DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2016/0237398 A1 Kalyuzhnaya Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2016/0237398 A1 Kalyuzhnaya Et Al US 2016O237398A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0237398 A1 Kalyuzhnaya et al. (43) Pub. Date: Aug. 18, 2016 (54) METHODS OF MICROBIAL PRODUCTION (86). PCT No.: PCT/US1.4f61304 OF EXCRETED PRODUCTS FROM S371 (c)(1) METHANE AND RELATED BACTERIAL (2) Date: Apr. 15, 2016 STRANS Related U.S. Application Data (71) Applicant: UNIVERSITY OF WASHINGTON THROUGHTS CENTERFOR (60) Eyal application No. 61/892,909, filed on Oct. COMMERCIALIZATION, Seattle, s WA (US) Publication Classification (72) Inventors: Marina Kalyuzhnaya, Seattle, WA (51) Int. Cl. (US); Mary E. Lidstrom, Seattle, WA CI2N I/20 (2006.01) (US) CI2P 7/02 (2006.01) CI2P 7/40 (2006.01) (52) U.S. Cl. (73) Assignee: UNIVERSITY OF WASHINGTON CPC. CI2N 1/20 (2013.01); C12P 7/40 (2013.01); THROUGHTS CENTERFOR CI2P 7/02 (2013.01) COMMERCIALIZATION, Seattle, WA (US) (57) ABSTRACT The present disclosure is directed to methods of producing (21) Appl. No.: 15/029,968 excreted products through the fermentation of methane with methanotrophs. In certain embodiments, the methods are per (22) PCT Fled: Oct. 20, 2014 formed at low oxygen levels. Patent Application Publication Aug. 18, 2016 Sheet 1 of 16 US 2016/0237398 A1 ########~## 3#######~## {######################$$$ ########## #######~###3 ######### ("~~~~q)+":"~~~~q) ####§§§ VI"OI) sess ex www.ww.wn M w.rwise-- s - 8 s es se Patent Application Publication Aug. 18, 2016 Sheet 2 of 16 US 2016/0237398 A1 i s w s s as: s s vex &x s iii) Patent Application Publication Aug. 18, 2016 Sheet 3 of 16 US 2016/0237398 A1 -- ... -- E --3 2 - S-- FF/EP -- E(R) i-- R-. -- -- Patent Application Publication Aug. 18, 2016 Sheet 4 of 16 US 2016/0237398 A1 -- -- B-2 2PG/3PG --3 s 8 68 s 4e Bi-- S. -- PRA E-3 s E. 66 s e 46 e FIG. 3 (cont.) Patent Application Publication Aug. 18, 2016 Sheet 5 of 16 US 2016/0237398 A1 is as is as social acao 8 S SS - - - & a is is is 8 s se sex s se s es ses Patent Application Publication Aug. 18, 2016 Sheet 6 of 16 US 2016/0237398 A1 Patent Application Publication Aug. 18, 2016 Sheet 11 of 16 US 2016/0237398 A1 ATGTCAATG-CAA CAGAATGAGCCA GTTC CATTAAATGAGCCACTTCA GGGTTAGAGCTTGAAGCTGATTGAGTCGAAATCCCCCCA (CATAAAAA GTTGAAAGGATGAGCGGTGACGATG-G-GTACGGCGA CGTCAT.G.A.A.A.A.A.A.G. GCECTAGGAAAACAGGGGAA CAAATTCAA CTCCACATA GGAAGAAATCAA TAAGAAATGTTGATSTCGATAGCCTCGGCTCGCCTTAGCCAGCTGAATCTACTAT GATGCCCAA GAAGCCGTA CAATGAGTGATCCA:CGAAA GCACAATTCCCGACCA AGTCGAACTGGGCGAACTATAAACGCTGGAATGGCCGTCCACCGCA CGCACCATGCCCAAAAAAGCCCCGCGCGGTGCGGGCATCCCAGA GATCAT AAAGCACTTAAAAAGCT(CCCA GT AATTACA FIG. 8 (cont.) Patent Application Publication Aug. 18, 2016 Sheet 13 of 16 US 2016/0237398 A1 G{CAA CCCACCACGAAGATGACAAACACAGGACGCACCCCGGC "ACA"TCOGCAC GCACACCGGAA. ACGCCGCA, CGGCAGCGAAGAC AACGAA CAATG{CCGCACGTCGGCTCACATCCC{CAA CTAG CAAC AGATTAGEAAACA, CGAAAAACARACCCCAAAAAACA: OCAAATC CTCCAAGGCAA CATTT GCCCCCGC AAAAATCCGGGAAC (CCAAACAAG GCCAA. A GAAA CGA CAAA (CECAFAC CGGAAGAAAAG CAT CACCACCGGACGTCATGACGACCAAATCCT CATTTGCACC ATCC AGCCAC, CCAACAA{{CCA, CGCTAAA (ACG (CGATTCAGGCCCCCAAA AAGCATCATCGTAATCCGA.GTCCGGGCAGTAAAAGACAGCGATATCACCCACCG ACCGA (CCGCACACCACC FIG. 9 (cont.) US 2016/0237398 A1 Aug. 18, 2016 METHODS OF MICROBAL PRODUCTION for single carbon (C1)-assimilation 12-14. The major bio OF EXCRETED PRODUCTS FROM chemical evidence that favored the EDD variant of the RuMP METHANE AND RELATED BACTERIAL cycle included relatively high activities of two key enzymes STRANS of the pathway (6-phosphogluconate dehydratase and 2-keto 3-deoxy-6-phosphogluconate aldolase) and multiple enzy CROSS-REFERENCE TO RELATED matic lesions in the Embden-Meyerhof-Parnas (EMP) path APPLICATIONS way 15-16. Activity of pyruvate kinase has not been detected previously in any gammaproteobacterial methan 0001. This