.B. Rose

and B. Jiménez-Cisneros, Global Water Pathogen Project

(http://www.waterpathogens.org/book/polioviruses-and-other-enteroviruses). Michigan

State University, E. Lansing, MI: UNESCO.

Betancourt, W. Q., Schijven, J., Regnery, J., Wing, A., Morrison, C. M., Drewes, J. E., & Gerba,

C. P. (2019). Variable non-linear removal of viruses during transport through a saturated

soil column. Journal of Contaminant Hydrology, (December 2018), 0–1.

https://doi.org/10.1016/j.jconhyd.2019.04.002

Bibby, K., Crank, K., Greaves, J., Li, X., Wu, Z., Hamza, I. A., & Stachler, E. (2019).

113

Metagenomics and the development of viral water quality tools. Npj Clean Water, 2(1),

1–13. https://doi.org/10.1038/s41545-019-0032-3

Bitton, G., & Harvey, R. W. (1992). Transport of pathogens through soils and aquifers.

Environmental Microbiology, 103–124.

CCR. (2015) Water Recycling Criteria, Title 22, Division 4, Chapter 3. California Code of

Regulations, Sacramento, CA, USA.

Charles, K. J., Shore, J., Sellwood, J., Laverick, M., Hart, A., & Pedley, S. (2009). Assessment

of the stability of human viruses and coliphage in groundwater by PCR and infectivity

methods. Journal of Applied Microbiology, 106(6), 1827–1837.

https://doi.org/10.1111/j.1365-2672.2009.04150.x

Dutilh, B. E., Cassman, N., McNair, K., Sanchez, S. E., Silva, G. G. Z., Boling, L., Barr, J. J.,

Speth, D. R., Seguritan, V., Aziz, R. K., Felts, B., Dinsdale, E. A., Mokili, J. L., &

Edwards, R. A. (2014). A highly abundant bacteriophage discovered in the unknown

sequences of human faecal metagenomes. Nature Communications, 5, 1–11.

https://doi.org/10.1038/ncomms5498

Dutta, T., Carles-Brangarí, A., Fernàndez-Garcia, D., Rubol, S., Tirado-Conde, J., & Sanchez-

Vila, X. (2015). Vadose zone oxygen (O2) dynamics during drying and wetting cycles:

An artificial recharge laboratory experiment. Journal of Hydrology, 527, 151–159.

https://doi.org/10.1016/j.jhydrol.2015.04.048

Elkayam, R., Michail, M., Mienis, O., Kraitzer, T., Tal, N., & Lev, O. (2015). Soil Aquifer

Treatment as Disinfection Unit. Journal of Environmental Engineering, 141(12),

05015001. https://doi.org/10.1061/(ASCE)EE.1943-7870.0000992

Espinosa, A. C., Mazari-Hiriart, M., Espinosa, R., Maruri-Avidal, L., Méndez, E., & Arias, C. F.

114

(2008). Infectivity and genome persistence of rotavirus and astrovirus in groundwater and

surface water. Water Research, 42(10–11), 2618–2628.

https://doi.org/10.1016/j.watres.2008.01.018

Farkas, K., Adriaenssens, E. M., Walker, D. I., McDonald, J. E., Malham, S. K., & Jones, D. L.

(2019). Critical Evaluation of CrAssphage as a Molecular Marker for Human-Derived

Wastewater Contamination in the Aquatic Environment. Food and Environmental

Virology, 11(2), 113–119. https://doi.org/10.1007/s12560-019-09369-1

Gentry-Shields, J., Wang, A., Cory, R. M., & Stewart, J. R. (2013). Determination of specific

types and relative levels of QPCR inhibitors in environmental water samples using

excitation-emission matrix spectroscopy and PARAFAC. Water Research, 47(10), 3467–

3476. https://doi.org/10.1016/j.watres.2013.03.049

Gerba, C. P., Powelson, D. K., Yahya, M. T., Wilson, L. G., & Amy, G. L. (1991). Fate of

viruses in treated sewage effluent during soil aquifer treatment designed for wastewater

reclamation and reuse. Water Science and Technology, 24(9), 95–102.

Gerba, C. P., Betancourt, W. Q., Kitajima, M., & Rock, C. M. (2018). Reducing uncertainty in

estimating virus reduction by advanced water treatment processes. Water Research, 133,

282–288. https://doi.org/10.1016/j.watres.2018.01.044

Guerin, E., Shkoporov, A., Stockdale, S. R., Clooney, A. G., Ryan, F. J., Sutton, T. D. S.,

Draper, L.A., Gonzales-Tortuero, E., Ross, R. P., & Hill, C. (2018). Biology and

Taxonomy of crAss-like Bacteriophages, the Most Abundant Virus in the Human Gut.

Cell Host and Microbe, 24(5), 653-664.e6. https://doi.org/10.1016/j.chom.2018.10.002

Gregory, J. B., Litaker, R. W., & Noble, R. T. (2006). Rapid one-step quantitative reverse

transcriptase PCR assay with competitive internal positive control for detection of

115

enteroviruses in environmental samples. Applied and environmental microbiology, 72(6),

3960–3967. https://doi.org/10.1128/AEM.02291-05

Gupta, V., Johnson, W. P., Shafieian, P., Ryu, H., Alum, A., Abbaszadegan, M., Hubbs, S. A., &

Rauch-Williams, T. (2009). Riverbank filtration: Comparison of pilot scale transport with

theory. Environmental Science and Technology, 43(3), 669–676.

https://doi.org/10.1021/es8016396

Haramoto, E., Kitajima, M., Kishida, N., Konno, Y., Katayama, H., Asami, M., & Akiba, M.

(2013). Occurrence of pepper mild mottle virus in drinking water sources in Japan.

Applied Environmental Microbiology, 79, 7413-7418.

https://doi.org/10.1128/AEM.02354-13

Haramoto, E., Kitajima, M., Hata, A., Torrey, J. R., Masago, Y., Sano, D., & Katayama, H.

(2018). A review on recent progress in the detection methods and prevalence of human

enteric viruses in water. Water Research, 135, 168–186.

https://doi.org/10.1016/j.watres.2018.02.004

Heim, A., Ebnet, C., Harste, G., & Ping-Akerblom, P. (2003). Rapid and quantitative detection

of human adenovirus DNA by real-time PCR. Journal of Medical Virology, 70, 228-239.

https://doi.org/10.1002/jmv.10382

ICTV. (2011a). Adenoviridae. International Committee of Taxonomy on Viruses. Retrieved from

https://talk.ictvonline.org/ictv-reports/ictv_9th_report/dsdna-viruses-

2011/w/dsdna_viruses/93/adenoviridae

ICTV. (2011b). Picornaviridae. International Committee of Taxonomy on Viruses. Retrieved

from https://talk.ictvonline.org/ictv-reports/ictv_9th_report/positive-sense-rna-viruses-

2011/w/posrna_viruses/234/picornaviridae

116

Ikner, L. A., Soto-Beltran, M., & Bright, K. R. (2011). New method using a positively charged

microporous filter and ultrafiltration for concentration of viruses from tap water. Applied

and Environmental Microbiology, 77(10), 3500–3506.

