bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1 Balanced release of neuropeptide FF and gonadotropin-releasing
2 hormone 3 modulates male sexual behavior
3
4 Chie Umatani1*, Nagisa Yoshida1, Eri Yamamoto1, Yasuhisa Akazome2, Yasutaka Mori1,
5 Shinji Kanda3, Kataaki Okubo4, Yoshitaka Oka1*
6
7 1 Department of Biological Sciences, Graduate School of Science, the University of
8 Tokyo, Tokyo, Japan
9 2 Department of Anatomy, St. Marianna University School of Medicine, Kanagawa,
10 Japan
11 3 Laboratory of Physiology, Atmosphere and Ocean Research Institute, the University of
12 Tokyo, Chiba, Japan
13 4 Department of Aquatic Bioscience, Graduate School of Agricultural and Life Sciences,
14 the University of Tokyo, Tokyo, Japan
1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
15 Corresponding Authors
16 Yoshitaka Oka
17 the University of Tokyo
19
20 Chie Umatani
21 the University of Tokyo
23
2 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
24 Abstract
25 Animals properly perform sexual behaviors by using multiple sensory cues. However, neural
26 mechanisms integrating multiple sensory cues and regulating motivation for sexual behaviors
27 remain unclear. Here, we focused on peptidergic neurons, terminal nerve gonadotropin-releasing
28 hormone (TN-GnRH) neurons, which receive inputs from various sensory systems and co-express
29 neuropeptide FF (NPFF) in addition to GnRH. Our behavioral analyses using knockout medaka
30 of GnRH (gnrh3) and/or NPFF (npff) demonstrated that some sexual behavioral repertories were
31 ‘delayed’, not disrupted, in gnrh3-/- and npff-/- males, while the double knockout showed normal
32 behaviors. We also found anatomical evidence to show that both neuropeptides modulate the
33 sexual behavior-controlling brain areas. Furthermore, we demonstrated that NPFF activates
34 neurons in the preoptic area via indirect pathway, which is considered to induce the increase in
35 the motivation for male sexual behaviors. Considering these results, we propose a novel
36 mechanism by which balanced release of co-existing peptides is important for the
37 neuromodulatory function of TN-GnRH neurons in the control of behavioral motivation. Our
38 results may go a long way toward understanding the functional significance of peptidergic
39 neuromodulation in response to external environments.
40
3 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
41 Introduction
42 When animals mate, they recognize their partners of the opposite sex by some sensory cues,
43 such as chemical and visual ones, and perform sexual behaviors towards them. After their partners
44 of the opposite sex accept their approach, they clasp (or copulate) and reproduce. Although lots
45 of behavioral studies have demonstrated this sequence of sexual behaviors, the neural mechanisms
46 integrating multiple sensory cues and regulating motivation for sexual behaviors remain unclear.
47 In recent three decades, various peptidergic neurons that release neuropeptides have been reported
48 as ones involved in sexual behaviors (Argiolas and Melis, 2013). Among them, we focused on the
49 terminal nerve gonadotropin-releasing hormone (TN-GnRH) neuron for the following reasons.
50 TN-GnRH neurons are suggested to modulate the motivation for sexual behavior, because
51 ablation of the terminal nerve induced decrease in the male sexual behavior (Wirsig and Leonard,
52 1987, Yamamoto et al., 1997). In addition, this neuron is anatomically suggested to receive
53 sensory information (Yamamoto and Ito, 2000).
54 Interestingly, TN-GnRH neurons have been found to express neuropeptide FF (NPFF) as a co-
55 transmitter in addition to gonadotropin-releasing hormone (GnRH) (Figure 1A, Oehlmann et al.,
56 2002, Wirsig-Wiechmann and Oka, 2002, Saito et al., 2010; FMRFamide-like peptides are now
57 identified as NPFF). GnRH in the terminal nerve has been suggested to modulate excitabilities
58 (neuromodulation) in the sensory processing neurons (Kinoshita et al., 2007, Kawai et al., 2010,
4 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
59 Umatani et al., 2015). In addition, GnRH-induced neuromodulation is suggested to modulate the
60 motivation for sexual behaviors (Li et al., 2017). In rodents, GnRH administration induced both
61 facilitatory and inhibitory effects on sexual behaviors, and the functions of GnRH in sexual
62 behaviors in the vertebrate are somewhat controversial (Dorsa and Smith, 1980, Myers and Baum,
63 1980, Dorsa et al., 1981, Dennison et al., 1996). On the other hand, the functions of NPFF have
64 only been reported in the spinal cord (Vilim et al., 1999, Yang et al., 2008), even though NPFF
65 and NPFF receptors are expressed in the brain (Gouarderes et al., 2004). Hence, it is still unknown
66 which neuropeptide, GnRH or NPFF in the terminal nerve, plays a key role in sexual behavior.
67 In the present study, in order to examine how neuropeptide in TN-GnRH neurons modulate
68 sexual behavior, we generated GnRH and/or NPFF knockout medaka, a teleost, and analyzed their
69 sexual behaviors. Medaka offers various advantages for conducting the present study; medaka
70 regularly shows stereotypical sexual behavior every day (Ono and Uematsu, 1957, Hiraki-
71 Kajiyama et al., 2019). In addition, unlike mammals and zebrafish, medaka is one of the animals
72 in which one of the three paralogues of GnRH, gnrh3, is clearly localized in the terminal nerve
73 neurons in the brain. This makes it easy to analyze the functions of GnRH (GnRH3) in the terminal
74 nerve independently of the hypophysiotropic GnRH (GnRH1) neurons (Okubo and Nagahama,
75 2008, Kim et al., 2011). Furthermore, in common with the previous report in the dwarf gourami
76 (Saito et al., 2010), NPFF is expressed only in the TN-GnRH neurons in the medaka brain (Figure
5 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
77 1A).
78 Here, we performed behavioral analyses using gnrh3 knockout (gnrh3 -/-) and/or npff knockout
79 (npff -/-) medaka and found that NPFF and GnRH3 modulate male sexual behaviors. In addition,
80 to localize the target neurons of NPFF or GnRH3 in the brain, we anatomically analyzed the
81 expressions of NPFF and GnRH receptors. Our results demonstrated that balanced release of
82 NPFF and GnRH3 from the terminal nerve may play an important role especially in the control
83 of motivation for male sexual behavior.
84
6 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
85 Result
86 Generation of npff -/- and gnrh3 -/- medaka
87 For the analysis of the function of NPFF and GnRH3, we generated knockout medaka of each
88 gene and double knockout medaka. Our designed TALEN caused frame shift of npff and gnrh3
89 (Figure 1B and 1C) and change of amino acid in each core peptide (Figure 1D). In addition,
90 GnRH3 and NPFF double knockout medaka (gnrh3 -/-;npff -/-) was generated by intercrossing npff
91 -/- medaka and gnrh3 -/- medaka. Next, we examined whether TALEN induced null function.
92 Because NPFF in the terminal nerve can be labeled by anti-FMRF (Phe-Met-Arg-Phe-NH2)
93 antibody (Saito et al., 2010), we made frontal brain sections of WT and npff -/- (Figure 1E) and
94 performed immunohistochemistry (IHC) using this antibody. The FMRF-immunoreactive signals
95 were found in the cell bodies of TN-GnRH neurons in WT but not in npff -/- medaka (Figure 1F).
96 Considering the method for generation of gnrh3 -/-;npff -/- medaka, gnrh3 -/-;npff -/- medaka should
97 also have lost NPFF expression. On the other hand, to examine the loss of GnRH3 expression, we
98 performed IHC using anti-GnRH3 antibody (LRH13), which is a specific antibody for GnRH3 in
99 medaka (Figure 1—figure supplement 1). As shown in Figure 1G, GnRH3-immunoreactive
100 signals were found in WT brain but not in gnrh3 -/- or gnrh3 -/-;npff -/- medaka. These results
101 confirm that our knockout strains have lost the functional peptides of NPFF and/or GnRH3.
102
7 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
103 npff -/- male shows a delay in various sexual behavior repertories
104 To examine whether NPFF and/or GnRH3 modulate motivation for sexual behavior, we first
105 analyzed sexual behaviors of npff -/- medaka and compared those behaviors with WT ones (Figure
106 2). We recorded sexual behaviors of npff -/- and WT medaka that have fully grown up (Figure 2—
107 figure supplement 1). Sexual behaviors of npff -/- medaka showed some abnormalities compared
108 with WT. The stereotypical sexual behavior repertories of medaka are illustrated in Figure 2A.
109 First, the male medaka follows or chases a female (called following) and presents courtship
110 behavior to the female by quickly circling in front of the female (courtship). If the female accepts
111 the male’s courtship, the male holds the female’s body by its anal fin (clasping), which is followed
112 by simultaneous spawning (spawning). Here, we found that npff -/- males show a prolongation of
113 the latency to the first following, the first courtship, the first clasping, and spawning (Figure 2B-
114 E). In addition, in the pair of npff -/- male and WT female, the courtship frequency before spawning
115 (Figure 2—figure supplement 2A) and percentage of following with successful courtship (Figure
116 2—figure supplement 2B) were also significantly less than those in WT pairs. On the other hand,
117 npff -/- female showed a prolongation of the latency to clasping and spawning (Figure 2D and 2E).
118 It should be noted that we used all pairs that spawned at least before the experimental day.
119 Considering these results, npff -/- medaka, especially npff -/- male, are suggested to have less
120 motivation for sexual behaviors (see Discussion for detail).
8 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
121
122 gnrh3 -/- male shows a delay in sexual behavior repertories after courtship
123 Next, to examine the function(s) of GnRH3 in the control of sexual behavior, we conducted
124 behavioral analysis of gnrh3 -/- or gnrh3 -/-;npff -/- (Figure 3) in addition to npff -/- (Figure 2). We
125 recorded sexual behaviors of each pair of medaka that have fully grown up (Figure 3—figure
126 supplement 1). Then, in the pairs of gnrh3 -/- male and WT female, the latencies to the first clasping
127 and spawning were significantly longer than WT pairs (Figure 3B-E). Similar to the experiments
128 of npff -/-, we used all pairs that spawned at least before the experimental day. In addition, because
129 there was no significant difference in the courtship frequency before spawning (Figure 3—figure
130 supplement 2A) and percentage of following with successful courtship (Figure 3—figure
131 supplement 2B) among all the pairs, it is suggested that gnrh3 -/- male are not able to show sexual
132 behaviors smoothly after courtship. On the other hand, gnrh3 -/-;npff -/- male and female showed
133 normal sexual behaviors (Figure 3B-E).
134
135 NPFF receptors are expressed broadly in the brain
136 Since npff -/- showed abnormal sexual behaviors, we examined the possible neuronal circuit via
137 NPFF, which is expressed only in TN-GnRH neurons in the brain, by analyzing anatomical
138 localizations of NPFF receptors in the brain. First, by the 5’ and 3’ rapid amplification of cDNA
9 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
139 ends (RACE), we found three genes as NPFF receptors and identified gpr147 (so-called NPFFR1,
140 Bonini et al., 2000), gpr74-1 and gpr74-2 (so-called NPFFR2, Bonini et al., 2000) (Figure 4—
141 figure supplement 1). All of these receptors were shown to function as G-protein coupled
142 receptors, whose ligand is NPFF (Figure 4—figure supplement 2). Then, by in situ hybridization
143 of these genes, we found that these receptors are expressed broadly in the brain (Figure 4A,
144 abbreviation of brain region in Supplementary file 1). Because TN-GnRH neurons do not project
145 to the pituitary, we analyzed brain regions except the pituitary. In Vv and Vs, which are the brain
146 region involved in the control of sexual behavior (Koyama et al., 1984, Satou et al., 1984), gpr74-
147 2 and gpr147 were abundantly expressed, respectively (Figure 4B and 4C, abbreviation of brain
148 nuclei is described in Supplementary file 1). In addition, in POA and hypothalamus, all subtypes
149 of NPFF receptors were expressed (Figure 4D). gpr74-1 was expressed in the dorsal and ventral
150 part of POA, while gpr74-2 and gpr147 were mostly expressed in the dorsal part of POA.