application claims benefit under 35 U.S.C. otrophs 16-17. The presence of a reversible pyrophosphate S119(e) of U.S. Provisional Application No. 61/892,909 filed (PPi)-dependent phosphofructotransferase led to the conclu Oct. 18, 2013, the contents of which are incorporated herein sion that the EMP pathway represents a metabolic loop bal by reference in their entirety. ancing the level of glyceraldehyde-3-phosphate (GAP) and GOVERNMENT SUPPORT phosphoenolpyruvate (PEP) 16,18). This metabolic arrange ment has served as the foundation for theoretical character 0002 This invention was made with federal funding under ization of efficiency and yield of methane utilization 14-15. Grant Nos. MCB-0842686, awarded by the National Science However, the predicted maximum carbon conversion effi Foundation, and under DE-SC0005154, awarded by the ciency (39-47%) was considerably less than measured values Department of Energy. The U.S. government has certain (64-66.5%) 15, 19. rights in the invention. SUMMARY SEQUENCE LISTING 0008. The technology described herein is directed to 0003. The instant application contains a Sequence Listing methods and compositions relating to the fermentation of which has been submitted electronically in ASCII format and methane by methantrophic microorganisms, e.g., for the pro is hereby incorporated by reference in its entirety. Said ASCII duction of execreted products (e.g. organic acids and/or alco copy, created on Oct. 16, 2014, is named 034186-082620 hols). PCT SL.txt and is 30,731 bytes in size. 0009. In this work, multi-pronged systems-level approaches were used to reassess the metabolic functions for TECHNICAL FIELD methane utilization in a promising bacterial biocatalyst. We demonstrate that methane assimilation is coupled with a 0004. The technology described herein relates to the highly efficient pyrophosphate-mediated glycolytic pathway, microbial conversion of methane to, e.g., organic acids and/or which under O limitation participates in a novel form of alcohols. fermentation-based methanotrophy. This Surprising discov ery suggests a novel mode of methane utilization in O-lim BACKGROUND ited environments, and opens new opportunities for a modular 0005 Methane is an essential component of the global approach towards producing a variety of excreted chemical carbon cycle and one of the most powerful greenhouse gases, products using methane as a feedstock. yet it is also one of the most promising alternative sources of 0010. In one aspect, described herein is a method for pro carbon for biological production of chemicals of high added ducing at least one excreted product by microbial fermenta value. Aerobic methane-consuming bacteria (methanotro tion of a gaseous Substrate, comprising: (a) providing a gas phs) represent a potential biological platform for methane eous Substrate comprising CH4 and optionally, O, to a based biocatalysis. culture of at least one methanotrophic microorganism; and (b) 0006 Nature provides two alternative forms of methane as maintaining the microorganism under conditions suitable for a resource: natural gas, relatively abundant today but still a fermentationata dissolved O tension of between 0 and about nonrenewable fossil fuel, and renewable bio-gas, a byproduct 1% of saturation with air to produce at least one excreted of modern society that is often wasted 1-3. Interest in new product; or maintaining the microorganism under conditions technologies for effective conversion of flared/wasted suitable for fermentationata dissolved O, tension of between Sources of methane into chemical compounds, including 0 and about 40% of saturation with air and reducing respira next-generation fuels, continues to increase 4-6. The use of tion to produce at least one excreted product. In some microbial cells and enzymes as catalysts for methane conver embodiments, the methanotrophic microorganism can be a sion