Involvement of the Aphthovirus RNA Region Located Between the Two Functional Augs in Start Codon Selection

Virology 255, 324–336 (1999) Article ID viro.1999.9598, available online at http://www.idealibrary.com on

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Involvement of the Aphthovirus RNA Region Located between the Two Functional AUGs in Start Codon Selection

Sonia Lo´pez de Quinto and Encarnacio´n Martı´nez-Salas1

Centro de Biologı´a Molecular “Severo Ochoa,” Consejo Superior de Investigaciones Cientı´ficas- Universidad Auto´noma de Madrid, Cantoblanco 28049 Madrid, Spain Received September 10, 1998; returned to author for revision November 2, 1998; accepted January 7, 1999

Initiation of translation in picornavirus RNAs occurs internally, mediated by an element termed internal ribosome entry site (IRES). In the aphthovirus RNA, the IRES element directs translation initiation at two in-frame AUGs separated by 84 nucleotides. We have found that bicistronic constructs that contained the IRES element followed by the fragment including the aphthovirus start codons in front of the second gene mimicked the translation initiation pattern of viral RNA observed in infected cells. In those constructs, the frequency of initiation at the first AUG was increased by a sequence context that resembled the favorable consensus for cap-dependent translation, although initiation at the second site was always preferred. In addition, we have found that initiation at the second start codon was not diminished under conditions in which the first initiation codon was blocked by antisense oligonucleotide interference. Interestingly, mutations that positioned the second AUG out-of-frame with the first AUG did not interfere with the frequency of initiation at the second one. On the contrary, IRES-dependent translation initiation in bicistronic constructs lacking the sequences present between functional AUGs in the viral RNA was sensitive to the presence of out-of-frame initiator codons and hairpins in the spacer region. This remarkable difference in start codon recognition was due to the nucleotide composition of the RNA that separated the IRES from the initiator codon. Thus our results indicate that the region located in the aphthovirus RNA between functional AUGs is involved in start codon recognition, strongly favoring selection of the second start AUG as the main initiator codon. © 1999 Academic Press

INTRODUCTION tions in all the cases. For example, in foot-and-mouth disease virus (FMDV), the sole member of the aphthovi- Ј The 5 noncoding region of picornavirus RNAs con- rus group, this stretch contains the highest concentration tains an element that directs internal initiation of trans- of genetic heterogeneity within the IRES (Escarmı´s et al., lation, known as the internal ribosome entry site (IRES), 1992). whose structure is essential to the determination of ac- Initiation of translation can occur at more than one tivity (reviewed in Hellen and Wimmer, 1995; Jackson and start codon in some picornaviruses. The best example of Kaminski, 1995). According to their secondary structure, two functional start codons is FMDV, which contains two the picornavirus IRES are classified into three groups: in-frame AUGs separated by 84 nt (Beck et al., 1983). type I includes enteroviruses and rhinoviruses; type II, Both start codons are functional, and thus two forms of cardioviruses and aphthoviruses; and type III, hepatovi- the L protein (Lab and Lb) are found during infection ruses. The conservation of primary sequence within the (Sangar et al., 1987). The amino acid sequence of the IRES elements of the Picornaviridae family is poor with N-terminus in Lab is highly variable, suggesting that this the exception of a polypyrimidine tract (PolyY) (Ku¨hn et part of the L protein is not essential, which is in agree- Ј al., 1990; Pilipenko et al., 1992) close to the 3 border of ment with the finding that Lb and Lab do not differ in the IRES. In type I, the stretch that separates the PolyY proteolytic activity and specificity (Medina et al., 1993). from the authentic initiator codon is larger than that in the Interestingly, the presence of the AUG that corresponds other types, and it has been considered as an spacer. In to the second initiation codon, but not the first one, is contrast, in type II the sequences required for IRES essential for viral replication (Cao et al., 1995). Two activity extend to the vicinity of the functional start codon functional start codons have been also reported in other (Hellen and Wimmer, 1995; Jackson and Kaminski, 1995). picornavirus containing type II and III IRES elements The nucleotide (nt) stretch located between the PolyY (Kaminski et al., 1994; Kong and Roos, 1991; Tesar et al., and the functional start codon accepts many substitu- 1992). Recently, it has been shown that IRES-driven translation in modified hepatitis A virus cDNAs can initiate efficiently at two start codons separated by 66–78 nt 1 To whom reprint requests should be addressed. Fax: 34-91- (Zhang and Kaplan, 1998). 3974799. E-mail: [email protected]. Studies of the effect of size and sequence changes of

0042-6822/99 $30.00 Copyright © 1999 by Academic Press 324 All rights of reproduction in any form reserved. FMDV IRES-DRIVEN TRANSLATION 325 the spacer region located between the 3Ј border of the zone, we studied the parameters influencing start codon IRES and the functional start codon have allowed the recognition in constructs that contain the IRES and initi- definition of the parameters that influence start codon ator codons positioned as in the FMDV RNA. We show selection. Thus in poliovirus, in which the functional AUG here that bicistronic constructs with the IRES region is located at position 743 although the entry site is in extended to the second AUG mimic the pattern of trans- front of a cryptic AUG, revertants of defective mutants lation initiation found during FMDV infections, providing originated by insertion or linker scanner mutagenesis a useful tool to study start codon recognition. Using either restored the correct spacing or created a new these constructs, we observed that the frequency of AUG at the right distance (Pilipenko et al., 1992; Haller initiation at the first functional codon depends on its and Semler, 1992). A model in which a starting window sequence context, but that initiation at the second start defines the site where the ribosome starts translation or codon is always preferred. In addition, we show that a scanning process depending on the presence of a start initiation at the second start codon is not diminished codon with a good sequence context was proposed for under conditions where the first start codon is blocked TheilerЈs murine encephalomyelitis virus (Pilipenko et by antisense interference or in frameshift mutants that al., 1994). The 11th AUG of encephalomyocarditis virus positioned the second AUG out-of-frame with the first (EMCV) is the functional one, and the actual entry site is one. located very close to this start codon (Jackson and Ka- minski, 1995). Deletions between the IRES element and RESULTS the authentic AUG result in the use of the 12th AUG. In Bicistronic constructs with the IRES region extended contrast, initiation at the 10th AUG occurs only if an IRES to the second AUG mimic the pattern of translation element is absent (Kaminski et al., 1994). The sequence initiation found in FMDV infections context of the 11th AUG codon in EMCV modulates its use efficiency, requiring an A at Ϫ3 position (Davies and Translation of the FMDV polyprotein starts at two in- Kaufman, 1992). Furthermore, a poor sequence context at frame AUG codons separated by 84 nt and is directed by AUG 11th results in increased initiation at the next AUG. an IRES element that spans from nt Ϫ1toϪ465, relative Conserved sequences adjacent to the initiation codon to the A of the first initiator AUG. The relative use of each are also important for hepatitis C virus (HCV) IRES func- AUG is dependent on the viral strain. We have observed tion, probably due to their role in RNA-ribosome complex that certain viral isolates, such as VR100, showed an stabilization (Pestova et al., 1998). However, initiation of increased frequency of initiation at the first AUG, relative translation does not seem to involve scanning in HCV to the parental strain, C-S8c1 (Fig. 1A). Thus although IRES-promoted translation (Rijnbrand et al., 1996, 1997). ϳ90% of the C-S8c1 RNA molecules were translated to Concerning the FMDV IRES, which has been reported produce the short form of the L protein (Lb) rather than to be one of the most efficient elements (Borman et al., the large one (Lab), the situation in VR100 was close to 1997; Ramesh et al., 1996), the parameters influencing 50%. The sequences of C-S8c1 and VR100 RNA differ by recognition frequency of initiator codons are still under ϳ1% of their nt composition, with substitutions distrib- study. Translation initiation of FMDV RNA is directed by uted all along the genome (Dıéz et al., 1990). In this an IRES element that is located several hundred of nt regard, differences in mobility of Lb from C-S8c1 and downstream from the 5Ј end of the RNA, spanning from VR100 could be attributed to amino acid changes found nt Ϫ1toϪ465, relative to the A of the first functional AUG in the Lb protein (Dıéz, 1990). in the viral RNA (Ku¨hn et al., 1990). This highly structured With the aim of understanding the parameters affect- cis-acting element efficiently promotes cap-independent ing start codon selection in those RNA variants, we internal initiation of translation in bicistronic constructs analyzed the pattern of IRES-dependent translation initi- (Belsham and Brangwyn, 1990; Martıńez-Salas et al., ation in bicistronic RNAs of the form CAT-IRES-luciferase, 1993), provided that essential structural motifs, e.g., the which included the 84 nt of the viral RNA located be- double-stranded structure at the base of domain 3, or the tween the IRES region and the second functional AUG. GNRA motif at a distal loop of this domain, are not For this purpose, we prepared the bicistronic constructs perturbed (Lo´pez de Quinto and Martıńez-Salas, 1997; p⌬lucC and p⌬lucR, in which truncated forms of the Martıńez-Salas et al., 1996). luciferase gene could be initiated at any of the two FMDV We have recently shown that bicistronic constructs start codons directed by their respective IRES (Fig. 1B). containing hairpins and/or out-of-frame AUGs in the After the transfection of BHK-21 cells, the mobility of the spacer region that separated the 3Ј border of the FMDV two polypeptides of 149 and 121 amino acids was pre- IRES from the initiator codon reduce translation effi- cisely detected. To correct for transfection efficiency, CAT ciency of the second cistron (Lo´pez de Quinto and Mar- protein was determined in all the extracts. Derivatives of tıńez-Salas, 1998). With the aim of determining whether the parental C-S8c1 viral RNA p⌬lucC translated its RNA this conclusion also applied to bicistronic RNAs that predominantly from the second start codon, whereas resembled the viral RNA in their translation initiation derivatives of the VR100 virus p⌬lucR used both AUGs 326 LO´ PEZ de QUINTO AND MARTIŃEZ-SALAS