https://doi.org/10.1128/AEM.02705-10

Kato, R., Asami, T., Utagawa, E., Furumai, H., & Katayama, H. (2018). Pepper mild mottle virus

as a process indicator at drinking water treatment plants employing coagulation-

sedimentation, rapid sand filtration, ozonation, and biological activated carbon treatments

in Japan. Water Research, 132, 61–70. https://doi.org/10.1016/j.watres.2017.12.068

Kauppinen, A., Pitkänen, T., & Miettinen, I. T. (2018). Persistent Norovirus Contamination of

Groundwater Supplies in Two Waterborne Outbreaks. Food and Environmental Virology,

10(1), 39–50. https://doi.org/10.1007/s12560-017-9320-6

Kitajima, M., Iker, B. C., Pepper, I. L., & Gerba, C. P. (2014). Relative abundance and treatment

reduction of viruses during wastewater treatment processes - Identification of potential

viral indicators. Science of the Total Environment, 488–489(1), 290–296.

https://doi.org/10.1016/j.scitotenv.2014.04.087

Kitajima, M., Sassi, H. P., & Torrey, J. R. (2018). Pepper mild mottle virus as a water quality

indicator. Npj Clean Water, 1(1). https://doi.org/10.1038/s41545-018-0019-5

Lance, J., & Gerba, C. (1984). Virus movement in soil during saturated and unsaturated flow.

Applied and Environmental Microbiology, 47(2), 335–337.

Pang, L. (2009). Microbial Removal Rates in Subsurface Media Estimated From Published

Studies of Field Experiments and Large Intact Soil Cores. Journal of Environment

Quality, 38(4), 1531. https://doi.org/10.2134/jeq2008.0379

Powelson, D. K., Gerba, C. P., & Yahya, M. T. (1993). Virus Transport and Removal in

117

Wastewater During Aquifer Recharge. Water Research, 27(4), 583–590.

Quanrud, D. M., Carroll, S. M., Gerba, C. P., & Arnold, R. G. (2003). Virus removal during

simulated soil-aquifer treatment. Water Research, 37(4), 753–762.

https://doi.org/10.1016/S0043-1354(02)00393-7

Quanrud, D. M., Hafer, J., Karpiscak, M. M., Zhang, J., Lansey, K. E., & Arnold, R. G. (2003).

Fate of organics during soil-aquifer treatment: sustainability of removals in the field.

Water Research, 37, 3401–3411. https://doi.org/10.1016/S0043-1354(02)00489-X

Rames, E., Roiko, A., Stratton, H., & Macdonald, J. (2016). Technical aspects of using human

adenovirus as a viral water quality indicator. Water Research, 96, 308–326.

https://doi.org/10.1016/j.watres.2016.03.042

Rosario, K., Symonds, E. M., Sinigalliano, C., Stewart, J., & Breitbart, M. (2009). Pepper mild

mottle virus as an indicator of fecal pollution. Applied and Environmental Microbiology,

75(22), 7261–7267. https://doi.org/10.1128/AEM.00410-09

Scanlon, B. R., Reedy, R. C., Faunt, C. C., Pool, D., & Uhlman, K. (2016). Enhancing drought

resilience with conjunctive use and managed aquifer recharge in California and Arizona.

Environmental Research Letters, 11(3), 35013. https://doi.org/10.1088/1748-

9326/11/3/035013

Schijven, J. F., & Hassanizadeh, S. M. (2000). Removal of viruses by soil passage: Overview of

modeling, processes, and parameters. Critical Reviews in Environmental Science and

Technology, 30(1), 49–127. https://doi.org/10.1080/10643380091184174

Schmitz, B. W., Kitajima, M., Campillo, M. E., Gerba, C. P., & Pepper, I. L. (2016). Virus

reduction during advanced bardenpho and conventional wastewater treatment processes.

Environmental Science and Technology, 50(17), 9524–9532.

118

https://doi.org/10.1021/acs.est.6b01384

Sharma, S. K., & Kennedy, M. D. (2017). Soil aquifer treatment for wastewater treatment and

reuse. International Biodeterioration and Biodegradation, 119, 671–677.

https://doi.org/10.1016/j.ibiod.2016.09.013

Shirasaki, N., Matsushita, T., Matsui, Y., & Murai, K. (2017). Assessment of the efficacy of

membrane filtration processes to remove human enteric viruses and the suitability of

bacteriophages and a plant virus as surrogates for those viruses. Water Research, 115,

29–39. https://doi.org/10.1016/j.watres.2017.02.054

Stachler, E., Kelty, C., Sivaganesan, M., Li, X., Bibby, K., & Shanks, O. C. (2017). Quantitative

CrAssphage PCR Assays for Human Fecal Pollution Measurement. Environmental

Science and Technology, 51(16), 9146–9154. https://doi.org/10.1021/acs.est.7b02703

Tandukar, S., Sherchan, S. P., & Haramoto, E. (2020). Applicability of crAssphage, pepper mild

mottle virus, and tobacco mosaic virus as indicators of reduction of enteric viruses during

wastewater treatment. Scientific Reports, 10(1), 1–8. https://doi.org/10.1038/s41598-020-

60547-9

TWDB. (2015). Final Report: Direct Potable Reuse Resource Document. Texas Water

Development Board, Forth Worth, TX, USA.

US EPA. (2012). 2012 Guidelines for Water Reuse. U.S. Environmental Protection Agency,

Office of Wastewater Management, Office of Water, Washington D.C. USA.

US EPA. (2014). Method 1615: Measurement of Enterovirus and Norovirus Occurance by

Culture and RT-qPCR. Environmental Protection Agency, Office of Research and

Development, Cincinatti, Ohio USA.

US EPA. (2019). National Primary Drinking Water Regulations. U.S. Environmental Protection

119

Figure 1. Map of Sweetwater Recharge Facility (SWRF) in Tucson, AZ

120

Figure 2. Average concentrations (Log10 genomic copies per liter) of viruses in treated effluent and groundwater at the SWRF SAT sites. Arrows indicate that no viruses were detected and a value of less than the value displayed (LOQ) should be assumed.

121

Associated Basin infiltration Basin Wet/Dry Average depth to Groundwater Sampling Well Basins Rate (m/day) Ratio groundwater (m) Turbidity (NTU) EW-008A RB 9-11 0.50 0.250 83.1 1.16 WR-069B RB 1-4 0.23 0.067 45.9 4.34 WR-398A NA NA NA 40 15.50

Table 1. Characteristics associated with each sampling well. NA = Not Applicable. Well WR-

398A was located slightly outside SWRF and not directly associated with a SAT operation.

