BASIC RESEARCH www.jasn.org
Histones and Neutrophil Extracellular Traps Enhance Tubular Necrosis and Remote Organ Injury in Ischemic AKI
Daigo Nakazawa,* Santhosh V. Kumar,* Julian Marschner,* Jyaysi Desai,* † Alexander Holderied,* Lukas Rath,* Franziska Kraft,* Yutian Lei,* Yuichiro Fukasawa, ‡ | Gilbert W. Moeckel, Maria Lucia Angelotti,§ Helen Liapis, and Hans-Joachim Anders*
*Nephrologisches Zentrum, Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Munich, Germany; †Department of Pathology, Sapporo City General Hospital, Sapporo, Hokkaido, Japan; ‡Department of Pathology, Yale University School of Medicine, New Haven, Connecticut; §Excellence Centre for Research, Transfer and High Education for the Development of De Novo Therapies, University of Florence, Florence, Italy; and |Departments of Pathology and Immunology and Internal Medicine (Renal), School of Medicine, Washington University in St. Louis, Missouri and Arkana Laboratories, Little Rock, Arkansas
ABSTRACT Severe AKI is often associated with multiorgan dysfunction, but the mechanisms of this remote tissue injury are unknown. We hypothesized that renal necroinflammation releases cytotoxic molecules that may cause remote organ damage. In hypoxia-induced tubular epithelial cell necrosis in vitro, histone secretion from ischemic tubular cells primed neutrophils to form neutrophil extracellular traps. These traps induced tubular epithelial cell death and stimulated neutrophil extracellular trap formation in fresh neutrophils. In vivo, ischemia-reperfusion injury in the mouse kidney induced tubular necrosis, which preceded the expansion of localized and circulating neutrophil extracellular traps and the increased expression of inflammatory and injury-related genes. Pretreatment with inhibitors of neutrophil extracellular trap formation reduced kidney injury. Dual inhibition of neutrophil trap formation and tubular cell necrosis had an additive protective effect. Moreover, pretreatment with antihistone IgG suppressed ischemia-induced neutrophil extracellular trap formation and renal injury. Renal ischemic injury also increased the levels of circulating histones, and we detected neutrophil infiltration and TUNEL-positive cells in the lungs, liver, brain, and heart along with neutrophil extracellular trap accumulation in the lungs. Inhibition of neutrophil extracellular trap formation or of circulating histones reduced these effects as well. These data suggest that tubular necrosis and neutrophil extracellular trap formation accelerate kidney damage and remote organdysfunctionthroughcytokineandhistonerelease and identify novel molecular targets to limit renal necroinflammation and multiorgan failure.
J Am Soc Nephrol 28: 1753–1768, 2017. doi: https://doi.org/10.1681/ASN.2016080925
AKI causes renal dysfunction and has potentially an autoamplification loop.3 Regulated forms of necro- life-threatening complications, such as the accu- sis include necroptosis, ferroptosis, and mitochondrial mulation of uremic toxins, fluid and electrolyte permeability transition–mediated regulated necrosis imbalances, and metabolic acidosis.1 The mortality rate of AKI has not improved beyond RRT. The Received August 31, 2016. Accepted November 30, 2016. epithelial and endothelial cell physiology and cell Published online ahead of print. Publication date available at to cell interactions in AKI were well studied using www.jasn.org. ischemic animal models.2 Recently, we introduced fl Correspondence: Dr. Hans-Joachim Anders, Medizinische Klinik the concept of necroin ammation, where renal cell and Poliklinik IV, Klinikum der Universität München–Innenstadt, necrosis via the release of damage-associated molec- Ziemssenstrasse 1, 80336 Munich, Germany. Email: hjanders@ ular patterns (DAMPs) from necrotic cells drives in- med.uni-muenchen.de trarenal inflammation and the injury of other cells in Copyright © 2017 by the American Society of Nephrology
J Am Soc Nephrol 28: 1753–1768, 2017 ISSN : 1046-6673/2806-1753 1753 BASIC RESEARCH www.jasn.org
Figure 1. NETs in human kidney biopsies with severe acute tubular necrosis. NET immunostaining in renal allograft biopsies with ATN (n=2) and healthy kidney samples (n=2). (A) Blue and overlay with phase contrast, 49,6-diamidin-2-phenylindol (DAPI) staining; green, NE; red, CitH3. (Right panel) The staining by isotype control IgG for NE and CitH3 is negative. NE/CitH3-positive NETs in tubulointerstitial space (top panel: ATN case 1, middle panel: ATN case 2). Bottom panels show the overlay of NETs staining in two
1754 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH
(MPT-RN).4 All forms of necrosis show DAMP-related activation Hematoxylin and eosin (H&E) staining showed that infil- of the innate immune system.5 Although this process can help to trating leukocytes were present in damaged tubular lumens control infections,6 it generates unnecessary secondary immuno- and the surrounding interstitium (Figure 1B), showing that pathology. Among DAMPs, histones have a particular role, be- human ATN is spatially and temporally associated with leu- cause they elicit direct cytotoxic effects.7 Neutrophils infiltrate the kocyte inflammation. kidney during the early injury phase8,9 and contribute to organ damage,10 but the mechanisms are not clear. Zychlinsky and co- NET Formation and Tubular Epithelial Cell Necrosis workers11 discovered the phenomenon of neutrophil extracellular Have Synergistic Functions trap (NET) formation as a previously unknown mode of bacterial Toevaluate whether hypoxia-induced necrosis of tubular epithe- killing. NET formation is usually associated with neutrophil lial cells activates neutrophils, conditioned media from Human death, a process named NETosis, which is morphologically distin- Kidney-2 (HK-2) cells treated with hypoxia (O2; 1%) or hydro- 12 guishedfromapoptosisandnecrosis. NET formation depends gen peroxide (H2O2; 1 mM) were applied to human neutro- on the activation of peptidyl arginine deiminase (PAD) enzymes, phils. After 4 hours of incubation, NET formation with the which convert arginine residues of histones to citrulline.13 Histone activation of CitH3 was confirmed by fluorescence micros- citrullination neutralizes DNA-histone interactions, resulting in copy (Figure 2, A and B), and the supernatants were positive chromatin decondensation and NET release.14 In addition, AKI for DNA-myeloperoxidase complexes (Figure 2D), both im- morbidity also relates to multiple organ failure,15 including severe plying NET formation. To test whether hypoxia can trigger lung injury,16 but the link between kidney injury and multiple NET formation directly, neutrophils were incubated under 17,18 organfailurehasnotyetbeendefined. Extracellular histones 20% O2 or hypoxic conditions for 24 hours, but there was are known components of NETs and important DAMPs de- no difference in NET (Supplemental Figure 2, A–D). These rived from necrotic cells. The histones bind with toll-like re- results indicate that only factors released from ischemic tu- ceptor 2 (TLR2) and TLR4 of renal cells to induce cell death,19 bular cells but not hypoxia itself triggers NET formation. To and these receptors are expressed in neutrophils. Therefore, examine whether NETs affect tubular cells, conditioned media we hypothesized that neutrophils infiltrating the kidney dur- containing phorbol 12-myristate 13-acetate (PMA) or necrotic ing AKI release cytotoxic histones while undergoing NET media-induced NETs (Figure 2, C and D) were applied to HK-2 formation and that such histones contribute to AKI severity cells. After 20 hours of incubation, the NET-containing media as well as AKI-related multiorgan damage via further NET induced high levels of lactate dehydrogenase (LDH) release from formation. injured HK-2 cell (Figure 2, E and F) and HK-2 cell death with propidium iodide positivity (Figure 2, G and H) compared with intact neutrophils media. In addition, the NET-containing me- RESULTS dia activated fresh neutrophils to undergo further NET forma- tion (Supplemental Figure 2, E and F). PAD inhibitor abrogated NETs in Severe Human Acute Tubular Necrosis induced NET formation in neutrophils and subsequent tubular NETswere observed at sites of sterile inflammation in humans20; cell injury (Figure 2, C–H). The protein expression of CitH3 and hence, we first questioned whether NETs also develop in human PAD4 in necrotic media–stimulated neutrophils was higher postischemic tubular necrosis. We performed immunofluores- than that in control neutrophils, hypoxia neutrophils, and nor- cence staining on two kidney biopsies obtained from patients mal HK-2 media neutrophils (Figure 2I). with post-transplant acute tubular necrosis (ATN) related to Together, these data suggest that neutrophils forming NETs long cold ischemia times and two healthy patients. Histone release factors that kill tubular cells and induce further NET citrullination is key in mediating NET formation, and the formation. In turn, necrotic tubular cells induce neutrophils to colocalization of citrullinated histone 3 (CitH3) and cytoplas- undergo NETosis. Thus, tubular epithelial cell death and neu- mic components in neutrophil indicates NET formation.21 trophil death enhance each other. Immunostaining in both ATN kidneys showed neutrophil CitH3-positive cells surrounding tubular epithelial cells (Figure Postischemic Tubular Necrosis Is Associated with NET 1A). Healthy kidney samples did not show any positivity of Formation in Mice CitH3/neutrophil elastase (NE) (Figure 1A). Furthermore, dou- We hypothesized that infiltrating neutrophils form NETs in the ble immunostaining of KIM1 and NE (Supplemental Figure 1) postischemic kidney, which would imply that release of more showed that the infiltrating neutrophils in kidneys with ATN histones and other DAMPs further accelerates AKI. Postische- localized to injured tubules highly expressing KIM1 but did mic AKI was induced in wild-type mice by unilateral clamping not exist in healthy kidney. of the renal pedicle for 35 minutes followed by reperfusion
healthy kidney samples. (B) H&E staining shows leukocyte infiltration into surrounding tubules (left panel: ATN case 1; right panel: ATN case 2). Scale bar, 25 mm.
