INVESTIGATION

A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae

Eugenia T. Prescott, Alexias Safi, and Laura N. Rusche1 Institute for Genome Sciences and Policy and Biochemistry Department, Duke University, Durham, North Carolina 27710

ABSTRACT Extended heterochromatin domains, which are repressive to transcription and help define centromeres and telomeres, are formed through specific interactions between silencing proteins and nucleosomes. This study reveals that in Saccharomyces cerevisiae, the same nucleosomal surface is critical for the formation of multiple types of heterochromatin, but not for local repression mediated by a related transcriptional repressor. Thus, this region of the nucleosome may be generally important to long-range silencing. In S. cerevisiae, the Sir proteins perform long-range silencing, whereas the Sum1 complex acts locally to repress specific genes. A mutant form of Sum1p, Sum1-1p, achieves silencing in the absence of Sir proteins. A genetic screen identified mutations in histones H3 and H4 that disrupt Sum1-1 silencing and fall in regions of the nucleosome previously known to disrupt Sir silencing and rDNA silencing. In contrast, no mutations were identified that disrupt wild-type Sum1 repression. Mutations that disrupt silencing fall in two regions of the nucleosome, the tip of the H3 tail and a surface of the nucleosomal core (LRS domain) and the adjacent base of the H4 tail. The LRS/H4 tail region interacts with the Sir3p bromo-adjacent homology (BAH) domain to facilitate Sir silencing. By analogy, this study is consistent with the LRS/H4 tail region interacting with Orc1p, a paralog of Sir3p, to facilitate Sum1-1 silencing. Thus, the LRS/H4 tail region of the nucleosome may be relatively accessible and facilitate interactions between silencing proteins and nucleosomes to stabilize long-range silencing.

HE formation of silenced chromatin, or heterochromatin, In S. cerevisiae, silenced chromatin domains associated Tin eukaryotes is important for proper gene regulation and with Sir proteins are found at the cryptic mating-type loci chromosome stability and helps define centromeres and te- HMLa and HMRa and subtelomeric regions (Rusche et al. lomeres. One interesting property of heterochromatin is its 2003). A distinct form of silencing occurs in the rDNA repeats capacity to spread along a chromosome to form an extended, and is mediated by the RENT complex. Strains lacking Sir2p, repressive domain. This spreading is enabled by specific in- Sir3p,orSir4p lose silencing at the mating-type loci and con- teractions between silencing proteins and nucleosomes. Con- sequently express both a and a mating-type information, re- sequently,particular surfaces on the nucleosome can be critical sulting in the loss of cell-type identity and an inability to mate. to the assembly of heterochromatin. This study reveals that Interestingly, silencing and mating can be restored by the in the budding yeast Saccharomyces cerevisiae, the same nu- SUM1-1 mutation, which was originally identified as a sup- cleosomal surface is critical for the formation of three types pressor of a sir2D mutation (Klar et al. 1985). The SUM1-1 of silenced chromatin, mediated by the Sir, RENT, or Sum1-1 mutation results from a single-amino-acid change (Chi and complexes, suggesting that this region of the nucleosome may Shore 1996), which enables the Sum1 repressor that normally be generally important to long-range silencing. does not spread to form an extended silenced domain (Rusche and Rine 2001; Sutton et al. 2001). The ability of mutant Sum1-1p to spread suggests that Sum1-1p or an associated Copyright © 2011 by the Genetics Society of America protein interacts with nucleosomes and raises the question of doi: 10.1534/genetics.111.129197 Manuscript received March 30, 2011; accepted for publication May 2, 2011 whether the wild-type, nonspreading Sum1 complex also in- Supporting information is available online at http://www.genetics.org/content/suppl/ teracts with nucleosomes. To address these issues, we identi- 2011/05/05/genetics.111.129197.DC1. fi 1Corresponding author: Institute for Genome Science and Policy, Box 3382, Duke ed histone residues important for silencing mediated by the University, Durham, NC 27710. E-mail: [email protected] mutant Sum1-1 complex and the wild-type Sum1 complex.

Genetics, Vol. 188, 535–548 July 2011 535 Sir silencing at the cryptic mating-type loci is initiated at ORC-binding sites (Rusche and Rine 2001; Sutton et al. 2001; the flanking E and I silencers, which contain binding sites for Lynch et al. 2005). Thus, the SUM1-1 mutation changes the the origin recognition complex (ORC) and the transcription location and function of the complex, from a locus-specific factors Rap1p and Abf1p. These factors recruit the Sir pro- repressor to a regional silencer. We predicted that Sum1-1p teins. Orc1p, the largest subunit of ORC, interacts directly or another component of the Sum1-1 complex interacts with with Sir1p, stabilizing the Sir proteins at the silencer (Triolo histones to enable the complex to spread. However, such an and Sternglanz 1996; Gardner et al. 1999). Sir2p is a NAD1- interaction has not been documented. dependent deacetylase (Imai et al. 2000; Landry et al. 2000; To investigate how the mutant Sum1-1 complex contacts Smith et al. 2000), and deacetylation of nucleosomes in the nucleosomes and to determine whether such an interaction vicinity of the silencers facilitates the binding of Sir3p and is also important for repression mediated by wild-type Sum1p, Sir4p, allowing the Sir complex to propagate along the chro- we conducted genetic screens for mutations in histones H3 mosome through a sequential deacetylation mechanism (Hoppe and H4 that disrupt Sum1-1 silencing or Sum1 repression. We et al. 2002; Rusche et al. 2002). discovered that the same region of the nucleosome is impor- Sir3p is proposed to have two distinct histone-binding tant for silencing mediated by the mutant Sum1-1, Sir, or RENT domains. A C-terminal histone-binding domain interacts with complexes but this region is not critical for Sum1 repression. In histone tails (Hecht et al. 1995; Carmen et al. 2002), and the addition, we present evidence that this region interacts with N-terminal bromo-adjacent homology (BAH) domain binds the Orc1p BAH domain to facilitate Sum1-1 silencing. the base of the histone H4 tail and an adjacent surface on the nucleosome core termed the LRS region (Onishi et al. 2007; Methods Buchberger et al. 2008; Norris et al. 2008; Sampath et al. 2009). Many mutations in histones that disrupt Sir silencing Yeast strains are thought to act by decreasing the affinity of Sir3p for S. cerevisiae strains were derived from W303-1b and are de- nucleosomes. These include mutations in the histone H4 tail scribed in supporting information, File S1 and Table S1. The (Johnson et al. 1990, 1992; Park and Szostak 1990; Altaf et al. SUM1-1,3myc-SUM1, 7myc-SUM1-1, sir2D::HIS3, sir3D:: 2007) and the LRS region (Park et al. 2002; Thompson et al. LEU2, hst1D::KanMX (Rusche and Rine 2001), pPES4-HIS3

2003; Buchberger et al. 2008; Norris et al. 2008; Sampath (Hickman and Rusche 2007), URA3::(lexAop)8-lacZ, LYS2: et al. 2009). Mutations that disrupt silencing have also been (lexAop)4-HIS3 (Hollenberg et al. 1995), and VR-ADE2-TEL identified in H2A and H2B (Dai et al. 2010; Kyriss et al. 2010), (Singer and Gottschling 1994) alleles were previously described. although the mechanism by which they act remains unknown. Plasmids In the cell, interactions between Sir proteins and nucleosomes are regulated by post-translational modifications. For example, Plasmids were constructed as described in File S1 and Table deacetylation of histones by Sir2p is thought to increase their S2, Table S3, Table S4, and Table S5. pDM9 (HHT1 HHF1), affinity for Sir3p (Megee et al. 1990; Johnson et al. 1992; pDM18 (HHT2 HHF2) (Duina and Winston 2004), pJR2292 Carmen et al. 2002; Altaf et al. 2007). In addition, the affinity (3myc-SUM1), pJR2291 (3myc-SUM1-1) (Rusche and Rine of Sir3p for nucleosomes is modulated by methylation of H3 2001), pLR052 (3HA-SUM1), pLR047 (3HA-SUM1-1) (Safi K4 (Santos-Rosa et al. 2004) and H3 K79, located within the et al. 2008), pTT93 (LexA-ORC5), pGAD424 (GAD), pRH01 LRSregion(VanLeeuwenet al. 2002). Thus, mutations that (GAD-SUM1), pRH02 (GAD-SUM1-1) (Sutton et al. 2001), mimic or block these modifications can also affect silencing. pRM430 (HHT2D4-30), and pGF29 (HHF2D4-28)(Linget al. Unlike the Sir proteins, wild-type Sum1p does not form 1996) were previously described. Point mutations to histones an extended silenced domain. Sum1p is a DNA-binding pro- H3 and H4 were obtained from Jef Boeke (Fry et al. 2006) tein that recognizes a motif found in the promoters of some and Michael Grunstein (Kayne et al. 1988; Johnson et al. midsporulation, NAD1 biosynthesis, and a-specific genes 1990) or were constructed as described. (Xie et al. 1999; Bedalov et al. 2003; Pierce et al. 2003; Zill Genetic screen for histone mutations and Rine 2008). Sum1p works with Hst1p, an NAD1-depen- dent deacetylase related to Sir2p (Xie et al. 1999; McCord To generate mutations in histones H3 and H4, the gene of et al. 2003). The mutant form of Sum1p, Sum1-1p, contains interest was amplified using error-prone PCR [0.2 mM dNTPs, a single-amino-acid change (T988I) that redirects Sum1-1p to 0.5 mM primers, 1.2 mM MnCl2, 5 ng plasmid pDM18, and the cryptic mating-type loci through interactions with ORC. 0.75 unit Taq (Roche) (5 units/ml) in 50 ml denatured for We have proposed that the SUM1-1 mutation acts by changing 3minat94°,followedby32cyclesof15secat94°, 15 sec of the binding partners of Sum1p.Inparticular,lossofT988 55°, and 2 min at 68°]. The HHT2 gene (H3) was amplified reduces the affinity of Sum1p for its DNA consensus sequence, from pDM18 using primers (GGCTATGGCTCGGTGTCAAA) and the presence of isoleucine at position 988 increases the and (GCCCCGCAATTATGTCTGTAAA), and the HHF2 gene tendency of the protein to self-associate (Safi et al. 2008), (H4) was amplified using primers (TACATACGTGTTTGTGC- which may enable it to spread along chromatin. Additionally, GTAT) and (CCAGGGTTTTCCCAGTCAC). The resultant col- the T988I mutation increases the affinity of Sum1-1p for ORC, lection of PCR products was integrated into plasmid pDM18 leading to the recruitment of Sum1-1p to HMRa and other by homologous recombination in yeast cells (Muhlrad et al.