FIG. 1. Pattern of translation initiation in different FMDV isolates. (A) Autoradiogram of a 15% SDS–acrylamide gel loaded with immunoprecipitated 35S-methionine-labeled L proteins synthesized during the course of an infection of BHK-21 cells with the FMDV strains indicated at the top of each lane. (B) Diagram of the construction of the plasmid p⌬lucC. CAT stands for chloramphenicol-acetyl transferase, the first cistron of the bicistronic RNA. The striped rectangle represents the 467 nt that conform the IRES, whereas the black rectangle corresponds to the first 84 nt of the FMDV polyprotein including the two start codons, named 1st and 2nd. The number of residues of the polypeptide encoded by the second unit of the bicistronic RNA, depending on the translation initiation codon used, is indicated. (C) Autoradiogram of a 15% SDS-polyacrylamide gel loaded with immunoprecipitated extracts of ϳ1 ϫ 10635S-methionine-labeled BHK-21 cells, infected with vTF7-3 vaccinia virus and transfected with the plasmids indicated at the top of each lane. No DNA correspond to the mock-transfected cells. Arrows indicate the position of polypeptides initiated at the first or the second functional start codon, as well as the CAT protein.

(Fig. 1C). Thus translation initiation in these bicistronic 2A). To determine the contribution of the nt present at constructs mimicked the pattern observed with the viral position ϩ4 to start codon selection, we generated the RNAs during the course of an infection (see Fig. 1A). substitutions indicated in Fig. 2A and analyzed their effect on AUG recognition in vivo, in combination with the The frequency of initiation at the first FMDV two substitutions previously found at position Ϫ15. In functional codon depends on its sequence context, each case, CAT translation efficiency was used as an but initiation at the second start codon is always internal control of each transfection assay. Comparison preferred of the pattern of initiation in the group of mutants that ⌬ ⌬ changed the sequence at position ϩ4 while maintaining Sequence analysis of p lucC and p lucR constructs, Ϫ ϩ ⌬ as well as their respective parental viral RNAs, revealed that of positions 15 and 23 found in p lucC and ⌬ four substitutions in the 551-nt region that contains the p lucR revealed that in vivo, there was an increase in the IRES and the functional AUGs (Fig. 1B). Defining the A of frequency of initiation at the first start codon when a G ϩ the first functional AUG as position ϩ1, two of these was present at 4 (Fig. 2B). These data were fully con- ⌬ substitutions are present at positions Ϫ376 and Ϫ15. To sistent with the pattern of initiation observed in p lucC ⌬ determine whether the mutation present in the upstream and p lucR constructs (Fig. 1C), carrying the sequence region of the IRES that was previously shown to affect of the viral isolates. In addition, we observed that the ϩ IRES efficiency (Martı´nez-Salas et al., 1993) was partici- presence ofaUatposition 4 exerted a strong negative pating in the shift in start codon use observed in the effect, reducing significantly the frequency of initiation in VR100 RNA, we exchanged fragments of the plasmids vivo at the first initiator AUG, whereas A and C residues containing the mutation affecting Ϫ376 position. Be- at this position had an intermediate effect. cause construct p⌬lucC/Ϫ376R behaved as p⌬lucC and Finally, to assess the contribution of the residue construct p⌬lucR/Ϫ376C behaved as p⌬lucR (Fig. 1C), present at position ϩ23 to the observed shift in start we concluded that this position is not involved in the codon recognition, we substituted the U present in selection of translation start codon. p⌬lucC to G and the C residue present in p⌬lucR to U, G, In addition to the substitution of A to G at position Ϫ15 or A. The results obtained were consistent with a main located in the 3Ј border of the PolyY, sequence changes effect of the residue present at ϩ4, and therefore, they of A to G at position ϩ4 and of U to C at position ϩ23 have been presented together (Fig. 2B). were present in p⌬lucC and p⌬lucR, respectively (Fig. Densitometric analysis of the data from at least three FMDV IRES-DRIVEN TRANSLATION 327