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1755 BASIC RESEARCH www.jasn.org
Figure 2. NETs initiate the necroinflammation loop in vitro. (A and B) HK-2 cells were incubated with normal oxygen, hypoxia (1% O2), or 1 mM H2O2 for 24 hours, and the cell culture supernatants were incubated with healthy human neutrophils for 4 hours. The NETs are detected by immunofluorescence staining. Blue, 49,6-diamidin-2-phenylindol (DAPI) staining; green, NE; red, CitH3. Scale bar, 50 mm. The graph of B shows the ratio of CitH3 to DAPI-positive area. (C–H) Neutrophils were treated with (C) 25 nM PMA and (D) necrotic
1756 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH for 0–72 hours. At 24 hours, postischemic kidneys displayed The Effect of Dual Inhibition of NET Formation and Cell positivity for CitH3 and Ly6b colocalizing with NETs in the Necrosis in Postischemic AKI outer stripe of the outer medulla as assessed by immunostaining To study the contribution of regulated necrosis and NETosis to (Figure 3A, Supplemental Figure 3A). The number of NETs in renal necroinflammation, we tested dual NET and necrosis the outer medulla increased between 15 hours and approxi- inhibition in mice with bilateral postischemic AKI. Necrosis mately 24 hours after reperfusion and decreased thereafter as inhibition reduced the abundance of NETs (Figure 5, A–D), determined by immunofluorescence staining (Figure 3, B–D) necrotic area (Figure 5, E and F), and AKI-related gene ex- and immunoblotting (Figure 3I, Supplemental Figure 3B). Sim- pression (Supplemental Figure 4A) and improved renal func- ilarly, circulating NETs were detected in plasma 15 hours to tion (Figure 5, G and H). Adding a PAD inhibitor to necrosis approximately 24 hours after reperfusion (Supplemental Figure inhibition abrogated intrarenal NET formation, further im- 3C). Contralateral kidneys did not show NETs between 0 hours proved renal dysfunction, reduced tubular necrosis (Figure 5, and approximately 72 hours after reperfusion (Supplemental A–E and G), and induced fewer injury-related genes compared Figure 3A). Interestingly, renal cell death in the outer medulla with necrosis inhibition alone (Supplemental Figure 5). The preceded NET formation between 1 hour and approximately additive effect of PAD inhibitor mainly contributed to reduc- 6 hours after reperfusion as shown by terminal deoxynucleotidyl ing the neutrophil-related factors (tissue CitH3 expression, transferase–mediated digoxigenin-deoxyuridine nick-end label- TNF-a mRNA, etc.), suggesting that the PAD inhibitor specif- ing (TUNEL) positivity in that area (Figure 3, B and E) as well as ically inhibits PAD4-mediated NETs via suppressing chroma- detection of plasma-free DNA (Supplemental Figure 3D). His- tin decondensation independent of Nec1; these factors might tologic analysis showed that tubular necrosis persisted for a long facilitate renoprotection. time after the peak of TUNEL positivity and NETs abundance Together, these results suggest that NET formation is an (Figure 3, B and F). Furthermore, the number of NETs and independent accelerating element during the crescendo of tubular injury at 24 hours after reperfusion increased in an is- necroinflammation in the postischemic kidney. chemic time–dependent manner (Figure 3, B, G, and H). These results indicate that tubular cell necrosis is an early event in Histones Are Central Mediators of Necroinflammation ischemia-reperfusion injury (IRI) followed by neutrophils in AKI undergoing NET formation, which is associated with ongoing To examine which components of necrotic cells induce NETs tubular injury. and which components of NETsinjure tubular cells, we focused on histones, because histones have unique cytotoxic DAMP 22 NET Formation Contributes to Postischemic Tubular effects. Necrotic HK-2 cells treated with H2O2 released his- Necrosis In Vivo tones into the supernatant (Figure 6A). To test if histones are Does NET formation drive ongoing tubular injury? Mice with sufficient to induce neutrophils to undergo NET formation, bilateral renal IRI (ischemia for 35 minutes and reperfusion for we exposed neutrophils from healthy human donors to extra- 24 hours) underwent either treatment with a PAD inhibitor or cellular histones. Three hour later, the neutrophils had formed neutrophil depletion by injection of anti-Ly6G mAb. The PAD aggregated NETs and showed CitH3 positivity (Figure 6, B and C). inhibitor substantially reduced the abundance of NETs in the Histone-induced NET formation could be inhibited with the his- postischemic kidney (Figure 4, A and B, Supplemental Figure tone-neutralizing BWA3 antibody (aHisAbs) (Figure 6D). To ex- 4A) as well as circulating NETs (Figure 4C). Furthermore, re- amine the toxicity of histone-induced NETs to tubular cells, the nal function (Figure 4, D and E), tissue necrosis (Figure 4F, supernatants of NETs were applied to HK-2 cells. At 20 hours of Supplemental Figure 4B), and expression of AKI marker genes incubation, NETsupernatants induced HK-2 cell death, a process (Supplemental Figure 4C) were significantly reduced in the suppressed by adding aHisAbs, which implies that histones mice treated with PAD inhibitor or neutrophil depletion. We are a central element of NET-related tissue injury (Figure conclude that neutrophils contribute to postischemic AKI by 6E). These results were compatible with previous studies forming NETs. that extracellular histones derived from NETs and necrotic
tubular cells media in the presence or absence of PAD inhibitor (200 mM). NETs in the culture supernatants were quantified by MPO-DNA complexes ELISA. NET supernatant after treatment with PMA and necrotic tubular cells media were incubated with healthy tubular epithelial cells for 20 hours, and the cytotoxicity of tubular epithelial cells was evaluated with (E and F) LDH assay and (G) propidium iodide (PI) staining. Upper and lower panels in G show the PI positivity of PMA NETs–stimulated HK-2 cells and necrotic media–mediated NETs-stimulated HK-2 cells, respectively. (H) The quantification of G. The conditioned NET media were prepared by replacing with fresh media to avoid the con- tamination of PMA and tubular cell necrotic media as previously described.41 Scale bar, 200 mm. (I) The expression of CitH3 and PAD4 of neutrophils treated with normal oxygen or hypoxia condition or different tubular epithelial cells necrotic media were detected by immuno- blotting with b-actin as a loading control. As a positive control of CitH3 expression, neutrophils were treated with 25 nM PMA. Data represent the mean6SEM of three to six independent experiments and were analyzed using the paired t test. *P,0.05 versus respective control; **P,0.01 versus respective control.
