DOCSLIB.ORG

Point Mutations in the Dystrophin Gene ROLAND G

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Point Mutations in the Dystrophin Gene ROLAND G Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2331-2335, March 1992 Genetics Point mutations in the dystrophin gene ROLAND G. ROBERTS, MARTIN BOBROW, AND DAVID R. BENTLEY Paediatric Research Unit, Division of Medical and Molecular Genetics, United Medical and Dental Schools of Guy's and St. Thomas's, Guy's Campus, London SE1 9RT, United Kingdom Communicated by Renato Dulbecco, December 16, 1991 ABSTRACT Derming the range of mutations in genes that The ability to identify mutations on a routine basis allows cause human disease is essential to determine the mechanisms precise establishment ofcarrier status in affected families and of genetic variation and the function of gene domains and to permits accurate prenatal diagnosis. In families with no gross perform precise carrier and prenatal diagnosis. The mutations dystrophin gene rearrangement, diagnosis of carriers cur- in one-third of Duchenne muscular dystrophy patients remain rently relies on linkage analysis. Due to the high mutation unknown as they do not involve gross rearrangements of the rate, the mutation has often originated within a living family dystrophin gene. The size and complexity of the gene have member; hence relatives carrying a high-risk haplotype may prohibited the systematic definition of point mutations. We not carry the mutation. Furthermore, recombination occurs have developed a method for the identification of these muta- within the dystrophin gene in up to 12% of meioses (9), tions by nested amplification, chemical mismatch detection, necessitating the analysis of flanking markers. Direct diag- and sequencing of reverse transcripts of trace amounts of nosis would not be subject to either of these problems. dystrophin mRNA from peripheral blood lymphocytes. Anal- We have analyzed the entire coding sequence of the ysis of the entire coding region (11 kilobases) in seven patients dystrophin gene from seven patients with DMD or interme- has resulted in detection of a sequence change in each case that diate muscular dystrophy (IMD). In each case one mutation is clearly sufficient to cause the disease. All mutations should is clearly sufficient to cause the disease. The approach we cause premature translational termination, and the resulting have used permits direct diagnosis to be extended to virtually phenotypes are thus equivalent to those caused by frameshift- any case of DMD and BMD and is applicable to many other ing deletions. The results support a particular functional complex tissue-specific genes. importance for the C-terminal region of dystrophin. Applica- tion of this approach to mutation detection will extend direct carrier and prenatal diagnosis to virtually every affected MATERIALS AND METHODS family. Patients. Patients with DMD or IMD were selected solely on the basis that no deletion was detected by a multiplex PCR The spectrum ofmutations that cause genetic disease exhibits (10), which is capable of identifying 98% of deletions. Phe- unusual variation in some genes. Mutations in the dystrophin notypes are indicated at the right of Fig. 3 (MR, mental (1) and steroid sulfatase (2) loci, for example, are predomi- retardation), in the format "diagnosis, age ofdiagnosis/age of nantly heterogeneous deletions, whereas mutations in anti- confinement to wheelchair/current age (years)" (-, still coagulant factors VIII and IX are mostly point mutations (3). mobile). Patient 2 only became wheelchair-bound at the age Analysis of the types of structural alteration that affect the of 14 years, 3 months, whereas patient 7 is still able to walk structure, expression, stability, or function of the gene prod- two miles at the age of 10 years. Results of muscle dystrophin uct can offer insight into the mechanisms by which such analysis were available in two cases. No dystrophin was mutations arise and the mode ofaction ofthe normal gene and detected in muscle biopsy from patient 5 with polyclonal its encoded protein. antiserum P6 (T. G. Sherratt and P. N. Strong, personal Mutations in the human dystrophin gene are associated communication) (raised against amino acids 2814-3028) or with common (1 in 3500 boys) X