151 Furthermore, TN-GnRH neurons, which have been suggested to modulate the motivation for
152 sexual behavior (Wirsig and Leonard, 1987, Yamamoto et al., 1997), also expressed gpr74-1
153 (Figure 4E). Thus, it is also suggested morphologically that NPFF plays an important role in
154 sexual behaviors.
155
156 GnRH receptors are mainly expressed in the sensory processing areas of the brain
10 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
157 We next examined the possible neuronal circuit via GnRH3 by analyzing anatomical
158 localizations of GnRH receptors in the brain (Figure 5A, abbreviation of brain region in
159 Supplementary file 1). Medaka has four subtypes of GnRH receptors (we here followed the
160 terminology of Okubo et al., 2003, Kim et al., 2011; GnRHR1-4). gnrhr1 (Figure 5B) and gnrhr2
161 (Figure 5C) were expressed in two different brain regions. gnrhr1 was expressed in the Dp and
162 the NI. There were more neurons expressing gnrhr1 in the Dp than in the NI. gnrhr2 was
163 expressed in the pineal organ and the NDTL. gnrhr2-expressing neurons in the pineal organ were
164 located in the surface of the organ. gnrhr3 (Figure 5D), among the four subtypes, was most
165 broadly expressed in the brain: Vv, Dd, vDm, and POA in the telencephalon; PO, NAT, NVT, and
166 NRP in the hypothalamus; MCN and near flm in the medulla oblongata. Since gnrhr4 in medaka
167 was newly discovered in 2011 (Kim et al., 2011), we examined whether GnRHR4 functions as a
168 Gq-coupled receptor and found that it does so (Figure 5—figure supplement 1). gnrhr4 (Figure
169 5E) was expressed in the NAT and the NFLM. gnrhr4-expressing neurons were localized in
170 NFLM as a symmetrical pair.
171
172 The expression level of immediate early gene, egr1, in vPOA of npff -/- male is lower than that
173 of WT
174 As described above, npff -/- male showed severe delay in sexual behaviors. To examine the
11 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
175 neural activities in WT and npff -/- male, we compared the expression of one of the immediate
176 early genes, egr1, in npff -/- male with that in WT male. egr1 expression is suggested to represent
177 neuronal activities during 30 min before sacrifice (Burmeister and Fernald, 2005). We made pairs
178 according to the behavioral test of npff -/- described above, sacrificed the male, and dissected out
179 the brains 25 – 28 min after removing the transparent separation, when the motivation for sexual
180 behavior in WT male was observed to be high in the present behavioral analysis (see Figure 2).
181 Because WT showed more egr1-expessing neurons only in the ventral part of preoptic area
182 (vPOA) than npff -/- male among other brain regions, we examined co-expression of egr1 and
183 gpr74-1, which is the npff receptor gene expressed in the vPOA (Figure 4D). As shown in Figure
184 6A and 6B, the percentage of egr1-expessing neurons in the vPOA of npff -/- male was less than
185 that of WT, while the difference between the percentage of gpr74-1-expessing neurons in npff -/-
186 and that in WT was not significant (Figure 6C). On the other hand, we found a small number of
187 egr1 and gpr74-1 co-expressing neurons in both genotypes (WT: 30 ± 8 cells, npff -/-: 13 ± 7 cells),
188 although the difference in the percentage of egr1- and gpr74-1-coexpessing neurons was not
189 significant between the two (Figure 6D). It should be noted that all WT males spawned within 6
190 min after removing the transparent separation, while five out of six npff -/- males failed to spawn
191 for 25 min after removing the transparent separation. Taken together, it is suggested that NPFF
192 activates neurons in the vPOA via NPFF receptor-expressing neurons, possibly via indirect
12 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
193 pathway.
194
195 The expression level of npff in gnrh3 -/- medaka is lower than that in WT medaka
196 Our behavioral analyses suggested that NPFF and GnRH3 may facilitate the motivation for the
197 control of male sexual behaviors in slightly different manners. Therefore, to examine the
198 relationship of GnRH3 and NPFF, we analyzed the expression of npff or gnrh3 in npff -/-, gnrh3
199 -/-, and WT medaka. As shown in Figure 7A, the expression level of npff in npff -/- was lower than
200 that in WT, and that of gnrh3 in gnrh3 -/- was lower than that in WT, which suggests that nonsense-
201 mediated mRNA decay has actually occurred. On the other hand, the expression level of npff in
202 gnrh3 -/- was lower than that in WT, while npff -/- showed normal expression of gnrh3. Thus, it is
203 suggested that GnRH3 may regulate the expression of npff.
204
13 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
205 Discussion
206 In the present study, we investigated the modulatory mechanism of sexual behaviors by TN-
207 GnRH neurons. Results of the behavioral analyses of gnrh3 -/- and/or npff -/- medaka suggested
208 that NPFF and GnRH3, which are co-expressed in TN-GnRH neurons, facilitate the motivation
209 for male sexual behavior (Figure 2 and 3). In addition, our morphological analyses showed that
210 NPFF receptors and GnRH receptors are expressed in the brain regions involved in sensory
211 processing and control of sexual behavior (Figure 4 and 5). Furthermore, we demonstrated that
212 NPFF activates neurons in the preoptic area via indirect pathway, which is considered to induce
213 the increase in the motivation for male sexual behaviors (Figure 6). Since TN-GnRH neurons
214 receive multiple sensory information, the present findings should provide novel knowledge for
215 the study of sexual behaviors controlled by integration of multiple sensory inputs. Here, we
216 discuss the modulatory mechanism of sexual behavior by NPFF and GnRH3.
217
218 NPFF and GnRH3 modulate male sexual behaviors
219 First, the present behavioral study demonstrated that NPFF, which is expressed only in the TN-
220 GnRH neurons in the brain, facilitates the motivation for sexual behaviors. We showed that the
221 latency of all sexual behavioral repertories in npff -/- male was longer than WT (Figure 2). The
222 frequency of courtship before spawning, and the percentage of following with successful
14 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
223 courtship in npff -/- male was also less than WT (Figure 2—figure supplement 2). Since we could
224 confirm that all pairs used in the present study spawned at least before the experimental day, it
225 follows that all the sexual behavior repertories of npff -/- male were delayed, but not disrupted
226 after all. It should be noted that the duration of the analysis was set to 25 min, and the latency of
227 the pair that did not show sexual behavior at all was defined as 25 min. Taken together, the present
228 results clearly demonstrated that npff -/- male shows severely low motivation for sexual behaviors.
229 In other words, NPFF facilitates male sexual behaviors by modulating the motivational level. In
230 addition, npff -/- female showed the delay in clasping and spawning, which suggests that NPFF
231 also facilitates the female acceptance of the male courtship behavior. To our knowledge, the
232 present study is the first report of the function of NPFF in the control of sexual behaviors.
233 On the other hand, gnrh3 -/- male showed a delay in clasping and spawning (Figure 3D and 3E).
234 Since the frequency of courtship before spawning and the percentage of following with successful
235 courtship in gnrh3 -/- male were not significantly different from those in WT, following and
236 courtship of gnrh3 -/- male may be normal. These results suggest that gnrh3 -/- male shows an
237 impairment in the behavioral shift from courtship to clasping. For clasping, it has been suggested
238 that male has to precisely recognize the distance to the female, the direction of female, the
239 response of female to male courtship, etc. (Ono and Uematsu, 1957, Walter and Hamilton, 1970).
240 Since TN-GnRH neurons are suggested to receive sensory information such as vision and
15 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
241 olfaction (Yamamoto and Ito, 2000, Li et al., 2017), it is possible that gnrh3 -/- male shows an
242 impairment in the GnRH3-induced neuromodulation (see Umatani et al., 2015, Unatani and Oka,
243 2019) and cannot perform sexual behaviors smoothly. Unlike gnrh3 -/- male, gnrh3 -/- female
244 showed normal sexual behaviors in the present study, although previous study reported that
245 GnRH3 are involved in the female preference for the familiarized male (Okuyama et al., 2014).
246 While the previous study focused on the social behavior by analyzing female preferences with
247 two males, our study focused more on the instinctive sexual behavior between a pair of one male
248 and one female. This difference in the analysis may have caused the apparent difference in
249 phenotype of gnrh3-/- female. It is possible that, under some specific conditions where female has
250 to actively choose male, GnRH3 may play an important role in the female preference.
251 The behavioral analyses of npff -/- male and gnrh3-/- male demonstrated that NPFF and GnRH3
252 facilitate sexual behavior of male, which plays more active roles than female in medaka. On the
253 other hand, both male and female of gnrh3-/-;npff -/- showed normal sexual behavior to the WT
254 partners of the opposite sex (Figure 3). In the previous behavioral studies of TN-GnRH neurons,
255 male animals, whose TN-GnRH neurons were surgically ablated, showed a decrease in the
256 motivation of sexual behavior (Yamamoto et al., 1997). This discrepancy may be caused by a
257 possibility that surgical ablation damaged the other neurons than TN-GnRH neurons or that
258 glutamate, which has been reported to coexist in these neurons (Akazome et al., 2011), have
16 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
259 played a role in the control of motivation. In addition, since each single knockout (npff -/- and
260 gnrh3-/-) showed abnormal sexual behaviors, the possibility of developmental compensation in
261 gnrh3-/-;npff -/- is extremely low. We therefore propose a novel mechanism in which balanced
262 release of NPFF and GnRH3 in the TN-GnRH neurons plays a key role in the control of male
263 sexual behaviors, which is discussed below in detail (see Balanced release of NPFF and GnRH3
264 in the TN-GnRH neurons may facilitate the motivation for male sexual behavior).
265
266 Anatomical distribution of NPFF and GnRH receptors suggests that NPFF and GnRH3
267 induce neuromodulation in the sexual behavior-controlling areas and the sensory processing
268 areas
269 Next, based on the anatomical studies, we discuss the modulatory mechanism of NPFF and
270 GnRH3. The present study and previous studies reported that TN-GnRH neurons express NPFF
271 in addition to GnRH3 (Figre 1A, Wirsig-Wiechmann and Oka, 2002, Oehlmann et al., 2002, Saito
272 et al., 2010). In teleosts, anatomical analysis using dwarf gourami demonstrated that a single TN-
273 GnRH neuron projects their axons widely in the brain, from the olfactory bulb to the spinal cord
274 (Oka and Matsushima, 1993). Since npff -/- and gnrh3-/- showed the abnormal sexual behaviors in
275 different manners (Figure 2 and 3), NPFF and GnRH3 are suggested to be released from TN-
276 GnRH neurons to exert peptidergic neuromodulation to the specific receptor-expressing neurons,
17 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
277 which is suggested to result in the increase in the motivation for sexual behaviors.
278 Our anatomical analyses demonstrated that NPFF receptors are expressed broadly in the brain
279 (Figure 4A), especially in the brain regions controlling sexual behaviors (Vv, Vs, POA; Koyama
280 et al., 1984, Satou et al., 1984). Previous study also reported that electrical stimulation of these
281 brain regions induces male sexual behavior in hime salmon. Furthermore, also in mammals, NPFF
282 receptors are expressed in the olfactory bulb and the lateral septum (Gouarderes et al., 2004),
283 which are regions regulating sexual behaviors (Crews et al., 1996, Tobet and Baum, 1982). From
284 these studies, it may be conserved among various vertebrates that NPFF receptors are expressed
285 in the brain regions controlling sexual behaviors.