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1757 BASIC RESEARCH www.jasn.org
Figure 3. NETs in the mouse kidney with acute injury. (A) Representative NETs staining in outer medullary lesions of unilateral IRI kidney (ischemia for 35 minutes and reperfusion for 24 hours). Colocalization of CitH3 (red), Ly6b (green), and swelled nuclei (blue) surrounding tubular duct indicates the NETs formation. Scale bar, 50 mm. (B) Histology of unilateral IRI kidney at different time points after re- perfusion and different ischemia times. (Row 1) Ly6b (green). (Row 2) CitH3 (red). (Row 3) TUNEL (green). (Row 4) Periodic acid–Schiff
1758 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH cells could induce NET formation via TLR4/923 and tubular DISCUSSION injury via TLR2/4,7,19 respectively; this could contribute to the mechanism of NET cytotoxicity. Wehad hypothesized that, during AKI, infiltrating neutrophils To test whether aHisAbs could also suppress the vicious undergo NETosis, leading to the release of cytotoxic DAMPs, cycle of tubular necrosis and NET formation, mice with bi- such as histones, which exacerbate tubular epithelial cell injury lateral IRI were treated with aHisAbs before the surgery. and interstitial inflammation. Furthermore, we speculated that aHisAbs reduced the abundance of NETs as assessed by im- such NET components enter the circulation and contribute to munostaining (Figure 6, F and G) and immunoblotting remote organ injury, which is often associated with AKI (e.g., in (Supplemental Figure 6B). Consistent with the decreased multiorgan failure). Our data confirm this concept and reveal abundance of NETs, tubular necrosis, renal dysfunction, that postischemic tubular necrosis involves DAMP release and the expression of kidney injury marker genes were sup- promoting NET formation as a second event, a process that pressed (Figure 6, F and H–J, Supplemental Figure 6C). The results in additional renal and extrarenal injury. results show that histones released from dying tubular cells The pathophysiology of AKI involves regulated cell death and NETs contribute to renal necroinflammation in AKI. and inflammation.24 In particular, necroptosis, ferroptosis, and MPT-RN of tubular cells result in the release of DAMPs, Upon AKI, Circulating NETs and Histones Promote leading to the recruitment of inflammatory cells and further Remote Organ Injury injury.25 Among the inflammatory cells, numerous neutro- The molecular mechanisms underlying AKI-related remote or- phils were detected in the early phase of ischemic AKI,9 and gan injury are unknown. Because we found that postischemic neutrophil depletion prevented renal dysfunction, indicating a AKI is associated with NETs and DAMPs in the plasma, we contribution of neutrophils to AKI.10 We found the presence speculated that injured kidneys release NETs and their cytotoxic of NETs in kidney biopsies of patients with ATN, which is components into the circulation, promoting also systemic in- consistent with data from noninfectious human kidney dis- flammation and injury in other organs. Indeed, mice with eases, such as ANCA vasculitis.7,20 On the basis of these find- bilateral IRI displayed not only NETs but also, increased ings, we speculated that hypoxia-induced necrotic tubular plasma concentrations of TNF-a, IL-6, and histone (Figure cells activate neutrophils to promote NET formation, which 7, A–C, Supplemental Figure 6A). To assess remote organ in- induced further tubular epithelial cell injury and enhanced jury, TUNEL staining and neutrophil immunostaining were NETs formation. DAMPs, such as NETs components, interact performed in lung, liver, brain, heart, and pancreas after bi- with TLR2/4 on tubular cells and produce the inflammatory lateral IRI surgery. TUNEL-positive cells and neutrophil in- cytokines, including IL-6, TNF-a, etc.26 These indicate that filtration were identified in multiple organs (lung, liver, brain, tubular necrosis and NETosis could amplify the inflammation and heart) (Figure 7, D and E), but immunoblotting of lysates and surrounding tissue damage and lead to renal necroinflam- from these organs detected histone citrullination only in kid- mation. Indeed, the IRI kidney was protected by treatment ney and lung (Figure 7F). Furthermore, NETs were detected with an inhibitor of NET formation, which is consistent in lungs by immunofluorescence staining (Figure 7G) but with previous findings in glomerular disease.7,27 In addition, were not detected in other organs (data not shown). The we used Cl-amidine, a pan-PAD enzyme inhibitor that can area of NETs in lungs correlated with the TUNEL-positive inhibit all types of PAD in other cells. PAD4 is located inside area and the number of immune cells in bronchoalveolar la- neutrophil nuclei, where it facilitates citrullination of histones, vage (BAL) fluid (Figure 7, H–J). NETarea and BAL cell num- whereas other PAD enzymes are mostly absent from the kid- ber peaked between 6 and 24 hours after reperfusion in the ney.28 Although PAD4 is expressed in tubular cells,29 its con- unilateral IRI kidney model (Supplemental Figure 7, A and B), tribution to tubular injury remains unclear. Our in vitro data and NETs components were detected in BAL supernatant of show that conditioned NET media pretreated with PAD in- bilateral IRI mice (Supplemental Figure 7C). Meanwhile, NETs hibitor reduced tubular cell damage. This indicates that the and necrosis inhibition reduced these markers of lung injury and PAD inhibitor in our study mainly inhibited NETosis by af- also, reduced remote organ injury to liver, heart, and brain (Fig- fecting PAD4 activity in neutrophils. Furthermore, we showed ure 7, K–M) and systemic inflammation (Figure 7, N and O). that dual inhibition of NET formation and cell necrosis has Specifically, aHisAbs were most effective for preventing remote additive protective effects on some parameters in IRI kidney. organ injury (Figure 7, I and K–M). These results indicate that Although RIPK3/CypD double-knockout mice,25 which have circulating histones promote lung injury and remote organ in- defects in necroptosis and MPT-RN, are prevented from IRI- jury after renal IRI. induced kidney damage, chemical inhibitors of these
(PAS) staining. Scale bar, 200 mm. (C) Ly6b-positive area, (D) CitH3-positive area, (E) TUNEL-positive area, and (F) histologic evaluation of PAS staining at different times. (G) Representative image and (H) tubular injury score at different ischemic times. (I) CitH3 expression of unilateral IRI kidney by immunoblotting. Data are mean6SEM from five mice in each group.
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1759 BASIC RESEARCH www.jasn.org
Figure 4. NET inhibitor ameliorates bilateral IRI kidney. Bilateral IRI kidney model mice (ischemia for 35 minutes and reperfusion for 24 hours) were treated with vehicle (20% DMSO in PBS; n=14), PAD inhibitor (Cl-amidine: 20 mg/kg intraperitoneally; n=5), and neutrophil depletion by injection of anti-Ly6G mAb (500 mganti-Ly6GIgGs;n=10 or control IgGs; n=5) 24 and 2 hours before the surgery. Sham-operated mice were prepared as a control (n=5). (A) Representative overlay images of NETs staining in each group. Blue, 49,6-diamidin-2-phenylindol (DAPI); green, NE; red, CitH3. B, upper panel shows NE staining and the ratio of NE-positive area. B, lower panel shows CitH3 staining and the ratio of CitH3-positive area in different treatment group. Scale bar, 100 mm. (C) Circulating NETs, (D) plasma creatinine, and (E) plasma urea level in each group. (F) Histologic findings and TUNEL staining. Upper panel shows representative periodic acid–Schiff (PAS) staining and tubular necrosis area, respectively. Lower panel shows representative TUNEL staining and the ratio of TUNEL-positive area. Data are mean6SEM from at least five mice in each group. Scale bar, 500 mm in F, upper panel; 200 mm in F, lower panel. *P,0.05 versus respective control; **P,0.01 versus respective control; ***P,0.01 versus respective control.