FIG. 2. Effect of sequence context of the first start codon on the frequency of IRES-dependent translation initiation. (A) Summary of the nt differences in constructs p⌬lucC and p⌬lucR close to the first AUG and the changes introduced by site-directed mutagenesis at positions ϩ4 and ϩ23. (B) Autoradiogram of a 16.5% SDS-polyacrylamide gel loaded with immunoprecipitated extracts of ϳ1 ϫ 10635S-methionine-labeled BHK-21 cells transfected with plasmids producing RNAs with the nt indicated at the top at positions Ϫ15, ϩ4, and ϩ23. Arrows indicate the position of the truncated luciferase forms initiated at the first and second functional AUGs, in addition to the CAT protein. (C) Relative frequency of initiation at the first IRES-dependent start codon. For each mutant, the percentage of the intensity of the polypeptide initiated at the first AUG has been made relative to the sum of the intensity of polypeptides initiated at the first plus the second initiator AUG, which was defined as 100%. The average from at least three independent experiments are plotted in decreasing order of initiation efficiency at the first site. Error bars correspond to the S.E.M. Sequence present in p⌬lucC and p⌬lucR constructs at positions Ϫ15, ϩ4, and ϩ23 has been indicated with C and R capital letters, respectively. (D) Average frequency of initiation at the second IRES-dependent site. Results from at least three independent experiments were normalized to the intensity of the polypeptide initiated at the second functional AUG in the construct p⌬lucC, included in all the experiments, which was defined as 100%. The reference RNA contains the nt A at position Ϫ15,Aatϩ4, and U at ϩ23, as outlined in a rectangle. For consistency, mutants have been ordered as in C. independent experiments reinforced our conclusions. tained the same residue at Ϫ15 and ϩ4 while changing When the frequency of initiation at the first functional the sequence at ϩ23 indicated that the residue present AUG was calculated relative to the total initiation events at the latter position may contribute to some extent to the at both AUGs, mutant sequences readily grouped around recognition of the first AUG. Thus constructs withaGat the nt present at ϩ4, showing a decreasing gradient ϩ4, which displayed the highest frequency of initiation of when the G was changed to A, C, and U (Fig. 2C). the first codon, containedaCoraGatϩ23. However, a Therefore, the nt present at ϩ4 position was a key factor U at this position was correlated with a decrease in the in determining recognition of the first functional start recognition frequency of the first AUG (Fig. 2C). codon as an initiation site. From these data, we also concluded that initiation at In addition, the results of the densitometric analysis the second functional AUG was always preferred. Even suggested that the nt at position Ϫ15 may modulate the in the best favorable context for the first start codon, its effect of ϩ4. In mutants havingaGoranAatposition frequency of initiation never reached the 50% value of the ϩ4, in most of the casesaGatϪ15 had a more positive total of first plus second AUGs (Fig. 2C). It is interesting influence on the frequency of initiation at the first start to note that the average frequency of initiation at the codon than an A at the same position. On the other hand, second start AUG, normalized to the value observed for data corresponding to the group of mutants that con- p⌬lucC in each experiment, varied from 74% to 115%, at 328 LO´ PEZ de QUINTO AND MARTI´NEZ-SALAS

the most (Fig. 2D), indicating that none of the changes observed in the frequency of initiation at the first AUG interfered strongly with the recognition of the second start codon.

Inhibition of initiation at the first FMDV functional codon does not interfere with initiation at the second functional AUG The results shown above raised the question of whether recognition of the second AUG was somehow dependent on the accessibility of the first start codon to the translation machinery. Antisense oligodeoxynucleotides (ODNs) form stable hybrid molecules that block biological processes such as translation (Le Tine´vez et al., 1998; Wakita and Wands, 1994). We used this ap- proach to examine their effect on translation initiation driven by the FMDV IRES element at both functional AUG codons. Thus in vitro transcribed bicistronic RNAs encoding the truncated forms of luciferase that could be initiated at any of the two FMDV start codons were used to program in vitro translation reactions in reticulocyte lysates. The use of this in vitro system has the advantage that we can control the ratio of antisense ODN to RNA in the reaction. A representative example of the results FIG. 3. Effect of antisense oligonucleotides targeted to each initiator obtained using a 1:20 molar ratio of RNA to ODN is AUG on the frequency of initiation. Autoradiogram of a 16.5% SDS- ␮ shown in Fig. 3. As observed in the lanes that do not polyacrylamide gel loaded with immunoprecipitated products of 10 l of the in vitro translation reactions programmed with the RNA tran- have any ODN added, the pattern of initiation at each scripts indicated at the top, which have been annealed to a 20-fold AUG in both types of transcripts reproduced the results molar excess of the ODN indicated on each lane. ATG1 and ATG2 observed in vivo (compare with Figs. 1 and 2). ODNs are complementary to the first and second initiation codons, Statistical analysis of the results from several indepen- respectively; ATG-R contains a randomized sequence of ATG2; PolyY is dent experiments showed that the addition of an anti- complementary to the PolyY of the FMDV IRES. The bottom panel shows the intensity of the CAT polypeptide present in 5 ␮lofthe sense ODN complementary to the first initiator AUG corresponding crude extracts. Arrows indicate the position of the rel- (ATG1) decreased the frequency of initiation at this start evant polypeptides. The quantitative analysis of the relative frequency codon in both constructs, p⌬lucC and p⌬lucR (Fig. 3). of initiation at each AUG modified by the presence of the ODNs added The addition of an antisense ODN complementary to the to the in vitro translation reaction (mean Ϯ S.E.M.) is shown in the second start site (ATG2) decreased the frequency of bottom. Data from at least three independent experiments, quantified in a PhosphorImager, were normalized to the intensity of the CAT initiation at the second initiator AUG, in agreement with polypeptide of each lane and made relative to the intensity of the previous results (Gutie´rrez et al., 1993, 1994). Antisense polypeptide bands initiated at the first or second AUG in the absence block of the second initiator AUG also reduced the in- of any ODN added to the reaction. tensity of the polypeptide band initiated at the first AUG (Fig. 3), suggesting interference with progression of the using a sequence ladder to identify the length of cleav- polypeptide chain initiated at the first start AUG. In con- age products. As shown in Fig. 4A, ATG1, ATG2, and trast to the constant inhibitory effect of ODNs ATG1 and PolyY ODNs formed hybrid molecules that constituted ATG2, the modifications observed in the pattern of initi- substrates for RNase H cleavage at positions consistent ation with a control ODN that contained a randomized with the formation of the predicted antisense-sense hy- sequence of the second start AUG (ATG-R) varied up and brid. No differential pattern was observed for the ATG-R down 1.5- to 2-fold. In addition, an ODN complementary ODN between ϩRNase H and ϪRNase H, even in over- to the PolyY was not inhibitory. exposed films. To correlate the observed inhibitory effect with anneal- The observation that antisense block of the first initi- ing of ODNs to the RNA used for translation, identifica- ator AUG did not diminish the frequency of initiation at tion of the hybrid position in the target RNA was required. the second functional AUG (Fig. 3) suggested that rec- To this end, 32P-labeled transcripts annealed to each of ognition of the second start codon was independent of the ODNs used in the in vitro translation assay were the accessibility of the first AUG to the translation ma- treated with commercial RNase H. Samples were then chinery. To test the possibility that the initiation observed run in denaturing gels to compare patterns of mobility, at the second AUG was due to 5Ј end-dependent initia- FMDV IRES-DRIVEN TRANSLATION 329

moved two or three positions. However, no differential pattern was observed in the case of ATG-R and PolyY ODNs. Furthermore, undetectable amounts of the labeled transcript is substrate of other RNases activities, as deduced from the intensity of the larger bands of the transcript.