286 In addition, neurons expressing the immediate early gene egr1 in the ventral part of POA
287 (vPOA) were more abundantly observed in WT males than in npff -/- males (Figure 6A and 6B).
288 Around the time of removal of the transparent separation between the pairs, WT males are
289 observed to be eagerly trying to mate with females, which means that the male’s motivation for
290 sexual behavior is high. Actually, WT male spawned within 6 min after removing the transparent
291 separation. Since the brain sampling was performed 25 – 28 min after removing the transparent
292 separation, the egr1 expression in the vPOA is suggested to be influenced by the motivation for
293 the sexual behavior. Thus, the loss of egr1 expression in the vPOA in npff -/- may result in the
294 lower motivation for male sexual behavior in these fish. On the other hand, in the analysis of co-
18 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
295 expression of egr1 and gpr74-1,which is the most predominant NPFF receptor subtype expressed
296 in the vPOA (Figure 4D), the difference in the percentage of co-expressing neurons between WT
297 and npff -/- was not significant (Figure 6D). Thus, the majority of neurons showing the increase in
298 egr1-expression in WT are suggested not to express NPFF receptors. Considering that there are
299 neural circuitries among Vv, Vs, and POA (O'Connell and Hofmann, 2011) and local neural
300 circuitries in POA (Zempo et al., 2018), NPFF shown to be expressed in TN-GnRH neurons in
301 medaka (the present result) is suggested to modulate neurons in the vPOA via indirect pathway.
302 Then, this neuromodulation may result in the increase in the motivation for male sexual behaviors.
303 In the present study, we also showed that GnRH receptors are expressed mostly in the sensory
304 processing areas (Figure 5A). Two subtypes of GnRH receptors, gnrhr1 and gnrhr3, were
305 expressed in the Dp, which is the olfactory and gustatory processing areas (Murakami et al., 1983,
306 Yoshimoto et al., 1998). In addition, gnrhr1-expressing neurons were localized in the NI, which
307 is the visual processing area (Ito et al., 1981). Moreover, the Dd and Dm, where gnrhr3 was
308 expressed, are somatosensory processing areas (Ito et al., 1986). Taken together, GnRH3 is
309 suggested to modulate processing of multiple sensory modalities mainly via GnRHR1 and
310 GnRHR3 in medaka. On the other hand, we found some gnrhr3-expressing neurons in the Vv and
311 POA, where NPFF receptors were also expressed. It is suggested that GnRH3 modulates sexual
312 behaviors via such brain regions.
19 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
313 Furthermore, in teleosts, TN-GnRH neurons project their axons to the inner granular layer in
314 the retina, and neurons in this region project to the optic tectum, which suggests that TN-GnRH
315 neurons integrate visual and olfactory information (Springer, 1983, Umino and Dowling, 1991,
316 Li and Dowling, 2000, Li et al., 2017, Umatani and Oka, 2019). Considering these studies and
317 our present results, NPFF and GnRH3 released from TN-GnRH neurons are suggested to integrate
318 and modulate multiple sensory information and finally modulate the motivation for sexual
319 behaviors.
320
321 Balanced release of NPFF and GnRH3 in the TN-GnRH neurons may facilitate the
322 motivation for male sexual behavior
323 We found that gnrh3-/- caused lower expression of npff- (Figure 7A). TN-GnRH neurons express
324 GnRH receptors (Hajdu et al., 2007), and electrophysiological analyses demonstrated that GnRH
325 modulates the electrical activities of TN-GnRH neurons in an auto/paracrine manner (Abe and
326 Oka, 2000). Since GnRH-GnRHR signaling has been reported to regulate gene expressions (Naor,
327 2009), the present results may suggest GnRH3 regulation of NPFF expression in TN-GnRH
328 neurons. To our knowledge, the present study is the first report suggesting expressional control of
329 a peptide by another co-existing peptide, except for one paper reporting that a neuropeptide,
330 cocaine- and amphetamine-regulated transcript, regulates the expression of co-existing
20 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
331 neuropeptide, proopiomelanocortin (Lau et al., 2018). On the other hand, NPFF and GnRH3 are
332 known to modulate neural activities by in vitro experiments (Karigo and Oka, 2013, Umatani and
333 Oka, 2019), and their receptors were expressed in the sexual behavior-controlling areas (present
334 results). Even though the expression of npff may be regulated by GnRH3, both NPFF and GnRH3
335 are suggested to be released from the terminal of TN-GnRH neurons and affect neurons in these
336 brain areas. Based on the discussions above, we here hypothesize the following modulatory
337 mechanism of male sexual behavior by TN-GnRH neurons (Figure 7B).
338 It should be noted that the function of NPFF and GnRH3 is neuromodulation of neural circuits
339 controlling motivation for sexual behaviors and that the sexual behaviors per se can occur without
340 these neuromodulations, because all the knockout medaka could eventually spawn in spite of
341 some behavioral abnormalities. First, we made assumptions that GnRH3 facilitates NPFF
342 expression and activates inhibitory neural circuits (blue). On the other hand, NPFF activates both
343 inhibitory (blue) and excitatory neural circuits (pink) controlling male sexual behaviors. In WT,
344 normal release of NPFF and GnRH3 causes balanced activities of excitatory and inhibitory neural
345 circuits, which enables WT male to show normal sexual behaviors (Figure 7Ba). In gnrh3-/-
346 medaka, loss of gnrh3 expression and subsequently diminished expression of npff induce
347 dominant activity of inhibitory neural circuits, which result in the low motivation for sexual
348 behaviors (Figure 7Bb). In npff -/-, loss of npff expression induces more dominant activity of
21 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
349 inhibitory neural circuits and diminishes motivation for sexual behaviors (Figure 7Bc). On the
350 other hand, in gnrh3 -/-;npff -/- male, loss of both genes results in the balanced activity of inhibitory
351 and excitatory neural circuits, which leads to the normal sexual behaviors (Figure 7Bd). In
352 summary, our present study provides a novel mechanism by which balanced release of co-existing
353 two peptides is important for the neuromodulatory function of TN-GnRH neurons, which may go
354 a long way toward understanding the modulatory mechanism of motivation for sexual behaviors
355 in response to external environments in general.
356
22 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
357 Material and Methods
358 Animal
359 We used male and female Japanese medaka (Oryzias latipes). They were kept at 27±1℃ under
360 the following daylight condition: 14 h light (8:00–22:00) and 10 h dark. The fish were fed with
361 artemia (Salt Creek Inc, Salt Lake, UT) or flake (Tetra, Yokohama, Japan) 2 – 5 times every day.
362 We used sexually mature fish (> three months old), whose body weight was 0.25 ± 0.1g. All the
363 experiments were conducted in accordance with the protocols approved by the animal care and
364 use committee of Graduate School of Science, the University of Tokyo (Permission number, 15-
365 3, 17-1, and 20-6).
366
367 Generation of neuropeptide knockout medaka (gnrh3 -/-, npff -/-, gnrh3 -/-;npff -/-)
368 Knockout fish were generated by using transcription activator-like effector nuclease (TALEN)
369 method. The cleavage site of each gene was designed by ZiFiT (supplied by ZINC FINGER
370 CONSORTIUM; http://www.zincfingers.org/default2.htm). Each binding site of TALEN
371 complex was the following:
372 gnrh3
373 Right - AGCCATCCATAGGACCA
374 Left - GGCGTTGGTGGTTCAGG
23 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
375 npff
376 Right - GAGGCTGATGAAGAACA
377 Left - GCTGCTGGGATTCCAGA
378 Transcription and injection of TALEN mRNA were performed as described in Takahashi et al.,
379 2016 (Takahashi et al., 2016). We injected TALEN solution (25 ng/l right- and left-TALEN
380 mRNA, 7.5 ng/l GFP mRNA, and 0.012% phenol red in phosphate buffered saline, PBS) into
381 the cytoplasm of one or two cell-stage embryo. Homozygous transgenic offspring were obtained
382 as described in Kayo et al., 2019 (Kayo et al., 2019). gnrh3 -/-;npff -/- medaka was generated by
383 crossing gnrh3 -/- medaka with npff -/- medaka.
384 The genotype of these knockout medaka was examined by using PCR with LightCycler 96
385 (Roche Diagnostics, Basel, Switzerland). The genome DNA of each fish was extracted through
386 proteinase K treatment (0.4 mg/ml proteinase K (Kanto Chemical Co., Inc., Tokyo, Japan) in TE
387 (10 mM tris (hydroxymethyl) aminomethane-HCl 1mM, 1 mM Ethylenediaminetetraacetic acid,
388 pH 8.0); 75℃ 20 min and 95℃ 10 min). Then, the genotype was identified by referring to the
389 melting curve after PCR (95℃ 10 sec, 60℃ 10 sec, and 72℃ 10 sec; 45 cycles) and/or the direct
390 sequencing after PCR (95℃ 20 sec, 70℃ 20 sec (-0.5℃/cycle), 72℃ 15 sec) × 20 cycles,
391 (95℃ 20 sec, 60℃ 20 sec, 72℃ 15 sec) × 15 cycles). The sequences of primers are shown in
392 Tables 1 and 2. The sequence of WT and each knockout were compared by using MAFFT
24 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
393 (https://mafft.cbrc.jp/alignment/software/) or APE (https://jorgensen.biology.utah.edu/wayned/
394 ape/).
395
396 Immunohistochemistry (IHC)
397 To examine the loss of NPFF expression in npff -/- medaka, we performed
398 immunohistochemistry using FMRF-amide antibody (1:10000, FA1155, Enzo Life Sciences, Inc.,
399 Farmingdale, NY). In addition, we performed fluorescent IHC using GnRH3 specific antibody
400 (LRH13, 1:10,000; (Park and Wakabayashi, 1986)) to examine the loss of GnRH3 expression in
401 gnrh3 -/- and gnrh3 -/-;npff -/- medaka. In each experiment, 25 µm frontal frozen sections were
402 processed for the IHC procedure according to the standard protocol we documented previously
403 (Karigo et al., 2014, Zempo et al., 2018). To analyze the cellular localizations and the axonal
404 projections of TN-GnRH neurons, the 3,3'-Diaminobenzidine Tetrahydrochloride (DAB) -stained
405 sections were counter-stained using the Nissl staining, after IHC using LRH13 antibody. For the
406 nomenclature of the brain nuclei, we referred to Ishikawa et al., 1999 (Ishikawa et al., 1999).
407
408 In situ hybridization (ISH)
409 Digoxigenin-labeled probes were made for each NPFF receptors (probe length; Gpr147: 1428
410 bases, Gpr74-1: 1323 bases, Gpr74-2: 1278 bases) and GnRH receptors (probe length; GnRHR1:
25 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
411 1234 bases, GnRHR2: 952 bases, GnRHR3: 1230 bases, GnRHR4: 1269bp). The brain sections
412 were made following the methods described above (IHC). Hybridization, wash, and chromogenic
413 reaction were performed as already reported in Zempo et al., 2013 (Zempo et al., 2013). After
414 detection of signals by treatment with a chromogenic substrate, NBT/BCIP, slides were immersed
415 in Neutral red solution (2 % Neutral red in distilled water : 2M phosphate buffer (pH4.8) = 1:1)
416 for 3–8 min in order to visualize brain nuclei. Antisense-specific signals were identified by
417 comparing with slides hybridized with sense probe.