536 E. T. Prescott, A. Safi, and L. N. Rusche 1992). Specifically, pDM18 was digested with BglII and EcoRI dilutions were prepared, and 3 mlofeachdilutionwasspotted to remove HHF2 or with AflII and RsrII to remove HHT2,and onto rich medium (YPD) to monitor growth or medium lacking yeast (LRY1450 or LRY1849) were simultaneously transfor- histidine to monitor Sum1 repression. med with the gapped plasmid (100 ng), PCR product (200 Chromatin immunoprecipitation ng), and 30 mg salmon sperm DNA (Stratagene, La Jolla, CA). Colonies containing repaired plasmids, many of which con- Chromatin immunoprecipitation (ChIP) was performed as tained mutations, were selected on medium lacking trypto- previously described (Rusche and Rine 2001). Two indepen- phan and replica plated to medium lacking tryptophan with dent cultures of each strain were grown, and 50 OD equiv- 0.1% 5-fluoroorotic acid (5-FOA) to select for cells that lost alents of cells were cross-linked with 1% formaldehyde for pDM9-bearing wild-type H3 and H4 with URA3. 30 min. Lysis and subsequent steps were as described using To identify histone mutations that disrupted Sum1-1 si- 3 ml of antibody [anti-myc (Millipore 06-549), anti-HA (Milli- lencing, parent strain LRY1450 was used. Colonies were rep- pore H6908), anti-H3 (Upstate 06-755), anti-H3 K4 Me2 (Up- lica plated to a lawn of the opposite mating type (LRY1021 state 07-030), and anti-H3 K4 Me3 (Millipore 04-745)]. MATa his4) on minimal plates to select for prototrophic dip- Samples were quantified relative to a standard curve pre- loids. Over 13,000 colonies were screened, and 163 colonies pared from input DNA using real-time PCR with SYBR Green failed to mate. Plasmids were isolated from these yeast, am- on a Bio-Rad (Hercules, CA) iCycler as described (Safi et al. plified in Escherichia coli, and incorporated back into the re- 2008). Data represent the average of two independent IPs for porter strain to confirm the nonmating phenotype. Plasmids each strain, each analyzed in two independent PCR reactions. that disrupted mating are listed in Table S3. Error bars represent the standard error. Oligonucleotide se- To identify histone mutations that disrupted Sum1 re- quences are listed in Table S6. pression, parent strain LRY1849 was used. Colonies were For immunoprecipitation of Gal4DBD-myc-SUM1-1 and replica plated to medium lacking histidine and leucine to ORC1-HA (Figure 4), immunoprecipitation was performed identify those that failed to repress Sum1p-regulated report- as previously described (Hickman and Rusche 2007), using ers pPES4-HIS3 and pYGL138C-LEU2. Over 17,000 colonies a second cross-linking agent (Kurdistani et al. 2002). Fifty were screened, and 80 colonies grew on medium lacking OD equivalents of cells were cross-linked for 1 hr in 10 ml histidine and leucine. Plasmids were isolated and retested, cold DMA (PBS with 10 mM dimethyl adipimidate, 0.25% and none of these plasmids enabled growth on medium DMSO), followed by 1 hr in 1% formaldehyde. Lysis lacking histidine and leucine. Twelve representative plas- and subsequent steps were as described above. Each sam- mids were sequenced and confirmed to have nucleotide ple was analyzed relative to a standard curve prepared and amino acid substitutions in the histone genes. from its own input DNA to control for plasmid copy number differences. Reporter assays Co-immunoprecipitation For the semiquantitative mating assay, one optical density (OD) equivalent of logarithmically growing cells was resus- Co-immunoprecipitations (co-IPs) were performed as previously pended in 100 ml yeast minimal medium (YM). Tenfold serial described (Rusche and Rine 2001; Safi et al. 2008), using 30 ODs dilutions were prepared, and 3 ml of each dilution was spotted of cells grown in medium lacking leucine and adenine to main- onto rich medium (YPD) or medium containing 5-FOA and tain plasmids. Cleared lysates were incubated with 5 mlrabbit lacking tryptophan to monitor growth. For mating, an equal polyclonal IgG antibodies [anti-myc (Upstate 06-549) and anti- volume of a tester strain of the opposite mating type HA (Upstate 05-902)] at 4° overnight and then with 60 ml (LRY1021 MATa his4 or LRY1022 MATa his4) at 10 OD equiv- protein A agarose beads (Upstate) for 1 hr. Samples were elec- alents per ml in YPD was mixed with each sample in the trophoretically fractionated on 7.5% polyacrylamide–SDS gels, dilution series. Three microliters of this mixture was spotted transferred to membranes, and probed using mouse monoclo- onto minimal medium to select for the growth of prototrophic nal antibodies (Upstate; 05-724 and 05-904). diploids. Yeast were grown at 30° for 3 days before imaging. RNA isolation and quantitative reverse To assess telomeric silencing, a reporter yeast strain transcriptase PCR (LRY2423) contained an ADE2 reporter gene integrated at telomere VR (Singer and Gottschling 1994) and lacked chro- RNA was isolated as described previously (Schmitt et al. 1990), mosomal histone genes. Tenfold serial dilutions were pre- and cDNA was synthesized and quantified as previously de- pared, and 10 ml of the 10,000-fold dilution was spread onto scribed (Hickman and Rusche 2007). The standard curve YPD medium. Yeast were grown at 30° for 3 days and placed was generated with genomic DNA isolated from wild-type at 4° for 7 days to allow color development before imaging. W303-1b. SUM1, HST1, RFM1, and ORC1 transcript levels Light pink, red, and sectored colonies were scored as (1) for were calculated relative to NTG1 and then normalized to the maintaining telomeric silencing, and white colonies were wild-type strain. Results represent the average of two inde- scored as (2) for silencing defective. pendently grown cultures for each strain, each analyzed in To assess Sum1 repression of PES4, the reporter yeast strain two independent PCR reactions. Error bars represent the stan- was LRY1793 containing reporter pPES4-HIS3.Tenfoldserial dard error. Oligonucleotide sequences are listed in Table S6.

Histones Contribute to Sum1-1 Silencing 537 Two-hybrid assay Two-hybrid interactions were detected through activation of a LacZ reporter construct as previously described (Safi et al. 2008). To assay for b-galactosidase activity, yeast were grown for 18 hr directly on a Magna Graph Nylon membrane (GE, NJOHY08250) placed on a YPD plate. The filter was flash frozen in liquid nitrogen, placed onto filter paper soaked in developing solution [65 mM sodium phosphate, pH 7.0, 10 mM KCl, 1 mM MgSO4, 0.6% b-mercaptoethanol, and 1% x-gal stock (100 mg/ml in N,N-dimethyl formamide)], and developed for 2 hr at 37° in a closed container.

Results Genetic screen for histone mutations that disrupt Sum1-1 silencing To identify mutations in histones H3 and H4 that disrupt Sum1-1 silencing, we developed a genetic screen employing a plasmid shuffling strategy (Figure 1A, left column). A re- porter yeast strain contained the SUM1-1 mutation and a sir2 deletion so Sum1-1 silencing could be assessed indepen- dently of Sir silencing. In addition, the essential histone H3 and H4 genes were deleted from their chromosomal loca- tions and provided on a plasmid bearing a URA3 marker. Mu- tations were generated in the histone H3 or H4 genes using error-prone PCR, and these mutated histone genes were in- corporated into the reporter strain on plasmids bearing the TRP1 marker. Finally, the wild-type histone genes were shuf- fled out by selecting against the URA3 marker. The efficacy of Sum1-1 silencing in the presence of these histone muta- tions was assessed using a mating assay (Figure 1B), as loss of silencing at HMRa in these MATa cells leads to simulta- neous expression of a and a mating-type information and sterility. Plasmids from colonies that failed to mate were isolated, amplified in E. coli, and reexamined in the reporter strain to confirm that the mating defect was linked to the plasmid. Over 13,000 colonies were screened: 7500 for H3 and 5700 for H4. Forty-eight plasmids were recovered that conferred a mating defect, each containing one to six muta- tions (Figure 1C). To identify those mutations that disrupted Sum1-1 silenc- ing, plasmids containing single-amino-acid mutations were Figure 1 Genetic screens for mutations in histones H3 and H4 that generated and tested in a semiquantitative assay for their disrupt Sum1-1 silencing or Sum1 repression. (A) Reporter yeast strains ability to disrupt mating. These single mutations were gen- were transformed with a library of mutated histone genes generated by homologous recombination between a PCR product, generated under erated by site-directed mutagenesis or were obtained from error-prone conditions, and a linearized vector (pDM18), the ends of existing sources (Kayne et al. 1988; Johnson et al. 1990; Fry which were homologous to the PCR product. Shaded bars indicate the et al. 2006; Dai et al. 2008). For each mutation, the fraction digestion sites. The reporter strains had their only copies of the H3 and H4 genes on a URA3-containing plasmid (pDM9), which was subsequently shuffled out by selecting for 5-FOA–resistant cells. To identify mutations was assessed using a mating assay, shown for representative histone that disrupted Sum1-1 silencing, a MATa sir2D SUM1-1 strain (LRY1450) mutations. Sum1 repression of the pPES4-HIS3 and pYGL138C-LEU2 was used, and colonies that failed to mate were identified. To identify reporters was assessed by growth on medium lacking histidine and leu- mutations that disrupted Sum1 repression, the starting strain (LRY1849) cine, shown for yeast strains SUM1 HST1 (LRY1849), sum1D HST1 had two reporters in which the promoters of the Sum1p-regulated genes (LRY1854), SUM1 hst1D (LRY1853), and sum1D hst1D (LRY1855). For PES4 and YGL138C drive the expression of HIS3 and LEU2. Colonies that both assays, 10-fold serial dilutions were plated on selective medium. grew in the absence of histidine and leucine were identified. (B) Muta- (C) The numbers of colonies screened, plasmids identified, and disruptive tions were assessed in semiquantitative assays. Sum1-1 silencing of HMRa mutations identified in each screen are indicated.