Virus Host Genome Capsid Shape Size Reference (+) ssRNA, 400 nm x Wetter et al. (1984); PMMoV Plant Rod linear 18 nm Rosario (2009); Pred. Icosahedral or Dutilh et al., (2014); CrAssphage Bacteria dsDNA, circular Unknown Isometric Guerin et al., (2018) (+) ssRNA, 30 nm Enterovirus Mammal Icosahedral ICTV, (2011b) linear (diam) 70-90 nm Adenovirus Mammal dsDNA, circular Icosahedral ICTV, (2011a) (diam)

Table 2. Summary of virus target characteristics

% positive No. Samples PMMoV crAssphage Adenovirus Enterovirus Treated Effluent 6 100 100 83 0 SAT associated 18 22 6 0 0 groundwater

Table 3. Prevalence of virus targets

122

Sampling Well PMMoV CrAssphage Adenovirus Enterovirus EW-008A 5.8 3.4 > 3.4 ND WR-398A 5.8 > 4.2 > 3.5 ND WR-069B > 6.2 > 4.2 > 3.5 ND

Table 4. Average LRVs for each virus at each groundwater sampling site. ND = Not determined due to non-detects in both treated effluent and recovered groundwater.

123

Appendix A, Supplementary Material:

POTENTIAL INDICATORS OF VIRUS TRANSPORT AND REMOVAL DURING SOIL

AQUIFER TREATMENT OF TREATED WASTEWATER EFFLUENT

Christina M. Morrison*1, Walter Q. Betancourt1, Daniel R. Quintanar2, Gerardo U. Lopez3, Ian

L. Pepper1, Charles P Gerba1

1 Department of Environmental Science, Water and Energy Sustainable Technology (WEST)

Center University of Arizona, Tucson, AZ

2 City of Tucson Water, Tucson, AZ

3 School of Animal and Comparative Biomedical Sciences, University of Arizona, Tucson, AZ

*Corresponding author

124

Table S1: Primers and probes for virus targets

Virus Primers/Probe Sequence (5' to 3') Reference PMMV- GAGTGGTTTGACCTTAACGTTTGA FP1rev Haramoto et al. PMMoV PMMV-RP1 TTGTCGGTTGCAATGCAAGT (2013) PMMV- FAM-CCTACCGAAGCAAATG-BHQ1 Probe1 crAssph-F GAACCTGACCGAACCCAATTA crAssph-R GGTAGTGATGGGCAAGATACAG This study (Table CrAssphage /56- S3) crAssph-P FAM/AGAATCGTA/ZEN/ATGAGCACCACCGCC /3IABkFQ/ AQ2 GCCCCAGTGGTCTTACATGCACATC AQ1 GCCACGGTGGGGTTTCTAAACTT Adenovirus FAM- Heim et al. (2003) AP TGCACCAGACCCGGGCTCAGGTACTCCGA- BHQ1 EV1F CCCTGAATGCGGCTAAT EV1R TGTCACCATAAGCAGCCA Gregory et al. Enterovirus FAM-ACGGACACCCAAAGTAGTCGGTTC- (2006) EV BHQ1

Table S2: Log10 concentration (gc/L) and prevalence of viruses during preliminary monitoring of WR-069B

Sampling No. PMMoV Adenovirus Enterovirus Well Samples WR-069B 8 0.5 ± 0.2 (13%) < 0.2 ± 0.2 (0%) < 0.3 ±0.5 (0%)

125

Table S3: Specific crAssphage assay details used in this study

CrAssphage Genome Accession Number NC_024711 Forward primer genome position 61214 - 61234 Reverse primer genome position 61311 - 21332 Coding Region Phage Tail Collar Fiber Protein 5'_GAACCTGACCGAACCCAATTAGAATAA AAGAAACCAGAGTCAGCCGAAGAATCGT Amplicon Sequence AATGAGCACCACCGCCAAGCAGAAGCAC ACGAACAGCTTTATCTGTATCTTGCCCATC ACTACC_3' Primer Concentration (per rxn) 500 nM Probe Concentration (per rxn) 400 nM Cycling Conditions 45 cycles of 94 C (30s), 60 C (60s)

Figure S1: Preliminary crAssphage qPCR concentrations in advanced and conventional treated effluent. Prevalence provided in parenthesis

126

References

Gregory, J. B., Litaker, R. W., & Noble, R. T. (2006). Rapid one-step quantitative reverse

transcriptase PCR assay with competitive internal positive control for detection of

enteroviruses in environmental samples. Applied and Environmental Microbiology, 72(6),

3960–3967. https://doi.org/10.1128/AEM.02291-05

Haramoto, E., Kitajima, M., Kishida, N., Konno, Y., Katayama, H., Asami, M., & Akiba, M.

(2013). Occurrence of pepper mild mottle virus in drinking water sources in Japan. Applied

and Environmental Microbiology, 79(23), 7413–7418. https://doi.org/10.1128/AEM.02354-

Heim, A., Ebnet, C., Harste, G., & Pring-Åkerblom, P. (2003). Rapid and quantitative detection

of human adenovirus DNA by real-time PCR. Journal of Medical Virology, 70(2), 228–239.

https://doi.org/10.1002/jmv.10382

127

APPENDIX B

FATE OF NATURALLY OCCURRING VIRAL INDICATORS IN PRESSURE-DRIVEN

MEMBRANE PROCESSES FOR ADVANCED TREATMENT OF WASTEWATER AT

PILOT AND FULL-SCALE.

Christina M. Morrison1, Justin T. Clark1, Bianca Miguel De Souza Chavez2, Andrea Achilli2,

Walter Q. Betancourt1, Charles P. Gerba1

1The University of Arizona, Department of Environmental Science, Tucson, AZ

2The University of Arizona, Department of Chemical and Environmental Engineering, Tucson,

Prepared for submission to Desalination

128

Abstract

The use of membrane processes as a barrier for contaminant removal is a common practice in many water reuse schemes. Membrane processes can be particularly valuable to control microbial pathogens in water reuse schemes since they allow significant physical removal of pathogens prior to chemical disinfection. Pressure-driven integrated ultrafiltration

(UF) and reverse osmosis (RO) membrane processes should have the capability for significant removal of viruses, however manufacturing imperfections and damage can result in inadequate removal of viruses. Therefore, membrane integrity monitoring is required for virus log10 removal value (LRV) attribution. This study evaluates the potential for viruses which occur naturally in wastewater (i.e. not spiked) as potential on-line indicators of membrane integrity. Pepper Mild

Mottle Virus (PMMoV), Cucumber Green Mottle Mosaic Virus (CGMMV), Wastewater circular rep-encoding single stranded (CRESS) DNA Virus 2 (WCDV-2), and human adenoviruses

(HAdVs) were evaluated across three different integrated membrane processes at both pilot and full-scale. Both PMMoV and CGMMV were detected in high prevalence from feed waters from all facilities, and concentrations were nearly indistinguishable from one another. WCDV-2, exhibited regional specificity, with prevalence decreasing with increasing distance from its place of discovery. LRVs from pilot-scale membrane processes were 1 to 3 log10 values higher than the full-scale facility, highlighting the necessity of membrane integrity evaluation at full scale.

Overall, due to their prevalence and abundance in both feed water and permeate across several facilities with various pre-treatment, as well as their large removals, PMMoV and CGMMV displayed the highest potential as membrane integrity indicators.