1760 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH
Figure 5. NET inhibition had additional protection on necrosis inhibition in the IRI kidney. Bilateral IRI kidney model mice (ischemia for 35 minutes and reperfusion for 24 hours) were treated with vehicle (20% DMSO in PBS; n=14), necrosis inhibitor cocktail (Necrostatin-1: 1.65 mg/kg intraperitoneally; Ferrostatin-1: 2 mg/kg intraperitoneally; cyclosporine: 10 mg/kg intravenously; n=5), and the combination necrosis inhibitor cocktail and PAD inhibitor (Cl-amidine: 20 mg/kg intraperitoneally; n=5) before the surgery. (A) Representative NETs staining in IRI kidney treated with vehicle, necrosis inhibitor cocktail (Nec In), and the combination Nec In and PAD inhibitor (PAD In). Blue, 49,6-diamidin-2-phenylindol; green, NE; red, CitH3. Scale bar, 200 mm. (B) Representative protein expression of CitH3 in IRI kidneys treated with different inhibitors and (D) the quantification normalized to b-actin expression. C, left panel shows the NE-positive area, and C, right panel shows the CitH3-positive area. (E) Representative periodic acid–Schiff (PAS) and TUNEL staining. Scale bar, 500 mm in upper panel; 200 mm in lower panel. (F) The quantification of necrotic area in PAS staining (upper panel) and TUNEL-positive area (lower panel). (G) Plasma creatinine and (H) plasma urea in each group. Data are mean6SEM from at least five mice in each group. *P,0.05 versus respective control; **P,0.01 versus respective control; ***P,0.01 versus respective control. processes, such as necrostatin 1, ferrostatin 1, and sanglifehrin A, cells undergoing necrosis was still sufficient to induce NETs for- did not completely prevent kidney injury. Thus, our data indicate mation and that the NETs could be inhibited by PAD inhibitor. that, although these inhibitors prevented some tubular cell death, Nevertheless, the additive effect of dual therapy was not large the amount of DAMPs that was released from the few tubular compared with necrosis inhibitor alone, which raises the
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1761 BASIC RESEARCH www.jasn.org
A B
C D
E
F
GHIJ
Figure 6. Histones are central key players of necroinflammation, including NETosis. (A) Histone concentration of the supernatant in HK-2 cells treated with 1 mM H2O2 and PBS for 24 hours was measured by the histone detection ELISA kit. Data represent the mean6SEM of four independent experiments. *P,0.05 versus respective control. (B–D) Human health neutrophils were incubated with exogenous histones (50 mg/ml) or control PBS for 3 hours. (B) Representative NETs staining of histone-stimulated neutrophils using CitH3 (red) and
1762 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH possibilities, in the necrosis inhibitor cocktail, (1) that necrostatin the high positive charge, which elicits direct membrane rup- 1 could inhibit neutrophil cell death by suppressing necroptosis ture.37 Conversely, NETs and necrosis inhibitors showed a trend via RIPK330 and (2) that cyclosporin, which was used for toward a better protective effect against kidney damage during blocking MPT-RN, could react with calcineurin to inhibit IRI compared with that of aHisAbs. These findings imply that NET induction.31 Consequently, these agents could inhibit cell death inhibitors are more potent at the site of initial injury, the formation of NETs. However, because it is unclear whether while remote injuries can be better controlled by targeting these inhibitors affect the PAD4-CitH pathway in neutrophils, circulating histones. In conclusion, during IRI of kidney, the the precise mechanism needs to be addressed in the future. Fur- necrosis of tubular epithelial cells could be an initial event that thermore, the test of NETs inhibition in RIPK3/pMLKL genet- leads to the release of DAMPs and the induction of NETosis. ically modified mice would be useful for understanding the NETs and NETs-derived DAMPs, such as histones and DNA, pathogenesis between necrosis and NETs. act as mediators of necroinflammation to induce additional Our study indicated that remote organ injury after AKI par- injury of tubular epithelial cells and additional NET formation. tially relates to NETs. In particular, the lungs are the most com- The cycle of tubular epithelial cell death and NET formation mon site of remote injury, because the permeability of lung exacerbates kidney injury and induces remote organ injury capillaries increases during AKI.32 In this study, we showed (Supplemental Figure 8). that NETs also form in the lungs in association with AKI, a pro- cess that is associated with acute lung injury. One possible reason why NETs mostly occurred in lungs as a remote organ seems to CONCISE METHODS be that pre-NET–forming neutrophils, which passed through the injured kidney and were stimulated by highly concentrated Animal Studies DAMPs, would anatomically return first to the lung and could C57BL/6N male mice were procured from Charles River Laboratories easily become trapped in lung capillaries that are smaller in di- (Sulzfeld, Germany); 6- to 8-week-old mice (n=5–14) were anesthetized ameter compared to other organs.33 Doi et al.34 reported that, in before renal pedicle clamping (unilateral: 15, 25, 35, and 45 minutes) bilateral nephrectomy mice, HMGB1 among DAMPs affected with a microaneurysm clamp via flank incisions (Medicon, Tuttlingen, acute lung injury via TLR4 signaling, but in bilateral IRI kidney Germany). Online rectal temperature recording was installed for every mice, it induced ALI independent from TLR4. These findings mouse after the onset of anesthesia. Body temperature was maintained seem to be compatible with those of our study, because IRI could between 36.5°C and 38.5°C throughout the procedure by placing the induce necroinflammation, including NETs formation, to acti- mice in a ventilated heating chamber (before and after surgery) and on a vate various receptors as well as TLR4 (for example, histones can heating pad (during surgery).38 After clamp removal, the kidney was activate TLR2, -4, and -9, whereas HMGB1 can activate TLR2, confirmed for recovery of blood flow evidenced by returning to its -4, and -9 and receptor for advanced glycation end products).35 original color before closing the wound. To maintain fluid balance, all The NETs and necrosis inhibitors also protected against other mice were supplemented with 0.5 ml 0.9% NaCl administered intraper- remote organ injuries via blocking circulating histones, cyto- itoneally. Mice were killed after 0, 15, or 30 minutes; 6, 12, 15, or 24 toxic cytokines, and circulating NETscomponents. Among these hours; or 2, 3, 7, or 10 days of the surgery. Bilateral IRI mice (ischemia treatments, aHisAbs were the most effective intervention to pro- for 35 minutes and reperfusion for 24 hours) were treated with PAD tect distant organs against damage, which indicates that histones inhibitor (n=5; 20-mg/kg intraperitoneal injection; Calbiochem), con- are one of the most important DAMPs mediating AKI-related trol PBS with 20% DMSO (n=14), antihistone IgGs (n=5; 20-mg/kg remote organ injury. Although NETs and necrosis inhibitors are intraperitoneal injection; clone BWA3; Immunomedics, Morris Plains, supposed to prevent remote organ injury via regulating the cell NJ), control IgGs (n=5), or necrosis inhibitor combination (n=5; death pathway caused by DAMPs, neutralizing histones could Necrostatin-1 [Enzo]: 1.65-mg/kg intraperitoneal injection; Ferros- possibly contribute to inhibiting the direct toxicity of histones36 tatin [Calbiochem]: 2-mg/kg intraperitoneal injection; Ciclosporin as well as TLR activation, which could not be inhibited by NET [Novartis]: 10-mg/kg intravenous injection) 2 hours before IRI sur- and necrosis inhibitors. The cytotoxicity is known to be due to gery. Neutrophil depletion was performed as described previously23
49,6-diamidin-2-phenylindol (DAPI; blue). Scale bar, 50 mm. (C) Representative scanning electron microscopy images of unstimulated neutrophils (upper panel) and histone-stimulated neutrophils (lower panel). Scale bar, 20 mm. (D) Neutrophils were treated with histones (50 mg/ml) in the presence of aHisAbs (100 mg/ml) or control Abs (100 mg/ml), and the ratio of CitH3-positive cells was quantified. (E) The supernatants of histones-stimulated neutrophils were applied to HK-2 cells, and the cytotoxicity was determined by LDH assay. The conditioned media were prepared as previously described to avoid the contamination of external histones. Data represent the mean6 SEM of four independent experiments. *P,0.05 versus respective control; **P,0.01 versus respective control. (F) Representative images of (left panel) NETs, (center panel) periodic acid–Schiff (PAS), and (right panel) TUNEL staining in IRI kidney treated with (upper panel) control and (lower panel) aHisAbs (20 mg/kg intraperitoneally; n=5). Blue, DAPI; green, NE; red, CitH3. Scale bar, 200 mm. The quanti- fication of (G) CitH3-positive NETs area, (H) histologic necrotic area, and (I) TUNEL-positive area. (J) Plasma creatinine in IRI kidney mice treated with control and aHisAbs. Data show the mean6SEM from at least five mice in each group. *P,0.05 versus respective control.