538 E. T. Prescott, A. Safi, and L. N. Rusche Figure 2 Histone mutations that disrupt Sum1-1 silencing cluster in discrete regions of the nucle- osome. (A) Positions of histone substitutions tested (x-axis) and the number of substitutions tested at each position (y-axis). Mutations that did not have a silencing defect are in blue for H3 and green for H4. Disruptive mutations (.10-fold decrease in mating) are in red. Fifty-seven H3 and 31 H4 mutations were tested, and 22 mutations caused a silencing defect. (B) The 22 histone mutations that caused silencing defects map to three distinct regions: the H3 tail, the H3 LRS region, and the H4 tail. Mutations in white were identified in the genetic screen, mutations in light gray were iden- tified by testing previously described LRS muta- tions, and the mutation in dark gray was identified through alanine scanning of modifiable residues. (C) The nucleosome structure, displaying H2A (yellow), H2B (orange), H3 (blue), and H4 (green) from PDB1ID3 (White et al. 2001) in Pymol. The positions of disruptive mutations are shown in red. A dashed line indicates where the H3 tails exit the nucleosome. of cells that mated in the presence of the mutation was esti- replacing each one with alanine. Only H3-K4A was found to mated relative to a strain expressing wild-type histones (Fig- disrupt Sum1-1 silencing (Figure 2B, dark gray box), consistent ure 1B). Once a disruptive residue was identified on a particular with our recovery in the original screen of 10 independent plasmid, the remaining mutations were not investigated. Thirty- plasmids bearing a mutation in H3-K4. After examining 96 in- one of the 71 histone H3 mutations and 11 of the 18 histone H4 dividual mutations in H3 and H4, we identified 22 that caused mutations were tested (Table S3). To confirm that the loss of adefectinSum1-1 silencing, 14 in H3 and 8 in H4 (Figure 2A mating resulted from the loss of silencing, as opposed to a and Table S4). These mutations cluster in three discrete defect in the mating pathway, the level of HMRa1 mRNA regions. Interestingly, the H3 LRS region and the H4 tail are was assessed in the presence of H3-K4I, H3-E73G, and H4- adjacent in the nucleosome structure (Figure 2C) and could G28P mutations. In each mutant strain, HMRa1 mRNA was form a surface that interacts with the Sum1-1 complex or an- induced compared to a strain with wild-type histones (data other protein important for silencing. not shown), confirming the loss of silencing. To determine whether histone mutations that disrupt This screen was sensitive enough to identify histone mu- Sum1-1 silencing are dominant, mating was assessed under tations that caused a 10-fold loss of mating, but we focused conditions that maintain plasmids expressing wild-type and on mutations conferring $100-fold defects in mating. Ten mutant histones. H3-K4A and -K4I resulted in a 10-fold mat- mutations in histone H3 and 4 mutations in histone H4 fell ing defect. These mutations also disrupted mating when ex- into this category [Figure 2, A (red bars) and B, and Table pressedinayeaststrainhavingwild-typechromosomalhistone S4]. These 14 amino acid residues mapped to three distinct genes. No other mutations were dominant (data not shown). regions of the nucleosome; residues 2–4 of the H3 tail, the Thus, H3-K4 is particularly critical for Sum1-1 silencing. LRS region in the H3 core, and residues 18–26 of the H4 tail. Histone mutations do not disrupt Sum1 repression Interestingly, mutations in two of these regions, the LRS do- main and the H4 tail, disrupt Sir silencing (Johnson et al. We reasoned that residues in histones H3 and H4 that are 1990; Park et al. 2002). Since the Sir and Sum1-1 complexes important for Sum1-1 silencing might be important contact both generate extended silenced domains, these regions of the points for the Sum1 complex. Therefore, these residues might nucleosome may contribute similarly to the formation of both also play a role in repression mediated by wild-type Sum1p, types of silenced chromatin. Therefore, 14 additional mutations which differs from Sum1-1p by a single amino acid. A role for in the LRS domain and the H4 tail that were previously dem- nucleosomes in Sum1 repression is also suggested by the re- onstrated to disrupt Sir silencing were tested for their effect quirement for the deacetylase Hst1p (Xie et al.1999;McCord on Sum1-1 silencing. Seven additional residues that disrup- et al. 2003), which could act on histones. To investigate ted Sum1-1 silencing were identified in this manner (Figure whether histones contribute to Sum1 repression, a second ge- 2B, light gray boxes, and Table S4). The remaining 7 resi- netic screen was conducted (Figure 1A, right). The starting dues did not have an effect on Sum1-1 silencing (Table S5). strain contained two reporters in which the Sum1p-repressed Post-translational modifications of histones modulate the PES4 and YGL138C promoters drive the expression of HIS3 assembly of chromatin structures. Therefore, we specifically and LEU2, allowing Sum1 repression to be assessed by growth examined the importance of 35 modifiable residues by on medium lacking histidine and leucine. Yeast with wild-type

Histones Contribute to Sum1-1 Silencing 539 SUM1 and HST1 genes were unable to grow in the absence of Table 1 Histone mutations and deletions tested for their ability to histidine and leucine, whereas control strains with sum1D or disrupt Sum1 repression hst1D mutations grew well (Figure 1B). The starting strain Plasmid Histone H3 Histone H4 also had its only copy of the histone H3 and H4 genes on pLR501 D4–28 WT a plasmid bearing the URA3 gene, and a plasmid shufflestrat- pRM430 D4–30 WT egy was used to screen for mutated histone genes that disrupt pLR547 D30–40 WT Sum1 repression. Over 17,000 colonies were screened, pLR497 WT D5–20 D – 11,200 for H3 and 6100 for H4, but no plasmids were iden- pGF29 WT 4 28 fi pLR675 K9, -14, -18, -23A WT ti ed that enabled cells to grow on medium lacking histidine pLR673 K9, -14, -18, -23R WT and leucine (Figure 1C). We also specifically examined each pLR674 K9, -14, -18, -23Q WT histone mutation that was found to disrupt Sum1-1 silenc- pLR676 WT K5, -8, -12, -16A ing, and none of these mutations disrupted Sum1 repres- pLR672 WT K5, -8, -12, -16Q sion. Therefore, Sum1 repression could not be disrupted pLR676 WT K5, -8, -12, -16R pLR702 K9, -14, -18, -23A K5, -8, -12, -16A by single mutations in the H3 or H4 genes. pLR700 K9, -14, -18, -23Q K5, -8, -12, -16Q It is possible that multiple lysine residues must be pLR763 K9, -14, -18, -23Q K5, -8, -12Q deacetylated by Hst1p to achieve repression. Therefore, tar- pLR701 K9, -14, -18, -23R K8, -12, -16R geted mutations and deletions were tested for their ability to pLR766 K9, -14, -18, -23R K5, -8, -12R disrupt Sum1 repression (Table 1). In particular, lysines pLR581 WT K5Q pLR582 WT K8Q known to be acetylated were replaced by glutamine to pLR583 WT K12Q mimic the acetylated state, arginine to mimic the deacety- pLR874 WT K16A lated state, or alanine. The tails of histones H3 and H4 were pLR533 WT K16R also deleted to remove the lysine residues entirely. In addi- pLR584 WT K16Q tion, mutations in H3 that disrupt Sum1-1 silencing were pLR822 A75V K16Q pLR821 E73G K16Q combined with H4-K16Q, as K16 is a critical substrate of Sir2p (Johnson et al. 1990; Imai et al. 2000), the paralog of LRY1793 was used as the reporter strain, monitoring growth on medium lacking histidine. None of these mutations affected Sum1 repression. pLR676 H4-K5, -8, Hst1p. However, none of these alterations to histones H3 -12, -16R was lethal. and H4 disrupted Sum1 repression of PES4 or YGL138C. a Therefore, although particular regions of the nucleosome HML . These results are consistent with H3-E73D having are critical for silencing mediated by the mutant Sum1-1 the strongest effect on HM silencing of any known H3 mu- complex, no such requirements exist for Sum1 repression. tation (Thompson et al. 2003). Interestingly, mutations in the H3 tail were not disruptive to Sir silencing, with the ex- Histone mutations in the H3 LRS region and H4 tail ception of H3-K4I and K4R, which disrupted telomeric si- disrupt Sir silencing lencing. Therefore, the H3 tail may serve a specific role in Our ability to identify histone mutations that disrupt si- Sum1-1 silencing, whereas the LRS/H4 tail region may have lencing mediated by Sum1-1p, which acts over several kilo- a common function in Sum1-1 and Sir silencing. base pairs, but not Sum1p, which acts over a more restricted Mutations in the H4 tail did not act by interfering with region, suggests that nucleosomes are more critical in gen- the ISW complex erating long-range chromatin structures involved in Sum1-1 silencing. Moreover, it is striking that mutations disruptive One possible explanation for silencing defects in the pres- to Sum1-1 silencing fall in the same regions of the nucleo- ence of H4 tail mutations is a defect in chromatin remodel- some important for silencing at the cryptic mating-type loci, ing. H4 tail residues R17, H18, and R19 form a binding site telomeres, and rDNA (Johnson et al. 1992; Park et al. 2002; for the ATP-dependent chromatin remodeler ISW (Clapier Thompson et al. 2003). Therefore, related higher-order struc- et al. 2002), and mutation of these residues could disrupt tures may be generated by the Sir and Sum1-1 complexes. Sir and Sum1-1 silencing by inhibiting chromatin remodel- To determine whether histone mutations that affect Sum1-1 ing. Indeed, deletion of ISW1 disrupts Sir silencing at HMR silencing also affect Sir silencing, a semiquantitative mating (Cuperus and Shore 2002) and HML (Yu et al. 2011). Sim- assay was used to assess silencing at the HMLa locus and a ilarly, we found that isw1D decreases Sum1-1 silencing at HMR, colorimetric assay was used to score silencing of ADE2 in- resulting in a 100-fold decrease in mating. However, most of tegrated at telomere VR (Singer and Gottschling 1994). Ex- the histone H4 mutations we identified disrupted mating at amining both loci enabled us to distinguish mild from more least 1000-fold, inconsistent with these mutations acting severe mutations, as Sir silencing is more easily disrupted at solely by disrupting remodeling by the ISW complex. the telomeres than at HMLa. All residues in the H3 LRS/H4 The BAH domain of Orc1p contributes to Sum1-1 tail region that disrupt Sum1-1 silencing also disrupted Sir silencing by binding nucleosomes silencing at the telomere (Table 2). Sir silencing of HMLa was less disrupted by histone mutations, and only H3-E73 The LRS/H4 tail domain of the nucleosome, in which many and residues 17–21 in the H4 tail cause a silencing defect at of the mutations fall, interacts with the BAH domain of