129

1. Introduction

Projections of worldwide water shortages have led to an increased interest in wastewater reuse for potable and non-potable purposes. The use of membrane processes as a barrier for contaminant removal is a common practice in many water reuse schemes (Reeve et al., 2016;

Tang et al., 2018; Wintgens et al., 2005). Membrane processes can be particularly valuable to control microbial pathogens in water reuse schemes since they allow significant physical removal of pathogens prior to chemical disinfection. Viruses require the highest log10 reduction values (LRVs) (CCR, 2015; NWRI, 2013; TWDB; 2015) due to variations in the effectiveness of chemical disinfection on inactivation of human pathogenic viruses (Torrey et al., 2019;

Xagoraraki et al., 2014).

High-pressure membranes, particularly reverse osmosis (RO), are key components of advanced wastewater reclamation systems for potable reuse application given their efficiency in removal of dissolved salts and pathogens, especially viruses (Pype, Lawrence, et al., 2016; Tang et al., 2018). RO membranes are often preceded by pretreatment via low-pressure membrane processes, such as ultrafiltration (UF), for mitigating RO membrane fouling, which increases the quality of the water being fed to the RO process (Tang et al., 2018). UF, a low-pressure membrane technology, has a pore size ranging from 10 to 100 nm. Medium- to high-pressure RO membranes with the smallest pores, are not considered size exclusion processes and at this level the separation of dissolved constituents is based on ionic diffusion (Warsinger et al., 2018).

Notwithstanding, both membrane technologies should have the capability for significant removal of viruses. In practice, inadequate removal of viruses by size-exclusion and ionic diffusion can occur for various reasons, including manufacturing imperfections, leaking seals and O-rings, as

130 well as damage during use (Ferrer et al., 2013; Pype, Lawrence, et al., 2016; US EPA, 2005;

Vickers et al., 2019).

Because of these limitations, virus log10 reduction value (LRV) attribution for membrane processes can only be obtained through regular monitoring and testing to ensure membrane integrity. Direct integrity testing is accomplished by pressure decay tests as well as direct spiking of bacteriophages that are performed off-line at specified intervals (Pype, Lawrence, et al., 2016;

US EPA, 2005). Indirect integrity testing is usually performed through on-line monitoring of a water quality surrogate, such as conductivity or total organic carbon (TOC), in the permeate stream which is then translated to membrane integrity (US EPA, 2005). However, due to limitations in detection sensitivity of conductivity and TOC, only minimal LRVs can be attributed to membrane processes. RO can receive up to 2 LRVs with regular monitoring in most states, whereas UF can receive up to 1, despite their ability to achieve greater reductions during experiments with spiked bacteriophages (Antony et al., 2016; Elhadidy et al., 2013; ElHadidy et al., 2014; Joseph G. Jacangelo et al., 1991; Kitis et al., 2003; Kreißel et al., 2012; Madireddi et al., 1997; Mi et al., 2004; Pierre et al., 2011; Pype, Donose, et al., 2016).

Previous studies evaluating virus removal by UF and RO membrane processes at bench or pilot-scale operation demonstrated LRVs of MS2 coliphage from 1 to >7.2 by UF (Hu et al.,

2003; Jacangelo et al., 1991), and from 2.7 to >6.7 by RO membranes (Madireddi et al., 1997).

While MS2 coliphage has been recommended for the use of direct integrity monitoring in the US

EPA Membrane Filtration Guidance Manual (US EPA, 2005), regular direct integrity testing of each membrane unit by the plaque assay is time consuming and costly to perform at full-scale, where large volumes of high-titer viruses need to be propagated to demonstrate target LRVs

(Pype, Lawrence, et al., 2016). In addition, MS2 is among the most hydrophobic of non-lipid

131 viruses (Farrah, 1982), making it potentially more easily removed due to interactions with membrane material. The use of naturally occurring viruses for monitoring membrane integrity at full-scale operation is more appealing as it would provide key information on virus removal and would eliminate the logistical issues associated with spiking bacteriophages at full-scale. Few studies have evaluated the removal of naturally occurring virus by integrated membrane processes. Otaki et al. (1998) and Ferrer et al. (2015) examined the removal of naturally occurring bacteriophages during pilot-scale UF of surface water and demonstrated LRVs of < 1 to 3. Lee et al. (2019) found LRVs of the Pepper mild mottle virus (PMMoV) ranging from < 1 to 4 during UF of treated effluent with variations in removal attributed to the extent of membrane damage. More recently, Hornstra et al. (2019) evaluated the integrity of RO membranes in pilot- scale operation by selecting novel natural viruses that were present abundantly in surface water.

The novel viruses were identified by metagenomics and their genomes were quantified by real time PCR, demonstrating LRVs of > 7 for an intact, pilot-scale RO membrane. Additionally,

Prado et al. (2019) evaluated LRVs of human adenoviruses (HAdV) and JC polyomaviruses

(JCPyV) across a full-scale advanced treatment scheme that included RO membranes. These studies demonstrated LRVs of 2.65 for HAdV and 2.3 for JCPyV.

In this study we analyze the use of a novel eukaryotic circular Rep-encoding ssDNA viruses (CRESS DNA) virus (Wastewater CRESS DNA Virus-2, WCDV-2), two plant viruses from the genus Tobamovirus, PMMoV and Cucumber green mottle mosaic virus (CGMMV), as well as human adenoviruses (HAdVs) as naturally occurring viral indicator of membrane integrity.

These naturally occurring viruses were selected as potential viral indicators to evaluate membrane integrity across three different integrated membrane processes in pilot and full-scale operation for wastewater reuse applications in the United States. This is the first demonstration

132 of natural virus removal at full-scale, as well as the first study to evaluate the potential for

CRESS DNA viruses to be utilized as process indicators.

Plant viruses, such as PMMoV have shown extreme abundance in wastewater effluent and resistance to treatment (Betancourt et al., 2014; Kato et al., 2018; Kitajima et al., 2014;

Morrison et al., 2020; Schmitz et al., 2016; Shirasaki et al., 2017), which may render these viruses as suitable indicators of advanced wastewater treatment performance, including size- exclusion mechanisms of virus removal by pressure-driven membrane processes. However, the rod-shaped capsid of PMMoV is unlike that of human enteric viruses, which could potentially make them less relevant as predictors of human virus fate. A virus which occurs abundantly in wastewater that exhibits a more relevant capsid design might provide more insight to physical removal of viruses by size-exclusion mechanisms associated with RO membranes.

CRESS viruses are among the smallest of eukaryotic viruses represented by an assortment of virus families described as circular rep-encoding single-stranded (CRESS) DNA viruses, many of which have recently been unified to the virus phylum Cressdnaviricota

(Krupovic et al., 2020). Eukaryotic CRESS viruses are largely undescribed, however, the virions of described families range from 15-40 nm in diameter and are capable of infecting a variety of host species, including plants, mammals, and invertebrates (Zhao et al., 2019). CRESS DNA viruses have been detected in both wastewater and treated effluent (Kraberger et al., 2015;

Rosario et al., 2019), however, there has been little research into the potential for these eukaryotic viruses to be used as a process indicators of virus removal during water/wastewater treatment processes.