418 For analyses of co-expression of gnrh3, npff and gpr74-1, a fluorescein-labelled probe for
419 GnRH3 mRNA was prepared using fluorescein RNA labelling mix (Roche Diagnostics), and it
420 was used in combination with the DIG-labelled RNA probes for npff or gpr74-1 mRNA. After
421 performing ISH procedures up to the blocking step described above, the sections were incubated
422 with a horseradish peroxidase-conjugated anti-fluorescein antibody (diluted 1:500 with DIG-1,
423 PerkinElmer, Foster City, CA) for 1 h and washed twice with DIG-1 for 5 min each time. The
424 sections were then incubated with Biotinyl Tyramide Amplification kits (TSA, TSA plus biotin
425 kit, PerkinElmer), following the manufacture’s protocol. After washing and signal amplification
426 with avidin biotin complex reagents (1:100 in DIG-1; Vector Laboratories), they were next
427 washed twice with DIG-1 for 5 min each, incubated with Alexa Fluor 488-conjugated streptavidin
428 (diluted 1:500 in DIG-1; Thermo Fisher Scientific) and alkaline phosphatase-conjugated anti-DIG
26 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
429 antibody (diluted 1:1,000 in DIG-1, Roche Diagnostics) for 2 h and washed twice with DIG-1 for
430 5 min each. After the detection of the GnRH3 fluorescent signal, alkaline phosphatase activity
431 was detected using an HNPP fluorescence detection kit (Roche Diagnostics) according to the
432 manufacturer’s instructions. Incubation for this substrate was conducted until visible signals were
433 detected. After detection, the reaction was stopped by washing in PBS solution, and the sections
434 were cover-slipped with CC/Mount (Diagnostic BioSystems, Pleasanton, CA).
435 For the analyses of co-expression of egr1and gpr74-1, a fluorescein-labelled probe for gpr74-
436 1 mRNA was prepared using a fluorescein RNA labelling mix, which was used in combination
437 with the DIG-labelled RNA probes (1308 bases) for egr1 mRNA. We prepared fish pairs
438 according to the behavioural experiment procedure for npff -/- (see below). Then, we separated the
439 pairs of WT or npff -/- in the evening before the experimental day and performed perfusion-fixation
440 25 – 28 min after removing the transparent separation in the next morning. After performing ISH
441 procedures up to the blocking step described above, the sections were incubated with anti-DIG
442 HRP antibody (Roche), and the signals for egr1 were detected with TSA Cy3 kits (PerkinElmer).
443 To block TSA reactions due to the activity of residual HRP carried over in the anti-DIG antibody,
444 we incubated the sections in 3% H2O2 for 40 min. After washing, we detected signals for gpr74-
445 1 following the protocol for fluorescein-labelled gnrh3 mRNA probe described above, with minor
446 modification. After incubation with HRP-conjugated anti-fluorescein antibody, we performed
27 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
447 TSA reaction (TSA plus biotin, Akoya Biosciences, Marlborough, MA) and ABC reaction (Vector
448 laboratories) and detected signals for gpr74-1 with Alexa Fluor 488-conjugated streptavidin. The
449 cell nuclei were labelled by DAPI (Dojindo laboratories, Kumamoto, Japan). After washing in
450 PBS solution, the sections were cover-slipped with FluoroMount/Plus (Diagnostic BioSystems).
451 We counted each labelled cells of three sections (thickness: 25 m), which contain gpr74-1-
452 expressing neurons in the vPOA, per one fish.
453
454 Photomicroscopy
455 The photomicrographs of the fluorescence-labeled sections were taken with laser confocal
456 microscopy (Zeiss LSM710; Carl Zeiss, Oberkochen, Germany). The photomicrographs of DAB-
457 visualized or NBT/BCIP-visualized sections were taken by using a digital camera (DFC310FX;
458 Leica Microsystems, Wetzlar, Germany) attached to a DM 5000 B microscope (Leica
459 Microsystems).
460
461 Behavioral analysis
462 For video recording of sexual behavior, we used a water tank with white sides and transparent
463 bottom (15 cm × 15 cm × 12 cm). The test tank contained about 1 L water at 28℃. A single board
464 computer Raspberry pi (Raspberry pi ZERO W; Raspberry Pi Foundation, Cambridge, UK) with
28 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
465 a Raspberry Pi Camera V2 (Raspberry Pi Foundation) was placed under the tank. For behavioral
466 analysis of phenotypes of gnrh3 -/-, npff -/-, and gnrh3 -/-;npff -/-, we paired one of these knockout
467 medaka, either male or female, with WT of the opposite sex medaka. We kept the pairs in the
468 same tank for 4–6 days before the behavioral recordings. Their behaviors were recorded one or
469 two days after the pairs were moved to the test tank. We used WT pairs for control, which spawned
470 eggs every day for successive three days. Each pair was separated by a transparent sheet with
471 some slits during the night before the behavioral recordings. The behaviors were recorded from
472 9:50 AM and analyzed for 25 mins after removing the transparent separation at 10:00 AM.
473 We analyzed medaka behaviors by using the method described by Tomihara et al. (Tomihara et
474 al., 2021). All the analyses were performed without knowing the genotype of the pair (blind test).
475 The parameters for behavioral analyses were as follows:
476 - latency to the first following (min); If a male did not follow a female at all in 25 min, the latency
477 of that pair was defined as 25 min.
478 - latency to the first courtship (min); If a male did not show courtship at all in 25 min, the latency
479 of that pair was defined as 25 min.
480 - latency to the first clasping (min); If a male did not show clasping at all in 25 min, the latency
481 of that pair was defined as 25 min.
482 - latency to the spawning (min); If a pair did not spawn in 25 min, the latency of that pair was
29 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
483 defined as 25 min.
484 - frequency of courtship before spawning (times/min); the frequency was calculated by dividing
485 the number of courtships by the latency to spawning.
486 - percentage of following with successful courtship (%); This analysis excluded a pair, whose
487 male did not show following at all.
488
489 Cloning of medaka gpr147 and gpr74 (Npff receptors)
490 The cDNAs encoding medaka gpr147 and gpr74 were isolated, and their sequences were
491 determined as previously described (Kanda et al., 2008). Briefly, total RNA of medaka brain was
492 extracted from medaka using ISOGEN (Nippon Gene Co., Ltd., Tokyo, Japan), and
493 polyadenylated RNA was enriched using Oligotex-dT30 Super mRNA Purification kits (Takara
494 Bio Inc.). The cDNAs that were used for RACE were synthesised from 1 µg of polyA+ RNA
495 using a SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA)
496 according to the manufacturer’s instructions. Blasting the known NPFF receptor (GPR147 and
497 GPR74) sequences against the medaka genome sequence database (Ensembl,
498 http://www.ensembl.org/Multi/blastview), three candidate partial sequences (one for gpr147 and
499 two for gpr74) were obtained. In order to determine the sequences of both the 5′ and 3′ ends of
500 medaka gpr147 and gpr74, gene-specific oligonucleotide primers were designed and subjected to
30 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
501 RACE. The sequences of the primers used are listed in Table 3. Polymerase chain reactions (PCR)
502 were conducted in 10 µL containing 10× ExTaq buffer, dNTP, ExTaq polymerase (Takara Bio
503 Inc.), 1 µL of template cDNA, 1× Universal Primer Mix (first PCR, Clontech Laboratories, Inc.)
504 or 1× Nested Universal Primer (secondary PCR, Clontech Laboratories, Inc.) and gene-specific
505 primers. The reaction conditions were as follows: 94 °C for 5 min; 5 cycles of 94 °C for 30 s and
506 72 °C for 2 min; 5 cycles of 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2 min; and 17 cycles of
507 94 °C for 30 s, 64 °C for 30 s, and 72 °C for 2 min. 200 nl of the first PCR solution was used for
508 the next nested PCR. The reaction conditions for the nested PCR were as follows: 94 °C for 5
509 min; 5 cycles of 94 °C for 30 s and 72 °C for 2 min; 5 cycles of 94 °C for 30 s, 70 °C for 30 s,
510 and 72 °C for 2 min; and 25 cycles of 94 °C for 30 s, 64 °C for 30 s, and 72 °C for 2 min. The
511 amplified PCR products were purified on 1.5% agarose gels and cloned into the pGEM-T vector
512 (Promega Corporation, Madison, WI) for sequence analysis. The nucleotide sequences were
513 determined by analyzing more than three clones obtained from independent amplification to avoid
514 PCR error. Transmembrane domains were predicted using the TMHMM server version 2.0.
515
516 Phylogenetic analysis
517 Multiple amino-acid sequence alignments were generated with Clustal X (2.1) (Thompson et
518 al., 1997). The phylogenetic relationships among sequences were analysed with MEGA6 using
31 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
519 the neighbour-joining method with 1000 bootstrap replicates (Tamura et al., 2007). The full-
520 length amino acid sequences of GPR147 (NPFFR1) and GPR74 (NPFFR2) were retrieved from
521 GenBank. GenBank accession numbers of used sequences are as follows: human NPFFR1
522 (AAK94199); cattle NPFFR1 (XP_612190); opossum GPR147 (XP_001374817); dog GPR147
523 (XP_851935); horse NPFFR1(XP_001917713); rat NPFFR1 (NP_071627); mouse RFRPR
524 (XP_137119); pig NPFFR1 (XP_001925251); chicken Rfrpr (BAE17050); quail Gnihr
525 (BAD86818); Takifugu Rfrpr (NP_001092117); zebrafish Gnihr1 (GU290219), Gnihr2
526 (GU290220), Gnihr3 (GU290221); human GPR74 (AAK58513); cattle NPFF2 (XP_609034); rat
527 NPFF2 (NP_076470); mouse GPR74 (AAK58514); opossum NPFF2 (XP_001374952); chicken
528 Npff2 (NP_001029997); zebrafish Npff2-1 (XP_693180); zebrafish Gpr74 (XP_690069);
529 Takifugu Npff2-1 (NP_001092118); Takifugu Npff2-2 (NP_001092119).
530
531 Luciferase assays
532 The cDNAs containing full-length open reading frames of Gpr147, Gpr74-1, Gpr74-2, and
533 GnRHR4 were subcloned into the expression vector pcDNA3.1+ (Thermo fisher scientific).
534 HEK293T cells were grown at 37 °C in Dulbecco’s modified Eagle’s medium supplemented with
535 5% foetal bovine serum. When cells reached 70-80% confluency in 10 cm dish, the medium was
536 replaced with Opti-MEM (Thermo fisher scientific), and the plasmid DNAs (5.5 g/dish) were
32 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
537 transfected into monolayer culture cells with pGL4.29 containing CRE-luciferase reporter gene
538 or pGL4.33 containing SRE-luciferase reporter gene (9.0 g/dish, Promega) and pGL4.74
539 containing the Renilla luciferase reporter gene (0.5 g/dish, Promega), as an internal control,
540 using Polyethyleneimin “Max” (Polyscience, Inc., Warrington, PA) according to the
541 manufacturer’s instructions. Cells were maintained in transfection mixture for 24 h. They were
542 then moved to 24-well plates, treated with NPFF at various concentrations ranging 0 to 10-5M
543 with or without 5 µM forskolin for 6 h before being harvested and analysed. Luminescence was
544 measured with the Dual-Glo Luciferase Assay System (Promega) in a Lumat LB 9507
545 luminometer (EG & G, Berthold, Germany). Transfection experiments were performed in
546 triplicate and repeated at least three times.