540 E. T. Prescott, A. Safi, and L. N. Rusche Table 2 The effects of histone mutations on Sir silencing and previous assays (Sutton et al. 2001; Safi et al. 2008), the C- Sum1 repression terminal portion of Sum1p (786–1062) was fused to the SIR activation domain of Gal4p, and Orc5p was fused to the SUM1-1: SUM1: LexA DNA-binding domain. An interaction between Sum1p Mutation HMRa HMLa Telomere pPES4 and Orc5p resulted in the activation of a LacZ gene driven 21 1 1 H3 R2G by a minimal promoter containing LexA-binding sites. As pre- H3 R2S 21 1 1 H3 T3S 21 1 1viously described, Orc5p interacted with the mutant Sum1- H3 K4A 21 1 11p but not the wild-type Sum1p (Figure 3A). Importantly, H3 K4E 21 1 1this interaction still occurred in an orc1Dbah strain (Figure H3 K4I 21 2 13A, right), indicating that the BAH domain of Orc1p was not 21 2 1 H3 K4R required. Therefore, although ORC recruits the Sum1-1 H3 R72G 21 2 1 H3 E73D 22 2 1complex, the BAH domain of Orc1p likely makes a different H3 E73G 22 2 1contribution to Sum1-1 silencing. H3 E73K 22 2 1To investigate whether the function of the Orc1p BAH do- H3 A75V 21 2 1main in Sum1-1 silencing requires its nucleosome-binding 21 2 1 H3 Q76R capacity, we created mutations homologous to mutations in H3 K79Q 21 2 1 H4 R17G 22 2 1Sir3p that disrupt its ability to bind nucleosomes (Buchberger H4 H18G 22 2 1et al. 2008). Such mutations should disrupt Sum1-1 silencing H4 H18P 22 2 1if the BAH domain acts by binding nucleosomes. Indeed, H4 R19G 22 2 1orc1-E84K and orc1-P179L mutations disrupted Sum1-1 si- 22 2 1 H4 I21V lencing, as assessed by mating (Figure 3B). Therefore, the H4 D24P 21 2 1 H4 I26T 21 2 1BAH domain likely acts by binding nucleosomes and not the H4 G28P 21 2 1Sum1-1 complex. HMLa Sir silencing of was tested in LRY1793 using a semiquantitative mating assay. The BAH domain of Orc1p contributes to Sum1-1 Mutations causing more than a 10-fold loss in mating were scored as defective (2). Silencing of telomere VR was tested in LRY2423 containing an ADE2 reporter at silencing at a step other than recruitment telomere VR. White colonies expressing the ADE2 gene were scored defective in silencing (2). Sectored, pink, and red colonies maintained Sir silencing (1). Sum1 To investigate whether the ability of the Orc1p BAH domain repression was tested in LRY1793 containing the Sum1p-regulated pPES4-HIS3 re- to bind nucleosomes is important for a step in Sum1-1 si- porter. No growth was seen on medium lacking histidine, and repression was lencing subsequent to recruitment, we created a situation in maintained (1). which Sum1-1p could be recruited to the HMRa locus inde- pendently of ORC. A plasmid containing the entire HMRa Sir3p, and this interaction is required for the spreading of locus was modified to replace the ORC-binding sites in the E the Sir complex (Connelly et al. 2006; Onishi et al. 2007; and I silencers with Gal4-binding sites (Figure 4A). Yeast cells Buchberger et al. 2008; Norris et al. 2008; Sampath et al. that lacked SIR2 and HMRa and expressed both a Gal4 DNA- 2009). Therefore, it is possible that the LRS/H4 tail domain binding domain (Gal4DBD)-myc-Sum1-1 fusion protein and plays a similar role in Sum1-1 silencing and that a BAH untagged Sum1-1p were transformed with this HMRa-Gal4 domain-containing protein is also critical for Sum1-1 silencing. plasmid. These strains also lacked Sir3p, to prevent it from sub- Sir3p itself is not required for Sum1-1p silencing (Laurenson stituting for its paralog Orc1p.IftheBAHdomainofOrc1p acts and Rine 1991), but Orc1p, which is a paralog of Sir3p,might at a step subsequent to recruitment, it should still be required play a similar role. Consistent with this idea, the BAH domain to silence this modified HMR locus. Silencing, as assessed by of Orc1p is required for Sum1-1 silencing (Rusche and Rine mating, was dependent on the presence of the Gal4DBD- 2001), and ORC has been implicated in the recruitment of Sum1-1 protein (Figure 4B), indicating that the recruitment Sum1-1p to chromatin (Rusche and Rine 2001; Sutton et al. of Sum1-1p was occurring through the Gal4DBD rather than 2001; Irlbacher et al. 2005; Lynch et al. 2005). We investi- ORC. Importantly, mutation or deletion of the BAH domain gated whether an interaction between the BAH domain of disrupted mating 100-fold (Figure 4B), consistent with the Orc1p and the LRS/H4 tail domain of nucleosomes is impor- BAH domain providing a function other than recruitment of tant for Sum1-1 silencing. Such an interaction is not antici- Sum1-1p. pated by the previous model that ORC recruits Sum1-1p to The requirement for the Orc1p BAH domain in silencing silenced loci. Therefore, to determine whether the BAH do- the HMRa-Gal4 locus suggests that Orc1p acts directly at the main of Orc1p contributes to Sum1-1 silencing by recruiting locus despite the absence of ORC-binding sites in the si- the Sum1-1 complex or by acting at subsequent steps in si- lencers. To examine this possibility, we performed a chroma- lencing, we conducted several experiments. tin IP assay and found Orc1p enrichment at the E silencer First, we tested whether a previously described two-hybrid even in the absence of Gal4DBD-Sum1-1p (Figure 4C). Thus, interaction between Sum1-1p and Orc5p,whichmaynotbe a cryptic ORC-binding site must still be present near the E direct, requires the BAH domain of Orc1p.Ifso,theprimary silencer. Nevertheless, in the presence of Gal4DBD-Sum1-1p, role of the BAH domain is most likely in recruitment. As in the enrichment of Orc1p was significantly increased at the E

Histones Contribute to Sum1-1 Silencing 541 The BAH domain of Orc1p was not required for the self- association of Sum1-1p In addition to binding nucleosomes and thereby stabilizing the association of Orc1p with chromatin, the BAH domain of Orc1p could contribute to Sum1-1 silencing in other ways. In particular, the SUM1-1 mutation increases the ability of Sum1-1p to self-associate (Safi et al. 2008), and the BAH domain could stabilize this interaction. We previously dem- onstrated that two differently tagged alleles of Sum1-1p coprecipitate, whereas similarly tagged wild-type proteins do not coprecipitate (Safi et al. 2008). This coprecipitation was not disrupted by DNaseI and therefore may be indepen- dent of association with silenced loci. To determine whether the BAH domain of Orc1p was required for the self-association of Sum1-1p, the coprecipitation experiment was repeated in an orc1Dbah strain. The coprecipitation still occurred (Figure 5, A Figure 3 The BAH domain of Orc1p acts in Sum1-1 silencing by binding nucleosomes. (A) The BAH domain of Orc1p was not required for the and B), indicating that the BAH domain was not required for interaction of Sum1-1p with ORC. MATa sum1D yeast strains with wild- self-association. type ORC1 (LRY1729) or orc1Dbah (LRY1835) were transformed with plas- mids expressing LexA-Orc5 (pTT93) and the Gal4 activation domain Mutations in the N terminus of H3 disrupt Sum1-1 (pGAD424), the Gal4 activation domain fused to Sum1p775-1062 (pRH01), or the Gal4 activation domain fused to Sum1-1p775-1062 (pRH02). Two- silencing at a step subsequent to recruitment of Sum1-1p hybrid interactions between LexA-Orc5p and GAD-Sum1-1p775-1062 In addition to mutations in the LRS/H4 tail domain, we ob- resulted in activation of a LacZ reporter gene. (B) Mutations in the BAH domain of Orc1p that disrupt nucleosome binding decreased mat- tained seven mutations at the N terminus of H3 that disrupted ing. Semiquantitative mating assays of MATa SUM1-1 sir2D sir3D yeast Sum1-1 silencing. These mutations may act through a different with ORC1 (LRY2762), ORC1-HA (LRY2763), orc1E84K-HA (LRY2764), mechanism than mutations in the LRS/H4 tail domain as they orc1P179L-HA (LRY2765), and orc1Dbah-HA (LRY2766) are shown. have distinct properties. In particular, H3-K4A and -K4I were the only mutations with a dominant phenotype, and most H3 silencer and was also observed at other sites within HMRa- tail mutations were not disruptive to Sir silencing. The H3 tail Gal4. Therefore, Orc1p is stabilized at the HMRa-Gal4 locus residues important for Sum1-1 silencing cluster around H3-K4, by Sum1-1p. As anticipated, Gal4DBD-Sum1-1p was enriched suggesting that the methylation status of H3-K4 could affect across the modified HMRa-Gal4 locus (Figure 4D). silencing. In particular, mutation of H3-K4 would block meth- Our initial hypothesis was that the interaction of the Orc1p ylation, and mutations of neighboring residues could interfere BAH domain with nucleosomes promotes the distribution of with the recognition of H3-K4 as a substrate. Consistent with Orc1p and Sum1-1p across the silenced locus, as is the case this notion, Sum1-1 silencing was severely disrupted in a strain for Sir3p. However, the distribution of Orc1p was more re- lacking Set1p, the methyltransferase specific for H3-K4 (Figure stricted than that of Gal4DBD-Sum1-1p (Figure 4, C and D), 6A). In contrast, deletion of Dot1p, which methylates H3-K79, suggesting that Orc1p does not spread with Sum1-1p and located in the LRS domain, resulted in a very modest disruption makes a different contribution to silencing. To determine how of Sum1-1 silencing. the BAH domain of Orc1p promotes silencing at HMRa-Gal4, Methylation of H3-K4 in silenced domains could be critical we performed chromatin IP in strains bearing ORC1 mutations for the assembly of Sum1-1p chromatin. Alternatively, meth- that disrupt nucleosome binding. If the ability of the BAH do- ylation of euchromatin may help restrict Sum1-1 silenced main to bind nucleosomes is important for stabilizing the chromatin to appropriate domains, as has been proposed for Sum1-1 complex across HMRa-Gal4, these mutations should Sir silenced chromatin (Santos-Rosa et al. 2004). To deter- decrease the associations of Sum1-1p and Orc1p. However, mine whether H3-K4 is methylated or unmethylated at HMRa although a significant decrease in enrichment of Orc1p was in the presence of Sum1-1p, chromatin IP was performed observed (Figure 4E), these mutations had only a slight ef- using antibodies specific for di- or trimethylated H3-K4 (Figure fect on the enrichment of Sum1-1p (Figure 4F). Therefore, 6B). In a background where Sir proteins silence HMRa,there the BAH domain of Orc1p stabilizes its own association with was no detectable enrichment of di- or trimethylated H3-K4, as HMRa-Gal4 and correlates with the maximally silenced previously reported (Bernstein et al. 2002; Santos-Rosa et al. state, suggesting that the presence of Orc1p is critical for 2002). In a sir3D strain, in which HMRa1 is expressed, di- and complete silencing. It is likely that mutations in the LRS/H4 trimethlyation of H3-K4 were enriched, as expected. In a sir3D tail region of the nucleosome have similar consequences for SUM1-1 strain, in which Sum1-1p restores silencing of HMRa, Orc1p association with HMRa, but we were unable to di- methylation of H3-K4 was not observed, indicating that meth- rectly test this idea due to technical complications of com- ylation of H3-K4 within the silenced domain is not necessary bining the HMRa-Gal4 plasmid with histone mutations. for Sum1-1 silencing.

542 E. T. Prescott, A. Safi, and L. N. Rusche Figure 4 The BAH domain of Orc1p is required for Sum1-1 silencing at a step other than recruitment. (A) ORC-binding sites at HMRa were replaced with Gal4-binding sites to create HMRa-Gal4. (B) Semiquantita- tive mating assay of MATa sir2D sir3D hmrD yeast containing SUM1-1 and ORC1-HA (LRY2804) or Gal4DBD-myc-SUM1-1 with ORC1 (LRY2752), ORC1-HA (LRY- 2753), orc1-E84K-HA (LRY2754), orc1-P179L-HA (LRY2755), and orc1Dbah-HA (LRY2756). These strains were transformed with pLR805 HMRa-Gal4 and tested for mating. (C and D) ChIP of Orc1p-HA (C) and Gal4-Sum1-1p (D) at HMRa-Gal4 in strains LRY2752, LRY2753, and LRY2804 described in B. Primers are spaced 1 kb apart, and enrichment val- ues are relative to PHO5,whichis not associated with Sum1-1p. Sig- nificance values (P , 0.0002) were calculated relative to SUM1-1 strain LRY2804. (E and F) ChIP of Orc1p- HA (E) and Gal4-Sum1-1p (F) at HMRa-Gal4 in strains LRY2752, LRY2753, LRY2754, LRY2755, and LRY2756 described in B. Sig- nificance values (P , 0.0002) were calculated relative to ORC1-HA strain LRY2753.