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1763 BASIC RESEARCH www.jasn.org
Figure 7. AKI-related remote organ injury is caused by circulating NETs and DAMPs, such as histones. (A) Plasma TNF-a, (B) IL-6, and (C) histone 3 content in sham-operated mice and bilateral IRI kidney mice (ischemia for 35 minutes and reperfusion for 24 hours) was measured by (A and B) ELISA and (C) immunoblotting methods. As a positive control for plasma histone, the plasma of LPS-induced sepsis mice was used. (D) Tissue injury, (E) neutrophil infiltration, and (F) NETs expression in multiorgan (kidney, lung, liver, brain, heart,
1764 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH
Table 1. Primers used for real-time RT-PCR Gene Forward Primer Sequence Reverse Primer Sequence 18s GCAATTATTCCCCATGAA AGGGCCTCACTAAACCAT Kim1 TGGTTGCCTTCCGTGTCT TCAGCTCGGGAATGCACA NGAL ATGTCACCTCCATCCTGG GCCACTTGCACATTGTAG PAD4 ACGCTGCCTGTCTTTGA ACCTCCAGGTTCCCAAAGGC IL-6 GGGACTGATGCTGGTGAC TAACGCACTAGGTTTGCC CCL2 GCTACAAGAGGATCACCA GTCTGGACCCATTCC TNF-a AGGGTCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTA with an intraperitoneal injection of 500 mg anti-Ly6G IgGs (1A8; (20 mg/kg intraperitoneally) was injected into wild-type mice (8 weeks BioXCell; n=10) or control IgGs (n=5)24and2hoursbeforeIRI of age; male), and the blood samples were taken 6 hours after LPS injec- surgery. All animal studies were approved by the local governmental tion.39 BAL fluid in IRI mice were evaluated as previously described.40 ethics committee. The BAL cell number and supernatant NETs were evaluated by cell coun- ter and NE-DNA complexes ELISA, respectively. Assessment of Tissue Injury and Inflammation Tissues were embedded in paraffin, and 3-mm sections were used for Immunohistofluorescence Staining in Human Tissues H&E, periodic acid–Schiff, and IHC staining. The sections for IHC were Fresh frozen sections of renal biopsies from two patients with ATN deparaffinized and rehydrated in a graded ethanol series. Endogenous caused by ischemic condition after renal transplant (donor of case 1 peroxidase was inhibited using 0.3% H2O2 in PBS for 30 minutes. Sec- was a 68-year-old man: nonheart-beating donor, ischemia time =30 tions were then heated in 97°C sodium citrate buffer (10 mM, pH 6) for minutes; donor of case 2 was a 69-year-old man, heart-beating donor) 40 minutes for antigen retrieval. Sections were treated with the Vector were provided from the Institute of Pathology at the Sapporo City Blocking Kit (Vector Laboratories, Burlingame, CA) for endogenous bi- General Hospital. As controls, four healthy kidney fresh frozen sam- otin inhibition. For immunofluorescence, the tissues after euthanasia ples were provided from the Excellence Centre for Research, Transfer were fixed with 4% paraformaldehyde for 2 hours, dehydrated with and High Education for the Development of De Novo Therapies, 30% sucrose for 24 hours at 4°C, frozen in OCT (Tissue-Tek OCT Com- University of Florence. Informed consent was obtained from the pa- pounds; Sakura), and cryosectioned (5-mm thick). The CitH3-positive tients. The samples were used for H&E stain and NETs/KIM1 immu- NETs and TUNEL-positive necrotic cells were quantified using ImageJ nostaining as previously described. software. Tubular injury in periodic acid–Schiff staining was scored by assessing the percentage of tubules in the cortex and outer medullary RNA Preparation and Real-Time RT-PCR lesion that displayed tubular cell necrosis, tubular dilation, luminal cast Total renal RNA was isolated using a Qiagen mRNA Extraction Kit formation, and inflammatory cells infiltration. For immunostaining, (Qiagen) as described.7 From isolated RNA, cDNA was prepared rat anti-mouse Ly6b (neutrophils) Ab (AbD Serotec, Oxford, United using reverse transcription (Superscript II; Invitrogen). The SYBR Kingdom), rabbit anti-CitH3 Ab (Abcam, Cambridge, United Kingdom), GreenDyeDetectionSystemwasusedfor quantitative real-time PCR goat anti-NE Ab (Santa Cruz Biotechnology), and rabbit anti-KIM1 Ab on a Light Cycler 480 (Roche). All gene expression values were nor- (Abcam) were used. To count the positive cells, three high-power fields malized using 18s rRNA as a housekeeping gene. (3100)wereanalyzed.BUNandcreatinineweremeasuredusingUreaor The expression of each gene was tested using primers as shown in Creatinine FS Kits (DiaSys Diagnostic Systems, Holzheim, Germany) Table 1 (300 nM; Metabion, Martinsried, Germany). according to the manufacturer’sprotocols.Miceplasmawasanalyzed for IL-6 and TNF cytokine secretion by ELISA (BD Pharmingen, San In Vitro Studies Diego, CA). Histone of the plasma was analyzed by immunoblotting and Cell Culture and Treatment histone-nucleosome complexes ELISA (Roche, Mannheim, Germany). The HK-2 (human) tubular cell lines were cultured in DMEM sup- To prepare a control model with high concentration of histone, LPS plemented with 10% FCS and 1% penicillin-streptomycin until the
and pancreas) sham and bilateral IRI (ischemia for 35 minutes and reperfusion for 24 hours) kidney mice were evaluated by TUNEL staining, Ly6b immunostaining, and immunoblotting, respectively. (G) Lung injury followed by bilateral IRI kidney (ischemia for 35 minutes and reperfusion for 24 hours) treated with vehicle, PAD inhibitor, neutrophil depletion, necrosis inhibitor, necrosis inhibitor and PAD inhibitor, or aHisAbs was evaluated by (upper panel)NETs immunostaining(blue, 49,6-diamidin-2-phenylindol[DAPI];green, NE; red, CitH3) and(lower panel) TUNEL staining (lower figures). The graphs show (H) NETs area and (I) TUNEL-positive area in lung. (J) The cell number in BAL of these groups was counted. (K–M) The quantification of TUNEL-positive area in (K) liver, (L) heart, and (M) brain in each group. (N) Plasma TNF-a and (O) IL-6 in differently treated mice were measured by ELISA method. Data show the mean6SEMfromatleastfive mice in each group. Scale bar, 100 mm. *P,0.05 versus respective control; **P,0.01 versus respective control; ***P,0.01 versus respective control; #P,0.05 compared with aHisAbs group.
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1765 BASIC RESEARCH www.jasn.org cells were 80% to approximately 90% confluent. Before the experi- point dried before being sputter coated with gold/palladium. Because the ments, these cell media were exchanged to DMEM in the absence of NETs are fragile, each step was done with minimal disturbance of the
FCS/glucose and placed into normal oxygen (O2: 20%) or hypoxia media to preserve the structures. Specimens were viewed with a JEOL
(O2:1%) chamber or H2O2 (1 mM) for 24 hours. HK-2 cells were Model 1200EX Electron Microscope (JEOL, Tokyo, Japan). originally purchased from ATCC and generously provided by B. Luckow and P.J. Nelson. Cell Death Assay A cell death detection (TUNEL) kit (Roche) was used to quantify dead Neutrophil Isolation and In Vitro NET Formation cells in accordance with the company’s description. Systemic dead Neutrophils were isolated from human healthy volunteers using cell–derived DNAs in plasma were quantified by the PICO Green standard dextran sedimentation followed by Ficoll–Hypaque den- dsDNA Assay Kit (Thermo Fisher Scientific). In vitro, cytotoxicity sity centrifugation procedures.11 Blood donors provided written was evaluated by LDH assay (Roche). informed consent forms approved by the local ethical committee. Neutrophils were suspended in RPMI (23105 to approximately Immunoblotting 23106 cells per 1 ml) and seeded onto eight-well microslides (Ibidi, Mice plasma or tissue extracts were analyzed by standard immunoblot Martinsried, Germany) or 12- or 96-well plates in a 5% carbon techniques as described elsewhere.43 Antihistone H3 antibodies and anti– dioxide atmosphere at 37°C for 30 minute before stimulation. b-actin were purchased from Cell Signaling Technology (Danvers, MA), The neutrophils were placed in normal or hypoxia conditions and anti-CitH3 antibodies and anti-PAD4 antibody were purchased (1% oxygen) for 3, 6, or 24 hours or stimulated by PMA (25 nM; from Abcam. The expression of protein was quantified using ImageJ Sigma-Aldrich), total calf thymus histones (10, 50, or 100 mg/ml; software. Sigma-Aldrich), and necrotic conditioned media from tubular cells (control, hypoxia, or H2O2 stimulation) for 3 to approximately Statistical Analyses 4 hours; other groups of neutrophils were pretreated with PAD Data were expressed as the mean6SEM. Comparison between inhibitor (Cl-amidine: 200 mM), aHisAbs (100 mg/ml), and control groups was performed by the two-tailed t test or one-way ANOVA IgGs (100 mg/ml). (nonparametric tests). A P value ,0.05 indicated statistical signifi- cance. All statistical analyses were calculated using GraphPad Prism NETs Induced Cytotoxicity to Tubular Cells and Neutrophils software (GraphPad). Neutrophils were stimulated by PMA, exogenous histones, and necrotic tubular cells–derived conditioned media; 3 hours after incubation, the supernatant was replaced with fresh media (RPMI), and the bottom ACKNOWLEDGMENTS NETs were collected to avoid the contamination of the media with ex- ogenous PMA, necrotic tubular cells, or histones as previously de- The expert technical assistance of Dan Draganovic and Janina scribed.41 After centrifugation (1200 rpm for 5 minutes), the supernatant Mandelbaum at Ludwig Maximilian Universityof Munich and Jacklyn was applied to tubular cells (1:1). At 20 hours after the addition of con- Lett at Washington University in St. Louis is gratefully acknowledged. ditioned NETs media, tubular cells injury was evaluated by LDH assay This work was funded by scholarship 1158708-STP2 of the and propidium iodide staining. To investigate whether the formed NETs Alexander von Humboldt Foundation (to D.N.), the Medical Faculty affect fresh neutrophils, conditioned NETs media were applied to fresh Förderprogramm für Forschung und Lehre (FöFoLe) Program (A.H., neutrophils, and 4 hours after incubation, additional NET formation in L.R., and F.K.), and grant AN372/14-3 and 23-1 from the Deutsche fresh neutrophils was evaluated by immunostaining. Forschungsgemeinschaft (to H.-J.A.).