chromosome-linked mus- from patient 4 with monoclonal antibody Dy4/6D3 (G. Dick- cular dystrophies of wide-ranging phenotype, from the mild son, personal communication) (raised against a murine poly- Becker (BMD) form to the severe Duchenne (DMD) form. peptide corresponding to amino acids 1164-1397) (11). Because the disease frequency is maintained by recurrent Reverse Transcription (RT) and Nested PCR. Total RNA mutation, many different mutants exist. Two-thirds of these was prepared from peripheral blood lymphocytes (12). Sam- mutations consist of large deletions (4), which have a non- ples (200-500 ng) of total lymphocyte RNA were reverse- random distribution, being clustered in two hotspots. In transcribed using primer DMDXb (X = 1-11; primer nomen- general (5), deletions resulting in a translational frameshift clature below). A PCR mix containing primers DMDXa and are generally associated with DMD, whereas those that may DMDXb was added to the products and 30 cycles of PCR remove large portions of the protein but maintain the reading (13-16) were performed. Two microliters ofthe products was frame are associated with BMD (6). The remaining one-third added to a second mix containing primer DMDXc or DMDXe of mutations have not been characterized. Their identifica- and primer DMDXd or DMDXf, and PCR was repeated (17). tion represents a formidable challenge because of the large Eight microliters of the final product was electrophoresed in size and complexity ofthe dystrophin gene [11 kilobases (kb) a 4% polyacrylamide minigel containing ethidium bromide. ofcoding sequence (7) distributed between 79 exons (R.G.R., Products were gel-purified from 4% polyacrylamide minigels A. J. Coffey, M.B., and D.R.B., unpublished data) across 2.3 using DEAE membrane. Primers [nomenclature: X, reaction megabases of genome (4)]. To date only one point mutation 1-11; DMDXa and DMDXb (outer set), 5' and 3', respec- has been reported (8), where immunological analysis of tively; DMDXc and DMDXd (inner set), 5' and 3', respec- truncated dystrophin from muscle biopsy material allowed tively; DMDXe, 5' inner primer for reaction Xb; DMDXf, 3' prior localization of the mutation. inner primer for reaction Xa] were as in ref. 15 except for the The publication costs of this article were defrayed in part by page charge Abbreviations: DMD, Duchenne muscular dystrophy; BMD, Becker payment. This article must therefore be hereby marked "advertisement" muscular dystrophy; IMD, intermediate muscular dystrophy; RT, in accordance with 18 U.S.C. §1734 solely to indicate this fact. reverse transcription; nt, nucleotide(s). 2331 Downloaded by guest on September 28, 2021 2332 Genetics: Roberts et al. Proc. Natl. Acad. Sci. USA 89 (1992) promoter reaction (18) and the following: DMD1d, DMD7a date deleterious mutations were confirmed by direct se- and DMD7d, DMD8d, DMD10d-DMD10f, DMDSe and quencing or restriction analysis of amplified genomic DNA DMD5f, DMD11a-DMD11d (sequences available on re- (Fig. 2B). quest). Sequence Differences in the Dystrophin Gene. Fourteen Characterization of Mutations. For each mismatch reac- distinct sequence changes were identified (Fig. 3B). Point tion, a probe was amplified from cloned cDNA (1, 19) using mutations generating in-frame termination codons were the same primers as were used for secondary PCR. The probe found in four patients (patient 1; patient 2, Fig. 2A; patient 3; was labeled using T4 polynucleotide kinase and [y-32PIATP patient 5, Fig. 1B). Two of these changes (in patients 3 and and was hybridized to gel-purified products from the nested 5) are C -- T transitions in CpG dinucleotides. For example, RT-PCR. The hybrid mixture was then divided into two and mismatch analysis of reaction 10a with either osmium tetrox- subjected to chemical modification of mismatched pyrimi- ide or hydroxylamine in patient 5 resulted in the appearance dine residues (20, 21) with osmium tetroxide (1 mM osmium of a 342-nt band (Fig. 1B). Direct sequencing revealed a C -- tetroxide/370 mM pyridine, 370C for 2 hr) and with hydrox- T change at nucleotide 10316 in the cDNA sequence, which ylamine (2.3 M hydroxylamine hydrochloride/1.67 M dieth- converts codon 3370 from an arginine codon to a termination ylamine, 370C for 2 hr). The DNA was cleaved adjacent to codon (Fig. 3B). Similarly, mismatch