547
548 Quantitative real-time PCR
549 We dissected a whole brain from WT, gnrh3 -/-, or npff -/- male. Total RNA of brain was extracted
550 by using FastGeneTM RNA basic kit according to the manufacturer’s instructions. We performed
551 reverse-transcription of 500 ng total RNA with FastGeneTM cDNA Synthesis 5× ReadyMix OdT
552 (NIPPON Genetics Co., Ltd) according to the manufacturer’s instructions. For real time PCR, 1
553 l of cDNA diluted with 10-fold MQ was mixed with KAPA SYBR Fast qPCR kit and amplified
554 with Lightcycler 96 (Roche; 95℃ 5 min, (95℃ 10 sec, 60℃ 10 sec, 72℃ 10 sec) × 45 cycles).
33 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
555 The data were normalized to a housekeeping gene, ribosomal protein s13.
556
557 Data analysis
558 Sample sizes, as indicated in figure legends, were determined based on the observed variability
559 across measurements. All experiments have been replicated in multiple independent trials (at least
560 twice). All data were included in figures. For statistical analysis, we used Kyplot 5.0 software
561 (Kyence, Tokyo, Japan) or R software (version 4.0.3, https://www.r-project.org/) with R studio
562 (https://rstudio.com/products/rstudio/). Steel’s multiple comparison test (compared with WT pairs
563 or WT) was used for multiple comparison of the latency of sexual behavior or the expression level.
564 For the comparison of the percentage of pairs in which sexual behavior occurred, we used
565 ‘survival’ package in R (https://cran.r-project.org/web/packages/survival/index.html) and Log-
566 rank test with Bonferroni’s correction. For the comparison of the percentage of neurons between
567 WT and npff -/-, we used Mann-Whitney U test. The number of cells was shown as mean ± SD. In
568 all statistical analysis, significance levels were described as follows; *: p < 0.05, **: p < 0.01,
569 ***: p < 0.001.
570
571 Data availability
34 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
572 The sequences of NPFF receptors were deposited in GenBank under the accession number
573 AB697148 for GPR147, AB697149 for GPR74-1, and AB697150 for GPR74-2. All data are
574 included in the manuscript and supporting source data files. Source data files have been
575 provided for Figure 2, Figure 3, Figure4—figure supplement2, Figure5—figure
576 supplement1, Figure 6, and Figure 7.
577
35 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
578 Tables
579 Table 1. Primers for the melting curve analysis
Primer Name Sequence GnRH3genoSE GGCTTCCCCATGCAGTTCTA GnRH3genoAS AACAATCACCCACCCTGATG NPFFgenoSE1 CTGCCTTTGGTGGTGAAAGC NPFFgenoAS2 TCATCTGTATTGGTGCTGACCTCTG
580 Table 2. Primers for the sequence in order to examine genotype
Primer Name Sequence GnRH3targetSeqSE GCCGTGAGCGAGTAGGCAG gnrh3CriKI_checkAS3 GGGCTGCGCACATTAATATTGC mfNPFFgeneSE AGGTACCAGCTCAGGGGAAT NPFFgenoAS1 GGTGTGACAGGTTTCATCTGTATTGG
581 Table 3. Primers for 5’ RACE and 3’ RACE (NPFFR1: Gpr147, NPFFR2: Gpr74-1, NPFFR3:
582 Gpr74-2)
Primer Name Sequence NPFFR1 AS1 GTGTGCTCCTTGGTCACCTGCAGC NPFFR1 AS2 (nest) AAGGGATAGACGATGCACCTGAAC NPFFR2 AS1 GCTGCGGAGCACAATGAAGCACACC NPFFR2 AS2 (nest) CACGAAGATCAGCAGGTAGGAGACC NPFFR3 AS1 ACACAGGATGACTACTGCCAATACCG NPFFR3 AS2 (nest) GCAGAGTCAGCTTGGGTTGTAGAGG NPFFR1 SE1 CGTGGAGCCCATTTCCATGAACAGC NPFFR1 SE2 (nest) CAGGAGCTGATCATGGAGGACCTG NPFFR2 SE1 AGTTGTGGACCACAGGAGCAAGACG NPFFR2 SE2 (nest) AGCGCCAACAAACTGAGCATGGACC NPFFR3 SE1 CATGGTGTCATGGCTGCCACTCTGGG NPFFR3 SE2 (nest) GGCTTGGACAGGGACCAACTGGAC C
36 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
583 Acknowledgements
584 We thank Dr. Nakajo (Osaka Medical and Pharmaceutical University) for helpful discussion
585 and advice. We also thank Mr. Tomihara (the University of Tokyo) for his help with the behavioral
586 analysis system. In addition, we thank Ms. Ruka Kojima for her construction of TALEN for
587 knockout of gnrh3 and Ms. Kiyoko Kataoka for her advice on in situ hybridization and her help
588 in performing the double ISH. We also thank Ms. Hisako Kohno, Ms. Miho Kyokuwa, Ms.
589 Fumika Muguruma, Ms. Fujiko Masui, Ms. Natsuko Ito, and Ms. Hiroko Tsukamoto for animal
590 care. This work was supported by Grants-in-Aid from Japan Society for the Promotion of Science
591 (JSPS) Grant (Grant number 17K15157 and 20H03071 to C. U., 24570067 to Y. A., 18H04881
592 and 18K19323 to S. K., and 26221104 to Y. O.), grant for Basic Science Research Projects from
593 Sumitomo Foundation to S. K., and Research Grants in the Natural Sciences from the Mitsubishi
594 Foundation to S. K.
595
596 Competing interests
597 The authors have no competing interests.
598
599
600
37 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
601 References 602 ABE, H. & OKA, Y. 2000. Modulation of pacemaker activity by salmon gonadotropin-releasing 603 hormone (sGnRH) in terminal nerve (TN)-GnRH neurons. J Neurophysiol, 83, 3196- 604 3200. 605 AKAZOME, Y., KANDA, S. & OKA, Y. 2011. Expression of vesicular glutamate transporter-2.1 606 in medaka terminal nerve gonadotrophin-releasing hormone neurones. J Neuroendocrinol, 607 23, 570-6. 608 ARGIOLAS, A. & MELIS, M. R. 2013. Neuropeptides and central control of sexual behaviour 609 from the past to the present: a review. Prog Neurobiol, 108, 80-107. 610 BONINI, J. A., JONES, K. A., ADHAM, N., FORRAY, C., ARTYMYSHYN, R., DURKIN, M. 611 M., SMITH, K. E., TAMM, J. A., BOTEJU, L. W., LAKHLANI, P. P., RADDATZ, R., 612 YAO, W. J., OGOZALEK, K. L., BOYLE, N., KOURANOVA, E. V., QUAN, Y., 613 VAYSSE, P. J., WETZEL, J. M., BRANCHEK, T. A., GERALD, C. & BOROWSKY, B. 614 2000. Identification and characterization of two G protein-coupled receptors for 615 neuropeptide FF. J Biol Chem, 275, 39324-31. 616 BURMEISTER, S. S. & FERNALD, R. D. 2005. Evolutionary conservation of the egr-1 617 immediate-early gene response in a teleost. J Comp Neurol, 481, 220-32. 618 CREWS, D., GODWIN, J., HARTMAN, V., GRAMMER, M., PREDIGER, E. A. & 619 SHEPPHERD, R. 1996. Intrahypothalamic implantation of progesterone in castrated 620 male whiptail lizards (Cnemidophorus inornatus) elicits courtship and copulatory 621 behavior and affects androgen receptor- and progesterone receptor-mRNA expression in 622 the brain. J Neurosci, 16, 7347-52. 623 DENNISON, E., BAIN, P. A., BARTKE, A. & MELISKA, C. J. 1996. Systemically administered 624 gonadotrophin-releasing hormone enhances copulatory behaviour in castrated, 625 testosterone-treated hyperprolactinaemic male rats. Int J Androl, 19, 253-9. 626 DORSA, D. M. & SMITH, E. R. 1980. Facilitation of mounting behavior in male rats by 627 intracranial injections of luteinizing hormone-releasing hormone. Regul Pept, 1, 147-55. 628 DORSA, D. M., SMITH, E. R. & DAVIDSON, J. M. 1981. Endocrine and behavioral effects of 629 continuous exposure of male rats to a potent luteinizing hormone-releasing hormone 630 (LHRH) agonist: evidence for central nervous system actions of LHRH. Endocrinology, 631 109, 729-35. 632 GEHLERT, D. R., THOMPSON, L. K., HEMRICK-LUECKE, S. K. & SHAW, J. 2008. 633 Monoaminergic compensation in the neuropeptide Y deficient mouse brain. 634 Neuropeptides, 42, 367-75. 635 GOUARDERES, C., PUGET, A. & ZAJAC, J. M. 2004. Detailed distribution of neuropeptide FF 636 receptors (NPFF1 and NPFF2) in the rat, mouse, octodon, rabbit, guinea pig, and
38 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
637 marmoset monkey brains: a comparative autoradiographic study. Synapse, 51, 249-69. 638 HAJDU, P., IKEMOTO, T., AKAZOME, Y., PARK, M. K. & OKA, Y. 2007. Terminal nerve 639 gonadotrophin-releasing hormone (GnRH) neurones express multiple GnRH receptors in 640 a teleost, the dwarf gourami (Colisa lalia). J Neuroendocrinol, 19, 475-9. 641 HIRAKI-KAJIYAMA, T., YAMASHITA, J., YOKOYAMA, K., KIKUCHI, Y., NAKAJO, M., 642 MIYAZOE, D., NISHIIKE, Y., ISHIKAWA, K., HOSONO, K., KAWABATA-SAKATA, 643 Y., ANSAI, S., KINOSHITA, M., NAGAHAMA, Y. & OKUBO, K. 2019. Neuropeptide 644 B mediates female sexual receptivity in medaka fish, acting in a female-specific but 645 reversible manner. Elife, 8. 646 ISHIKAWA, Y., YOSHIMOTO, M. & ITO, H. 1999. A brain atlas of a wild-type inbred strain of 647 the medaka, Oryzias latipes. Fish Biology Journal Medaka, 10, 1-26. 648 ITO, H., MURAKAMI, T., FUKUOKA, T. & KISHIDA, R. 1986. Thalamic fiber connections in 649 a teleost (Sebastiscus marmoratus): visual somatosensory, octavolateral, and cerebellar 650 relay region to the telencephalon. J Comp Neurol, 250, 215-27. 651 ITO, H., TANAKA, H., SAKAMOTO, N. & MORITA, Y. 1981. Isthmic afferent neurons 652 identified by the retrograde HRP method in a teleost, Navodon modestus. Brain Res, 207, 653 163-9. 654 KANDA, S., AKAZOME, Y., MATSUNAGA, T., YAMAMOTO, N., YAMADA, S., 655 TSUKAMURA, H., MAEDA, K. & OKA, Y. 2008. Identification of KiSS-1 product 656 kisspeptin and steroid-sensitive sexually dimorphic kisspeptin neurons in medaka 657 (oryzias latipes). Endocrinology, 149, 2467-76. 658 KARIGO, T., AIKAWA, M., KONDO, C., ABE, H., KANDA, S. & OKA, Y. 2014. Whole brain- 659 pituitary in vitro preparation of the transgenic medaka (Oryzias latipes) as a tool for 660 analyzing the differential regulatory mechanisms of LH and FSH release. Endocrinology, 661 155, 536-547. 662 KARIGO, T. & OKA, Y. 2013. Neurobiological study of fish brains gives insights into the nature 663 of gonadotropin-releasing hormone 1-3 neurons. Front Endocrinol (Lausanne), 4, 177. 664 KAWAI, T., ABE, H., AKAZOME, Y. & OKA, Y. 2010. Neuromodulatory effect of GnRH on the 665 synaptic transmission of the olfactory bulbar neural circuit in goldfish, Carassius auratus. 666 J Neurophysiol, 104, 3540-50. 667 KAYO, D., ZEMPO, B., TOMIHARA, S., OKA, Y. & KANDA, S. 2019. Gene knockout analysis 668 reveals essentiality of estrogen receptor beta1 (Esr2a) for female reproduction in medaka. 669 Sci Rep, 9, 8868. 670 KIM, D. K., CHO, E. B., MOON, M. J., PARK, S., HWANG, J. I., KAH, O., SOWER, S. A., 671 VAUDRY, H. & SEONG, J. Y. 2011. Revisiting the evolution of gonadotropin-releasing 672 hormones and their receptors in vertebrates: secrets hidden in genomes. Gen Comp