This study aimed to analyze the use of a novel eukaryotic CRESS virus, Wastewater

CRESS DNA Virus-2 (WCDV-2), two plant viruses from the genus Tobamovirus, PMMoV and

133

Cucumber green mottle mosaic virus (CGMMV), as well as human adenoviruses (HAdVs).

CRESS DNA viruses to be utilized as process indictors.

2. Materials and Methods

2.1 Integrated membrane systems

Three facilities that utilize pressure-driven membrane processes, UF and RO, for potable water reuse were selected for this study under the premise that all three viruses were equally present in feed water to be pretreated by UF membranes prior to RO processes. The schematics of the facilities are presented in Figure 1 and specific details of each membrane process are described in Table 1. Membrane system A (MSA) is a pilot-scale operation system at the

University of Arizona Water, Energy & Sustainable Technology (WEST) Center which receives tertiary treated wastewater effluent from a local, full-scale, wastewater treatment plant, implementing dissolved air flotation, 5-stage modified bardenpho, disc filtration, and chlorination (Figure 1a). Membrane system B (MSB) represents a full-scale integrated membrane process as part of an advanced water treatment plant for direct potable reuse applications. Membrane feed water is treated by primary sedimentation, activated sludge with secondary clarification, disc filtration, and ozonation (Figure 1b). Membrane system C (MSC) is a pilot-scale UF and RO membrane system which receives treated effluent that has undergone primary sedimentation, secondary treatment through a series of constructed wetlands, disc filtration, and chlorination prior to being allocated for on-site potable reuse (Figure 1c).

134

2.2 Indicator viruses

PMMoV and CGMoV are two plant viruses within the Tobamovirus genus characterized by rod-shaped, non-enveloped virions of 18 nm in diameter with a predominant length of 300-

310 nm (Wetter et al., 1984). The virus genome consists of single-stranded, positive-sense RNA.

A novel CRESS DNA virus was selected for this study, Wastewater CRESS DNA Virus 2,

(WCDV-2), which was initially identified in treated wastewater using a degenerate PCR assay targeting the replication protein (Rep) of members of the Circoviridae family (Rosario et al.,

2019). CRESS DNA viruses are single-stranded DNA (ssDNA) viruses with relatively small genomes and are among the smallest of eukaryotic viruses, with icosahedral capsids ranging from 15-40 nm (Zhang et al., 2019). CRESS viruses are ideal natural surrogates of size-exclusion integrated membrane processes due to their small size. Human adenoviruses (HAdVs) were also evaluated as they are found abundantly in wastewater effluent and are highly resistant to ultraviolet disinfection, which increases the need for physical removal by pressure-driven membrane processes (Rames et al., 2016).

2.3 Sample Collection

Reverse osmosis permeate was collected using a series of primary and secondary concentration methods to fulfill downstream analytical sensitivities associated with clean water sources. The recovery and concentration of viruses from the RO permeate stream involved filtration of 1,000 L using an electropositive charged NanoCeram filter (Argonide Corporation,

Sanford, FL, USA). Filters were processed within 24 hours of sample collection using methods described in Ikner et al. (2011), which includes virus elution using 1% (w/v) sodium polyphosphate followed by virus recovery and concentration via centrifugal ultrafiltration

(Centricon Plus – 70, Millipore Sigma, Burlington, MA, 100,000 nominal molecular weight

135 limit). Final concentrated sample volumes were stored at - 80 °C until nucleic acid extractions were performed.

Feed water to each RO system from MSA and MSC was collected in sterile bottles and processed by membrane filtration following the principles of the method previously described by

Katayama et al. (2002). Preliminary assays indicated that water used to feed MSB had much lower concentrations of viruses compared to MSA and MSC, therefore a large volume of water was needed for analysis of incoming indicator concentrations. For this purpose, 50 L samples were processed by NanoCeram filtration. All final concentrated sample volumes were stored at -

80 °C until nucleic acid extractions were performed.

A total of seven feed and permeate samples were collected and analyzed for MSA. Eight permeate samples were collected and analyzed from MSB, however only four feed samples were able to be collected and analyzed from this membrane system. Eight feed and permeate samples were collected and analyzed from MSC.

2.5 Molecular Analysis

Nucleic acids were extracted from samples using the QIamp Ultrasens Virus Kit (Qiagen,

Hilden, Germany), per manufacturer’s instruction. Complimentary DNA (cDNA) was synthesized from a portion of the extracted nucleic acids using the High Capacity cDNA Reverse

Transcription kit with random hexamers (Applied Biosystems, Foster City, CA, USA), per manufacturer’s instruction. Quantitative polymerase chain reaction (qPCR) was performed to quantify target sequences, using the LightCycler 480 Instrument II (Roche Applied Science,

Indianapolis, IN, USA) and analyzed with LightCycler 480 Software version 1.5. Reaction volumes consisted of 25 uL containing 12.5 µL Lightcycler 480 Probes Master Mix (Roche

136

Diagnostics), 5 µL template, and primers and probes as listed in Table 2. Inhibition was evaluated and mitigated using techniques described in Morrison et al., (2020).

2.6 Statistical Analysis

Statistical analysis was performed using R (version 3.6.3). The R package NADA was utilized to properly handle left-censored data. Summary statistics were estimated using the

Kaplan-Meier method within the cenfit( ) function, where applicable. Differences between virus concentrations in the feed and permeate samples were determined using the cendiff( ) function with rho = 1 (Peto & Peto modification of the Gehan-Wilcoxon Test), with α = 0.05. Feed and permeate concentrations which failed to reject the null hypothesis were subjected to pairwise comparisons using the same cendiff( ) function, using Bonferroni’s method using a p-value less than � . Four virus targets results in six pairwise groups, meaning pairwise �� comparisons with a p value less than 0.00833 were considered significantly different (Helsel,

2012).

2.7 Quality Assurance/Quality Control

All sample collection equipment was sterilized prior to collection by either autoclaving at

120 °C for 15 minutes prior to use or soaking for 20 minutes in a 10% bleach solution and neutralization by sodium thiosulfate. All sample processing was performed in a designated environmental sample processing area. Nucleic acid extractions were performed in designated hood which was wiped down with 10% bleach and UV light treated for 15 minutes before and after extractions. An extraction blank consisting of 0.01 M phosphate buffered saline was processed with each set of samples to account for cross contamination that might occur during nucleic acid extractions. All molecular analyses were performed in a separate room designated for molecular work (i.e. no sample processing). PCR reagents were prepared in a separate “clean

137 room” in which any samples or positive controls were excluded. PCR reagent preparation took place within a hood which was UV light treated before and after use to reduce any cross contamination of primers or probes. Template addition took place in a separate hood outside of the PCR clean room, which was both treated with bleach and UV light before and after use. No template controls containing nuclease free water are utilized to assess false negatives which may occur during qPCR. Target standards in the form of double- stranded DNA fragments (i.e., gBlock gene fragments) synthesized by Integrated DNA Technologies (Coralville, Iowa) were used for generation of standard curves and included in each run for absolute quantification of virus genomes.