Initiation at the second functional AUG in vivo is independent of the second AUG being out-of-frame with the first one Due to the strong bias to initiate at the second AUG, we tested whether positioning of both AUGs in-frame was a requisite to initiate translation correctly. To this end, we assayed constructs p⌬lucC-⌬ and p⌬lucR-⌬, which contained a deletion of 1 nt at residues ϩ22 or ϩ23 respectively, positioning the second AUG out-of- frame with the first one (Fig. 5A). As a result of these frameshift mutations, two stop codons are now present in-frame with the first functional AUG, at codons 11 and 17. Transfection of these constructs in BHK-21 cells, in parallel to their respective parental DNAs, indicated that the frequency of initiation at the second AUG was not decreased in RNAs that contained the second AUG out- of-frame with the first one (Fig. 5B). Furthermore, analysis of data from three independent experiments showed that initiation at the second start codon was 129% in constructs ⌬lucC-⌬ and 118% in ⌬lucR-⌬, relative to their respective parental constructs (Fig. 5C). Therefore, these FIG. 4. (A) Mapping of RNA-ODN hybrid. Representative example of results indicated that recognition of the second AUG as a 6% acrylamide denaturing gel loaded with an aliquot corresponding to ϳ7000 cpm/lane, showing an RNase H cleavage analysis of the the main initiator codon was independent of whether the indicated ODNs annealed to 32P-labeled transcript, prepared from second functional AUG is in-frame with the first one. p⌬lucR plasmid. Arrows depict the position of the preferred cleavage Interestingly, the viral RNA sequence between AUGs sites, as indicated by a DNA sequence run in parallel. (B) Transcript 32 adopts a stem-loop conformation with an energy of stability in in vitro translation assays. Pattern of P-labeled transcript Ϫ12.6 kcal/mol according to computer folding predic- annealed to ODNs, incubated for the time (min) indicated at the top. A 6% acrylamide denaturing gel gel was loaded with an aliquot corre- tions, but translation initiation at the second AUG in sponding to ϳ28,000 cpm/lane. p⌬lucC and p⌬lucR was not interfered. The overall secondary structure is maintained in p⌬lucC-⌬ (Fig. 6) and p⌬lucR-⌬ constructs, although the energy of these struc- tion caused by an RNase H cleavage of RNA-ATG1 hy- tures is slightly modified. Similarly, the substitutions in- brid molecules, we determined the stability of the tran- troduced in positions ϩ4 and ϩ23 by site-directed mu- scripts in the mixture of reticulocytes. Thus RNA was tagenesis do not modify this structure to a significant incubated in the presence or absence of the correspond- extent (data not shown) and led to energy increments ing ODN for 0 and 15 min with the reticulocyte mixture, between ϩ1.6 to Ϫ0.1 kcal/mol. under the same conditions used for in vitro translation. Results described above are in contrast to those ob- After extraction of the RNA, the samples were loaded served in bicistronic constructs lacking the viral RNA onto denaturing acrylamide gels to analyze the pattern of region present between both functional start codons. mobility (Fig. 4B). As observed in the lane with no ODN Transcription from T7 or Tk promoter in pBIC plasmid added, after 15 min of incubation at 30°C, transcript yields a bicistronic RNA of the form CAT-IRES-luciferase molecules retained the mobility observed in the samples (Martı´nez-Salas et al., 1993). In this vector, the authentic incubated for 0 min. Quantification of the results indi- initiator codon of the luciferase gene is preceded by 35 cated that only 3–4% of the total RNA was processed by nt of its own untranslated region (Fig. 7A). Derivatives of an endogenous RNase H activity in the case of ATG1 and pBIC containing out-of-frame AUGs and/or stable hair- ATG2 (2.9% and 4.3%, respectively). Relative to the pat- pins between the 3Ј end of the FMDV IRES and the tern obtained with commercial RNase H, preferred cleav- luciferase initiator codon showed a strong reduction in age position in the reticulocyte RNase H activity is the luciferase translation efficiency (Lo´pez de Quinto and 330 LO´ PEZ de QUINTO AND MARTI´NEZ-SALAS

FIG. 5. Effect of frameshift mutations on the initiation at the second functional AUG. (A) Nucleotide sequence of mutants bearing a deletion of 1 nt (open arrow) at positions ϩ22 and ϩ23 in p⌬lucC and p⌬lucR constructs, respectively, that resulted in the presence of UAA codons (underlined) at positions ϩ31 and ϩ49 in both cases. The out-of-frame start codons (lowercase) as well as all initiator AUGs and the PolyY in front of the second AUG are underlined. The parental constructs have been included for completeness. (B) Autoradiogram of a representative example of a 16.5% SDS-polyacrylamide gel loaded with immunoprecipitated extracts of ϳ1 ϫ 10635S-methionine-labeled BHK-21 cells transfected with plasmid indicated at the top of each lane. (C) Average frequency of initiation at the second AUG. Results from three independent experiments were normalized to the intensity of the polypeptide initiated at the second functional AUG in the parental constructs p⌬lucC, and p⌬lucR, which were defined as 100% on each case.

Martıńez-Salas, 1998). To confirm these striking differ- akin of the situation found in vivo (compare with Fig. 5, ences, we performed in vitro translation assays pro- and see Lo´pez de Quinto and Martıńez-Salas, 1998). grammed with RNAs derived from these two different The presence of a stable hairpin with internal energy types of bicistronic constructs. As expected from the of Ϫ71.6 kcal/mol (construct pBIC-6X, Fig. 7A) was highly results obtained previously in vivo, luciferase translation deleterious for correct initiation at the luciferase start from bicistronic transcripts prepared from construct codon in vitro, leading to a reduction of luciferase ex- pBIC-1N, which contains one AUG out-of-frame with the pression of 95% (Fig. 7B), in agreement with the obser- luciferase initiator codon (Fig. 7A), was strongly dimin- vations found in vivo (Lo´pez de Quinto and Martıńez- ished relative to the RNA derived from the plasmid pBIC Salas, 1998). Taken together, these results allowed us to (Fig. 7B), leading to a reduction of luciferase expression conclude that the viral RNA region present between the of 92%. However, relative to their control constructs, two functional AUGs in the aphthovirus RNA is involved translation initiation at the second AUG in p⌬lucC-⌬ and in start codon recognition, strongly favoring selection of p⌬lucR-⌬ was barely affected by the presence of the the second AUG. out-of-frame AUG (Fig. 7C). Statistical analysis of the results from four independent experiments revealed that DISCUSSION initiation at the second IRES-dependent AUG was 71% in Distinct FMDV viral isolates initiate translation with p⌬lucC-⌬ and 59% in p⌬lucR-⌬, relative to their respec- different frequencies at each of the two in-frame func- tive in-frame parental constructs. Cap-dependent trans- tional start codons separated by 84 nt. We show here lation in these RNAs was monitored by the intensity of that this pattern of initiation was mimicked by artificial the CAT polypeptide, which was used to normalize the RNAs containing the IRES region fused to the viral region reticulocyte lysate activity between assays. The pattern present between functional start codons in front of the of IRES-driven translation initiation observed in vitro is second cistron. Thus RNA produced from the construct FMDV IRES-DRIVEN TRANSLATION 331