39 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
673 Endocrinol, 170, 68-78. 674 KINOSHITA, M., KOBAYASHI, S., URANO, A. & ITO, E. 2007. Neuromodulatory effects of 675 gonadotropin-releasing hormone on retinotectal synaptic transmission in the optic tectum 676 of rainbow trout. Eur J Neurosci, 25, 480-4. 677 KOYAMA, Y., SATOU, M., OKA, Y. & UEDA, K. 1984. Involvement of the telencephalic 678 hemispheres and the preoptic area in sexual behavior of the male goldfish, Carassius 679 auratus: a brain-lesion study. Behav Neural Biol, 40, 70-86. 680 LAU, J., FARZI, A., QI, Y., HEILBRONN, R., MIETZSCH, M., SHI, Y. C. & HERZOG, H. 2018. 681 CART neurons in the arcuate nucleus and lateral hypothalamic area exert differential 682 controls on energy homeostasis. Mol Metab, 7, 102-118. 683 LI, L. & DOWLING, J. E. 2000. Disruption of the olfactoretinal centrifugal pathway may relate 684 to the visual system defect in night blindness b mutant zebrafish. J Neurosci, 20, 1883- 685 92. 686 LI, L., WOJTOWICZ, J. L., MALIN, J. H., HUANG, T., LEE, E. B. & CHEN, Z. 2017. GnRH- 687 mediated olfactory and visual inputs promote mating-like behaviors in male zebrafish. 688 PLoS One, 12, e0174143. 689 MURAKAMI, T., MORITA, Y. & ITO, H. 1983. Extrinsic and intrinsic fiber connections of the 690 telencephalon in a teleost, Sebastiscus marmoratus. J Comp Neurol, 216, 115-31. 691 MYERS, B. M. & BAUM, M. J. 1980. Facilitation of copulatory performance in male rats by 692 naloxone: effects of hypophysectomy, 17 alpha-estradiol, and luteinizing hormone 693 releasing hormone. Pharmacol Biochem Behav, 12, 365-70. 694 NAOR, Z. 2009. Signaling by G-protein-coupled receptor (GPCR): studies on the GnRH receptor. 695 Front Neuroendocrinol, 30, 10-29. 696 O'CONNELL, L. A. & HOFMANN, H. A. 2011. The vertebrate mesolimbic reward system and 697 social behavior network: a comparative synthesis. J Comp Neurol, 519, 3599-639. 698 OEHLMANN, V. D., KORTE, H., STERNER, C. & KORSCHING, S. I. 2002. A neuropeptide 699 FF-related gene is expressed selectively in neurons of the terminal nerve in Danio rerio. 700 Mechanisms of Development, 117, 357-361. 701 OKA, Y. & MATSUSHIMA, T. 1993. Gonadotropin-releasing hormone (GnRH)-immunoreactive 702 terminal nerve cells have intrinsic rhythmicity and project widely in the brain. J Neurosci, 703 13, 2161-2176. 704 OKUBO, K., ISHII, S., ISHIDA, J., MITANI, H., NARUSE, K., KONDO, M., SHIMA, A., 705 TANAKA, M., ASAKAWA, S., SHIMIZU, N. & AIDA, K. 2003. A novel third 706 gonadotropin-releasing hormone receptor in the medaka Oryzias latipes: evolutionary 707 and functional implications. Gene, 314, 121-131. 708 OKUBO, K. & NAGAHAMA, Y. 2008. Structural and functional evolution of gonadotropin-
40 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
709 releasing hormone in vertebrates. Acta Physiol (Oxf), 193, 3-15. 710 OKUYAMA, T., YOKOI, S., ABE, H., ISOE, Y., SUEHIRO, Y., IMADA, H., TANAKA, M., 711 KAWASAKI, T., YUBA, S., TANIGUCHI, Y., KAMEI, Y., OKUBO, K., SHIMADA, A., 712 NARUSE, K., TAKEDA, H., OKA, Y., KUBO, T. & TAKEUCHI, H. 2014. A neural 713 mechanism underlying mating preferences for familiar individuals in medaka fish. 714 Science, 343, 91-4. 715 ONO, Y. & UEMATSU, T. 1957. Mating ethogram in oryzias latipes. Jour Fac Sci Hokkaido 716 Univ Ser VI Zool, 13, 197-202. 717 PARK, M. K. & WAKABAYASHI, K. 1986. Preparation of a monoclonal antibody to common 718 amino acid sequence of LHRH and its application. Endocrinol Jpn, 33, 257-72. 719 SAITO, T. H., NAKANE, R., AKAZOME, Y., ABE, H. & OKA, Y. 2010. Electrophysiological 720 analysis of the inhibitory effects of FMRFamide-like peptides on the pacemaker activity 721 of gonadotropin-releasing hormone neurons. J Neurophysiol, 104, 3518-3529. 722 SATOU, M., OKA, Y., KUSUNOKI, M., MATSUSHIMA, T., KATO, M., FUJITA, I. & UEDA, 723 K. 1984. Telencephalic and preoptic areas integrate sexual behavior in hime salmon 724 (landlocked red salmon, Oncorhynchus nerka): results of electrical brain stimulation 725 experiments. Physiol Behav, 33, 441-7. 726 SPRINGER, A. 1983. Centrifugal innervation of goldfish retina from ganglion-cells of the nervus 727 terminalis. Journal of Comparative Neurology, 214, 404-415. 728 TAKAHASHI, A., KANDA, S., ABE, T. & OKA, Y. 2016. Evolution of the Hypothalamic- 729 Pituitary-Gonadal Axis Regulation in Vertebrates Revealed by Knockout Medaka. 730 Endocrinology, 157, 3994-4002. 731 TAMURA, K., DUDLEY, J., NEI, M. & KUMAR, S. 2007. MEGA4: Molecular Evolutionary 732 Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol, 24, 1596-9. 733 THOMPSON, J. D., GIBSON, T. J., PLEWNIAK, F., JEANMOUGIN, F. & HIGGINS, D. G. 734 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence 735 alignment aided by quality analysis tools. Nucleic Acids Res, 25, 4876-82. 736 TOBET, S. A. & BAUM, M. J. 1982. Implantation of dihydrotestosterone propionate into the 737 lateral septum inhibits sexual receptivity in estrogen-primed, ovariectomized rats. 738 Neuroendocrinology, 34, 333-8. 739 TOMIHARA, S., OKA, Y. & KANDA, S. 2021. Establishment of open-source semi-automated 740 behavioral analysis system and quantification of the difference of sexual motivation 741 between laboratory and wild strains. Scientific Reports, 11, 10894. 742 UMATANI, C., MISU, R., OISHI, S., YAMAGUCHI, K., ABE, H. & OKA, Y. 2015. GnRH 743 suppresses excitability of visual processing neurons in the optic tectum. J Neurophysiol, 744 114, 2775-84.
41 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
745 UMATANI, C. & OKA, Y. 2019. Multiple functions of non-hypophysiotropic gonadotropin 746 releasing hormone neurons in vertebrates. Zoological Lett, 5, 23. 747 UMINO, O. & DOWLING, J. E. 1991. Dopamine release from interplexiform cells in the retina: 748 effects of GnRH, FMRFamide, bicuculline, and enkephalin on horizontal cell activity. J 749 Neurosci, 11, 3034-46. 750 VILIM, F. S., AARNISALO, A. A., NIEMINEN, M. L., LINTUNEN, M., KARLSTEDT, K., 751 KONTINEN, V. K., KALSO, E., STATES, B., PANULA, P. & ZIFF, E. 1999. Gene for 752 pain modulatory neuropeptide NPFF: induction in spinal cord by noxious stimuli. Mol 753 Pharmacol, 55, 804-11. 754 WALTER, R. O. & HAMILTON, J. B. 1970. Head-up Movements as an Indicator of Sexual 755 Unreceptivity in Female Medaka, Oryzias latipes. Animal Behaviour, 18, 125-127. 756 WIRSIG-WIECHMANN, C. R. & OKA, Y. 2002. The terminal nerve ganglion cells project to 757 the olfactory mucosa in the dwarf gourami. Neurosci Res, 44, 337-41. 758 WIRSIG, C. R. & LEONARD, C. M. 1987. Terminal nerve damage impairs the mating behavior 759 of the male hamster. Brain Res, 417, 293-303. 760 YAMAMOTO, N. & ITO, H. 2000. Afferent sources to the ganglion of the terminal nerve in 761 teleosts. J Comp Neurol, 428, 355-75. 762 YAMAMOTO, N., OKA, Y. & KAWASHIMA, S. 1997. Lesions of gonadotropin-releasing 763 hormone-immunoreactive terminal nerve cells: effects on the reproductive behavior of 764 male dwarf gouramis. Neuroendocrinology, 65, 403-12. 765 YANG, H. Y., TAO, T. & IADAROLA, M. J. 2008. Modulatory role of neuropeptide FF system 766 in nociception and opiate analgesia. Neuropeptides, 42, 1-18. 767 YOSHIMOTO, M., ALBERT, J. S., SAWAI, N., SHIMIZU, M., YAMAMOTO, N. & ITO, H. 768 1998. Telencephalic ascending gustatory system in a cichlid fish, Oreochromis (Tilapia) 769 niloticus. J Comp Neurol, 392, 209-26. 770 ZEMPO, B., KANDA, S., OKUBO, K., AKAZOME, Y. & OKA, Y. 2013. Anatomical 771 distribution of sex steroid hormone receptors in the brain of female medaka. J Comp 772 Neurol, 521, 1760-80. 773 ZEMPO, B., KARIGO, T., KANDA, S., AKAZOME, Y. & OKA, Y. 2018. Morphological 774 Analysis of the Axonal Projections of EGFP-Labeled Esr1-Expressing Neurons in 775 Transgenic Female Medaka. Endocrinology, 159, 1228-1241. 776
777
42 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
778 Figure legends
779 Figure 1: Generation of npff -/-, gnrh3 -/-, and gnrh3 -/-;npff -/- medaka
780 (A) npff and gnrh3 are co-expressed in the terminal nerve as demonstrated by ISH. Magenta
781 shows signal for npff mRNA, and green shows signal for gnrh3 mRNA. Scale bar: 30 m. (B)
782 Schematic diagram of TALEN target site. Black box: coding region, white box: non-coding region
783 of exon, arrowhead: TALEN target region, arrow and dotted line: region where frame shift
784 occurred. (C) The sequence of npff or gnrh3 of knockout medaka (the bottom row) compared with
785 that of WT (the upper row). (D) The amino acid sequence of NPFF (pro-NPFF) or GnRH3 of
786 knockout fish (the bottom row) compared with that of WT (the upper row). The changes in amino
787 acid sequences caused by frame shift are indicated by blue font. * means stop codon. (E)
788 Illustration of the side view of the fish brain and the frontal section in the telencephalon. The red
789 line indicates the region of the section of F and G, and the red rectangular indicates the brain
790 region around the terminal nerve. (F) NPFF-immunoreactive cell bodies were found only in the
791 brain of WT. The black arrowhead shows cell bodies of TN-GnRH3 neurons. The dotted
792 arrowhead indicates the region of TN-GnRH3 neurons. Scale bar: 20 µm. (G) GnRH3-
793 immunoreactive cell bodies and fibers were found only in the brain of WT. The white arrowhead
794 shows cell body of TN-GnRH3 neurons. The dotted arrowhead indicates the region of TN-GnRH3
795 neurons. † means non-specific signal of the meninges. Scale bar: 25 µm.