analysis ofreaction 9 in modified residues with 1 M piperidine at 90'C for 30 min. patient 3 using hydroxylamine resulted in the appearance of Products were electrophoresed in a denaturing 5% polyacryl- a band of 374 nt. Direct sequencing revealed a C -- T amide gel and autoradiographed. Direct sequencing (22, 23) transition at nucleotide 9152, which converts codon 2982 of regions identified by chemical mismatch detection was from arginine to a termination codon. In patient 7 a band of performed using PCR primers or internal oligonucleotides 238 nt was detected in reaction lOb (Fig. 1B). This corre- (sequences available on request). sponded to deletion of the single nucleotide T10662, resulting Determination of Intron Sequence. In instances where mu- in a frameshift mutation that should cause premature termi- tations lay near the ends of exons or in introns, intron nation of translation 10 amino acids after Pro3484 (Fig. 2C). sequences were required for amplification of genomic DNA. In patients 4 (Fig. 1A) and 6 the mutations were betrayed These were determined by sequence analysis
Load more

Recommended publications
  • Structural Effects of Point Mutations in Proteins Suvethigaa Shanthirabalan, Jacques Chomilier, Mathilde Carpentier
    Structural effects of point mutations in proteins Suvethigaa Shanthirabalan, Jacques Chomilier, Mathilde Carpentier To cite this version: Suvethigaa Shanthirabalan, Jacques Chomilier, Mathilde Carpentier. Structural effects of point muta- tions in proteins. Proteins - Structure, Function and Bioinformatics, Wiley, 2018, 86 (8), pp.853-867. 10.1002/prot.25499. hal-01909365 HAL Id: hal-01909365 https://hal.sorbonne-universite.fr/hal-01909365 Submitted on 31 Oct 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Structural effects of point mutations in proteins Suvethigaa Shanthirabalan1, Jacques Chomilier2, Mathilde Carpentier1,2 1. Institut Systématique Evolution Biodiversité (ISYEB), Sorbonne Université, MNHN, CNRS, EPHE, Paris, France. 2. Sorbonne Université, CNRS, MNHN, IRD, IMPMC, BiBiP, Paris, France Corresponding author: [email protected] Mail: [email protected]; [email protected]; [email protected] Abstract A structural database of eleven families of chains differing by a single amino acid substitution has been built. Another structural dataset of 5 families with identical sequences has been used for comparison. The RMSD computed after a global superimposition of the mutated protein on each native one is smaller than the RMSD calculated among proteins of identical sequences.
    [Show full text]
  • Genetic Analysis of the Transition from Wild to Domesticated Cotton (G
    bioRxiv preprint doi: https://doi.org/10.1101/616763; this version posted April 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genetic analysis of the transition from wild to domesticated cotton (G. hirsutum) Corrinne E. Grover1, Mi-Jeong Yoo1,a, Michael A. Gore2, David B. Harker3,b, Robert L. Byers3, Alexander E. Lipka4, Guanjing Hu1, Daojun Yuan1, Justin L. Conover1, Joshua A. Udall3,c, Andrew H. Paterson5, and Jonathan F. Wendel1 1Department of Ecology, Evolution and Organismal Biology, Iowa State University, Ames, IA 50011 2Plant Breeding and Genetics Section, School of Integrative Plant Science, Cornell University, Ithaca, NY 14853 3Plant and Wildlife Science Department, Brigham Young University, Provo, UT 84602 4Department of Crop Sciences, University of Illinois, Urbana, IL 61801 5Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30602 acurrent address: Department of Biology, University of Florida, Gainesville, FL 32611 bcurrent address: Department of Dermatology, The University of Texas Southwestern Medical Center, Dallas, TX 75390 ccurrent address: Southern Plains Agricultural Research Center, USDA-ARS, College Station, TX, 77845- 4988 Corresponding Author: Jonathan F. Wendel ([email protected]) Data Availability: All data are available via figshare (https://figshare.com/projects/Genetic_analysis_of_the_transition_from_wild_to_domesticated_cotton_G _hirsutum_QTL/62693) and GitHub (https://github.com/Wendellab/QTL_TxMx). Keywords: QTL, domestication, Gossypium hirsutum, cotton Summary: An F2 population between truly wild and domesticated cotton was used to identify QTL associated with selection under domestication.