A trivial explanation for the disruption of Sum1-1 silenc- (Figure 6D), suggesting that the Sum1-1 complex assembles ing by mutations in the H3 tail is that improper methylation properly at HMRa and that a subsequent step in the silencing of H3-K4 alters the expression of a component of the Sum1-1 process must be disrupted. Similarly, mutations in the LRS complex. To examine this possibility, the steady-state mRNA region (H3-E73G) or the H4 tail (H4-I21V) caused a modest levels of SUM1-1, HST1, RFM1, and ORC1 were compared reductionintheassociationofSum1-1p with HMRa (Figure by quantitative reverse transcriptase (RT)–PCR in strains 6D), consistent with the modest decrease in Sum1-1p enrich- expressing wild-type or mutant histones and in a strain lack- ment in the presence of Orc1p BAH mutations (Figure 4E). ing Set1p. The levels of these mRNAs did not change sig- nificantly (Figure 6C). In addition, immunoblot analysis of Discussion Sum1-1p in these strains revealed no significant differences (data not shown). Therefore, a change in the expression of In this study, we identified three regions of the nucleosome the Sum1-1 complex does not account for the silencing de- that are important for long-range silencing mediated by the fect in strains expressing H3 tail mutations. mutant Sum1-1 complex but not for wild-type Sum1 repres- It is possible that mutations in the H3 tail reduce an in- sion. The H3 LRS and H4 tail regions are in close proximity teraction between this portion of H3 and the Sum1-1 com- in the nucleosome structure and may form a potential in- plex, thereby disrupting silencing. To examine this possibility, teraction surface. This LRS/H4 tail region is also important the association of Sum1-1p with HMRa was assessed in the for Sir silencing and is thought to interact with the Sir3p BAH presence of H3-K4I, the most disruptive mutation. However, in domain. By analogy, we suggest that the BAH domain of the presence of H3-K4I, the enrichment of Sum1-1p was only Orc1p facilitates Sum1-1 silencing. The extreme N-terminal slightly reduced compared to a strain with wild-type histones tail of H3 is more important for Sum1-1 than Sir silencing and

Histones Contribute to Sum1-1 Silencing 543 residues did not disrupt Sir silencing (data not shown) and the LRS region is not reported to interact with other regions of the nucleosome. Therefore, assisting in chromatin compac- tion may not be the primary contribution of the LRS/H4 tail region. A second possibility is that the LRS/H4 tail region asso- ciates with a common factor required for multiple types of si- lencing. One candidate is the ISW chromatin remodeling complex, which is associated with transcriptional repression and requires H4 tail residues 17–19 for remodeling (Clapier et al. 2002). However, Sum1-1 silencing was more severely affected by mutations in H4 tail residues than by an isw1D deletion (data not shown), indicating that the histone tail mutations do not act solely by blocking the activity of ISW. A third possibility is that the LRS/H4 tail region is relatively accessible and consequently is bound by different silencing proteins, including the BAH domains of Sir3p and its paralog Orc1p. Whether a nucleosome-binding protein is also important for silencing in the rDNA is unclear, as Sir3p and Orc1p are not thought to contribute to rDNA silencing.

Orc1p contributes to Sum1-1p silencing in a capacity other than recruitment Figure 5 The BAH domain of Orc1p was not required for Sum1-1p self- association. (A) Co-immunoprecipitation of HA-Sum1p with myc-Sum1p. Given the ability of mutations in the LRS/H4 tail region to Yeast of the genotype sum1D (LRY144) or sum1D orc1Dbah (LRY1879) disrupt Sum1-1 silencing, we suspected that the Orc1p BAH were transformed with plasmids expressing HA- and myc-tagged Sum1p domain, previously shown to be required for Sum1-1 silenc- (pLR052 and pLR021) or Sum1-1p (pLR047 and pJR2291). The samples ing, makes important contacts with nucleosomes. This model were analyzed by immunoblotting with antibodies against the HA or myc tags. (B) Co-immunoprecipitation of myc-Sum1p with HA-Sum1p. HA- is interesting in light of the association of ORC with hetero- Sum1-1p or HA-Sum1p was immunoprecipitated from the same strains chromatin in a variety of species. For example, in Drosophila described in A. and humans, ORC interacts with HP1 (Pak et al. 1997; Lidonnici et al. 2004; Prasanth et al. 2004; Auth et al. disrupts silencing without significantly reducing the associa- 2006) and is enriched in telomeric and pericentromeric het- tion of Sum1-1 with the silenced domain. erochromatin (Deng et al. 2007, 2009; Prasanth et al. 2010; Shen et al. 2010). On the basis of the paradigm from The LRS/H4 tail region of the nucleosome is important S. cerevisiae, ORC is thought to serve as a platform for recruit- for multiple types of silencing ing heterochromatin proteins. However, ORC could also bind It is striking that the same region of the nucleosome, the LRS nucleosomes via the BAH domain of Orc1p and thus act like region and the adjacent base of the H4 tail, plays an impor- Sir3p, which enables spreading of the Sir complex (Hecht et al. tant role in silencing mediated by three distinct protein com- 1995; Carmen et al. 2002; Onishi et al. 2007; Buchberger et al. plexes, Sir, RENT, and Sum1-1 (Johnson et al. 1990, 1992; 2008). In fact, in the yeast Kluyveromyces lactis, which lacks Park and Szostak 1990; Park et al. 2002; Thompson et al. adistinctSir3p, Orc1p acts in a Sir3p-like manner (Hickman 2003; Altaf et al. 2007; Buchberger et al. 2008; Norris et al. and Rusche 2010). 2008; Sampath et al. 2009), suggesting a common mechanism Consistent with the “platform” model, ORC is proposed of action. This region could contribute to silencing by promot- to recruit Sum1-1p to HMRa (Rusche and Rine 2001; Sut- ing proper chromatin compaction, providing a binding site for ton et al. 2001; Lynch et al. 2005). However, the role of the a common factor, or serving as a multipurpose recruitment site BAH domain in Sum1-1 silencing remained a mystery. Our for silencing proteins. identification of histone mutations that fall in the LRS/H4 One possibility is that the LRS/H4 tail region is important tail region of the nucleosome and disrupt Sum1-1 silencing for multiple types of silencing because it facilitates internu- suggests that an interaction between the Orc1p BAH do- cleosome interactions necessary for chromatin compaction. main and nucleosomes contributes to silencing. Indeed, For example, histone H4 basic residues 14–19 and acidic mutations in ORC1 predicted to decrease the affinity of the residues in histones H2A and H2B are proposed to interact BAH domain for nucleosomes also disrupted silencing, and (Dorigo et al. 2004; Kan et al. 2009). In addition, acetylation the BAH domain of Orc1p was still required for silencing of H4 at K16 inhibits 30-nm fiber formation (Shogren-Knaak when Sum1-1p was recruited to HMRa independently of et al. 2006). However, mutations of H2A and H2B acidic ORC (Figure 4).

544 E. T. Prescott, A. Safi, and L. N. Rusche Figure 6 Mutations in the N terminus of H3 disrupt Sum1-1 silencing at a step subsequent to recruitment of Sum1-1p. (A) Deletion of Set1p disrupts Sum1-1 silencing. A mating assay of MATa myc-SUM1-1 strains with SIR2 (LRY529), sir2D (LRY459), sir2D dot1D (LRY1364), and sir2D set1D (LRY1384) is shown. (B) Sum1-1 silencing blocks H3-K4 methylation at HMRa. ChIP is shown of di- and trimethylated H3-K4 at HMR in MATa strains with SUM1 SIR3 (LRY1007), SUM1 sir3D (LRY341), and SUM1-1 sir3D (LRY344). Enrichment values are relative to downstream ATG1, shown to be devoid of methylation (Pokholok et al. 2005). (C) H3-K4I did not dis- rupt expression of the Sum1 complex. RT–PCR analysis is shown of SUM1, HST1, RFM1, and ORC1 in MATa sir2D myc-SUM1-1 strains with SET1 (LRY459) or set1D (LRY1384) or a h3D h4D strain (LRY1450) transformed with a plas- mid expressing wild-type histones (pDM18) or H3 K4I (pLR619). mRNA amounts were quan- tified relative to the control mRNA NTG1 and normalized to LRY459, containing wild-type genomic histones. (D) H3-K4I did not disrupt Sum1-1p enrichment at HMRa. Chromatin IP is shown of myc-Sum1-1p at HMRa in a MATa sir2D myc-SUM1-1 h3D h4D strain (LRY1450) transformed with plasmids expressing wild-type histones (pDM18), H3-K4I (pLR619), H3-E73G (pLR615), or H4-I21V (pLR640). Enrichment values are relative to PHO5, which is not associated with Sum1-1p.

In theory, Orc1p could act in a Sir3p-like manner to pro- Sir protein assembly, and the H3 tail may contribute simi- mote the spreading of Sum1-1p across HMRa. However, the larly to Sum1-1 silencing. enrichment of Sum1-1p was only moderately decreased in Histones in heterochromatin formation in other species strains containing mutations in the Orc1p BAH domain (Fig- ure 4) or mutations in the LRS region (Figure 6). Moreover, Little is known about regions of the nucleosome important Orc1p was not uniformly distributed across HMRa, as would for heterochromatin formation in species other than S. cer- be expected if it acted like Sir3p. Thus, the presence of Orc1p evisiae. In species outside the budding yeast clade, H3-K9Me at the E silencer may promote transcriptional silencing by al- and heterochromatin protein 1 (HP1) are hallmarks of het- tering the conformation of the chromatin fiber or recruiting erochromatin, and different portions of the nucleosome factors that make the region less permissive for transcription. might be critical for the formation of this type of heterochro- It is interesting that the ancestral Sum1p likely acted with matin. In fact, in Schizosaccharomyces pombe, mutation of Orc1p to achieve silencing, and the SUM1-1 mutation may histone H3-K9, -S10, or -K14 disrupted pericentromeric het- recapitulate this cooperation. In the yeast K. lactis, the Sum1 erochromatin formation, but mutation of H4-K8 or -K16 did complex silences HMLa in conjunction with KlSir4p and not (Mellone et al. 2003), consistent with the importance of KlOrc1p (Hickman and Rusche 2009, 2010). Therefore, the H3-K9Me. common ancestor of KlSum1p and ScSum1p most likely had It is possible that the LRS/H4 tail region of the nucle- a similar function, which was lost in the S. cerevisiae lineage. osome is also important for other types of heterochromatin. For example, the BAH domain-containing protein BAHD1 The H3 tail is important for silencing contributes to heterochromatin in humans (Bierne et al. 2009) We also identified mutations in the H3 tail that disrupted andcouldinteractwiththeLRS/H4tailregioninamanner Sum1-1 silencing but had less impact on Sir silencing. These similar to Sir3p or Orc1p. mutations could act by disrupting specific interactions be- Histones do not disrupt promoter-specific repression tween the Sum1-1 complex and the H3 tail or reducing the mediated by Sum1p available Sum1-1 by allowing nonspecific binding through- out the genome. However, neither interpretation is consis- A goal of this study was to identify mutations in histones H3 tent with the enrichment of Sum1-1 at HMRa in H3-K4I and H4 that disrupt a potential interaction between the Sum1 strains (Figure 6D). Interestingly, similar observations were complex and nucleosomes, which could contribute to wild- made for Sir proteins, which remain associated with silenced type repression. However, no such mutations were isolated in loci in strains bearing a deletion of the H3 tail that disrupts the genetic screen, and candidate approaches did not identify transcriptional silencing (Sperling and Grunstein 2009). more complex mutations that disrupt repression. Nevertheless, These authors concluded that the H3 tail contributes to the deacetylase activity of Hst1p is required for Sum1 repres- chromatin compaction and hence silencing at a step after sion (Hickman and Rusche 2007), and it has been assumed