represents an appealing approach in this context 7-11. native methanotrophic microorganism. In some embodi The benefits of methane biotechnology include a self-sustain ments, reducing respiration can comprise contacting the able component, since any biomass generated could be used microorganism with an inhibitor of the electron transport as single cell protein or converted back to methane via anaero chain. In some embodiments, the inhibitor is antimycin A. bic digestion. However, besides single cell protein and poly 0011. In some embodiments, the methanotrophic micro hydroxybutyrate, exploitation of methane-based catalysis for organism can be engineered to comprise a downregulated the production of chemicals and fuels has not yet proven level of a gene selected from the group consisting of NAD Successful at the commercial level. reducing hydrogenase (MALCv4 1304 and 1307); acetate 0007 Gammaproteobacterial methanotrophs with the kinase (MALCv4 2853); lactate dehydrogenase (MALCV4 ribulose monophosphate (RuMP) pathway are among the 0534); acetate kinase (MALCV4 2853) and lactate dehydro most promising microbial systems for methane-based bio genase (MALCV4 0534); bacteriohemerythrin (MALCV4 technology. Reconstruction of the methane utilization net 2316); sucrose-phosphate synthase (MALCv4 0614); and work in these methanotrophs has been based on a number of sucrose-phosphate synthase (MALCV4 0614) and bacterio biochemical studies that pointed toward the Entner-Doudor hemerythrin (MALCV4 2316); a member of the cytochrome off (EDD)-variant of the RuMP pathway as the major route be complex (MALCv4 0634, MALCv4 0633, and US 2016/0237398 A1 Aug. 18, 2016 MALCV4 0632); a glycogen biosynthesis gene (MALCV4 for fermentation at a dissolved O tension of between 0 and 3502: MALCv4 3503; MALCv 3504: MALCv4 3505; about 40% of saturation with air to produce at least one MALCv 3506; MALCv4 3507,
Load more

Recommended publications
  • Evolution of Methanotrophy in the Beijerinckiaceae&Mdash
    The ISME Journal (2014) 8, 369–382 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE The (d)evolution of methanotrophy in the Beijerinckiaceae—a comparative genomics analysis Ivica Tamas1, Angela V Smirnova1, Zhiguo He1,2 and Peter F Dunfield1 1Department of Biological Sciences, University of Calgary, Calgary, Alberta, Canada and 2Department of Bioengineering, School of Minerals Processing and Bioengineering, Central South University, Changsha, Hunan, China The alphaproteobacterial family Beijerinckiaceae contains generalists that grow on a wide range of substrates, and specialists that grow only on methane and methanol. We investigated the evolution of this family by comparing the genomes of the generalist organotroph Beijerinckia indica, the facultative methanotroph Methylocella silvestris and the obligate methanotroph Methylocapsa acidiphila. Highly resolved phylogenetic construction based on universally conserved genes demonstrated that the Beijerinckiaceae forms a monophyletic cluster with the Methylocystaceae, the only other family of alphaproteobacterial methanotrophs. Phylogenetic analyses also demonstrated a vertical inheritance pattern of methanotrophy and methylotrophy genes within these families. Conversely, many lateral gene transfer (LGT) events were detected for genes encoding carbohydrate transport and metabolism, energy production and conversion, and transcriptional regulation in the genome of B. indica, suggesting that it has recently acquired these genes. A key difference between the generalist B. indica and its specialist methanotrophic relatives was an abundance of transporter elements, particularly periplasmic-binding proteins and major facilitator transporters. The most parsimonious scenario for the evolution of methanotrophy in the Alphaproteobacteria is that it occurred only once, when a methylotroph acquired methane monooxygenases (MMOs) via LGT.