    [Show full text]
  • Large Accumulation of Mrna and DNA Point Modi¢Cations in a Plant
    FEBS Letters 472 (2000) 14^16 FEBS 23560 View metadata, citation and similar papers at core.ac.uk brought to you by CORE Large accumulation of mRNA and DNA point modi¢cationsprovided in by a Elsevier plant - Publisher Connector senescent tissue Maria Plaa;*, Anna Jofre¨a, Maria Martellb, Marisa Molinasa, Jordi Go¨mezb aLaboratori del Suro, Universitat de Girona, Campus Montilivi sn, E-17071 Girona, Spain bLiver Unit, Department of Medicine, Universitat Auto©noma de Barcelona, Hospital General Universitari Vall d'Hebron, E-08035 Barcelona, Spain Received 26 January 2000 Edited by Takashi Gojobori We investigated the frequency of cDNA modi¢cation in Abstract Although nucleic acids are the paradigm of genetic information conservation, they are inherently unstable molecules cork (phellem) compared to a normally growing young tissue that suffer intrinsic and environmental damage. Oxidative stress (root tip) using cork-oak (Quercus suber) as a model system. has been related to senescence and aging and, recently, it has For this purpose, we analyzed a population of Qs_hsp17 been shown that mutations accumulate at high frequency in mRNA sequences (reverse transcription PCR products form mitochondrial DNA with age. We investigated RNA and DNA position 32^401, AC AJ000691) in cork and in root tip tissue modifications in cork, a senescent plant tissue under high [6]. Cork (phellem) is an external layer of protective tissue, endogenous oxidative stress conditions. When compared to consisting of several layers of cells that deposit large amounts normally growing young tissue, cork revealed an unexpected of suberin and undergo programmed cell death. Due to phen- high frequency of point modifications in both cDNA (Pn = oxy radicals generated during suberin synthesis [7,8], cork 1/1784) and nuclear DNA (Pn = 1/1520).
    [Show full text]
  • Genetic Testing: Background and Policy Issues
    Genetic Testing: Background and Policy Issues Amanda K. Sarata Specialist in Health Policy March 2, 2015 Congressional Research Service 7-5700 www.crs.gov RL33832 Genetic Testing: Background and Policy Issues Summary Congress has considered, at various points in time, numerous pieces of legislation that relate to genetic and genomic technology and testing. These include bills addressing genetic discrimination in health insurance and employment; precision medicine; the patenting of genetic material; and the oversight of clinical laboratory tests (in vitro diagnostics), including genetic tests. The focus on these issues signals the growing importance of public policy issues surrounding the clinical and public health implications of new genetic technology. As genetic technologies proliferate and are increasingly used to guide clinical treatment, these public policy issues are likely to continue to garner attention. Understanding the basic scientific concepts underlying genetics and genetic testing may help facilitate the development of more effective public policy in this area. Humans have 23 pairs of chromosomes in the nucleus of most cells in their bodies. Chromosomes are composed of deoxyribonucleic acid (DNA) and protein. DNA is composed of complex chemical substances called bases. Proteins are fundamental components of all living cells, and include enzymes, structural elements, and hormones. A gene is the section of DNA that contains the sequence which corresponds to a specific protein. Though most of the genome is similar between individuals, there can be significant variation in physical appearance or function between individuals due to variations in DNA sequence that may manifest as changes in the protein, which affect the protein’s function.
    [Show full text]
  • Point Mutations Underlying NF1 and NF2 and Increased Risk of Malignancy
    Central Annals of Otolaryngology and Rhinology Mini Review *Corresponding author Andrea L.O. Hebb, MSc, PhD, RN, Maritime Lateral Skull Base Clinic, Otolaryngology, Neurosurgery and the Point Mutations Underlying NF1 Stereotactic Radiotherapy Group QEII Health Science Centre, Halifax, Canada; Email: [email protected] and NF2 and Increased Risk of Submitted: 12 February 2020 Accepted: 25 February 2020 Published: 27 February 2020 Malignancy ISSN: 2379-948X Copyright 1 2 3,4 3,4 Myles Davidson , Haupt TS , Morris DP , Shoman NM , © 2020 Davidson M, et al. 2,4 1,2,4 Walling SA , and Hebb ALO * OPEN ACCESS 1Department of Psychology, Saint Mary’s University, Canada 2Division of Neurosurgery, Dalhousie University, Canada Keywords 3 Division of Otolaryngology, Dalhousie University, Canada • Neurofibromatosis 4 Maritime Lateral Skull Base Clinic, Otolaryngology, Neurosurgery and the Stereotactic • Missense mutation Radiotherapy Group QEII Health Science Centre, Canada • Frameshift mutation • Nonsense mutation Abstract • KRAS gene • Colorectal cancer Neurofibromatosis Type-1 and Neurofibromatosis Type-2 are autosomal dominant • Acoustic neuroma tumor suppressor disorders that result from inherited or spontaneous mutations in • Vestibular schwannoma their respective genes. Neurofibromatosis Type-1 has been attributed to a non-sense • Meningioma mutation in chromosome 17 and Neurofibromatosis Type-2 a point mutation in its gene on chromosome 22. The following discussion briefly reviews point and frameshift mutations and explores the relationship between point mutations and development of malignancies in patients with Neurofibromatosis Type-1 and Neurofibromatosis Type-2. INTRODUCTION producing phenylalanine hydroxylase, the majority of which are missense mutations [4]. A point mutation is the change of one base for another in the DNA sequence.