FIG. 6. Secondary structure of the FMDV RNA stretch including the functional AUGs. Predictions of secondary structure were obtained with the M-Fold program and the Squiggles output of the University of Wisconsin package. Both functional AUGs are boxed. An arrow depicts the nt deleted in p⌬lucC-⌬. p⌬lucR initiated at the first initiator AUG more frequently clear effect of ϩ4 position on start codon recognition is than that transcribed from p⌬lucC, as did their parental reminiscent of the scanning model proposed for cap- viral RNAs. Therefore, these bicistronic constructs con- dependent translation (Grunert and Jackson, 1994; stitute a suitable tool to study the parameters that influ- Kozak, 1987, 1997). In contrast, the strong preference for ence start codon selection in the context of the viral RNA initiation at the second functional AUG even in the pres- in the absence of infection. ence of frameshift mutations was an argument against it. In this report, we have shown that the modified fre- This observation is particularly relevant in the case of the quency of initiation at the first start codon was a direct p⌬lucR-⌬ construct because the first AUG in p⌬lucR is effect of sequence context because in vitro generated used close to 50%. Scanning of the ribosome through the substitutions that incorporated a G residue at the posi- RNA after entry was proposed on the basis that two tion ϩ4 always initiated at the first site more frequently additional AUGs inserted in-frame with the natural FMDV than those having A, C, or U. However, in constructs that start codons in the presence of the IRES induced a contained the first AUG out-of-frame with the second reduction in the expression of the downstream gene functional AUG, the latter is as efficiently recognized as (Belsham, 1992). However, also in this case, there was a in constructs with both AUGs in frame. These observa- bias toward the utilization of the second natural initiator tions are consistent with the fact that IRES-dependent AUG of FMDV that was now the fourth start codon. initiation at the second FMDV functional AUG was pre- Antisense ODNs complementary to either the first or ferred to the first start codon, independently of the con- the second start AUG efficiently blocked translation ini- text of the first initiator AUG. tiation from their respective target codons. According to Different models for AUG selection were compatible the scanning model, the prediction is that preventing with the results shown in this report. The finding of a translation from the first codon should affect initiation 332 LO´ PEZ de QUINTO AND MARTI´NEZ-SALAS