    [Show full text]
  • Methanotrophic Bacterial Biomass As Potential Mineral Feed Ingredients for Animals
    International Journal of Environmental Research and Public Health Article Methanotrophic Bacterial Biomass as Potential Mineral Feed Ingredients for Animals Agnieszka Ku´zniar 1,*, Karolina Furtak 2 , Kinga Włodarczyk 1, Zofia St˛epniewska 1 and Agnieszka Woli ´nska 1 1 Department of Biochemistry and Environmental Chemistry, The John Paul II Catholic University of Lublin, Konstantynów St. 1 I, 20-708 Lublin, Poland 2 Department of Agriculture Microbiology, Institute of Soil Sciences and Plant Cultivation State Research Institute, Czartoryskich St. 8, 24-100 Puławy, Poland * Correspondence: [email protected]; Tel.: +48-81-454-5461 Received: 14 June 2019; Accepted: 23 July 2019; Published: 26 July 2019 Abstract: Microorganisms play an important role in animal nutrition, as they can be used as a source of food or feed. The aim of the study was to determine the nutritional elements and fatty acids contained in the biomass of methanotrophic bacteria. Four bacterial consortia composed of Methylocystis and Methylosinus originating from Sphagnum flexuosum (Sp1), S. magellanicum (Sp2), S. fallax II (Sp3), S. magellanicum IV (Sp4), and one composed of Methylocaldum, Methylosinus, and Methylocystis that originated from coalbed rock (Sk108) were studied. Nutritional elements were determined using the flame atomic absorption spectroscopy technique after a biomass mineralization stage, whereas the fatty acid content was analyzed with the GC technique. Additionally, the growth of biomass and dynamics of methane consumption were monitored. It was found that the methanotrophic biomass 1 contained high concentrations of K, Mg, and Fe, i.e., approx. 9.6–19.1, 2.2–7.6, and 2.4–6.6 g kg− , respectively.
    [Show full text]
  • Seasonal and Ecohydrological Regulation of Active Microbial Populations Involved in DOC, CO2, and CH4 fluxes in Temperate Rainforest Soil
    The ISME Journal https://doi.org/10.1038/s41396-018-0334-3 ARTICLE Seasonal and ecohydrological regulation of active microbial populations involved in DOC, CO2, and CH4 fluxes in temperate rainforest soil 1,2 2,3 1,2 4 5 David J. Levy-Booth ● Ian J. W. Giesbrecht ● Colleen T. E. Kellogg ● Thierry J. Heger ● David V. D’Amore ● 6 1 1 Patrick J. Keeling ● Steven J. Hallam ● William W. Mohn Received: 9 February 2018 / Revised: 12 October 2018 / Accepted: 3 December 2018 © The Author(s) 2019. This article is published with open access Abstract The Pacific coastal temperate rainforest (PCTR) is a global hot-spot for carbon cycling and export. Yet the influence of microorganisms on carbon cycling processes in PCTR soil is poorly characterized. We developed and tested a conceptual model of seasonal microbial carbon cycling in PCTR soil through integration of geochemistry, micro-meteorology, and eukaryotic and prokaryotic ribosomal amplicon (rRNA) sequencing from 216 soil DNA and RNA libraries. Soil moisture and pH increased during the wet season, with significant correlation to net CO2 flux in peat bog and net CH4 flux in bog 1234567890();,: 1234567890();,: forest soil. Fungal succession in these sites was characterized by the apparent turnover of Archaeorhizomycetes phylotypes accounting for 41% of ITS libraries. Anaerobic prokaryotes, including Syntrophobacteraceae and Methanomicrobia increased in rRNA libraries during the wet season. Putatively active populations of these phylotypes and their biogeochemical marker genes for sulfate and CH4 cycling, respectively, were positively correlated following rRNA and metatranscriptomic network analysis. The latter phylotype was positively correlated to CH4 fluxes (r = 0.46, p < 0.0001).