43 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
796
797 Figure 1—figure supplement 1: LRH13 is a specific antibody for medaka GnRH3
798 (A) LRH13 immuno-reactive cell bodies and neurites were localized in the terminal nerve. On
799 the other hand, LRH13 immuno-reactive cell bodies were found neither in the POA (B), where
800 the cell bodies of GnRH1 neurons are located, and LRH13 immuno-reactive fibers, nor in the
801 pituitary (C), where the axons of GnRH1 neurons are located. In addition, immuno-reactive
802 structures were not found in the midbrain tegmentum (D), where the cell bodies of GnRH2
803 neurons are localized. Scale bar: 20 µm.
804
805 Figure 2: npff -/- medaka shows the increase in the latency to sexual behaviors
806 (A) Normal sexual behavioral repertories in WT male and female medaka. (B-E) The upper
807 graph: latency to each sexual behavior illustrated in (A). The lower graph: reverse Kaplan-Meier
808 curve indicating the percentage of pairs in which each sexual behavior illustrated in (A) occurred.
809 The short latency indicates that the sequence of sexual behavior proceeded quickly. The latency
810 of a pair, which did not show the behavior, was defined as 25 min. (B) The first following. (C)
811 The first courtship. (D) The first clasping. (E) The spawning. WT male and female pair: n = 15,
812 WT male and npff -/- female pair: n = 17, npff -/- male and WT female pair: n =15. For the analyses
813 of the latency, each knockout group was compared with WT male and female pair (*: p < 0.05,
44 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
814 **: p < 0.01, ***: p < 0.001, Steel’s multiple comparison test). For the analyses of percentage of
815 pairs, we used Log-rank test with Bonferroni’s correction (*: p < 0.05, **: p < 0.01, ***: p <
816 0.001).
817
818 Figure 2—figure supplement 1: npff -/- medaka shows normal body size
819 All knockout fish grew as normally as WT. (A) & (B) Body weight of control (WT) and npff -/-
820 medaka. WT male and female pair: n = 15, WT male and npff -/- female pair: n = 17, npff -/- male
821 and WT female pair: n = 15. Steel’s multiple comparison test, not significant. The body weights
822 of the fish labeled with bold font are shown. The fish labeled with gray font indicates that of the
823 partner in behavioral analysis.
824
825 Figure 2—figure supplement 2: npff -/- male shows an impairment of following and courtship
826 behaviors
827 (A) courtship frequency before spawning (times/min). WT male and female pair: n = 15, WT
828 male and npff -/- female pair: n = 17, npff -/- male and WT female pair: n = 15. (B) percentage of
829 following with successful courtship (%). WT male and female pair: n = 15, WT male and npff -/-
830 female pair: n = 17, npff -/- male and WT female pair: n = 10. Each knockout group was compared
831 with WT male and female pair. (*: p < 0.05, **: p < 0.01, Steel’s multiple comparison test)
45 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
832
833 Figure 3: gnrh3 -/- male shows the increase in the latency to some sexual behaviors, although
834 gnrh3 -/-;npff -/- male shows normal sexual behaviors
835 (A) Normal sexual behavioral repertories in WT male and female medaka. (B-E) The upper
836 graph: latency to each sexual behavior illustrated in (A). The lower graph: reverse Kaplan-Meier
837 curve indicating the percentage of pairs in which each sexual behavior illustrated in (A) occurred.
838 The short latency indicates that the sequence of sexual behavior proceeded quickly. The latency
839 of a pair, which did not show the behavior, was defined as 25 min. (B) The first following. (C)
840 The first courtship. (D) The first clasping. (E) The spawning. WT male and female pair: n = 20,
841 WT male and gnrh3 -/- female pair: n = 15, gnrh3 -/- male and WT female pair: n = 15, WT male
842 and gnrh3 -/-;npff -/- female pair: n = 11, gnrh3 -/-;npff -/- male and WT female pair: n = 11. For the
843 analyses of the latency, each knockout group was compared with WT male and female pair (*: p
844 < 0.05, Steel’s multiple comparison test). For the analyses of percentage of pairs, we used Log-
845 rank test with Bonferroni’s correction (*: p < 0.05).
846
847 Figure 3—figure supplement 1: gnrh3 -/- and gnrh3 -/-;npff -/- medaka showed normal body
848 size
849 All knockout fish grew almost normally as well as WT. (A) & (B) Body weight of control (WT),
46 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
850 gnrh3 -/-, and gnrh3 -/-;npff -/- medaka. WT male and female pair: n = 20, WT male and gnrh3 -/-
851 female pair: n = 15, gnrh3 -/- male and WT female pair: n = 15, WT male and gnrh3 -/-;npff -/- female
852 pair: n = 11, gnrh3 -/-;npff -/- male and WT female pair: n = 11. Steel’s multiple comparison test, *:
853 p < 0.05. The body weights of the fish labeled with bold font are shown. The fish labeled with
854 gray font indicates that of the partner in behavioral analysis.
855
856 Figure 3—figure supplement 2: gnrh3 -/- and gnrh3 -/-;npff -/- male show the normal following
857 and courtship behaviors
858 (A) Courtship frequency before spawning (times/min). WT male and female pair: n = 20, WT
859 male and gnrh3 -/- female pair: n = 15, gnrh3 -/- male and WT female pair: n = 15, WT male and
860 gnrh3 -/-;npff -/- female pair: n = 11, gnrh3 -/-;npff -/- male and WT female pair: n = 11. (D) Percentage
861 of following with successful courtship (%). WT male and female pair: n = 20, WT male and gnrh3
862 -/- female pair: n = 15, gnrh3 -/- male and WT female pair: n = 14, WT male and gnrh3 -/-;npff -/-
863 female pair: n = 11, gnrh3 -/-;npff -/- male and WT female pair: n = 9. Each knockout group was
864 compared with WT male and female pair. (n.s.: not significant, Steel’s multiple comparison test)
865
866 Figure 4: gpr147, 74-1, and 74-2 (NPFF receptors)-expressing neurons are distributed
867 broadly in the brain.
47 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
868 (A) Localization of the cell bodies expressing gpr147, 74-1, and 74-2. The right part of the
869 brain indicates nuclear boundaries, while the left part of the brain does localizations of neurons
870 expressing each type of receptor. (B) gpr74-2 expressing neurons in the ventralis telencephali pars
871 ventralis (Vv) (C) gpr147 expressing neurons in the ventralis telencephali pars
872 supracommissuralis (Vs) (D) gpr147, 74-1, and 74-2 expressing neurons in the preoptic area
873 (POA) (E) Co-expression of gpr74-1 (magenta) and gnrh3 (green) in the terminal nerve. Scale
874 bar: 20 m.
875
876 Figure 4—figure supplement 1: Alignment of the deduced amino acid sequence and
877 phylogenic tree of Gpr147, 74-1, and 74-2
878 (A) The amino acid sequence of Gpr147, 74-1, and 74-2. Full-length protein sequences were
879 aligned by ClustalX 2.1 using the default settings. Identical residues are shaded in black. (B)
880 Phylogenetic tree of GPR147, GPR74-1, and GPR74-2. Unrooted phylogenetic tree of the
881 receptors was constructed by the neighbor-joining method using MEGA6 software. Each medaka
882 receptor was named Gpr147, Gpr74-1, or Gpr74-2 in accordance with other known sequences of
883 GPR147 and GPR74. The numbers at the nodes are bootstrap values as percentages, which were
884 obtained from 1,000 replicates. Scale bar indicates the substitution rate per residue.
885
48 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
886 Figure 4—figure supplement 2: Cloned Gpr147, 74-1, and 74-2 worked as G-protein coupled
887 receptor.
888 (A) Inhibition of forskolin-induced CRE-luciferase activities in HEK293T cells transfected
889 with medaka Gpr147, Gpr74-1 or Gpr74-2 in combination with pGL4.29 (CRE-luc) plasmid. The
890 mammalian expression vector pcDNA3.1+ was transfected as a mock-transfection. (D) Induction
891 of CRE-luciferase activities HEK293T cells transfected with medaka Gpr147, Gpr74-1 or Gpr74-
892 2 in combination with pGL4.29 (CRE-luc) plasmid. The mammalian expression vector
893 pcDNA3.1+ was transfected as a mock-transfection. In A and B, after stimulation with increasing
894 concentration of medaka Npff (dark triangle) luciferase activity was assessed. The data are
895 indicated as the means ± S.E.M. of at least three independent experiments performed in triplicate.
896
897 Figure 5: gnrhr1, 2, and 4 -expressing neurons are distributed locally, whereas gnrhr3-
898 expressing neurons are distributed broadly in the brain
899 (A) Localization of the cell bodies expressing each gnrhr. The right part of the brain indicates
900 nuclear boundaries, while the left part of the brain does localizations of neurons expressing each
901 type of receptor. (B) gnrhr1-expressing neurons in the area dorsalis telencephali pars posterior
902 (A-a) and the nucleus isthmi (A-b). (C) gnrhr2-expressing neurons in the pineal organ (C-a) and
903 the nucleus diffusus tori lateralis (C-b). (D) gnrhr3-expressing neurons in representative brain
49 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
904 nuclei. a, area dorsalis telencephali pars dorsalis (Dd), b, area ventralis telencephali pars ventralis
905 (Vv), c, ventral region of Dm (vDm), d, area dorsalis telencephali pars posterior, e, preoptic area
906 (POA), f, nucleus anterior tuberis (NAT) and neucleus ventralis tuberis (NVT), (E) gnrhr4 was
907 expressed in the nucleus anterior tuberis (E-a) and the nucleus of fasciculus longitudinalis mediali
908 (E-b). scale bar in B-E: 20 m.
909
910 Figure 5—figure supplement 1: GnRHR4 functions as a Gq -protein coupled receptor.
911 Induction of SRE-luciferase activities HEK293T cells transfected with medaka gnrhr4 in
912 combination with pGL4.33 (SRE-luc) plasmid. After stimulation with increasing concentration
913 of medaka GnRH1 (mdGnRH, white triangle), chicken GnRH2 (cGnRHII, dark square), or
914 salmon GnRH3 (sGnRH, white circle), luciferase activity was assessed. The data are indicated as
915 the means ± S.E.M. of at least three independent experiments performed in triplicate.
916
917 Figure 6 : egr1-expressing neurons were more abundantly observed in WT than in npff -/-
918 male medaka
919 (A) egr1 (magenta) and gpr74-1 (green) expression in the preoptic area (POA) of WT (left)
920 and npff -/- (right) male medaka. The nuclei were counterstained by DAPI (blue). The inset shows
921 an enlarged image of the region in square. The white arrowhead indicates a neuron expressing
50 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
922 both egr1 and gpr74-1. We counted cells in vPOA (the region under dotted bars). Scale bars: 50
923 m, 10 m (inset) (B) The percentage of egr1-expressing neurons (egr1+) in the ventral part of
924 POA. (C) The percentage of gpr74-1+-expressing neurons (gpr74-1+) in the ventral POA. (D) The
925 percentage of neurons expressing both gpr74-1 and egr1 (egr1+∩gpr74-1+) in the ventral POA.