    [Show full text]
  • Methods for Detection of Point Mutations: Performance and Quality
    Clinical Chemistry 43:7 1114–1128 (1997) Review Methods for detection of point mutations: performance and quality assessment Downloaded from https://academic.oup.com/clinchem/article/43/7/1114/5640834 by guest on 29 September 2021 Peter Nollau and Christoph Wagener*, on behalf of the IFCC Scientific Division, Committee on Molecular Biology Techniques We give an overview of current methods for the detec- 10) What kind of quality assessment can be achieved? tion of point mutations as well as small insertions and Here, different methods for the detection of point muta- deletions in clinical diagnostics. For each method, the tions and small deletions or insertions will be discussed following characteristics are specified: (a) principle, (b) on the basis of the above criteria (for simplification, we major modifications, (c) maximum fragment size that shall refer to point mutations only in the text, though in can be analyzed, (d) ratio and type of mutations that can general, small deletions or insertions are detected equally be detected, (e) minimum ratio of mutant to wild-type well by the methods described). In general, PCR is either alleles at which mutations can be detected, and (f) used for the generation of DNA fragments, or is part of detection methods. Special attention is paid to the the detection method. Screening methods for unknown possibilities of quality assessment and the potential for mutations as well as methods for the detection of known standardization and automation. mutations are included. Though DNA sequencing tech- niques will not be covered, we stress that DNA sequenc- INDEXING TERMS: alleles • electrophoresis • gene insertions ing is considered the gold standard and remains the • gene deletions • polymerase chain reaction definitive procedure for the detection of mutations so far.
    [Show full text]
  • Characterization of Point Mutations in the Same Arginine Codon in Three Unrelated Patients with Ornithine Transcarbamylase Deficiency
    Characterization of point mutations in the same arginine codon in three unrelated patients with ornithine transcarbamylase deficiency. A Maddalena, … , W E O'Brien, R L Nussbaum J Clin Invest. 1988;82(4):1353-1358. https://doi.org/10.1172/JCI113738. Research Article Point mutations in the X-linked ornithine transcarbamylase (OTC) gene have been detected at the same Taq I restriction site in 3 of 24 unrelated probands with OTC deficiency. A de novo mutation could be traced in all three families to an individual in a prior generation, confirming independent recurrence. The DNA sequence in the region of the altered Taq I site was determined in the three probands. In two unrelated male probands with neonatal onset of severe OTC deficiency, a guanine (G) to adenine (A) mutation on the sense strand (antisense cytosine [C] to thymine [T]) was found, resulting in glutamine for arginine at amino acid 109 of the mature polypeptide. In the third case, where the proband was a symptomatic female, C to T (sense strand) transition converted residue 109 to a premature stop. These results support the observation that Taq I restriction sites, which contain an internal CG, are particularly susceptible to C to T transition mutation due to deamination of a methylated C in either the sense or antisense strand. The OTC gene seems especially sensitive to C to T transition mutation at arginine codon 109 because either a nonsense mutation or an extremely deleterious missense mutation will result. Find the latest version: https://jci.me/113738/pdf Characterization of Point Mutations in the Same Arginine Codon in Three Unrelated Patients with Ornithine Transcarbamylase Deficiency Anne Maddalena,*" J.