Histones Contribute to Sum1-1 Silencing 545 that histones are the relevant substrate of Hst1p. In fact, acet- Buchberger, J. R., M. Onishi, G. Li, J. Seebacher, A. D. Rudner et al., ylation of histones H3 and H4 at Sum1-repressed genes 2008 Sir3-nucleosome interactions in spreading of silent chro- – increases in the absence of HST1 (Robert et al. 2004; Hickman matin in Saccharomyces cerevisiae. Mol. Cell. Biol. 28: 6903 6918. Carmen, A. A., L. Milne, and M. Grunstein, 2002 Acetylation of and Rusche 2007; Weber et al. 2008). However, given that the yeast histone H4 N terminus regulates its binding to hetero- mutations that mimicked the acetylated state did not disrupt chromatin protein SIR3. J. Biol. Chem. 277: 4778–4781. repression, the key substrate of Hst1p may not be histone H3 Chi, M. H., and D. Shore, 1996 SUM1–1, a dominant suppressor of or H4. Instead, Hst1p may deacetylate other proteins such as SIR mutations in Saccharomyces cerevisiae, increases transcrip- histones H2A and H2B or the Sum1 complex. tional silencing at telomeres and HM mating-type loci and de- creases chromosome stability. Mol. Cell. Biol. 16: 4281–4294. The lack of histone mutations that disrupt Sum1 repres- Clapier, C. R., K. P. Nightingale, and P. B. Becker, 2002 A critical sion contrasts with other repressors in S. cerevisiae that can epitope for substrate recognition by the nucleosome remodeling be disrupted by histone mutations (Lenfant et al. 1996; ATPase ISWI. Nucleic Acids Res. 30: 649–655. Recht et al. 1996; Sabet et al. 2003; Parra et al. 2006). For Connelly, J. J., P. Yuan, H. C. Hsu, Z. Li, R. M. Xu et al., example, repression mediated by the Tup1-Ssn6 complex is 2006 Structure and function of the Saccharomyces cerevisiae Sir3 BAH domain. Mol. Cell. Biol. 26: 3256–3265. disrupted by histone mutations that mimic acetylation (Watson Cuperus, G., and D. Shore, 2002 Restoration of silencing in Sac- et al. 2000) or diminish the association of the corepressor charomyces cerevisiae by tethering of a novel Sir2-interacting Tup1p with histone tails (Edmondson et al. 1996). Unlike protein, Esc8. Genetics 162: 633–645. Tup1p,theSum1 complex may not require a stabilizing Dai, J., E. M. Hyland, D. S. Yuan, H. Huang, J. S. Bader et al., interaction with histones to achieve repression. 2008 Probing nucleosome function: a highly versatile library of synthetic histone H3 and H4 mutants. Cell 134: 1066–1078. Summary Dai, J., E. M. Hyland, A. Norris, and J. D. Boeke, 2010 Yin and Yang of histone H2B roles in silencing and longevity: a tale of Regional silencing involves the formation of extended do- two arginines. Genetics 186: 813–828. mains of heterochromatin, whereas gene-specific repression Deng, Z., J. Dheekollu, D. Broccoli, A. Dutta, and P. M. Lieberman, occurs at individual promoters. This study reveals that in the 2007 The origin recognition complex localizes to telomere re- peats and prevents telomere-circle formation. Curr. Biol. 17: yeast S. cerevisiae, the same nucleosomal surface is critical for 1989–1995. the formation of multiple types of heterochromatin, but not Deng, Z., J. Norseen, A. Wiedmer, H. Riethman, and P. M. Lieber- for local repression mediated by a related transcriptional re- man, 2009 TERRA RNA binding to TRF2 facilitates hetero- pressor. Thus, this region of the nucleosome may be generally chromatin formation and ORC recruitment at telomeres. Mol. – important to long-range silencing. In addition, this region of Cell 35: 403 413. Dorigo, B., T. Schalch, A. Kulangara, S. Duda, R. R. Schroeder et al., the nucleosome may act as a binding surface for silencing 2004 Nucleosome arrays reveal the two-start organization of proteins, including the paralogs Sir3p and Orc1p. the chromatin fiber. Science 306: 1571–1573. Duina, A. A., and F. Winston, 2004 Analysis of a mutant histone Acknowledgments H3 that perturbs the association of Swi/Snf with chromatin. – We thank Patrick Lynch, Yuting Fan, Radharani De, and Mol. Cell. Biol. 24: 561 572. Edmondson, D. G., M. M. Smith, and S. Y. Roth, 1996 Repression Yang (Sunny) Wu for technical assistance; Fred Winston, domain of the yeast global repressor Tup1 interacts directly with Michael Grunstein, Jef Boeke, Junbiao Dai, Daniel Gottschling, histones H3 and H4. Genes Dev. 10: 1247–1259. Toishio Tsukiyama, Jasper Rine, and Rolf Sternglanz for yeast Fry, C. J., A. Norris, M. Cosgrove, J. D. Boeke, and C. L. Peterson, strains and plasmids; and Junbiao Dai for comments on the 2006 The LRS and SIN domains: two structurally equivalent manuscript. This work was supported by a grant from the but functionally distinct nucleosomal surfaces required for tran- scriptional silencing. Mol. Cell. Biol. 26: 9045–9059. National Institutes of Health (GM073991) (to L.N.R.). Gardner, K. A., J. Rine, and C. A. Fox, 1999 A region of the Sir1 protein dedicated to recognition of a silencer and required for Literature Cited interaction with the Orc1 protein in Saccharomyces cerevisiae. Genetics 151: 31–44. Altaf, M., R. T. Utley, N. Lacoste, S. Tan, S. D. Briggs et al., Hecht, A., T. Laroche, S. Strahl-Bolsinger, S. M. Gasser, and M. 2007 Interplay of chromatin modifiers on a short basic patch Grunstein, 1995 Histone H3 and H4 N-termini interact with of histone H4 tail defines the boundary of telomeric heterochro- SIR3 and SIR4 proteins: a molecular model for the formation of matin. Mol. Cell 28: 1002–1014. heterochromatin in yeast. Cell 80: 583–592. Auth, T., E. Kunkel, and F. Grummt, 2006 Interaction between Hickman, M. A., and L. N. Rusche, 2007 Substitution as a mecha- HP1alpha and replication proteins in mammalian cells. Exp. Cell nism for genetic robustness: the duplicated deacetylases Hst1p Res. 312: 3349–3359. and Sir2p in Saccharomyces cerevisiae. PLoS Genet. 3: e126. Bedalov, A., M. Hirao, J. Posakony, M. Nelson, and J. A. Simon, Hickman, M. A., and L. N. Rusche, 2009 The Sir2-Sum1 complex 2003 NAD1-dependent deacetylase Hst1p controls biosynthe- represses transcription using both promoter-specific and long- sis and cellular NAD1 levels in Saccharomyces cerevisiae. Mol. range mechanisms to regulate cell identity and sexual cycle in Cell. Biol. 23: 7044–7054. the yeast Kluyveromyces lactis. PLoS Genet. 5: e1000710. Bernstein,B.E.,E.L.Humphrey,R.L.Erlich,R.Schneider,P.Bouman Hickman, M. A., and L. N. Rusche, 2010 Transcriptional silenc- et al., 2002 Methylation of histone H3 Lys 4 in coding regions of ing functions of the yeast protein Orc1/Sir3 subfunctionalized active genes. Proc. Natl. Acad. Sci. USA 99: 8695–8700. after gene duplication. Proc. Natl. Acad. Sci. USA 107: 19384– Bierne, H., T. N. Tham, E. Batsche, A. Dumay, M. Leguillou et al., 19389. 2009 Human BAHD1 promotes heterochromatic gene silenc- Hollenberg, S. M., R. Sternglanz, P. F. Cheng, and H. Weintraub, ing. Proc. Natl. Acad. Sci. USA 106: 13826–13831. 1995 Identification of a new family of tissue-specific basic he-