FIG. 7. Comparison of the effect of out-of-frame mutations in constructs that do or do not contain the FMDV region found between functional start codons in in vitro translation assays. (A) Sequence of the spacer region between the 3Ј end of the IRES and the start codon of the luciferase gene in pBIC. Relative to pBIC, pBIC-1N and pBIC-6X contain one out-of-frame AUG (underlined) provided by insertion of one NcoI linker and a stable hairpin provided by the insertion of six XbaI linkers (brackets), respectively (Lo´pez de Quinto and Martıńez-Salas, 1998). (B) Autoradiogram of a 12% SDS-polyacrylamide gel loaded with 5 ␮lofthein vitro translation reactions programmed with the RNA transcripts indicated at the top. The bottom panel shows the intensity of the CAT polypeptide present in the same crude extracts. (C) Autoradiogram of a 16.5% SDS-polyacrylamide gel loaded with immunoprecipitated products of 10 ␮lofthein vitro translation reactions programmed with the RNA transcripts indicated at the top. The bottom panel shows the intensity of the CAT polypeptide present in 5 ␮l of the corresponding crude extracts. Arrows indicate the position of the relevant polypeptides. from the second one. On the other hand, if direct recog- ples of ODNs that are not inhibitory despite their ability to nition of the initiator codon is occurring, translation from hybridize with HCV IRES transcripts (Wakita and Wands, the second start codon is expected to be independent of 1994). In fact, only 6% of ODNs used in the literature are the presence of a block at the first site. Remarkably, we efficient inhibitors (Tu et al., 1998). Binding affinity has have observed that antisense interference of the first site been correlated with biological activity of antisense did not decrease the frequency of initiation at the second ODNs (Lima et al., 1997). Conversely, potent ODNs tar- one, suggesting that initiation at the second AUG is geted to the translation initiation codon do not promote independent of the recognition of the first AUG. RNase H-dependent degradation (Tu et al., 1998). The limited amount of RNase H activity exhibited by Altogether, our results are compatible either with a the reticulocytes mixture used in the translation assay is leaky scanning process or with the existence of two not sufficient to explain the observed use of AUG2 during alternative entry sites for each FMDV start codon. Under ODN ATG1 inhibition of translation. Fewer than 5% of the regular circumstances, the first AUG is mostly bypassed, transcript molecules are cleaved in RNA-ATG1 or RNA- and only a favorable context increases its use. The use ATG2 hybrid molecules. Furthermore, trimming of the of the second start codon when the first site is inhibited RNA-PolyY ODN hybrid molecule may lead to recognition by an antisense ODN as well as the lack of reduction of of a cryptic AUG present at Ϫ8 position (Figs. 6 and 7A). initiation at the second AUG in the frameshift mutants, This would lead to a decrease in initiation at the first p⌬lucC-⌬ and p⌬lucR-⌬, favors the existence of a sec- functional AUG, a result that was not observed (Fig. 3). At ond entry site. In this regard, substitutions of the PolyY present, we do not know why the PolyY ODN is not CTTTTCCT (Fig. 5A) present 19 nt in front of the second inhibitory. Several possibilities, including lack of hybrid AUG to purines led to the expression of short polypep- formation or displacement by protein binding, could ac- tides originated from incorrect initiation sites (Cao et al., count for this effect. From experiments shown in Fig 4A, 1995). it is evident that this ODN hybridizes with its target at the Compared with other IRES-dependent translation ini- appropriate position. In agreement with the results ob- tiation, including those of EMCV and HCV (Kaminski et tained using the PolyY ODN, there are reported exam- al., 1994; Pestova et al., 1998; Rijnbrand et al., 1996) that FMDV IRES-DRIVEN TRANSLATION 333 share some of the FMDV functional characteristics, the TABLE 1 FMDV initiation sites seems to have peculiar properties. Oligonucleotide Sequences Although the FMDV IRES extends up to the first initiation site (Ku¨hn et al., 1990), this one is not normally used Primer Nucleotide sequence (5Ј–3Ј)a Orientation unless its sequence context is made favorable, as shown here. Furthermore, the fact that initiation at the second ATG2 GTTTTTGTCAACTTCCATTTTTCCTGC Antisense NR4b CACGAGCTCAGCAGGTTTCC Sense functional AUG in vivo is independent of whether the EcoRVluc CCACCTGATATCCTTTGTATTTAA Antisense second AUG is out-of-frame with the first one, together ATGluc GGAAAAATGGAAGGTTGACAAAAAC Sense with the result that inhibition of initiation at the first start ClaIluc GGGTGTTTGTAACAATATCGATTCC Antisense codon in vitro did not interfere with initiation at the DEG4,23 GNATACAACTGACTGTTTTANCGC Antisense second functional AUG, suggests that the second AUG is ATG1 CAGTCAGTTGTATTCATAGGGTC Antisense PolyY TGTAAAGGAAAGGGTGCCGAC Antisense the main IRES-dependent initiator codon. In agreement with our results, FMDV cDNA mutants that had the first a N indicates A, C, G, or T. Oligonucleotides were synthesized by AUG mutated were viable but not those that contained Isogen Bioscience bv (Amsterdam, The Netherlands). mutations to nonstarter codons in the second functional b Primer NR4 was described previously (Martıńez-Salas et al., 1996). AUG (Cao et al., 1995). Using bicistronic constructs devoid of the 84- nt region present downstream of the aphthovirus IRES, we have between the FMDV functional AUGs is not simply an recently shown that IRES-dependent translation initiation spacer in respect to IRES-driven translation initiation. In was sensitive to the presence of out-of-frame AUGs or this regard, the first indication of a direct involvement of hairpin structures in close proximity to the 3Ј end of the these sequences in the selection of start codon came FMDV IRES in vivo (Lo´pez de Quinto and Martıńez-Salas, from the observation that their presence was required to 1998) and in vitro (present report). On the contrary, as reproduce the pattern of translation initiation found in the shown here, in constructs that contained the FMDV 84 nt viral RNA. Therefore, on the basis of the different behav- region, neither the presence of out-of-frame AUGs nor ior shown by bicistronic constructs that did or did not the secondary structure of this viral region reduced the contain the viral sequences present between functional ability of the translation machinery to recognize the sec- AUGs, we conclude that the 84-nt region located down- ond AUG as the main IRES-dependent initiator codon. stream of the aphthovirus IRES contains sequences ac- Comparison of the sequences present in these two types tively involved in the recognition of the second AUG as of constructs (compare pBIC and p⌬lucC in Figs. 5A and the authentic FMDV initiator codon. 7A) reveals that the PolyY present in p⌬lucC is absent in pBIC. Although the distance of the initiator AUG is 35 nt MATERIALS AND METHODS in one case and 1 and 84 in the other, it has been shown Plasmid constructions that the distance per se is not essential because a spacer of 95 nt in the derivative pBIC-D (Lo´pez de Quinto On transcription, the constructs used in this study and Martıńez-Salas, 1998) was tolerated for IRES-depen- produce bicistronic RNAs of the form CAT-IRES-lucif- dent translation initiation. As shown by the mutants de- erase, in which translation initiation of the CAT gene is scribed in Fig. 2, a short distance to the IRES border (1 nt) cap dependent, whereas initiation of luciferase is IRES is not a limitation to see initiation at the first AUG but, dependent. The plasmids p⌬lucC and p⌬lucR, which rather, an effect of consensus sequence around the first encode a truncated form of the luciferase protein, were initiator codon. Furthermore, a stop codon in-frame with prepared in two steps. First, the IRES region of FMDV the first AUG in p⌬lucR-⌬ or p⌬lucC-⌬ in front of the was extended to the second translation start codon of second functional FMDV AUG did not interfere with ini- the viral RNA and fused to the luciferase start codon, tiation at the second AUG. Conversely, in the construct using a PCR procedure (Higuchi et al., 1988). Briefly, pBIC-1N (Fig. 7A), a stop codon in-frame with the first C-S8c1 and VR100 RNAs (Dıéz et al., 1990) were sub- initiator AUG (the additional out-of-frame AUG) just in jected to reverse transcription followed by PCR amplifi- front of the authentic luciferase initiator codon did not cation as described (Martıńez-Salas et al., 1993), using abolish inhibition of translation. This observation also the primers ATG2 and NR4 (see Table 1 for all primers). applied to constructs pBIC-2N, pBIC-3N, and pBIC-4N In parallel, most of the luciferase coding region from (Lo´pez de Quinto and Martıńez-Salas, 1998). Therefore, plasmid pBIC (Martıńez-Salas et al., 1993) was PCR am- what is important to direct initiation at the second FMDV plified with primers EcoRVluc and ATGluc. About 0.2 AUG is the 84-nt region, not the presence of a stop codon pmol of each PCR product was mixed and annealed by in-frame with the first start codon in p⌬lucC-⌬ or their complementary ends present in ATG2 and ATGluc p⌬lucR-⌬. primers. Then, a second PCR round was performed us- The comparative results obtained with these con- ing NR4 and EcoRVluc primers. The reaction products, structs indicated that the viral RNA segment present digested with SacI and EcoRV, were ligated to the large 334 LO´ PEZ de QUINTO AND MARTIŃEZ-SALAS fragment of plasmid pBIC digested with the same en- mingo, 1995). Crude extracts from transfected cells were zymes, yielding plasmids pFMDlucC and pFMDlucR. diluted 2-fold in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 Second, the 1292-bp XbaI-EcoRV luciferase fragment mM NaCl, 1% Triton X-100, 0.1% SDS, 1% NaDOC) and from pFMDlucC and pFMDlucR was deleted by consec- allowed to bind for4hat4°Ctocomplexes of protein utive digestion with EcoRV and HindIII (yielding two frag- A–Sepharose CL-4B with sera, preformed during a mini- ments of 1431 and 5048 bp) followed by XbaI digestion of mumof4hat4°C. Four washes with RIPA and 1 wash with the 1.4-kb fragment. The resulting HindIII-XbaI fragment TBS (20 mM Tris-HCl, pH 7.5, 140 mM NaCl) were carried of 192 bp was ligated via its HindIII end to the corre- out before the addition of disruption buffer (50 mM Tris-HCl, sponding 5-kb EcoRV–HindIII fragment. One-end ligation pH 6.8, 12% glycerol, 0.1% bromophenol blue, 2% ␤-mercap- products were then blunt-ended and religated. Plasmids toethanol, and 4% SDS). Immunoprecipitated complexes p⌬lucC/Ϫ376R and p⌬lucR/Ϫ376C were prepared by were separated by electrophoresis in 16.5% SDS-polyacryl- exchanging the 610-bp NcoI-HindIII fragments of p⌬lucC amide gels run on Tricine buffer (Shagger and von Jagow, and p⌬lucR, respectively. Before expression analysis, the 1987). When indicated, CAT protein was determined by sequence of the entire length of each region under study immunoprecipitation with an anti-CAT antibody (5 Prime 3 was obtained using Sequenase or Thermosequenase Prime). Translation products were quantified using a Mo- (Amersham Life Sciences). lecular Dynamics