    [Show full text]
  • Denitrification and the Hypoxic Response in Obligate Aerobic Methane-Oxidizing Bacteria
    Denitrification and the hypoxic response in obligate aerobic methane-oxidizing bacteria By Kerim Dimitri Kits A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy In Microbiology and Biotechnology Department of Biological Sciences University of Alberta Kerim Dimitri Kits, 2016 Abstract Aerobic methanotrophic bacteria lessen the impact of the greenhouse gas methane (CH4) not only because they are a sink for atmospheric methane but also because they oxidize it before it is emitted to the atmospheric reservoir. Aerobic methanotrophs, unlike anaerobic methane oxidizing archaea, have a dual need for molecular oxygen (O2) for respiration and CH4 oxidation. Nevertheless, methanotrophs are highly abundant and active in environments that are extremely hypoxic and even anaerobic. While the O2 requirement in these organisms for CH4 oxidation is inflexible, recent genome sequencing efforts have uncovered the presence of putative denitrification genes in many aerobic methanotrophs. Being able to use two different terminal electron acceptors – hybrid respiration – would be massively advantageous to aerobic methanotrophs as it would allow them to halve their O2 requirement. But, the function of these genes that hint at an undiscovered respiratory anaerobic metabolism is unknown. Moreover, past work on pure cultures of aerobic methanotrophs ruled out the possibility that these organisms - denitrify. An organism that can couple CH4 oxidation to NO3 respiration so far does not exist in pure culture. So while the role of aerobic methanotrophs in the carbon cycle is appreciated, the hypoxic metabolism and contribution of these specialized microorganisms to the nitrogen cycle is not understood. Here we demonstrate using cultivation dependent approaches, microrespirometry, and whole genome, transcriptome, and proteome analysis that an aerobic - methanotroph – Methylomonas denitrificans FJG1 – couples CH4 oxidation to NO3 respiration - with N2O as the terminal product via the intermediates NO2 and NO.
    [Show full text]
  • Computational and Experimental Approaches for Evaluating the Genetic Basis of Mitochondrial Disorders
    Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Lieber, Daniel Solomon. 2013. Computational and Experimental Citation Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders. Doctoral dissertation, Harvard University. Accessed April 17, 2018 4:10:16 PM EDT Citable Link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11158264 This article was downloaded from Harvard University's DASH Terms of Use repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http://nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA (Article begins on next page) Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders A dissertation presented by Daniel Solomon Lieber to The Committee on Higher Degrees in Systems Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Systems Biology Harvard University Cambridge, Massachusetts April 2013 © 2013 - Daniel Solomon Lieber All rights reserved. Dissertation Adviser: Professor Vamsi K. Mootha Daniel Solomon Lieber Computational and Experimental Approaches For Evaluating the Genetic Basis of Mitochondrial Disorders Abstract Mitochondria are responsible for some of the cell’s most fundamental biological pathways and metabolic processes, including aerobic ATP production by the mitochondrial respiratory chain. In humans, mitochondrial dysfunction can lead to severe disorders of energy metabolism, which are collectively referred to as mitochondrial disorders and affect approximately 1:5,000 individuals. These disorders are clinically heterogeneous and can affect multiple organ systems, often within a single individual.