NETs Quantification Assay In human neutrophil experiments, NETs were quantified by the MPO- DISCLOSURES DNA sandwich ELISA method using anti-DNA Abs (Roche) and anti- None. human MPO Abs (AbD Serotec) as described.42 In mouse neutrophils experiment, BAL NETs (undiluted) and plasma NETs (two times diluted in PBS) were evaluated by the NE-DNA complex using anti-DNA Abs REFERENCES and anti-mouse NE Abs (Santa Cruz Biotechnology) as described.40 The CitH3-positive NETs were quantified using ImageJ software. 1. Libório AB, Leite TT, Neves FM, Teles F, Bezerra CT: AKI complications in critically ill patients: Association with mortality rates and RRT. Clin J Scanning Electron Microscopy Am Soc Nephrol 10: 21–28, 2015 Neutrophils were stimulated with total histones (50 mg/ml) or control 2. Sharfuddin AA, Molitoris BA: Pathophysiology of ischemic acute kidney (PBS) for 2 hours. Cells were fixed in 2% paraformaldehyde/2% glutar- injury. Nat Rev Nephrol 7: 189–200, 2011 fl aldehyde in PBS for 24 hours followed by three washes for 15 minutes 3. Mulay SR, Linkermann A, Anders HJ: Necroin ammation in kidney disease. JAmSocNephrol27: 27–39, 2016 each in PBS. After rinsing in distilled H2O, cells on coverslips were treated 4. Linkermann A, Stockwell BR, Krautwald S, Anders HJ: Regulated cell fi with 1% thiocarbohydrazide, post xed with 0.1% osmium tetroxide, death and inflammation: An auto-amplification loop causes organ fail- dehydrated in ethanol, mounted on stubs with silver paste, and critical ure. Nat Rev Immunol 14: 759–767, 2014
1766 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 www.jasn.org BASIC RESEARCH
5. Braza F, Brouard S, Chadban S, Goldstein DR: Role of TLRs and DAMPs pattern-activated neutrophil extracellular trap exacerbates sterile in- in allograft inflammation and transplant outcomes. Nat Rev Nephrol 12: flammatory liver injury. Hepatology 62: 600–614, 2015 281–290, 2016 24.LinkermannA,SkoutaR,HimmerkusN,MulaySR,DewitzC,DeZen 6. Anders HJ: Four danger response programs determine glomerular and F, Prokai A, Zuchtriegel G, Krombach F, Welz PS, Weinlich R, tubulointerstitial kidney pathology: Clotting, inflammation, epithelial Vanden Berghe T, Vandenabeele P, Pasparakis M, Bleich M, and mesenchymal healing. Organogenesis 8: 29–40, 2012 Weinberg JM, Reichel CA, Bräsen JH, Kunzendorf U, Anders HJ, 7. Kumar SV, Kulkarni OP, Mulay SR, Darisipudi MN, Romoli S, Stockwell BR, Green DR, Krautwald S: Synchronized renal tubular Thomasova D, Scherbaum CR, Hohenstein B, Hugo C, Müller S, Liapis cell death involves ferroptosis. Proc Natl Acad Sci USA 111: 16836– H, Anders HJ: Neutrophil extracellular trap-related extracellular his- 16841, 2014 tones cause vascular necrosis in severe GN. JAmSocNephrol26: 25. Linkermann A, Bräsen JH, Darding M, Jin MK, Sanz AB, Heller JO, De 2399–2413, 2015 Zen F, Weinlich R, Ortiz A, Walczak H, Weinberg JM, Green DR, 8. Matthijsen RA, Huugen D, Hoebers NT, de Vries B, Peutz-Kootstra Kunzendorf U, Krautwald S: Two independent pathways of regulated CJ, Aratani Y, Daha MR, Tervaert JW, Buurman WA, Heeringa P: necrosis mediate ischemia-reperfusion injury. Proc Natl Acad Sci USA Myeloperoxidase is critically involved in the induction of organ 110: 12024–12029, 2013 damage after renal ischemia reperfusion. Am J Pathol 171: 1743– 26. Cantaluppi V, Quercia AD, Dellepiane S, Ferrario S, Camussi G, 1752, 2007 Biancone L: Interaction between systemic inflammation and renal tu- 9. Lech M, Römmele C, Gröbmayr R, Eka Susanti H, Kulkarni OP, Wang bular epithelial cells. Nephrol Dial Transplant 29: 2004–2011, 2014 S, Gröne HJ, Uhl B, Reichel C, Krombach F, Garlanda C, Mantovani A, 27. Knight JS, Zhao W, Luo W, Subramanian V, O’Dell AA, Yalavarthi S, Anders HJ: Endogenous and exogenous pentraxin-3 limits post- Hodgin JB, Eitzman DT, Thompson PR, Kaplan MJ: Peptidylarginine ischemic acute and chronic kidney injury. Kidney Int 83: 647–661, deiminase inhibition is immunomodulatory and vasculoprotective in 2013 murine lupus. JClinInvest123: 2981–2993, 2013 10. Hayama T, Matsuyama M, Funao K, Tanaka T, Tsuchida K, Takemoto Y, 28. Wong SL, Demers M, Martinod K, Gallant M, Wang Y, Goldfine AB, Kawahito Y, Sano H, Nakatani T, Yoshimura R: Benefical effect of neu- Kahn CR, Wagner DD: Diabetes primes neutrophils to undergo trophil elastase inhibitor on renal warm ischemia-reperfusion injury in NETosis, which impairs wound healing. Nat Med 21: 815–819, the rat. Transplant Proc 38: 2201–2202, 2006 2015 11. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss 29.HamA,RabadiM,KimM,BrownKM,MaZ,D’Agati V, Lee HT: Pep- DS, Weinrauch Y, Zychlinsky A: Neutrophil extracellular traps kill bac- tidyl arginine deiminase-4 activation exacerbates kidney ischemia- teria. Science 303: 1532–1535, 2004 reperfusion injury. Am J Physiol Renal Physiol 307: F1052–F1062, 12. Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, 2014 Weinrauch Y, Brinkmann V, Zychlinsky A: Novel cell death program 30. Desai J, Kumar SV, Mulay SR, Konrad L, Romoli S, Schauer C, Herrmann leads to neutrophil extracellular traps. JCellBiol176: 231–241, M, Bilyy R, Müller S, Popper B, Nakazawa D, Weidenbusch M, 2007 Thomasova D, Krautwald S, Linkermann A, Anders HJ: PMA and crystal- 13. Li P, Li M, Lindberg MR, Kennett MJ, Xiong N, Wang Y: PAD4 is es- induced neutrophil extracellular trap formation involves RIPK1-RIPK3- sential for antibacterial innate immunity mediated by neutrophil ex- MLKL signaling. Eur J Immunol 46: 223–229, 2016 tracellular traps. JExpMed207: 1853–1862, 2010 31. Gupta AK, Giaglis S, Hasler P, Hahn S: Ef ficient neutrophil extracellular 14. Remijsen Q, Kuijpers TW, Wirawan E, Lippens S, Vandenabeele P, trap induction requires mobilization of both intracellular and extracel- Vanden Berghe T: Dying for a cause: NETosis, mechanisms behind an lular calcium pools and is modulated by cyclosporine A. PLoS One 9: antimicrobialcelldeathmodality.Cell Death Differ 18: 581–588, e97088, 2014 2011 32. Ware LB, Matthay MA: The acute respiratory distress syndrome. NEngl 15. Scheel PJ, Liu M, Rabb H: Uremic lung: New insights into a forgotten JMed342: 1334–1349, 2000 condition. Kidney Int 74: 849–851, 2008 33. Bathe M, Shirai A, Doerschuk CM, Kamm RD: Neutrophil transit times 16. Faubel S, Edelstein CL: Mechanisms and mediators of lung injury after through pulmonary capillaries: The effects of capillary geometry and acute kidney injury. Nat Rev Nephrol 12: 48–60, 2016 fMLP-stimulation. Biophys J 83: 1917–1933, 2002 17. Klein CL, Hoke TS, Fang WF, Altmann CJ, Douglas IS, Faubel S: 34. Doi K, Ishizu T, Tsukamoto-Sumida M, Hiruma T, Yamashita T, Interleukin-6 mediates lung injury following ischemic acute kidney Ogasawara E, Hamasaki Y, Yahagi N, Nangaku M, Noiri E: The high- injury or bilateral