densitometer or an IP Eraser BAS, Fuji- The region around the first AUG in the bicistronic film, PhosphorImager. At least three independent experi- constructs p⌬lucC and p⌬lucR was subjected to site- ments, which always included the control p⌬lucC to nor- specific mutagenesis by PCR as described (Martıńez- malize the data within experiments, were used for Salas et al., 1996). The sequences of external primers statistical analysis. CAT protein intensity as well as CAT NR4 and ClaIluc and mutagenic oligonucleotide activity, determined as described (Martıńez-Salas et al., DEG4,23 are given in Table 1. The products of the second 1993), was parallel to the initiation at the second FMDV PCR were digested with HindIII and ClaI, purified by AUGinp⌬lucC and its derivatives. agarose gel electrophoresis, and ligated to the large fragment of p⌬lucC and p⌬lucR, similarly digested, to In vitro translation and antisense block of initiation produce the constructs with the sequence described in codons ⌬ ⌬ ⌬ ⌬ Fig. 2. The sequence of mutants p lucC- and p lucR- , Before in vitro transcription with T7 RNA polymerase ϩ which contain a deletion of 1 residue at positions 22 (New England Biolabs) to produce bicistronic transcripts ϩ and 23, respectively, is shown in Fig. 5A. encoding CAT and the truncated or full-length forms of luciferase, all plasmids (p⌬lucC and pBIC derivatives) Infection and transient expression assays were linearized with HpaI. In vitro translation of nucle- 35 ase-treated reticulocyte lysates (Promega) were pro- BHK-21 cells were infected with FMDV and S-methi- ␮ onine radiolabeled as described (Martıńez-Salas and grammed with 0.5 g of the desired RNA, previously heated at 70°C during 5 min, and translated during1hat Domingo, 1995). Immunoprecipitation of the L polypep- ␮ tides was carried out with a rabbit polyclonal anti-L sera, 30°C, in 25 l of 50% reticulocyte lysate in the presence ␮ 35 kindly provided by Dr. E. Beck. Immunoprecipitated com- of 25 Ci of [ S]methionine. When indicated, the oligonucleotides ATG1, ATG2, and ATG-R (kindly provided by plexes were separated in 15% SDS-acrylamide gels run Dr. F. Sobrino) and PolyY (sequences given in Table 1) on Tris-glycine buffer. were mixed with the template RNA at 1:20 molar ratio BHK-21 monolayers 80–90% confluent were infected before heating at 70°C. Truncated forms of luciferase with the vaccinia virus recombinant vTF7-3 (Fuerst et al., were immunoprecipitated to eliminate endogenous 1986) when transcription from the T7 promoter was de- translation backgrounds, whereas CAT and the full- sired at 1 h before transfection with the relevant plasmid. length form of luciferase were directly detected in the Liposome-mediated transfection (Rose et al., 1991) was translation reaction. Translation products were treated carried out as described (Lo´pez de Quinto and Martıńez- with 50 ␮g/ml RNase A, mixed with disruption buffer, and Salas, 1997). Soluble extracts were prepared by lysing electrophoresed through 16.5% SDS-acrylamide gels run the cells in 0.5% Nonidet P-40, 120 mM NaCl, and 50 mM on Tricine buffer. To quantify the data, the intensity of Tris-HCl, pH 7.8, followed by centrifugation at 12,000 rpm polypeptide bands initiated at the first or the second start for 5 min in a microfuge. When required, transfected codons, determined as indicated above, were made rel- BHK-21 cells were radiolabeled 20 h after transfection, ative to the intensity of the CAT polypeptide obtained in duringa3hpulse, with 100 ␮Ci of [35S]methionine (1190 the same extract. Ci/mmol TRAN35S-label; ICN Biochemicals). Cells were kept for1hinmethionine-free medium before labeling. RNA–ODN hybrid mapping. A rabbit polyclonal anti-luciferase serum (Cortex) was used to immunoprecipitate the truncated forms of lucif- The 32P-labeled transcripts were prepared in vitro us- erase basically as described (Martıńez-Salas and Do- ing T7 polymerase and [␣-32P]CTP (Amersham Life Sci- FMDV IRES-DRIVEN TRANSLATION 335 ences) from ClaI-linearized p⌬lucC or p⌬lucR plasmids Dıéz, J. (1990). PhD dissertation. Universidad Autońoma de Madrid. to produce transcripts of 2012 nt. After denaturation for 2 Dıéz, J., Da´vila, M., Escarmı´s, C., Mateu, M. G., Domıńguez, J., Pe´rez, min at 90°C, ϳ14,000 cpm corresponding to 25 ng of J. J., Giralt, E., Melero, J. A., and Domingo, E. (1990). Unique amino 32 acid substitutions in the capsid proteins of foot-and-mouth disease P-labeled transcripts was annealed to each of the virus from a persistent infection in cell culture. J. Virol. 64, 5519–5528. ODNs at a molar ratio of 1:20 (as in the translation assay) Escarmı´s, C., Toja, M., Medina, M., and Domingo, E. (1992). Modifica- tions of the 5Ј untranslated region of foot-and-mouth disease virus in 20 mM Tris-HCl, pH 7.5, 100 mM KCl, 10 mM MgCl2,0.1 mM DTT, and 5% (w/v) sucrose, and subsequently incu- after prolonged persistence in cell culture. Virus Res. 26, 113–125. bated with 0.3 unit of RNase H (GIBCO BRL) during 15 Fuerst, T. R., Niles, E. G., Studier, F. W., and Moss, B. (1986). Eukaryotic ␮ transient expression system based on recombinant vaccinia virus min in a final volume of 20 l. After phenol extraction, the that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. resulting products were resolved in 6% acrylamide de- Acad. Sci. USA 83, 8122–8126. naturing gels, run in parallel to a known sequence. The Grunert, S., and Jackson, R. J. (1994). The immediate downstream codon predicted cleavage site of RNA-ODN hybrid will be strongly influences the efficiency of utilization of eukaryotic transla- around positions 60–85 (ATG2), 145–170 (ATG1), and tion initiation codons. EMBO J. 15, 3618–3630. Ј Gutie´rrez, A., Martıńez-Salas, E., Pintado, B., and Sobrino, F. (1994). 175–195 (PolyY) from the 3 end of the labeled transcript. Specific inhibition of aphthovirus infection by RNAs transcribed from both 5Ј and 3Ј noncoding regions. J. Virol. 68, 7426–7432. Transcript stability Gutie´rrez, A., Rodrı´guez, A., Pintado, B., and Sobrino, F. (1993). Transient inhibition of foot-and-mouth disease virus infection of BHK-21 cells 32 ϳ The P-labeled RNA (250 ng, 140,000 cpm), in the by antisense oligonucleotides directed against the second functional presence or absence of the indicated ODN at a molar initiator AUG. Antiviral Res. 22, 1–13. ratio of 1:20, was incubated with the reticulocytes mix- Haller, A. A., and Semler, B. L. (1992). Linker scanning mutagenesis of ture under the same conditions used for in vitro transla- the internal ribosome entry site of poliovirus RNA. J. Virol. 66, 5075– 5086. tion. After an incubation at 30°C for 0 and 15 min, sam- Hellen, C. V. T., and Wimmer, E. (1995). Translation of encephalomyo- ples were diluted in 10 mM Tris, pH 7.5, 1 mM EDTA, and carditis virus RNA by internal ribosome entry. Curr. Top. Microbiol. 0.1% SDS, and the RNA was extracted using 5 volumes of Immunol. 203, 31–63. guanidine thiocyanate-phenol using Tripure reagent Higuchi, R., Krummel, B., and Saiki, R. K. (1988). A general method of in (Boehringer-Mannheim). Aliquots of extracted RNA were vitro preparation and specific mutagenesis of DNA fragments: Study of protein and DNA interactions. Nucleic Acid Res. 16, 7351–7368. loaded in 6% denaturing acrylamide gels in parallel to a Jackson, R. J., and Kaminski, A. (1995). Internal initiation of translation in DNA sequence. eukaryotes: The picornavirus paradigm and beyond. RNA 1, 985– 1000. ACKNOWLEDGMENTS Kaminski, A., Belsham, G. J., and Jackson, R. J. (1994). Translation of encephalomyocarditis virus RNA: Parameters influencing the selec- We are grateful to E. Beck for providing the anti-L sera, to E. Domingo tion of the internal initiation site. EMBO J. 13, 1673–1681. in whose laboratory the immunoprecipitation of the L polypeptides from Kong, W.-P., and Roos, R. P. (1991). Alternative translation initiation site infected cells was performed, and to F. Sobrino for the gift of ATG-R in the DA strain of TheilerЈs murine encephalomyelitis virus. J. Virol. ODN. We thank C. Gutie´rrez and J. P. Garcıá-Ruiz for their continuous 65, 3395–3399. support and encouragement. We also thank C. Gutie´rrez for helpful Kozak, M. (1987). An analysis of 5Ј-noncoding sequences upstream suggestions on the manuscript. This work was supported by grants from 699 vertebrate messenger RNAs. Nucleic Acid Res. 15, 8125– PM95-0001 from DGES and 08.2/0024/97 from CAM and by an Institu- 8148. tional grant from Fundacioń Ramoń Areces. Kozak, M. (1997). Recognition of AUG and alternative initiator codons is augmented by G in position ϩ4 but is not generally affected by the REFERENCES nucleotides in positions ϩ5 and ϩ6. EMBO J. 16, 2482–2492. Ku¨hn, R., Luz, N., and Beck, E. (1990). Functional analysis of the internal Beck, E., Forss, S., Strebel, K., Cattaneo R., and Feil, G. (1983). Structure translation initiation site of foot-and-mouth disease virus. J. Virol. 64, of the FMDV translation initiation site and of the structural proteins. 4625–4631. Nucleic Acid Res. 11, 7873–7885. Le Tine´vez, R., Mishra, R. K., and Toulme´, J. J. (1998). Selective inhibition Belsham, G. J. (1992). Dual initiation sites of protein synthesis on of cell-free translation by oligonucleotides targeted to an mRNA foot-and-mouth disease virus RNA are selected following internal hairpin structure. Nucleic Acids Res. 26, 2273–2278. entry and scanning of ribosomes in vivo. EMBO J. 11, 1105–1110. Lima, W. F., Brown-Driver, V., Fox, M., Hanecak, R., and Bruice, T. W Belsham, G. J., and Brangwyn, J. K. (1990). A region of the 5Ј noncoding (1997). Combinatorial screening and rational optimization for hybrid- region of foot-and-mouth disease virus RNA directs efficient internal ization to folded hepatitis C virus RNA of oligonucleotides with initiation of protein synthesis within cells: Involvement with the role biological antisense activity. J. Biol. Chem. 272, 626–638. of L protease in translational control. J. Virol. 64, 5389–5395. Lo´pez de Quinto, S., and Martıńez-Salas, E. (1997). Conserved struc- Borman, A. M., Le Mercier, P., Girard, M., and Kean, K. M. (1997). tural motifs located in distal loops of the aphthovirus internal ribo- Comparison of picornaviral IRES-driven internal initiation of transla- some entry site domain 3 are required for internal initiation of tion in cultured cells of different origins. Nucleic Acid Res. 25, translation. J. Virol. 71, 4171–4175. 925–932. Lo´pez de Quinto, S., and Martıńez-Salas, E. (1998). Parameters influ- Cao, X., Bergman, I. E., Fu¨llkrug, R., and Beck, E. (1995). Functional encing translational efficiency in aphthovirus IRES-based bicistronic analysis of the two alternative translation initiation sites of foot-and- expression vectors. Gene 217, 51–56. mouth disease virus. J. Virol. 69, 560–563. Martıńez-Salas, E., and Domingo, E. (1995). Effect of expression of the Davies, M. V., and Kaufman, R. J. (1992). The sequence context of the aphthovirus protease 3C on viral infection and gene expression. initiation codon in the encephalomyocarditis virus leader modulates Virology 212, 111–120. efficiency of internal translation initiation. J. Virol. 66, 1924–1932. Martıńez-Salas, E., Regalado, M. P., and Domingo, E. (1996). Identifica- 336 LO´ PEZ de QUINTO AND MARTIŃEZ-SALAS