3. Results

3.1 Virus prevalence in feed water and permeate stream

Presence of each virus were indicated by amplification during qPCR in feed and permeate samples from each membrane system, and the results are illustrated in Figure 2a-b. The results demonstrated differences in the detection frequency of viral targets in feed water to the different membrane systems, with viruses detected in the feed from MSB less frequently. The detection frequency between PMMoV and CGMMV were largely indistinguishable in most cases, with PMMoV showing higher prevalence only in permeate from MSA operating at pilot- scale. Interestingly, WCDV-2 was detected in 100% of the feed water and 57% of the permeate samples from this membrane system, where WCDV-2 was originally isolated. However, this virus was not detected from the feed water for MSB and MSC, and only occurred once in a permeate sample from MSB operating at full-scale. HAdVs were detected in most feed samples from MSA but never detected in RO permeate. However, HAdVs were detected in permeate

138 samples from membrane systems B and C after remaining undetected in water fed to the membrane systems.

3.2 Concentration of viruses through integrated membrane process

Concentrations of virus markers were determined in the feed and permeate using RT- qPCR/qPCR assays with corresponding calibration curves for quantification. For comparison purposes, concentrations are displayed as the log10 transformed genomic copies (gc) per 100 L of water, as to keep the log10 permeate values positive. Concentrations of viral targets are displayed in Figure 2a-c.

Similar PMMoV concentrations were observed in feed water of MSA and MSC (8.1 ±

0.4 and 8.2 ± 0.9 log10 gc per 100 L, respectively), however its concentration was more variable in the feed water of full-scale MSB (4.9 ± 2.0 log10 gc per 100 L). CGMMV was orders of magnitude lower in feed water of MSA (5.8 ± 0.5 log10 gc per 100 L), however concentrations of this virus in feed water of MSB and MSC were statistically similar to PMMoV (7.5 ± 0.9 and 4.3

± 1.3 log10 gc per 100 L). WCDV-2, which was only detected in feed water at MSA, was detected at similar levels to CGMMV (5.9 ± 1.3 log10 gc per 100 L), but with greater variability.

Similarly, HAdVs were only detected in feed water at MSA, and exhibited the lowest concentration of all potential indicators (3.8 ± 0.5 log10 gc per 100 L). The concentrations of the viral indicators in feed water for MSA were statistically different (p < 0.05), with PMMoV found significantly higher than the rest of the viruses (p < 8.33e-03).

Despite the variability in concentrations of virus genomes in water fed to each membrane system, the concentrations of viruses in permeate streams were relatively similar. PMMoV and

CGMMV concentrations were indistinguishable from each other but their concentrations were slightly higher in permeate streams from MSB (2.9 ± 0.2 and 2.5 ± 0.4 log10 gc per 100 L,

139 respectively) when compared to the permeate of the rest of the membrane systems. WCDV-2 was detected at similar levels in permeate streams from MSA and MSB (1.4 ± 0.5 and 1.3 ± 0.4 log10 gc per 100 L, respectively), whereas HAdVs were detected at similar levels from permeate streams corresponding to MSB and MSC (1.3 ± 0.4 and 1.1 ± 0.3 log10 gc per 100 L, respectively). PMMoV and CGMMV were found to be significantly higher than WCDV-2 and

HAdVs at permeate stream from MSC only (p < 8.33e-03), otherwise there were no discernable differences between indicator concentrations in the permeate samples.

3.3 Average reduction of Viruses across integrated membrane processes

To assess average LRVs of each viral indicator corresponding to each membrane system, differences in average log10 virus concentrations between the feed water and permeate stream were determined (Table 3). Average LRVs were only determined for viral indicators that were detected in feed water. PMMoV exhibited the highest LRVs from each membrane system, with the full-scale process (MSB) exhibiting the lowest PMMoV LRV corresponding to 3.4, and the pilot-scale membranes exhibiting similar removals (5.8 and 6.0 for MSA and MSC, respectively). Removal of CGMMV was more variable among the three membrane systems, ranging from 2.8 to 5.1. MSB (full-scale) again exhibited the lowest removals. LRVs of WCDV-

2 and HAdVs were only determined from MSA, corresponding to 4.4 and >2.6, respectively.

3.4 Reduction of PMMoV at a pilot-scale membrane system for on-site reuse

MSC was part of an on-site pilot potable reuse project that relied on PMMoV LRVs to evaluate the extent to which UF and RO were contributing to the overall removal of a surrogate virus. This allowed for LRVs to be determined across each set of membranes. The results indicated that PMMoV LRVs were very similar across both membranes despite the different

140 characteristics of each membrane system. The LRV observed for PMMoV by UF was 3.1 while the LRV by RO was 2.9.

4. Discussion

A large discrepancy in LRVs of the selected naturally occurring viruses was observed by the results obtained from the membrane systems operating at pilot and full-scale. LRVs of

PMMoV and CGMMV at pilot-scale operation were 1 to 2 log10 more than at full-scale operation. This can be explained by the many hundreds of individual UF and RO membranes in operation at full-scale, increasing the likelihood of minor damage in any of the membranes that may go unnoticed via conductivity or TOC monitoring, as currently on-line monitoring of these surrogates is not sensitive enough to notice minute fluctuations (Pype, Donose, et al., 2016).

LRVs of plant viruses ranged from 2.8 to 3.4 across UF combined with RO treatment, which is much lower than MS2 spiking studies previously conducted at full scale, which ranged from 1.18 to 5.4 for UF (Kruithof et al., 2001; Regel et al., 2012) and 3.0 to 6.0 during RO (Kruithof et al.,

2001; Vickers et al., 2019). The low removal values at full-scale were largely influenced by the low concentration of indicators in the feed water (Figure 3b). Prado et al. (2019) found similar low removals of naturally occurring viruses across an extensive advanced treatment scheme which included RO membranes. MSB received high-quality water compared to water used to feed MSA and MSC, despite water fed to MSA undergoing similar levels of treatment prior to the integrated membrane process. This issue needs special consideration when selecting a specific virus or group of viruses to evaluate the integrity of membrane systems. Repeated sampling of feed water and permeate stream at the same facility taking into consideration the long-term quality of feed water, the type of membrane, operational parameters (e.g., feed water fouling parameters, transmembrane pressure, flux rate), virus recovery efficiencies and analysis

141 of similar equivalent volumes may provide a more realistic approach for selecting suitable, naturally occurring viral indicators of membrane integrity. These components will allow better estimations of LRVs of integrated membrane processes. Despite the low initial concentration, the full-scale facility (MSB) was the only membrane system which exhibited presence of every viral indicator at least once (WCDV-2 and HAdVs) and up to five occasions (PMMoV and CGMMV) in the permeate (Figure 2b).