nephrectomy. Kidney Int 74: 901–909, 2008 mobility group protein B1-Toll-like receptor 4 pathway contributes to 18. Yap SC, Lee HT: Acute kidney injury and extrarenal organ dysfunction: the acute lung injury induced by bilateral nephrectomy. Kidney Int 86: New concepts and experimental evidence. Anesthesiology 116: 1139– 316–326, 2014 1148, 2012 35. Chen Q, Guan X, Zuo X, Wang J, Yin W: The role of high mobility group 19. Allam R, Scherbaum CR, Darisipudi MN, Mulay SR, Hägele H, box 1 (HMGB1) in the pathogenesis of kidney diseases. Acta Pharm Sin Lichtnekert J, Hagemann JH, Rupanagudi KV, Ryu M, Schwarzenberger B 6: 183–188, 2016 C, Hohenstein B, Hugo C, Uhl B, Reichel CA, Krombach F, Monestier M, 36. Chen R, Kang R, Fan XG, Tang D: Release and activity of histone in Liapis H, Moreth K, Schaefer L, Anders HJ: Histones from dying renal diseases. Cell Death Dis 5: e1370, 2014 cells aggravate kidney injury via TLR2 and TLR4. JAmSocNephrol23: 37. Gillrie MR, Lee K, Gowda DC, Davis SP, Monestier M, Cui L, Hien TT, 1375–1388, 2012 Day NP, Ho M: Plasmodium falciparum histones induce endothelial 20. Kessenbrock K, Krumbholz M, Schönermarck U, Back W, Gross WL, proinflammatory response and barrier dysfunction. Am J Pathol 180: Werb Z, Gröne HJ, Brinkmann V, Jenne DE: Netting neutrophils in 1028–1039, 2012 autoimmune small-vessel vasculitis. Nat Med 15: 623–625, 2009 38. Marschner JA, Schäfer H, Holderied A, Anders HJ: Optimizing mouse 21. Nakazawa D, Kumar SV, Desai J, Anders HJ: Neutrophil extracellular surgery with online rectal temperature monitoring and preoperative traps in tissue pathology. Histol Histopathol 2016: 11816, 2016 heat supply. Effects on post-ischemic acute kidney injury. PLoS One 11: 22. Allam R, Kumar SV, Darisipudi MN, Anders HJ: Extracellular his- e0149489, 2016 tones in tissue injury and inflammation. JMolMed(Berl)92: 465– 39. Li Y, Liu B, Fukudome EY, Lu J, Chong W, Jin G, Liu Z, Velmahos GC, 472, 2014 Demoya M, King DR, Alam HB: Identification of citrullinated histone 23. Huang H, Tohme S, Al-Khafaji AB, Tai S, Loughran P, Chen L, Wang S, H3 as a potential serum protein biomarker in a lethal model of Kim J, Billiar T, Wang Y, Tsung A: Damage-associated molecular lipopolysaccharide-induced shock. Surgery 150: 442–451, 2011
J Am Soc Nephrol 28: 1753–1768, 2017 Neutrophil Extracellular Traps Exacerbate Ischemic AKI 1767 BASIC RESEARCH www.jasn.org
40. Sayah DM, Mallavia B, Liu F, Ortiz-Muñoz G, Caudrillier A, DerHovanessian 43. Allam R, Darisipudi MN, Rupanagudi KV, Lichtnekert J, Tschopp J, A, Ross DJ, Lynch JP 3rd, Saggar R, Ardehali A, Ware LB, Christie JD, Anders HJ: Cutting edge: Cyclic polypeptide and aminoglycoside an- Belperio JA, Looney MR; Lung Transplant Outcomes Group Investigators: tibiotics trigger IL-1b secretion by activating the NLRP3 inflammasome. Neutrophil extracellular traps are pathogenic in primary graft dysfunction JImmunol186: 2714–2718, 2011 after lung transplantation. AmJRespirCritCareMed191: 455–463, 2015 41. Najmeh S, Cools-Lartigue J, Giannias B, Spicer J, Ferri LE: Simplified Human Neutrophil Extracellular Traps (NETs) isolation and handling. J Vis Exp 98: 10.3791/52687, 2015 See related editorial, “Neutrophil Extracellular Traps Orchestrate Necroinflam- 42.NakazawaD,ShidaH,TomaruU,YoshidaM,NishioS,AtsumiT, mation,” on pages 1670–1672. Ishizu A: Enhanced formation and disordered regulation of NETs in myeloperoxidase-ANCA-associated microscopic polyangiitis. JAm This article contains supplemental material online at http://jasn.asnjournals. Soc Nephrol 25: 990–997, 2014 org/lookup/suppl/doi:10.1681/ASN.2016080925/-/DCSupplemental.
1768 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 1753–1768, 2017 Supplemental Figure 1
KIM1 NE DAPI Overlay ATN case1
ATN Case 2 overlay
Healthy kidney 1
Healthy kidney 2
Supplement Figure 1. The presence of neutrophils in injured tubules of renal allogra biopsies with acute tubular necrosis (Top and second from top) and healthy kidney samples (second from bo om and bo om) Each staining shows KIM1: Red, neutrophil elastase (NE): Green, DAPI staining: Blue and overlay. NE posi ve neutrophils were detected in KIM1-high expressed tubulointers al space of ATN sample. Scale Bar: 25um. Supplemental Figure 2
A 20%O2 24h Hypoxia 24h PMA 25nM 3h
DAPI
CitH3 B C D
Time course NETs 30 1.0 10 Normal O2 0.8 8 Hypoxia N.S 20 N.S N.S 0.6 6 N.S 10 N.S 0.4 4 0.2 2 0 0.0 0 CitH3/DAPI area ra o (%) CitH3/DAPI area ra o (%)
MPO-DNA complexes (O.D) 20%O Hypo PMA 3h 6h 24h 20%O2 Hypo PMA 2 24h 24h 24h 24h E Condi oned NETs media→fresh neutrophil
Uns mulated PMA-s mulated Necro media-s mulated neutrophil media neutrophil media neutrophil media
CitH3
(Overlay) CitH3/ DAPI F * Unstimulated
60 * neutropil media
40 PMA-stimulated neutrophil media 20 NecroTC media CitH3/DAPI area ra o (%) -stimulated 0 neutrophil media
Supplement Figure 2. Neutrophil under hypoxia condi on and the influence of NETs to other neutrophils. Neutrophils were treated with normal oxygen (20% O2) and hypoxia condi on (1%) for 3, 6, 24 hours. (A) Immunofluorescence images show the presence of NETs using CitH3 (Red) and DAPI (Blue) in neutrophils treated with 20%O2 (24hours), hypoxia (24hours), and 25nM PMA for 3hours. (B-C) The graph shows the NETs quan fica on of immunostaining (B) and MPO-DNA complexes (C) of neutrophil supernatant. (D) The graph shows NETs area in 3, 6, 24 hours a er incuba on
(20%O2, hypoxia). Scale Bar: 100um. (E) NETs media induced by PMA and necro c TCs media were applied to fresh healthy neutrophil. A er 4 hours of incuba on, NETs were detected by immunostaining (CitH3:Red, DAPI: Blue) and the ra o of CitH3 / DAPI posi ve area were quan fied as NETs area. Scale Bar: 50um. Data represent the means±SEM of 3-6 independent experiments, and were analysed using Student’s t-test.*P<0.05, N.S: not significant. Supplemental Figure 3
A B CitH3 expression in unilateral IRI kidney 0.5 0.4 n=4 0.3 0.2 Contralateral Kidney CitH3/ Ac n Ra o (AU)
0.1 0.0
6H 15H 24H 72H
IRI kidney Sham (After reperfusion time) Red: Ly6b, Brown: CitH3
C Circula ng NET D Circula ng extracellular DNA
* 150 * 0.8 * *
0.6 100 0.4 50 (450nm O.D) 0.2 NE-DNA complexes Fluorescence 485nm 0.0 0
6H 6H 15H 24H 72H 15H 24H 72H Sham Sham
Supplement Figure 3. Focal and systemic NETs evidence of IRI kidney model. (A) Representa ve immunohistochemistry staining of unilateral IRI kidney and contralateral kidney (Ischemia 35min, 24hours a er reperfusion model) using Ly6b (Red) and CitH3 (Brown). Scale bar: 25um. (B) CitH3 expression of westernblo ng in unilateral IRI (ischemia 35min) kidney was quan fied at different reperfusion me point (sham, 6h, 15h, 24h, 72hours) using Image J so ware. β-ac n was used as loading control. (C) Circula ng NETs and circula ng extracellular DNAs (D) in plasma of unilateral IRI (ischemia 35min) kidney model were determined by NE-DNA complexes ELISA and PicoGreen assay, respec vely. Data are means±SEM from five mice in each group. *P<0.05 versus respec ve control. Supplemental Figure 4