tion of an essential domain for internal initiation of translation in the Bredenbeek, P. J. (1996). The influence of AUG codons in the hepatitis aphthovirus IRES, and implications for viral evolution. J. Virol. 70, C virus 5Ј nontranslated region on translation and mapping of the 992–998. translation initiation window. Virology 226, 47–56. Martı´nez-Salas, E., Sa´iz, J. C., Da´vila, M., Belsham, G. J., and Domingo, Rijnbrand, R., van der Straaten, T, van Rijn, P., Spaan W. J. M., and E. (1993). A single nucleotide substitution in the internal ribosome Bredenbeek, P. J. (1997). Internal entry of ribosomes is directed by the entry site of foot-and-mouth disease virus leads to enhanced cap- 5Ј noncoding region of classical swine fever virus and is dependent independent translation in vivo. J. Virol. 67, 3748–3755. on the presence of an RNA pseudoknot upstream of the initiation Medina, M., Domingo, E., Brangwyn, J. K., and Belsham, G. J. (1993). The codon. J. Virol. 71, 451–457. two species of the foot-and-mouth disease virus leader protein, Rose, J. K., Buonocore, L., and Whitt, M. A. (1991). A new cationic expressed individually, exhibit the same activities. Virology 194, liposome reagent mediating nearly quantitative transfection of ani- 355–359. mal cells. Biotechniques 10, 520–525. Pestova, T. V., Shatsky, I. N., Fletcher, S. P., Jackson, R. J., and Hellen, Sangar, D. V., Newton, S. E., Rowlands, D. J., and Clarke, B. E. (1987). All C. U. T. (1998). A prokaryotic-like mode of cytoplasmic eukaryotic foot-and-mouth disease virus serotypes initiates protein synthesis at ribosome binding to the initiation codon during internal translation two separate AUGs. Nucleic Acid Res. 15, 3305–3315. initiation of hepatitis C and classical swine fever virus RNAs. Genes Shagger, H., and von Jagow, G. (1987). Tricine-sodium dodecyl sulfate- Dev. 12, 67–83. polyacrylamide gel electrophoresis for the separation of proteins in Pilipenko, E. V., Gmyl, A. P., Maslova, S. V., Bolev, G. A., Sinyakov, A. N., the range from 1 to 100 kDa. Anal. Biochem. 166, 368–379. Huang, M., Brown, T. D. K., and Agol, V. I. (1994). Starting window, a Tesar, M., Harmon, S. A., Summers, D. F., and Ehrenfeld, E. (1992). distinct element in the cap-independent internal initiation of transla- Hepatitis A virus polyprotein synthesis initiates from two alternative tion on Picornaviridae RNA. J. Mol. Biol. 241, 398–414. AUG codons. Virology 186, 609–618. Pilipenko, E. V., Gmyl, A. P., Maslova, S. V., Svitkin, Y. V., Sinyakov, A. N., Tu, G., Cao, Q., Zhou, F., and Israel, Y. (1998) Tetranucleotide GGGA and Agol, V. I. (1992). Prokaryotic-like cis elements in the cap- motif in primary RNA transcripts: Novel target site for antisense independent internal initiation of translation on picornavirus RNA. design. J. Biol. Chem. 273, 25125–25131. Cell 68, 119–131. Wakita, T., and Wands, J. R. (1994). Specific inhibition of hepatitis C virus Ramesh, N., Kim, S.-T., Wei, M. Q., Khalighi, M., and Osborne, W. R. A. expression by antisense oligodeoxynucleotides. J. Biol. Chem. 269, (1996). High titer bicistronic retroviral vectors employing foot-and- 14205–14210. mouth disease virus internal ribosome entry site. Nucleic Acid Res. Zhang, Y., and Kaplan, G. (1998). Characterization of replication-com- 24, 2697–2700. petent hepatitis A virus constructs containing insertions at the N Rijnbrand, R., Abbink, T. E. M., Haasnoot, P. C. J., Spaan, W. J. M., and terminus of the polyprotein. J. Virol. 72, 349–357.