926 WT: n = 5, npff -/-: n = 6. Mann-Whitney U test, **: p < 0.01, n.s.: not significant.
927
928 Figure 7 : Expression of npff in gnrh3-/- male is lower than that of WT male medaka
929 (A) gnrh3 and npff expression in the brain of gnrh3 -/-, npff -/-, and WT male medaka. Each
930 group: n = 5. Steel’s multiple comparison test, *: p < 0.05. (B) Hypothetical illustrations of NPFF-
931 and GnRH3-induced modulation of male sexual behavior. The size of the circle (blue or pink)
932 indicates the activity level of each neural circuit. GnRH3 facilitates NPFF expression and
933 activates inhibitory neural circuits (blue). On the other hand, NPFF activates both inhibitory (blue)
934 and excitatory neural circuits (pink) controlling male sexual behaviors. (a) In WT, normal release
935 of NPFF and GnRH3 causes balanced activities of excitatory and inhibitory neural circuits, which
936 enables WT male to show normal sexual behaviors. (b) In gnrh3-/- medaka, loss of gnrh3
937 expression and subsequently diminished expression of npff results in the low motivation for sexual
938 behaviors. (c) In npff -/-, loss of npff expression induces dominant activity of inhibitory neural
939 circuits and diminishes motivation for sexual behaviors. (d) On the other hand, in gnrh3 -/-;npff -/-
51 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
940 male, loss of both genes results in the balanced activity of inhibitory and excitatory neural circuits,
941 which leads to the normal sexual behaviors.
942
52 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Figure 2 B A following 100 ♂ :wt ♀ :wt
Percentage of pairs in which following occurred Latency to the1 1st 1 following2 (min)2 20 40 60 80 0 5 0 5 0 5 0 0 Time to following(min) (which wasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.It bioRxiv preprint 5 10 *** npff 15 -/- wt♂×wt♀ npff wt♂×npff
doi: -/- ♂×wt♀ 20 -/- npff https://doi.org/10.1101/2021.07.14.452327 ♀ wt
*** -/- 25
C 100 Latency to the 1st courtship (min) courtship ♂ :wt ♀ :wt
Percentage of pairs in which courtship occurred 1 1 2 2 20 40 60 80 0 5 0 5 0 5 0 0 Time to courtship(min) made availableundera 5 10 *** npff 15 -/- wt♂×wt♀ npff wt♂×npff
-/- ♂×wt♀ 20 -/- npff ♀ wt
*** -/- CC-BY 4.0Internationallicense ; 25
this versionpostedJuly14,2021. D
100 Latency to the 1st clasping (min) clasping Percentage of pairs in which clasping occurred 1 1 2 2 ♀ :wt
♂ :wt 20 40 60 80 0 5 0 5 0 5 0 0 Time to clasping(min) 5 * 10 *** npff 15 -/- wt♂×wt♀ npff wt♂×npff
-/- ♂×wt♀ . 20 -/- npff ♀ The copyrightholderforthispreprint ** wt
*** -/- 25
E
Percentage of pairs in which spawning occurred100 20 40 60 80 ♂ :wt ♀ :wt Latency to the spawning (min) 2 2 1 1 spawning 0 5 0 5 0 0 5 0 Time to spawning(min) 5 * 10 *** npff 15 -/- wt♂×wt♀ npff wt♂×npff
-/- ♂×wt♀ 20 -/- ♀ npff
* wt *** -/- 25
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 2—figure supplement 1
A B 0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2 body weight (g) body weight (g) 0.1 0.1
0 0 ♂ : wt wt npff-/- ♂ : wt wt npff-/- ♀ : wt npff-/- wt ♀ : wt npff-/- wt A Figure 2—figuresupplement2 Courtship frequency (which wasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.It before spawning (/min) bioRxiv preprint 7 0 1 2 3 4 5 6 ♂ :wt wt ♀ : wt doi: https://doi.org/10.1101/2021.07.14.452327 npff ** -/- made availableundera npff wt -/-
CC-BY 4.0Internationallicense ; this versionpostedJuly14,2021. B Percentage of following with succeessful courtship (%) 1 2 4 6 8 0 0 0 0 0 0 0 ♀ : wt ♂ :wt wt . The copyrightholderforthispreprint npff * -/- npff wt -/-
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 3 A
following courtship clasping spawning
B C p = 0.05841 D E n.s. * * 25 25 25 25
20 20 20 20
15 15 15 15
10 10 10 10
5 5 5 5 Latency to the spawning (min) Latency to the 1st clasping (min) Latency to the 1st following (min) Latency to the 1st courtship (min) 0 0 0 0 -/- -/- -/- -/- ♂ : wt wt gnrh3-/- wt gnrh3-/-; ♂ : wt wt gnrh3 wt gnrh3 ; ♂ : wt wt gnrh3 wt gnrh3 ; ♂ : wt wt gnrh3-/- wt gnrh3-/-; -/- -/- npff-/- npff npff npff-/- -/- -/- -/- -/- ♀ : wt gnrh3-/- wt gnrh3-/-; wt ♀ : wt gnrh3 wt gnrh3 ; wt ♀ : wt gnrh3 wt gnrh3 ; wt ♀ : wt gnrh3-/- wt gnrh3-/-; wt -/- -/- npff-/- npff npff npff-/-
100 100 100 100
80 80 80 80
60 60 60 60
40 40 40 40
wt♂×wt♀ wt♂×wt♀ wt♂×wt♀ wt♂×wt♀ -/- -/- -/- -/- * 20 wt♂×gnrh3 ♀ 20 wt♂×gnrh3 ♀ 20 wt♂×gnrh3 ♀ 20 wt♂×gnrh3 ♀ * gnrh3-/-♂×wt♀ * gnrh3-/-♂×wt♀ gnrh3-/-♂×wt♀ gnrh3-/-♂×wt♀ wt♂×gnrh3-/-;npff-/-♀ wt♂×gnrh3-/-;npff-/-♀ wt♂×gnrh3-/-;npff-/-♀ wt♂×gnrh3-/-;npff-/-♀ gnrh3-/-;npff-/-♂×wt♀ gnrh3-/-;npff-/-♂×wt♀ gnrh3-/-;npff-/-♂×wt♀ gnrh3-/-;npff-/-♂×wt♀ 0 0 0 0 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 Percentage of pairs in which clasping occurred
Percentage of pairs in which following occurred Time to following (min) Time to courtship (min) Time to clasping (min) Time to spawning (min) Percentage of pairs in which spawning occurred Percentage of pairs in which courtship occurred bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 3—figure supplement 1
A B 0.5 * 0.5
0.4 0.4
0.3 0.3
0.2 0.2
body weight (g) 0.1 body weight (g) 0.1
0 0 ♂ : wt wt gnrh3-/- wt gnrh3-/-; ♂ : wt wt gnrh3-/- wt gnrh3-/-; npff-/- npff-/- ♀ : wt gnrh3-/- wt gnrh3-/-; wt ♀ : wt gnrh3-/- wt gnrh3-/-; wt npff-/- npff-/- bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 3—figure supplement 2
A B 6 n.s. 100 n.s.
5 80 4 60 3 40 2 20 Courtship frequency 1 before spawning (/min) Percentage of following
0 with successful courtship (%) 0 ♂ : wt wt gnrh3-/- wt gnrh3-/-; ♂ : wt wt gnrh3-/- wt gnrh3-/-; npff-/- npff-/- ♀ : wt gnrh3-/- wt gnrh3-/-; wt ♀ : wt gnrh3-/- wt gnrh3-/-; wt npff-/- npff-/- A
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
B bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 4—figure supplement 1
A TM I
TM II TM III TM IV
TM V
TM VI TM VII
B 29 Dog NPFFR1 12 Horse NPFFR1 48 Human NPFFR1 Cattle NPFFR1 100 Pig NPFFR1 56 90 Rat NPFFR1 100 Mouse NPFFR1 100 Oppossum GPR147 Chicken Rfrpr GPR147 (NPFFR1) 100 Quail Gnihr Zebrafish Gnihr1 Zebrafish Gnihr3 75 Zebrafish Gnihr2 81 Takifugu Rfrpr 92 100 Medaka Gpr147 99 Human GPR74 92 Cattle NPFFR2 99 Rat NPFFR2 Mouse GPR74 80 100 Opossum NPFFR2 Chicken Npffr2 88 Takifugu Npffr2-2 GPR74 (NPFFR2) 100 Medaka Gpr74-1 Zebrafish Npffr2-2 97 Zebrafish Npffr2-1 0.05 64 Takifugu Npffr2-1 97 98 Medaka Gpr74-2 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 4—figure supplement 2 A (FKN-induced) d d d
Gpr147 d Gpr74-1 Gpr74-2 pcDNA3.1+ e e e e
1.75 c 1.2 1.4 1.4 c c c u u u u d d d d n
n 1.50 n n 1.2 1.2 i i y
y 1.0 i i y y - t - t - t - t i i i i N v N v N v N v i i i i 1.25 t t 1.0 1.0 K K t t K K c c 0.8 c F c F F F
a
a
a a f
f
f f
1.00 c o
0.8 c
0.8 o c o c o
u
u u u l l
n 0.6 n l l n n - - - - o o o o 0.75 i i
0.6 0.6 E i E i t E t E t t i i i i R R R b R
b 0.4 b b i i i i C C
C 0.50 C h 0.4 h 0.4 h
h
n n n n i i i i
0.2
0.25 d 0.2 0.2 d d d l l l l o o o o F F F 0.0 F 0.0 0.00 0.0 FKN -13 -12 -11 -10 -9 -8 -7 -6 -5 FKN -13 -12 -11 -10 -9 -8 -7 -6 -5 FKN -13 -12 -11 -10 -9 -8 -7 -6 -5 FKN -13 -12 -11 -10 -9 -8 -7 -6 -5 only NPFF (log[M]) only NPFF (log[M]) only NPFF (log[M]) only NPFF (log[M]) B (CRE only) y y y y t t t t i i i i v v 25 v v 25 25 i i i i t t t 14 t c c c c a a a a
c 12 c 20 c c 20 20 u u u u l l l l - - - 10 - E E E E R R 15 R R 15 15 C 8 C C C
f f f f o o o o
6 10 10 10 n n n n o o o o i i i i t t t 4 t c c c c u u u 5 u 5 5 d d d 2 d n n n n i i i i
d d d d l l
0 l 0 l 0 0 o o o Vehicle -11 -10 -9 -8 -7 -6 -5 Vehicle -11 -10 -9 -8 -7 -6 -5 o Vehicle -11 -10 -9 -8 -7 -6 -5 Vehicle -11 -10 -9 -8 -7 -6 -5 F F F NPFF (log[M]) NPFF (log[M]) F NPFF (log[M]) NPFF (log[M]) bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 5—figure supplement 1
GnRHR4 100 mdGnRH 80 cGnRHII sGnRH
60
40
20
0 Percentage of SRE-luc activity (%)
-20 vehicle -13 -12 -11 -10 -9 -8 -7 -6 -5 Peptides (log[M]) bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/2021.07.14.452327; this version posted July 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
Figure 7
A Relative exp. of gnrh3 (/rps13) Relative exp. of npff (/rps13) wt * * gnrh3-/- * npff-/-
3 2.5 2 1.5 1 0.5 0 0 0.5 1 1.5 2 2.5 3
B
a wild type b gnrh3-/- c npff-/- d gnrh3-/-;npff-/-
GnRH3 NPFF GnRH3 NPFF GnRH3 NPFF GnRH3 NPFF
? ? ? ? ? ? ? ?
sexual behavior sexual behavior sexual behavior sexual behavior