At the pilot-scale, the overall LRVs of viral indicators were also relatively low when compared to previous studies. Reductions of viruses, mainly MS2 coliphage, from RO alone, during pilot-scale treatment have exhibited LRVs of greater than 6, unless the membrane was manually compromised (Hornstra et al., 2019; Kitis et al., 2003; Madireddi et al., 1997). The highest LRV determined in this study was 6.0 for PMMoV at MSC, however when broken down by membrane, RO only exhibited an LRV of 2.9. LRVs of viruses from pilot-scale UF filters implementing a range of MWCOs have ranged from 2.8 to greater than 7 as demonstrated for spiked MS2 coliphage (Boudaud et al., 2012; Ferrer et al., 2015; J. G. Jacangelo et al., 2005;

Joseph G. Jacangelo et al., 1991; Madireddi et al., 1997). Interestingly, all studies with UF that implemented naturally occurring viruses tended to exhibit lower LRVs, from <1 to 4 (Ferrer et al., 2015; Lee et al., 2019; Otaki et al., 1998), indicating that lab-propagated MS2 might be more efficiently removed than viruses which are naturally present in treated water.

Based on the four indicators evaluated in this study, PMMoV exhibited both the highest prevalence as well as highest concentrations in the feed, a necessary requirement for an indicator of membrane integrity. The prevalence of PMMoV in the treated wastewater effluent which feeds the membrane processes is in agreement with other evaluations of PMMoV in secondary and tertiary treated effluent (Betancourt et al., 2014; Kitajima et al., 2014; Morrison et al., 2020;

142

Rosario, Symonds, et al., 2009; Sassi et al., 2018; Schmitz et al., 2016; Symonds et al., 2014;

Tandukar et al., 2020). Interestingly, our results deviate from other studies in which PMMoV offers the most conservative estimate of virus removal during treatment (Kitajima et al., 2014;

Rosario, Symonds, et al., 2009; Schmitz et al., 2016), as CGMMV exhibited lower reduction values, by roughly 1 LRV. However, a conservative indicator is not necessarily the most desired for membrane integrity, as current surrogates (conductivity, TOC) already provide an overly conservative estimate, due to limitations of their detection sensitivity, which restricts current

LRV attributions (Pype, Lawrence, et al., 2016). Further studies which evaluate the sensitivity of

PMMoV detection as well as other viruses in permeate stream as a function of membrane damage, such as those performed by Lee et al., (2019), would be beneficial, particularly at full- scale where data is lacking.

This was the first study to evaluate CGMMV, another member of the genus

Tobamovirus, as an indicator of virus removal. Despite CGMMV and other Tobamoviruses, such as Tobacco Mosaic Virus, being found abundantly in feces and wastewater (Bačnik et al., 2020;

Rosario, Nilsson, et al., 2009; T. Zhang et al., 2006), there have been limited studies evaluating their removal during water/wastewater treatment (Tandukar et al., 2020). Both prevalence and concentrations of CGMMV mirrored PMMoV in almost every sampling location, excluding

MSA, where PMMoV was found to be significantly higher than CGMMV. As previously mentioned, CGMMV exhibited lower LRVs than PMMoV from every membrane system, making it a more conservative estimator than PMMoV. This result has valuable implications for log10 reduction determination during water and wastewater treatment, where conservative estimators are valuable for risk assessments. Additionally, as wastewater reuse applications produce increasingly cleaner waters after each step, making the detection of single viral species

143 difficult due to limits of detection, it might be worthwhile to utilize PCR primers that more broadly target Tobamoviruses as a whole group of viral indicators, as they have similar physical properties, are highly abundant in wastewater, and behave in similar fashions through treatment.

Another goal of the study was to evaluate the potential of a CRESS DNA Virus as an indicator of membrane integrity. Eukaryotic CRESS viruses are among the smallest of viruses, some as small as 14 nm in diameter (Zhao et al., 2019), which could likely lead to greater passage through compromised membranes, and thus easier detection in permeate streams.

WCDV-2 was discovered in a previous study evaluating the treated effluent which feeds MSA

(Rosario et al., 2019), and was unsurprisingly detected in 100% of the feed samples from the same facility during this study. Despite its lower initial concentration when compared to

PMMoV and CGMMV, WCDV-2 was detected in the permeate stream of MSA in similar concentrations (Figure 3), thus supporting the idea that they are passing through damaged membranes at potentially greater rates. However, this novel virus provided minimal use at the other two membrane systems. Interestingly, WCDV-2 was detected in RO permeate stream of

MSB, which is located roughly 170 km away from the facility housing MSA where the virus was initially isolated, but was not detected in the feed or the permeate from MSC, located over 1,000 km away , indicating that this novel virus might be spatially associated and therefore geographically distinct which warrants further investigations. Current virus metagenomic studies conducted by our group revealed more than 100 operational taxonomic units belonging to

CRESS viruses associated with RO permeate stream of MSA (unpublished). Additional research identifying human-associated CRESS viruses with less spatial constriction would be valuable for the continued search of virus indicators, particularly for integrated membrane processes. CRESS

144 viruses are particularly suitable as viral indicators of size-exclusion treatment processes due to their small size and morphology compared to other eukaryotic or prokaryotic viruses.

The use of HAdVs as indicators of virus removal has been suggested due to their abundance in treated wastewater, their resistance to UV disinfection, and the fact that they are human enteric viruses (Rames et al., 2016; Rusiñol et al., 2014). As UV treatment is typically applied after membrane processes, it was important to consider HAdVs in this study, as this would be a main barrier for removal of highly UV resistant viruses. However, in this study,

HAdVs were not detected in feed waters from MSB and MSC, despite being detected in permeate. This could be attributed to the lower volumes examined in feed samples or lower feed sampling events at MSB. Additionally, feed samples consisted of grab samples, whereas permeate samples require up to two hours of on-site filtration, in which concentrations might fluctuate, and thus could account for detection in permeate but not feed. Additionally, feed from

MSA, where they were successfully detected, the concentration of HAdVs is much lower than in studies which evaluate the same effluent (Betancourt et al., 2014; Morrison et al., 2020; Sassi et al., 2018; Schmitz et al., 2016). This might reflect any potential seasonal variability of HAdVs, differences in recovery by different concentration methods, or a change in operational parameters of the WWTP feeding MSA, which could reduce the concentration of HAdVs. The data from this study indicate that HAdVs are less valuable as a membrane integrity indicator, however, the passage of HAdVs through both UF and RO treatment, as shown in the permeate of

MSB and MSC exemplifies the necessity of membrane integrity testing for LRV attribution.

HAdVs are larger than many other enteric viruses, ranging from 60-90 nm in diameter, with long fibrils extending from the capsid, therefore damage which would allow for the passage of

HAdVs is indicative of the likely passage of smaller enteric viruses. However, as the presence of

145 viruses were determined using qPCR, it is unclear whether this represents the passage of a fully intact virus or solely the genomic material.