A B Tubular Injury (%) 17kDa- (%) 80 (CitH3) Cortex 80 Outer Medulla 42kDa- 60 60 Sham (β-ac n) 1 2 3 4 5 6 7 8 9 IR+Vehicle 40 40 IR+PADinh 20 20 IR+Neut dep IgG 1: Sham1 IR+ConIgG
0 0
2, 3: IR+Vehicle1, 2 Cast
4, 5: IR+PADinh Cast Dila on
6, 7: IR+Neut dep IgG Dila on 8, 9: IR+Con IgG Inflamma on Necro c area Inflamma on Necro c area C TNFa mRNA CCL2 mRNA IL-6 mRNA ** p=0.07 20 *** ** p=0.06 ** 15 10 * ** ** 15 8 10 6 10 4 18s (fold) 5 5 2
Rela ve expression/ 0 0 0 PAD4 mRNA KIM1mRNA NGAL mRNA * * ** * 10 p=0.07 p=0.05 p=0.06 p=0.09 ** 8 * * * 20 8 6 15 Sham 6 IR+Vehicle 4 10 4 IR+PADinh 18s (fold) 2 5 IR+Neut dep IgG 2 IR+ConIgG
Rela ve expression/ 0 0 0
Supplement Figure 4. NET inhibitor ameliorate Bilateral IRI kidney via suppressing NETs forma on. (A) The protein expression of CitH3 in sham mice and bilateral IRI kidney model mice treated with vehicle, PAD inhibitor, neutrophil deple on IgGs and control IgGs. (B) Histological findings in cortex and outer medulla lesion of IRI kidney were evaluated by the presence of necrosis, dila on of tubular duct, inflammatory cells and casts. (C) Real- me RT-PCR for TNF-a, CCL2, IL-6, PAD4, KIM1 and NGAL mRNA on renal ssue of bilateral IRI kidney model. Data are means±SEM from at least five mice in each group. *P<0.05, **P<0.01, ***P<0.01 versus respec ve control. Supplemental Figure 5
A. RT-PCR expression of inflamma on and kidney injury CCL2 mRNA IL-6 mRNA TNFa mRNA Vehicle
** ** Nec In * 1.5 ** 1.5 **
1.5 ** Nec In+PAD In 1.0 1.0 p=0.13 1.0
0.5 0.5 0.5 18s (fold)
0.0 0.0 0.0 Rela ve expression/ PAD4 mRNA KIM1 mRNA NGAL mRNA ** ** ** 0.4 1.5 1.5 * 1.0
* 1.0 1.0 0.5 0.2 0.5 18s (fold) 0.5
0.0 0.0 0.00.0 Rela ve expression/
Supplement Figure 5. NET inhibi on has addi onal effects of an -inflamma on and an - injury on necrosis inhibi on. Real- me RT-PCR for TNF-a, CCL2, IL-6, PAD4, KIM1 and NGAL mRNA on renal ssue of bilateral IRI kidney model mice treated with vehicle, necrosis inbibitor (Nec In) and the combina on Nec In and PAD inhibitor (PAD In). Data are means ±SEM from at least five mice in each group. *P<0.05, **P<0.01, ***P<0.01 versus respec ve control. Supplement Figure 6
A Histone-nucleosome B Western blot of CitH3/b-ac n (AU) ** IRI kidney
* aHis aHis 2.0 1.5 Con * IgG1 IgG2 1.5 1.0 17kDa- CitH3 1.0
0.5 42kDa- 0.5 405nm O.D. β-Ac n 0.0 0.0 Sham IRI LPS sepsis IR+Control model IR+aHis IgG C RT-PCR expression of inflamma on and kidney injury IR+Control IR+aHis IgG TNFa mRNA CCL2 mRNA IL-6 mRNA 1.5 * 1.5 1.5
* 1.0 1.0 1.0
0.5 0.5 0.5 18s (fold)
0.0 0.0 0.0 Rela ve expression/
PAD4 mRNA KIM1 mRNA NGAL mRNA p=0.11 1.5 1.5 * 1.5
1.0 1.0 1.0 18s (fold) 0.5 0.5 0.5 Rela ve expression/ 0.0 0.0 0.0
Supplement Figure 6. Histone blockage reduce the NETs and kidney injury in IRI kidney. (A) Histone nucleosome complexes in plasma of sham operated mice, bilateral IRI mice and LPS injected sepsis model mice. (B) Representa ve western blot image of CitH3 expression in IRI kidney treated with control or aHisAbs (le ) and quan fica on, normalized to βac n expression (right). (C) Real- me RT-PCR for TNF-a, CCL2, IL-6, PAD4, KIM1 and NGAL mRNA on renal ssue of bilateral IRI kidney model treated with control or aHisAbs. Data are means ±SEM from at least five mice in each group. *P<0.05, versus respec ve control. Supplement Figure 7 A Sham 6H 15h 24H (reperfusion)
Ly6b (IHC)
Ly6b (IF)
CitH3 (IF)
B (%) Ly6b posi ve area (%) CitH3 posi ve area (%) CitH3/Ly6b posi ve ra o
1.0 0.15 25 0.8 20 0.10 0.6 15 0.4 0.05 10 0.2 5
0.0 0.00 0
6h 6h 6h 15h 24h 15h 24h 15h 24h Sham Sham Sham Reperfusion Reperfusion Reperfusion C 0.3 *
0.2
0.1 (450nm O.D)
0.0
NE-DNA complexes in BAL supernatant 6h 15h 24h Sham Sham
Reperfusion Vehicle Uni IRI kidney Bilateral IRI kidney (ischemic 35min) (ischemic 35min, reperfusion 24h)
Supplement Figure 7. The presence of lung NETs followed IRI kidney. (A) Lung inflamma on followed unilateral IRI (ischemia 35min) kidney at different reperfusion me was determined by immunostaining of Ly6b (immunohistochemistry, upper figures), Ly6b (immunofluorescence staining: IF, middle figures) and CitH3 (IF, lower figures). (B) Graphs show the Ly6b (IF) posi ve area (le ), CitH3 (IF) area (middle), and the ra o of CitH3/Ly6b (right). (C) NE-DNA complexes in BAL supernatant of unilateral IRI (sham, Ischemia 35min, reperfusion: 6, 15, 24h) and bilateral IRI (sham, Ischemia 35min, reperfusion 24h) kidney mice was measured by ELISA method. Scale Bar: 50um. Data show the means±SEM from at least five mice in each group. *P<0.05, **P<0.01, ***P<0.01 versus respec ve. IHC: immunohistochemistry. IF: immunofluorescence. Supplement Figure 8 Ischemia Reperfusion Necroinflamma on Dynamics Molecular signaling pathway Tubular cell
1st event Tubular necrosis Bax, RIP1/RIP3 ROS↑ /pMLKL↑ GPX4↓
MPT-RN Necroptosis Ferroptosis
2nd event NETosis DAMPs release NETs Neutrophil
Histone citrullina on↑ pre NET ng neutrophil NETs release↑ DAMPs release↑
Remote organ injury
Healthy tubular cell Necro c tubular cells Histones DAMPs
cytokines immune cells
Supplement Figure 8. Concept of necroinflamma on characterized by an auto-amplifica on of NETs and necrosis. Our in vivo and in vitro data suggest that IRI induces the necrosis of TCs as a first event. Subsequently, DAMPs such as histones released by dead TCs elicit direct cytotoxicity to the surrounding cells and ac vate infiltra ng neutrophils to undergo NETosis. Furthermore, NETs induce addi onal injury to TCs via their content of pathogenic histones. During this process, dead TCs and NETs-derived DAMPs induce inflamma on, which is involved in the further recruitment of cytokine-producing leukocytes. Pathogenic cytokines such as TNF-α and IL-6, which circulate systemically in AKI, could induce regulated cell death as a secondary step and thus accelerate tubular necrosis and renal dysfunc on. As well as being a local issue in injured kidney, NET-forming neutrophils could reach the lung to cause pulmonary injury, and DAMPs derived from NETs and TCs may contribute to systemic organ dysfunc on. Simultaneously, cell death related molecules are ac vated during this dynamics. For necrosis, necroptosis, ferroptosis and MPT-RN develop in tubules, via RIPK1/RIPK3/MLKL kinesis, GPX4, ROS ac va on leading to leakage of DAMPs. This induces the histone citrullina on of neutrophils to undergo NETosis. Therefore, the combina on of TC necrosis and NETs forma on underpins the auto-amplifica on loop of necroinflamma on, which exacerbates renal and remote organ failure.