    [Show full text]
  • Phd Thesis F.M. Kerckhof: the Methanotrophic Interactome
    The methanotrophic interactome: Microbial partnerships for sustainable methane cycling ir. Frederiek-Maarten Kerckhof 1 Notation index Promotors: Prof. dr. ir. Nico Boon Department of Biochemical and Microbial Technology, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium. Dr. Kim Heylen Department of biochemistry and microbiology, Faculty of Sciences, Ghent University, Ghent, Belgium. Members of the examination committee: Prof. dr. ir. Koen Dewettinck (Chairman) Laboratory of food technology and engineering, Faculty of bioscience engineering, Ghent University, Gent, Belgium Prof. dr. ir. Diederik Rousseau (Secretary) Laboratory of industrial water- and ecotechnology, Faculty of bioscience engineering, Ghent University, Kortrijk, Belgium Prof. dr. ir. Pascal Boeckx ISOFYS, Faculty of bioscience engineering, Ghent University, Gent, Belgium Prof. dr. Paul De Vos Laboratory of microbiology (LM-Ugent), Faculty of sciences, Ghent University, Ghent, Belgium Dr. Paul Bodelier Department of microbial ecology, Netherlands institute of ecology (NIOO-KNAW), Wageningen, The Netherlands Dr. Hannah Marchant Department of biogeochemistry, Max-Planck Institute (MPI) for Marine Microbiology, Bremen, Germany Dean Faculty of Bioscience Engineering Prof. dr. ir. Marc van Meirvenne Rector Ghent University Prof. dr. Anne De Paepe 2 The methanotrophic interactome: Microbial partnerships for sustainable methane cycling ir. Frederiek-Maarten Kerckhof Thesis submitted in fulfilment of the requirements for the degree of Doctor (Ph.D.) in Applied Biological Sciences 3 Notation index Titel van het doctoraat in het Nederlands: Het methanotroof interactoom: microbiële relaties voor een duurzame methaancyclus. Cover illustration by Tim Lacoere (www.timternet.be) “Sustainable interactomes” Chapter illustrations by Maarten Van Praet (www.maartenisdemax.be) Please refer to this work as: Kerckhof F.M. (2016). The methanotrophic interactome: microbial partnerships for sustainable methane cycling.
    [Show full text]
  • Metabolic Features of Aerobic Methanotrophs: News and Views Valentina N
    Metabolic Features of Aerobic Methanotrophs: News and Views Valentina N. Khmelenina*, Sergey Y. But, Olga N. Rozova and Yuri A. Trotsenko G.K. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, Russia. *Correspondence: [email protected] htps://doi.org/10.21775/cimb.033.085 Abstract halotolerant representatives are especially Tis review is focused on recent studies of carbon promising for industrial applications, as they are metabolism in aerobic methanotrophs that spe- genetically tractable due to the availability of a cifcally addressed the properties, distribution and variety of genetic manipulation tools (Kalyuzh- phylogeny of some of the key enzymes involved naya et al., 2015; Mustakhimov et al., 2015; Fu and in assimilation of carbon from methane. Tese Lidstrom, 2017; Garg et al., 2018). Te adaptation include enzymes involved in sugar synthesis and of halo- and thermotolerant methanotrophs to cleavage, conversion of intermediates of the tricar- extreme environmental conditions includes the boxylic acid cycle, as well as in osmoadaptation in acquisition of the specifc mechanisms for syn- halotolerant methanotrophs. thesis and reutilization of the compatible solutes. Tis review focuses on the recent studies of carbon metabolism in three model species of the aerobic Introduction methanotrophs Methylomicrobium alcaliphilum Methanotrophs inhabit a variety of ecosystems 20Z, Methylosinus trichosporium OB3b, and Methy- including soils, fresh and marine waters and sedi- lococcus capsulatus Bath. ments, saline and alkaline lakes, hot springs, rice paddies, peatlands, and tissues of higher organisms. Tey play a major role in both global carbon and The carbon assimilation global nitrogen cycles (Hanson and Hanson, 1996; pathways McDonald et al., 2008, Etwig et al., 2010; Khadem Methanotrophs obtain energy for growth pre- et al., 2010).
    [Show full text]
  • A New Cell Morphotype Among Methane Oxidizers: a Spiral-Shaped Obligately Microaerophilic Methanotroph from Northern Low-Oxygen Environments
    The ISME Journal (2016) 10, 2734–2743 © 2016 International Society for Microbial Ecology All rights reserved 1751-7362/16 www.nature.com/ismej ORIGINAL ARTICLE A new cell morphotype among methane oxidizers: a spiral-shaped obligately microaerophilic methanotroph from northern low-oxygen environments Olga V Danilova1, Natalia E Suzina2, Jodie Van De Kamp3, Mette M Svenning4, Levente Bodrossy3 and Svetlana N Dedysh1 1Winogradsky Institute of Microbiology, Research Center of Biotechnology of the Russian Academy of Sciences, Moscow, Russia; 2G.K. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, Moscow Region, Russia; 3CSIRO Oceans and Atmosphere, Hobart, Tasmania, Australia and 4UiT The Arctic University of Norway, Department of Arctic and Marine Biology, Tromsø, Norway Although representatives with spiral-shaped cells are described for many functional groups of bacteria, this cell morphotype has never been observed among methanotrophs. Here, we show that spiral-shaped methanotrophic bacteria do exist in nature but elude isolation by conventional approaches due to the preference for growth under micro-oxic conditions. The helical cell shape may enable rapid motility of these bacteria in water-saturated, heterogeneous environments with high microbial biofilm content, therefore offering an advantage of fast cell positioning under desired high methane/low oxygen conditions. The pmoA genes encoding a subunit of particulate methane monooxygenase from these methanotrophs form a new genus-level lineage within the family Methylococcaceae, type Ib methanotrophs. Application of a pmoA-based microarray detected these bacteria in a variety of high-latitude freshwater environments including wetlands and lake sediments. As revealed by the environmental pmoA distribution analysis, type Ib methanotrophs tend to live very near the methane source, where oxygen is scarce.