546 E. T. Prescott, A. Safi, and L. N. Rusche lix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. Megee, P. C., B. A. Morgan, B. A. Mittman, and M. M. Smith, 15: 3813–3822. 1990 Genetic analysis of histone H4: essential role of lysines Hoppe, G. J., J. C. Tanny, A. D. Rudner, S. A. Gerber, S. Danaie et al., subject to reversible acetylation. Science 247: 841–845. 2002 Steps in assembly of silent chromatin in yeast: Sir3-in- Mellone, B. G., L. Ball, N. Suka, M. R. Grunstein, J. F. Partridge dependent binding of a Sir2/Sir4 complex to silencers and role et al., 2003 Centromere silencing and function in fission yeast for Sir2-dependent deacetylation. Mol. Cell. Biol. 22: 4167– is governed by the amino terminus of histone H3. Curr. Biol. 13: 4180. 1748–1757. Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente, Muhlrad, D., R. Hunter, and R. Parker, 1992 A rapid method for 2000 Transcriptional silencing and longevity protein Sir2 localized mutagenesis of yeast genes. Yeast 8: 79–82. is an NAD-dependent histone deacetylase. Nature 403: Norris, A., M. A. Bianchet, and J. D. Boeke, 2008 Compensatory 795–800. interactions between Sir3p and the nucleosomal LRS surface Irlbacher, H., J. Franke, T. Manke, M. Vingron, and A. E. Ehrenhofer- imply their direct interaction. PLoS Genet. 4: e1000301. Murray, 2005 Control of replication initiation and heterochro- Onishi,M.,G.G.Liou,J.R.Buchberger,T.Walz,andD. matin formation in Saccharomyces cerevisiae by a regulator of Moazed, 2007 Role of the conserved Sir3-BAH domain in nu- meiotic gene expression. Genes Dev. 19: 1811–1822. cleosome binding and silent chromatin assembly. Mol. Cell 28: Johnson, L. M., P. S. Kayne, E. S. Kahn, and M. Grunstein, 1015–1028. 1990 Genetic evidence for an interaction between SIR3 and Pak, D. T., M. Pflumm, I. Chesnokov, D. W. Huang, R. Kellum histone H4 in the repression of the silent mating loci in Saccha- et al., 1997 Association of the origin recognition complex romyces cerevisiae. Proc. Natl. Acad. Sci. USA 87: 6286–6290. with heterochromatin and HP1 in higher eukaryotes. Cell 91: Johnson, L. M., G. Fisher-Adams, and M. Grunstein, 311–323. 1992 Identification of a non-basic domain in the histone H4 Park, E. C., and J. W. Szostak, 1990 Point mutations in the yeast N-terminus required for repression of the yeast silent mating histone H4 gene prevent silencing of the silent mating type locus loci. EMBO J. 11: 2201–2209. HML. Mol. Cell. Biol. 10: 4932–4934. Kan, P. Y., T. L. Caterino, and J. J. Hayes, 2009 The H4 tail Park, J. H., M. S. Cosgrove, E. Youngman, C. Wolberger, and J. D. domain participates in intra- and internucleosome interactions Boeke, 2002 A core nucleosome surface crucial for transcrip- with protein and DNA during folding and oligomerization of tional silencing. Nat. Genet. 32: 273–279. nucleosome arrays. Mol. Cell. Biol. 29: 538–546. Parra,M.A.,D.Kerr,D.Fahy,D.J.Pouchnik,andJ.J.Wyrick, Kayne, P. S., U. J. Kim, M. Han, J. R. Mullen, F. Yoshizaki et al., 2006 Deciphering the roles of the histone H2B N-terminal do- 1988 Extremely conserved histone H4 N terminus is dispens- main in genome-wide transcription. Mol. Cell. Biol. 26: 3842–3852. able for growth but essential for repressing the silent mating loci Pierce, M., K. R. Benjamin, S. P. Montano, M. M. Georgiadis, E. in yeast. Cell 55: 27–39. Winter et al., 2003 Sum1 and Ndt80 proteins compete for Klar, A. J., S. N. Kakar, J. M. Ivy, J. B. Hicks, G. P. Livi et al., binding to middle sporulation element sequences that control 1985 SUM1, an apparent positive regulator of the cryptic mat- meiotic gene expression. Mol. Cell. Biol. 23: 4814–4825. ing-type loci in Saccharomyces cerevisiae.Genetics111:745–758. Pokholok, D. K., C. T. Harbison, S. Levine, M. Cole, N. M. Hannett Kurdistani, S. K., D. Robyr, S. Tavazoie, and M. Grunstein, et al., 2005 Genome-wide map of nucleosome acetylation and 2002 Genome-wide binding map of the histone deacetylase methylation in yeast. Cell 122: 517–527. Rpd3 in yeast. Nat. Genet. 31: 248–254. Prasanth, S. G., K. V. Prasanth, K. Siddiqui, D. L. Spector, and B. Kyriss, M. N., Y. Jin, I. J. Gallegos, J. A. Sanford, and J. J. Wyrick, Stillman, 2004 Human Orc2 localizes to centrosomes, centro- 2010 Novel functional residues in the core domain of histone meres and heterochromatin during chromosome inheritance. H2B regulate yeast gene expression and silencing and affect the EMBO J. 23: 2651–2663. response to DNA damage. Mol. Cell. Biol. 30: 3503–3518. Prasanth, S. G., Z. Shen, K. V. Prasanth, and B. Stillman, Landry, J., J. T. Slama, and R. Sternglanz, 2000 Role of NAD(1) 2010 Human origin recognition complex is essential for HP1 in the deacetylase activity of the SIR2-like proteins. Biochem. binding to chromatin and heterochromatin organization. Proc. Biophys. Res. Commun. 278: 685–690. Natl. Acad. Sci. USA 107: 15093–15098. Laurenson, P., and J. Rine, 1991 SUM1–1: a suppressor of silenc- Recht, J., B. Dunn, A. Raff, and M. A. Osley, 1996 Functional ing defects in Saccharomyces cerevisiae. Genetics 129: 685–696. analysis of histones H2A and H2B in transcriptional repression Lenfant, F., R. K. Mann, B. Thomsen, X. Ling, and M. Grunstein, in Saccharomyces cerevisiae. Mol. Cell. Biol. 16: 2545–2553. 1996 All four core histone N-termini contain sequences re- Robert, F., D. K. Pokholok, N. M. Hannett, N. J. Rinaldi, M. Chandy quired for the repression of basal transcription in yeast. EMBO et al., 2004 Global position and recruitment of HATs and J. 15: 3974–3985. HDACs in the yeast genome. Mol. Cell 16: 199–209. Lidonnici, M. R., R. Rossi, S. Paixao, R. Mendoza-Maldonado, R. Rusche, L. N., and J. Rine, 2001 Conversion of a gene-specific Paolinelli et al., 2004 Subnuclear distribution of the largest repressor to a regional silencer. Genes Dev. 15: 955–967. subunit of the human origin recognition complex during the cell Rusche, L. N., A. L. Kirchmaier, and J. Rine, 2002 Ordered nucle- cycle. J. Cell Sci. 117: 5221–5231. ation and spreading of silenced chromatin in Saccharomyces Ling, X., T. A. Harkness, M. C. Schultz, G. Fisher-Adams, and M. cerevisiae. Mol. Biol. Cell 13: 2207–2222. Grunstein, 1996 Yeast histone H3 and H4 amino termini are Rusche, L. N., A. L. Kirchmaier, and J. Rine, 2003 The establish- important for nucleosome assembly in vivo and in vitro: redun- ment, inheritance, and function of silenced chromatin in Saccha- dant and position-independent functions in assembly but not in romyces cerevisiae. Annu. Rev. Biochem. 72: 481–516. gene regulation. Genes Dev. 10: 686–699. Sabet, N., F. Tong, J. P. Madigan, S. Volo, M. M. Smith et al., Lynch, P. J., H. B. Fraser, E. Sevastopoulos, J. Rine, and L. N. 2003 Global and specific transcriptional repression by the his- Rusche, 2005 Sum1p, the origin recognition complex, and tone H3 amino terminus in yeast. Proc. Natl. Acad. Sci. USA the spreading of a promoter-specific repressor in Saccharomyces 100: 4084–4089. cerevisiae. Mol. Cell. Biol. 25: 5920–5932. Safi, A., K. A. Wallace, and L. N. Rusche, 2008 Evolution of new McCord, R., M. Pierce, J. Xie, S. Wonkatal, C. Mickel et al., function through a single amino acid change in the yeast re- 2003 Rfm1, a novel tethering factor required to recruit the pressor Sum1p. Mol. Cell. Biol. 28: 2567–2578. Hst1 histone deacetylase for repression of middle sporulation Sampath, V., P. Yuan, I. X. Wang, E. Prugar, F. van Leeuwen et al., genes. Mol. Cell. Biol. 23: 2009–2016. 2009 Mutational analysis of the Sir3 BAH domain reveals mul-

Histones Contribute to Sum1-1 Silencing 547 tiple points of interaction with nucleosomes. Mol. Cell. Biol. 29: Thompson, J. S., M. L. Snow, S. Giles, L. E. McPherson, and M. 2532–2545. Grunstein, 2003 Identification of a functional domain within Santos-Rosa, H., R. Schneider, A. J. Bannister, J. Sherriff, B. E. the essential core of histone H3 that is required for telomeric Bernstein et al., 2002 Active genes are tri-methylated at K4 and HM silencing in Saccharomyces cerevisiae. Genetics 163: of histone H3. Nature 419: 407–411. 447–452. Santos-Rosa,H.,A.J.Bannister,P.M.Dehe,V.Geli,andT. Triolo, T., and R. Sternglanz, 1996 Role of interactions between Kouzarides, 2004 Methylation of H3 lysine 4 at euchromatin the origin recognition complex and SIR1 in transcriptional si- promotes Sir3p association with heterochromatin. J. Biol. lencing. Nature 381: 251–253. Chem. 279: 47506–47512. van Leeuwen, F., P. R. Gafken, and D. E. Gottschling, 2002 Dot1p Schmitt, M. E., T. A. Brown, and B. L. Trumpower, 1990 A rapid modulates silencing in yeast by methylation of the nucleosome and simple method for preparation of RNA from Saccharomyces core. Cell 109: 745–756. cerevisiae. Nucleic Acids Res. 18: 3091–3092. Watson, A. D., D. G. Edmondson, J. R. Bone, Y. Mukai, Y. Yu et al., Shen, Z., K. M. Sathyan, Y. Geng, R. Zheng, A. Chakraborty et al., 2000 Ssn6-Tup1 interacts with class I histone deacetylases re- 2010 A WD-repeat protein stabilizes ORC binding to chroma- quired for repression. Genes Dev. 14: 2737–2744. tin. Mol. Cell 40: 99–111. Weber, J. M., H. Irlbacher, and A. E. Ehrenhofer-Murray, Shogren-Knaak, M., H. Ishii, J. M. Sun, M. J. Pazin, J. R. Davie 2008 Control of replication initiation by the Sum1/Rfm1/ et al., 2006 Histone H4-K16 acetylation controls chromatin Hst1 histone deacetylase. BMC Mol. Biol. 9: 100. structure and protein interactions. Science 311: 844–847. White, C. L, R. K Suto, and K. Luger, 2001 Structure of the yeast Singer, M. S., and D. E. Gottschling, 1994 TLC1: template RNA nucleosome core particle reveals fundamental changes in inter- component of Saccharomyces cerevisiae telomerase. Science 266: nucleosome interactions. EMBO J. 20: 5207–5218. 404–409. Xie, J., M. Pierce, V. Gailus-Durner, M. Wagner, E. Winter et al., Smith, J. S., C. B. Brachmann, I. Celic, M. A. Kenna, S. Muhammad 1999 Sum1 and Hst1 repress middle sporulation-specific gene et al., 2000 A phylogenetically conserved NAD1-dependent expression during mitosis in Saccharomyces cerevisiae. EMBO J. protein deacetylase activity in the Sir2 protein family. Proc. Natl. 18: 6448–6454. Acad. Sci. USA 97: 6658–6663. Yu, Q., X. Zhang, and X. Bi, 2011 Roles of chromatin remodeling Sperling, A. S., and M. Grunstein, 2009 Histone H3 N-terminus factors in the formation and maintenance of heterochromatin regulates higher order structure of yeast heterochromatin. Proc. structure. J. Biol. Chem. 286: 14659–14669. Natl. Acad. Sci. USA 106: 13153–13159. Zill, O. A., and J. Rine, 2008 Interspecies variation reveals a con- Sutton, A., R. C. Heller, J. Landry, J. S. Choy, A. Sirko et al., served repressor of alpha-specific genes in Saccharomyces yeasts. 2001 A novel form of transcriptional silencing by Sum1-1 Genes Dev. 22: 1704–1716. requires Hst1 and the origin recognition complex. Mol. Cell. Biol. 21: 3514–3522. Communicating editor: M. Hampsey

548 E. T. Prescott, A. Safi, and L. N. Rusche GENETICS

Supporting Information http://www.genetics.org/content/suppl/2011/05/05/genetics.111.129197.DC1

A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae

Eugenia T. Prescott, Alexias Safi, and Laura N. Rusche

Copyright © 2011 by the Genetics Society of America DOI: 10.1534/genetics.111.129197

File S1

Supporting Materials and Methods

Yeast strains

Strains used in this study were derived from W303‐1b and are described in Table S1. The hht1‐hhf1Δ::NatMX, hht2‐ hhf2Δ::HygMX, sum1Δ::URA3, sir2Δ::LEU2, set1Δ::URA3, and dot1Δ::URA3 alleles are complete deletions of the open reading frames generated by one step gene replacement. To generate the hmrΔ::URA3 allele, HMRa sequence including the E silencer, a1 and a2 genes was replaced with URA3 by one step gene replacement using primers 5’

GAAATGCAAGGATTGGTGATGAGATAAGATAATGAAACATAGATT GTACTGAGAGTGCAC 3’ and 5’

CCTCGAGGTGTAATCTAAATAATAACTTTATCGCAGTAGACTGTGCGGT ATTTCACACCG 3’. To generate the pYGL138C‐LEU2 reporter allele, the open reading frame of YGL138C was replaced precisely with the LEU2 open reading frame by one‐step gene replacement. Correct integrations were confirmed by PCR using primers flanking the sites of insertion. These alleles were moved into the desired genetic backgrounds through standard genetic crosses.