    [Show full text]
  • Teacher Materials (PDF)
    The Making of the Fittest: LESSON The Birth and Death of Genes TEACHER MATERIALS THE MOLECULAR EVOLUTION OF GENE BIRTH AND DEATH OVERVIEW This advanced lesson describes how mutation is a key element in both the birth and death of genes. Students proceed through a series of presentation slides that include background information, examples, and embedded video, and animation links. Questions challenge students to synthesize information and apply what they learn regarding how genes are gained and lost through evolutionary time. KEY CONCEPTS AND LEARNING OBJECTIVES • Mutations are changes in an organism’s DNA. They occur at random. • Whether or not a mutation has an effect on an organism’s traits depends on the type of mutation and its location. • Mutations can result in both the appearance of new genes and the loss of existing genes. • One way that a new gene can arise is when a gene is duplicated and one copy (or both copies) of the gene accumulates mutations, which change the function of the gene. • One way that a gene can be lost is when one or more mutations accumulate that destroy its function. Students will be able to • analyze gene sequences and transcribe DNA into messenger RNA (mRNA); • translate mRNA into a sequence of amino acids by using a genetic code chart; and • compare wild-type and mutated DNA sequences to determine the type of mutation present. CURRICULUM CONNECTIONS Curriculum Standards NGSS (April 2013) HS-LS1-1, HS-LS3-1, HS-LS3-2, HS-LS4-2, HS-LS4-4, HS-LS4-5 HS.LS1.A, HS.LS3.A, HS.LS3.B, HS.LS4.B, HS.LS4.C Common Core
    [Show full text]
  • Genetics of Sma
    CURE SMA CARE SERIES BOOKLET A SOURCE OF INFORMATION AND SUPPORT FOR INDIVIDUALS LIVING WITH SPINAL MUSCULAR ATROPHY AND THEIR FAMILIES. GENETICS OF SMA 1 SMA AND GENETICS Spinal muscular atrophy (SMA) is often referred to by several terms, including “genetic disease,” ‘’autosomal recessive genetic disorder,” “motor-neuron disease,” or ‘’neuromuscular disease.” SMA is a genetic disease. “Genetic” means it is relating to the genes and is inherited. Genes are responsible for our traits and unique characteristics. In SMA, there is a mutation in a gene responsible for the survival motor neuron (SMN) protein, a protein that is critical to the function of the nerves that control normal muscle movements. SMA is an autosomal recessive genetic disorder. “Autosomal recessive” refers to how the disease is inherited, or passed down, from the parents to the child. In SMA, the individual who is affected by SMA inherits two copies of a non-working gene—one copy from each parent. SMA is a motor-neuron disease. “Motor-neuron” refers to the type of nerve cell that sends messages to and from muscles responsible for movement and control of the head, neck, chest, abdomen, legs, and limbs. In SMA, the motor-neurons in the spinal cord do not have enough SMN protein. As a result, these motor-neurons do not function normally and may die, resulting in muscle weakness and atrophy (shrinkage). SMA is a neuromuscular disease. A “neuromuscular disease” affects the neuromuscular system. This can include problems with the nerves that control muscles, the muscles, and the communication between the nerves and the muscles.
    [Show full text]
  • Indel Information Eliminates Trivial Sequence Alignment in Maximum Likelihood Phylogenetic Analysis
    Cladistics Cladistics 28 (2012) 514–528 10.1111/j.1096-0031.2012.00402.x Indel information eliminates trivial sequence alignment in maximum likelihood phylogenetic analysis John S.S. Dentona,b,* and Ward C. Wheelerb,c aDivision of Vertebrate Zoology, American Museum of Natural History, New York, NY 10024, USA; bRichard Gilder Graduate School, American Museum of Natural History, New York, NY 10024, USA; cDivision of Invertebrate Zoology, American Museum of Natural History, New York, NY 10024, USA Accepted 12 March 2012 Abstract Although there has been a recent proliferation in maximum-likelihood (ML)-based tree estimation methods based on a fixed sequence alignment (MSA), little research has been done on incorporating indel information in this traditional framework. We show, using a simple model on a single character example, that a trivial alignment of a different form than that previously identified for parsimony is optimal in ML under standard assumptions treating indels as ‘‘missing’’ data, but that it is not optimal when indels are incorporated into the character alphabet. We show that the optimality of the trivial alignment is not an artefact of simplified theory assumptions by demonstrating that trivial alignment likelihoods of five different multiple sequence alignment datasets exhibit this phenomenon. These results demonstrate the need for use of indel information in likelihood analysis on fixed MSAs, and suggest that caution must be exercised when drawing conclusions from software implementations claiming improvements in likelihood scores under an indels-as-missing assumption. Ó The Willi Hennig Society 2012. Maximum likelihood (ML) has become a popular the increasing sophistication of search heuristics in ML optimality criterion for inferring evolutionary trees software (e.g.