    [Show full text]
  • Genome-Scale Metabolic Reconstruction and Metabolic Versatility of an Obligate Methanotroph Methylococcus Capsulatus Str. Bath
    bioRxiv preprint doi: https://doi.org/10.1101/349191; this version posted June 18, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Genome-scale metabolic reconstruction and metabolic versatility of 2 an obligate methanotroph Methylococcus capsulatus str. Bath 3 4 Authors : Ankit Gupta1†, Ahmad Ahmad2†, Dipesh Chothwe1†, Midhun K. Madhu1, 5 Shireesh Srivastava2*, Vineet K. Sharma1* 6 7 Affiliation 8 1 Indian Institute of Science Education and Research, Bhopal, Madhya Pradesh, INDIA 9 2 International Centre For Genetic Engineering And Biotechnology, New Delhi, INDIA 10 †These authors have contributed equally to this work 11 *Corresponding Authors 12 13 Correspondence to be addressed: 14 Dr. Vineet K. Sharma 15 Address: IISER Bhopal, Bhopal By-Pass Road, Bhauri, Bhopal, Madhya Pradesh - 462066, 16 INDIA 17 Telephone: +91-755-6691401 18 Email-id: [email protected] 19 20 Dr. Shireesh Srivastava, Systems Biology for Biofuels Group, ICGEB Campus, Aruna Asaf 21 Ali Marg, New Delhi 110067 22 Telephone: +91-11-26741361 x 450 23 Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/349191; this version posted June 18, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 24 Abstract 25 The increase in greenhouse gases with high global warming potential such as methane is a 26 matter of concern and requires multifaceted efforts to reduce its emission and increase its 27 mitigation from the environment.
    [Show full text]
  • Diversity and Habitat Preferences of Cultivated and Uncultivated Aerobic Methanotrophic Bacteria Evaluated Based on Pmoa As Molecular Marker
    REVIEW published: 15 December 2015 doi: 10.3389/fmicb.2015.01346 Diversity and Habitat Preferences of Cultivated and Uncultivated Aerobic Methanotrophic Bacteria Evaluated Based on pmoA as Molecular Marker Claudia Knief* Institute of Crop Science and Resource Conservation – Molecular Biology of the Rhizosphere, University of Bonn, Bonn, Germany Methane-oxidizing bacteria are characterized by their capability to grow on methane as sole source of carbon and energy. Cultivation-dependent and -independent methods have revealed that this functional guild of bacteria comprises a substantial diversity of organisms. In particular the use of cultivation-independent methods targeting a subunit of the particulate methane monooxygenase (pmoA) as functional marker for the detection of Edited by: aerobic methanotrophs has resulted in thousands of sequences representing “unknown Svetlana N. Dedysh, methanotrophic bacteria.” This limits data interpretation due to restricted information Winogradsky Institute of Microbiology, Russia Academy of Science, Russia about these uncultured methanotrophs. A few groups of uncultivated methanotrophs Reviewed by: are assumed to play important roles in methane oxidation in specific habitats, while Marc Gregory Dumont, the biology behind other sequence clusters remains still largely unknown. The discovery University of Southampton, UK of evolutionary related monooxygenases in non-methanotrophic bacteria and of pmoA Levente Bodrossy, CSIRO Ocean and Atmosphere, paralogs in methanotrophs requires that sequence clusters of uncultivated organisms Australia have to be interpreted with care. This review article describes the present diversity Paul Bodelier, Netherlands Institute of Ecology, of cultivated and uncultivated aerobic methanotrophic bacteria based on pmoA gene Netherlands sequence diversity. It summarizes current knowledge about cultivated and major clusters *Correspondence: of uncultivated methanotrophic bacteria and evaluates habitat specificity of these Claudia Knief bacteria at different levels of taxonomic resolution.