5. Conclusions

This was the first study to evaluate naturally occurring indicator organisms across UF and

RO at full scale, the first study to evaluate the removal of plant pathogens from the genus

Tobamovirus during RO, as well as the first study to evaluate the use of highly abundant CRESS

DNA viruses as potential virus removal indicators during any form of water/wastewater treatment. Due to its prevalence and abundance in feed waters, PMMoV displayed the highest potential as a membrane integrity indicator. CGMMV also showed potential as a conservative indicator, as it was removed less efficiently than PMMoV. This is the first study to evaluate

CGMMV in any virus reduction capacity, and its conservative removal warrants further research as a viral water quality indicator. WCDV-2, a CRESS DNA Virus, was found in abundance at

MSA, where it had previously been discovered, and exhibited lower LRVs than PMMoV in this system. However, it was detected infrequently at MSB, which was less than 200 km away from

MSA, and undetected at MSC, over 1,000 km away, likely meaning that this potential indicator is highly localized. Overall, naturally occurring indicators of membrane integrity have potential to eliminate the need for large spiking studies, and further research evaluating their reductions with specific levels of membrane damage. This is particularly needed at full-scale where, as shown in this study, removal values vary greatly from pilot-scale operations due to the increased number of membrane modules which might acquire damage.

Funding

The authors acknowledge financial support provided by the United States Department of

Agriculture-National Institute of Food and Agriculture, Grant Number 20166800725064, that

146 established CONSERVE: A Center of Excellence at the Nexus of Sustainable Water Reuse, Food and Health.

147

References

Antony, A., Branch, A., Leslie, G., & Le-Clech, P. (2016). Impact of membrane ageing on

reverse osmosis performance – Implications on validation protocol. Journal of Membrane

Science, 520, 37–44. https://doi.org/10.1016/j.memsci.2016.07.036

Bačnik, K., Kutnjak, D., Pecman, A., Mehle, N., Žnidarič, M. T., Aguirre, I. G., & Ravnikar, M.

(2020). Viromics and infectivity analysis reveal the release of infective plant viruses from

wastewater into the environment. Water Research, 177, 115628.

https://doi.org/10.1016/j.watres.2020.115628

Betancourt, W. Q., Kitajima, M., Wing, A. D., Regnery, J., Drewes, J. E., Pepper, I. L., & Gerba,

C. P. (2014). Assessment of virus removal by managed aquifer recharge at three full-scale

operations. Journal of Environmental Science and Health. Part A, Toxic/Hazardous

Substances & Environmental Engineering, 49(14), 1685–1692.

https://doi.org/10.1080/10934529.2014.951233

Boudaud, N., Machinal, C., David, F., Fréval-Le Bourdonnec, A., Jossent, J., Bakanga, F., Arnal,

C., Jaffrezic, M. P., Oberti, S., & Gantzer, C. (2012). Removal of MS2, Qβ and GA

bacteriophages during drinking water treatment at pilot scale. Water Research, 46(8), 2651–

2664. https://doi.org/10.1016/j.watres.2012.02.020

Elhadidy, A. M., Peldszus, S., & Van Dyke, M. I. (2013). An evaluation of virus removal

mechanisms by ultrafiltration membranes using MS2 and φx174 bacteriophage. Separation

and Purification Technology, 120, 215–223. https://doi.org/10.1016/j.seppur.2013.09.026

ElHadidy, A. M., Peldszus, S., & Van Dyke, M. I. (2014). Effect of hydraulically reversible and

hydraulically irreversible fouling on the removal of MS2 and φX174 bacteriophage by an

148

ultrafiltration membrane. Water Research, 61, 297–307.

https://doi.org/10.1016/j.watres.2014.05.003

Farrah, S. R. (1982). Chemical factors influencing adsorption of bacteriophage MS2 to

membrane filters. Applied and Environmental Microbiology, 43(3), 659–663.

https://doi.org/10.1128/aem.43.3.659-663.1982

Ferrer, O., Casas, R., Galvañ, C., Lucena, F., Vega, A., Gibert, O., Jofre, J., & Bernat, X. (2013).

Challenge tests with virus surrogates: an accurate membrane integrity evaluation system?

Desalination and Water Treatment, 51(25–27), 4947–4957.

https://doi.org/10.1080/19443994.2013.795339

Ferrer, O., Casas, S., Galvañ, C., Lucena, F., Bosch, A., Galofré, B., Mesa, J., Jofre, J., & Bernat,

X. (2015). Direct ultrafiltration performance and membrane integrity monitoring by

microbiological analysis. Water Research, 83, 121–131.

https://doi.org/10.1016/j.watres.2015.06.039

Helsel, D. R. (2012). Statistics for Censored Environmental Data Using Minitab (2nd ed.). John

Wiley & Sons, Inc.

Hornstra, L. M., Rodrigues da Silva, T., Blankert, B., Heijnen, L., Beerendonk, E., Cornelissen,

E. R., & Medema, G. (2019). Monitoring the integrity of reverse osmosis membranes using

novel indigenous freshwater viruses and bacteriophages. Environmental Science: Water

Research & Technology. https://doi.org/10.1039/C9EW00318E

Hu, J. Y., Ong, S. L., Song, L. F., Feng, Y. Y., Liu, W. T., Tan, T. W., Lee, L. Y., & Ng, W. J.

(2003). Removal of MS2 bacteriophage using membrane technologies. Water Science and

Technology, 47(12), 163–168. https://doi.org/10.2166/wst.2003.0642

149

Ikner, L. A., Soto-Beltran, M., & Bright, K. R. (2011). New method using a positively charged

microporous filter and ultrafiltration for concentration of viruses from tap water. Applied

and Environmental Microbiology, 77(10), 3500–3506. https://doi.org/10.1128/AEM.02705-

Jacangelo, J. G., Madec, A., Schwab, K. J., Huffman, D. E., & Mysore, C. S. (2005). Advances

in the use of low-pressure, hollow fiber membranes for the disinfection of water. Water

Science and Technology: Water Supply, 5(5), 109–115.

https://doi.org/10.2166/ws.2005.0045

Jacangelo, Joseph G., Laine, J. M., Carns, K. E., Cummings, E. W., & Mallevialle, J. (1991).

Low-pressure membrane filtration for removing Giardia and microbial indicators. Journal /

American Water Works Association, 83(9), 97–106. https://doi.org/10.1002/j.1551-

8833.1991.tb07219.x

Katayama, H., Shimasaki, A., & Ohgaki, S. (2002). Development of a virus concentration

method and its application to detection of enterovirus and Norwalk virus from coastal

seawater. Applied and Environmental Microbiology, 68(3), 1033–1039.

https://doi.org/10.1128/AEM.68.3.1033-1039.2002

Kato, R., Asami, T., Utagawa, E., Furumai, H., & Katayama, H. (2018). Pepper mild mottle virus

as a process indicator at drinking water treatment plants employing coagulation-

sedimentation, rapid sand filtration, ozonation, and biological activated carbon treatments in

Japan. Water Research, 132, 61–70. https://doi.org/10.1016/j.watres.2017.12.068

Kitajima, M., Iker, B. C., Pepper, I. L., & Gerba, C. P. (2014). Relative abundance and treatment

reduction of viruses during wastewater treatment processes - Identification of potential viral

150

indicators. Science of the Total Environment, 488–489(1), 290–296.

https://doi.org/10.1016/j.scitotenv.2014.04.087

Kitis, M., Lozier, J. C., Kim, J. H., Mi, B., & Mariñas, B. J. (2003). Microbial removal and