    [Show full text]
  • Systematic (Genomic Based)
    Trivial Codon Exon/Intron Name Codon Nucleotide Change* Changed Systematic(cDNA based) Systematic (genomic based) Other names Type 2 M-1T -1 CCATGGC>CCACGGC Met>Thr c.2T>C g.4895T>C M1T transition 2 R3Op 3 CACCGAT>CACTGAT Arg>Opal c.10C>T g.4903C>T R3X, R3ter transition 2 ∆A20 20 CCC[A]GAG>CCCGAG Gln>Arg (fs) c.62delA g.4955delA (first base of deletion) ∆A20 deletion IVS2 IVS2-1G>A atagGTA>ataaGTA g.5814G>A c.113-1G>A transition 3 IVS2-1∆4 37-38 ata[gGTA]CCA>ataCCA g.5813delGGTA G12/∆3;IVS2-delGGTA;∆4IVS2-E3 deletion 3 R59op 59 TTCCGAG>TTCTGAG Arg>Opal c.178C>T g.5880C>T R59X;R59ter transition 3 I73T 73 GCATCGG>GCACCGG Ile>Thr c.221T>C g.5923T>C transition 3 L83∆C 83 CCT[C]TAC>CCTTAC Leu>Leu(fs) c.252delC g.5954delC c.250 delC deletion 3 1123ins12 104 GGT[]GGG>GGT[GGGGATCGTGGT]GGG c.314^315ins12 g.6016^6017insGGGGATCGTGGT —12E3;V104+GIVV insertion IVS3 K107K∆12 104-107del GTG[GTGGGAATCAAG]gtt>GTGgtgggaatcaaagtt c.324G>A;delGTGGGAATCAAG(312-324) g.6026G>A g.1133G>A transition IVS3 IVS3-1G>A acagTTA>acaaTTA g.7257G>A c.325-1G>C, g.8180G>C,IVS3sas transversion 4 ∆28E4 114-151 TCC[TCTTGCAGGAACAAACAAAGAAACCACC]ATT>TCCATT Pro>Pro(fs) c.345-372del28 g.7277^7305del c.345_72del28 deletion 4 Q110Oc 110 GACCAAG>GACTAAG Gln>Ochre c.331C>T g.7264C>T transition 4 ∆4E4 118-120 GAAC[AAAC]AAAG>GAACAAAG c.357delAAAC g.7289delAAAC ∆4, MD∆4 deletion 4-5 ∆E4-E5 ccc[tgt…TCC]AGC>cccAGC g.6594^8239del F13/∆4,5 deletion 5 C134R 134 CGCTGTG>CGCCGTG Cys>Arg c.403T>C g.8162T>C C135R transition 5 W147R 147 AAGTGGC>AAGCGGC Trp>Arg c.442T>C g.8201T>C W148R transition
    [Show full text]
  • G14TBS Part II: Population Genetics
    G14TBS Part II: Population Genetics Dr Richard Wilkinson Room C26, Mathematical Sciences Building Please email corrections and suggestions to [email protected] Spring 2015 2 Preliminaries These notes form part of the lecture notes for the mod- ule G14TBS. This section is on Population Genetics, and contains 14 lectures worth of material. During this section will be doing some problem-based learning, where the em- phasis is on you to work with your classmates to generate your own notes. I will be on hand at all times to answer questions and guide the discussions. Reading List: There are several good introductory books on population genetics, although I found their level of math- ematical sophistication either too low or too high for the purposes of this module. The following are the sources I used to put together these lecture notes: • Gillespie, J. H., Population genetics: a concise guide. John Hopkins University Press, Baltimore and Lon- don, 2004. • Hartl, D. L., A primer of population genetics, 2nd edition. Sinauer Associates, Inc., Publishers, 1988. • Ewens, W. J., Mathematical population genetics: (I) Theoretical Introduction. Springer, 2000. • Holsinger, K. E., Lecture notes in population genet- ics. University of Connecticut, 2001-2010. Available online at http://darwin.eeb.uconn.edu/eeb348/lecturenotes/notes.html. • Tavar´eS., Ancestral inference in population genetics. In: Lectures on Probability Theory and Statistics. Ecole d'Et´esde Probabilit´ede Saint-Flour XXXI { 2001. (Ed. Picard J.) Lecture Notes in Mathematics, Springer Verlag, 1837, 1-188, 2004. Available online at http://www.cmb.usc.edu/people/stavare/STpapers-pdf/T04.pdf Gillespie, Hartl and Holsinger are written for non-mathematicians and are easiest to follow.
    [Show full text]