    [Show full text]
  • Contribution of Genome Characteristics to Assessment of Taxonomy of Obligate Methanotrophs J
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Apr. 1991, p. 301-305 Vol. 41, No. 2 0020-7713/91/020301-05$02.00/0 Copyright 0 1991, International Union of Microbiological Societies Contribution of Genome Characteristics to Assessment of Taxonomy of Obligate Methanotrophs J. P. BOWMAN,” L. I. SLY, AND A. C. HAYWARD Department of Microbiology, University of Queensland, Brisbane, Queensland, Australia 4072 The DNAs of a variety of obligate methanotrophic bacteria were analyzed for base composition and nucleotide distribution. Genome molecular weights were determined for representative strains. Similarity ‘\, maps attained by plotting DNA base composition versus nucleotide distribution and genome molecular weight showed that related species formed distinct clusters. Group I methanotrophs were found to form three clusters in both nucleotide distribution and genome size analyses. The first cluster consisted of five Methylomonas species, Methylomonas methanica, Methylomonas fodinarum, Methylomonas aurantiaca, “Methylomonas ru- bra,” and “Methylomonas agile.” The other clusters included both Methylomonas species and Methylococcus species, indicating the heterogeneity within these genera. One cluster contained low-G+ C-content Methylo- coccus strains and included Methylococcus whittenburyi, Methylococcus bovis, Methylococcus vinelandii, Methylococcus luteus, and ‘4Methylococcus ucrainicus. ” The type strains of Methylomonas pelagica and “Methylomonas alba” and a marine methanotrophic strain also clustered with the low-G+C-content Methylococcus
    [Show full text]
  • Cultivation of Methanotrophic Bacteria in Opposing Gradients of Methane and Oxygen Ingeborg Bussmann, Monali Rahalkar & Bernhard Schink
    Cultivation of methanotrophic bacteria in opposing gradients of methane and oxygen Ingeborg Bussmann, Monali Rahalkar & Bernhard Schink LS Mikrobielle O¨ kologie, Fachbereich Biologie, Universitat¨ Konstanz, Konstanz, Germany Correspondence: Ingeborg Bussmann, LS Abstract Mikrobielle O¨ kologie, Fachbereich Biologie, Universitat¨ Konstanz, Fach M 654, 78457 In sediments, methane-oxidizing bacteria live in opposing gradients of methane Konstanz, Germany. Tel.: 149 7531 883249; and oxygen. In such a gradient system, the fluxes of methane and oxygen are fax: 149 7531 884047; e-mail: controlled by diffusion and consumption rates, and the rate-limiting substrate is [email protected] maintained at a minimum concentration at the layer of consumption. Opposing gradients of methane and oxygen were mimicked in a specific cultivation set-up in Received 6 July 2005; revised 31 October 2005; which growth of methanotrophic bacteria occurred as a sharp band at either c.5or accepted 6 November 2005. 20 mm below the air-exposed end. Two new strains of methanotrophic bacteria First published online 24 January 2006. were isolated with this system. One isolate, strain LC 1, belonged to the Methylomonas genus (type I methantroph) and contained soluble methane doi:10.1111/j.1574-6941.2006.00076.x mono-oxygenase. Another isolate, strain LC 2, was related to the Methylobacter Editor: Gary King group (type I methantroph), as determined by 16S rRNA gene and pmoA sequence similarities. However, the partial pmoA sequence was only 86% related to cultured Keywords Methylobacter species. This strain accumulated significant amounts of formalde- freshwater sediment; gradient cultivation; Lake hyde in conventional cultivation with methane and oxygen, which may explain Constance; methanotrophs; Methylobacter ; why it is preferentially enriched in a gradient cultivation system.
    [Show full text]