To generate ADE2::Gal4DBD‐7myc‐SUM1‐1, an integrating plasmid was first constructed. The Gal4 DNA binding domain (DBD; amino acids 1‐94) was amplified from genomic DNA using oligos that contain NcoI restriction sites at the ends.

This DNA fragment was digested with NcoI and ligated into pLR20 (7myc‐SUM1‐1 ADE2) to generate pLR40 (Gal4DBD‐7myc‐

SUM1‐1 ADE2). A NotI/BamHI fragment containing Gal4DBD‐7myc‐SUM1‐1 was isolated from plasmid pLR40 and ligated into the integrating plasmid pRS402 to generate pLR836. A unique AgeI site was created within the ADE2 ORF by site‐directed mutagenesis to generate plasmid pLR855. pLR855 was linearized with AgeI and integrated at the ADE2 locus.

To generate ORC1::3HA‐HIS3, a 3HA‐HIS3 tagging cassette was amplified from plasmid pLR541 (derived from pMPY‐

3xHA (SCHNEIDER et al. 1995)) with primers having homology to the 3’ end of ORC1. This PCR product was integrated at the ORC1 locus to create LRY1991 (W303‐1b MATα ORC1::3HA‐HIS3). To generate orc1E84K::3HA‐HIS3 and orc1P179L::3HA‐HIS3, the

ORC1::3HA‐HIS3 allele was amplified from LRY1991 and incorporated into pLR560 (ORC1 URA3) by homologous recombination to obtain pLR776 (ORC1::3HA‐HIS3 URA3). The E84K and P179L mutations were created by site‐directed mutagenesis of pLR776, and these mutated orc1 genes were then integrated at the ORC1 locus. The orc1Δbah::3HA‐HIS3 allele, which lacks amino acids 2‐235, was generated in two steps. First, orc1Δbah from plasmid pSPB1.48 (BELL et al. 1995) was integrated at the

ORC1 locus by one‐step gene replacement in an orc1Δ::URA3 strain. Then, a 3HA‐HIS3 tagging cassette was integrated at the 3’ end of the orc1Δbah gene.

2 SI E. T. Prescott, A. Safi, and L. N. Rusche

Plasmids

Plasmids used in this study are described in Tables S2‐S5. Single point mutations to histones H3 and H4 were obtained from Jef Boeke (FRY et al. 2006) or made in one of two ways. Some histone mutations were created by site directed mutagenesis of pDM18. Other mutations were generated by homologous recombination to integrate desired mutations from other plasmids into pDM18. A BstNI‐SpeI fragment containing the HHF2 gene with the desired mutation was isolated from plasmids generated in the Grunstein lab. HHF2‐R17G, H18G, and K20G mutations were isolated from yeast strains LJY921,

LJY933, LJY952 (JOHNSON et al. 1990), and HHF2‐D24P and G28P were isolated from yeast strains containing modified versions of pUK499 HHF2 URA3 (KAYNE et al. 1988). A wild‐type yeast strain was transformed with the mutated HHF2 fragment of interest and linearized pDM18 in which the HHF2 gene had been removed using BglII and HpaI. Intact plasmids regenerated by homologous recombination were isolated from yeast, amplified in E. coli, and sequenced to verify the presence of the mutation of interest. Histone H3 and H4 tail deletion plasmids pLR497 (HHF2Δ5‐20), pLR501 (HHT2Δ4‐28), and pLR547 (HHT2Δ30‐40) were created by site‐directed deletion of pDM18.

Plasmids containing multiple lysine mutations were created by ligating synthetic histone genes obtained from Junbiao

Dai and Jef Boeke (DAI et al. 2008) into pDM18. Plasmids pLR673 (HHTS‐K9,14,18,23R), pLR674 (HHTS‐K9,14,18,23Q), and pLR675 (HHTS‐K9,14,18,23A) were created by ligation of a NotI‐KpnI fragment containing mutated HHTS (DAI et al. 2008) into the NotI‐KpnI sites of pDM18, replacing the H3 gene. Plasmids pLR672 (HHFS‐K5,8,12,16Q), pLR676 (HHFS‐K5,8,12,16A), pLR677

(HHFS‐K5,8,12,16R), and pLR747 (HHTS‐K4A) were created by ligation of a SalI‐NotI fragment containing mutated HHFS (DAI et al. 2008) into the SalI‐NotI sites of pDM18, replacing the H4 gene. Plasmids pLR700 (HHTS‐K9,14,18,23Q HHFS‐K5,8,12,16Q) and pLR702 (HHTS‐K9,14,18,23A HHFS‐K5,8,12,16A) were created by ligation of a MluI‐BamHI fragment containing HHTS from pLR674 or pLR675 into pLR672 or pLR676. Plasmid pLR763 (HHTS‐K9,14,18,23Q HHF2‐K5,8,12Q was created using site directed mutagenesis of pLR700. Plasmid pLR766 (HHTS‐K9,14,18,23R HHF2‐K5,8,12R) was created by ligation of a PstI‐BamHI fragment containing HHF2‐K5,8,12R (Grunstein lab) into pLR673. Plasmid pLR701 (HHTS‐K9,14,18,23R HHF2‐K8,12,16R) was created by ligation of a PstI‐BamHI fragment containing HHF2‐K8,12,16R (Grunstein lab) into pLR673.

A modified HMR synthetic silencer with Gal4 binding sites replacing ORC binding sites (HMRa‐Gal4) was created in several steps. First, pLR495 containing a HindIII fragment of HMR was altered by site‐directed mutagenesis to replace the ACS binding sites at the E and I silencers with Gal4 binding sites. HMR‐E CCTAAATATAAAAAATG was mutated to

CGGAATTCTGAATTCCG, and HMR‐I CATTAATTAATATTTAT was mutated to CGGAAATCTGATTTCCG, creating pLR559. Additional mutagenesis was performed to remove a 9/11 bp match to the ACS at HMR‐I that was essential for ARS function (CHANG et al.

2008) and a cryptic ACS near HMR‐E. Specifically, at HMR‐E TTGTTTA was changed to TCGTAGA, and HMR‐I TATCATG was changed to GGTCGAC to generate plasmid pLR805.

E. T. Prescott, A. Safi, and L. N. Rusche 3 SI

Reporter assays

To test the dominance of histone mutations that disrupt Sum1‐1 silencing, yeast were grown on medium lacking tryptophan and uracil to maintain both wild‐type and mutant histone plasmids. Alternatively, yeast with chromosomal histone genes (LRY1363) were transformed with mutant histone plasmids and mating was assessed in medium lacking tryptophan to select for the mutant plasmids. For these experiments, LRY2386 MATa his4‐519 trp1 ura3‐52 was the mating partner, and prototrophic diploids were selected on YM plates supplemented with uracil.

4 SI E. T. Prescott, A. Safi, and L. N. Rusche

Table S1 Strains used in this study Strain Genotype Source W303‐1b MATα ade2‐1 can1‐100 his3‐11,15 leu2‐3,112 trp1‐1 ura3‐1 R. Rothstein LRY0144 W301‐1b MATα sum1Δ::URA3 LRY0341 W303‐1b MATα sir3Δ::LEU2 Rusche and Rine, 2001 LRY0344 W303‐1b MATα sir3Δ::LEU2 SUM1‐1 S. Loo LRY0459 W303‐1b MATα sir2Δ::HIS3 7myc‐SUM1‐1 LRY0529 W303‐1b MATα 7myc‐SUM1‐1 Rusche and Rine, 2001 LRY1007 W303‐1b MATα LRY1021 MATa his4 P. Schatz LRY1022 MATα his4 P. Schatz LRY1363 W303‐1b MATα sir2Δ::HIS3 7myc‐SUM1‐1 pRS316 LRY1364 W303‐1b MATα sir2Δ::HIS3 7myc‐SUM1‐1 dot1Δ::URA3 LRY1384 W303‐1b MATα sir2Δ::HIS3 7myc‐SUM1‐1 set1Δ::URA3 LRY1450 W303‐1b MATα hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMX 7myc‐SUM1‐1 sir2Δ::HIS3 pDM9

LRY1729 MATa sum1Δ::URA3 leu2‐3,112 trp1‐901 URA3::(lexAop)8‐ lacZ LYS2:(lexAop)4‐HIS3 LRY1793 W303‐1b MATa hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMx 3myc‐SUM1 pPES4‐HIS3 pDM9

LRY1835 MATa sum1Δ::URA3 orc1ΔBAH HMRssΔI leu2‐3,112 trp1‐901 URA3::(lexAop)8‐ lacZ LYS2:(lexAop)4‐HIS3 LRY1849 W303‐1b MATα hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMX pPES4‐HIS3 pYGL138C‐LEU2 3myc‐SUM1 pDM9 LRY1853 W303‐1b MATα hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMX hst1Δ::KanMX pPES4‐HIS3 pYGL138C‐LEU2 3myc‐SUM1 pDM18 LRY1854 W303‐1b MATα hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMX pPES4‐HIS3 pYGL138C‐LEU2 sum1Δ::URA3 pDM18 LRY1855 W303‐1b MATα hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMX hst1Δ::KanMX sum1Δ::URA3 pPES4‐HIS3 pYGL138C‐LEU2 pDM18 LRY1879 W303‐1b MATα sum1Δ::URA3 orc1ΔBAH LRY2386 MATa his4‐519 trp1 ura3‐52 LRY2423 W303‐1b MATa hht1‐hhf1Δ::NatMX hht2‐hhf2Δ::HygMx pPES4‐HIS3 VR‐ADE2‐TEL pDM9 LRY2752 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 hmrΔ::URA3 SUM1‐1 ADE2::Gal4DBD‐7myc‐SUM1‐1 lys2 pLR805 LRY2753 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 hmrΔ::URA3 SUM1‐1 ADE2::Gal4DBD‐7myc‐SUM1‐1 ORC1::3HA‐HIS3 lys2 pLR805 LRY2754 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 hmrΔ::URA3 SUM1‐1 ADE2::Gal4DBD‐7myc‐SUM1‐1 orc1E84K::3HA‐HIS3 lys2 pLR805

E. T. Prescott, A. Safi, and L. N. Rusche 5 SI

LRY2755 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 hmrΔ::URA3 SUM1‐1 ADE2::Gal4DBD‐7myc‐SUM1‐1 orc1P179L::3HA‐HIS3 lys2 pLR805 LRY2756 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 hmrΔ::URA3 SUM1‐1 ADE2::Gal4DBD‐7myc‐SUM1‐1 orc1ΔBAH::3HA‐HIS3 lys2 pLR805 LRY2762 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 SUM1‐1 lys2 LRY2763 W303‐1b MATα sir2Δ::LEU2 sir3:Δ:LEU2 SUM1‐1 ORC1::3HA‐HIS3 lys2 LRY2764 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 SUM1‐1 orc1E84K::3HA‐HIS3 lys2 LRY2765 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 SUM1‐1 orc1P179L::3HA‐HIS3 lys2 LRY2766 W303‐1b MATα sir2Δ::LEU2 sir3Δ::LEU2 SUM1‐1 orc1ΔBAH::3HA‐HIS3 lys2 LRY2804 W303‐1b MATα sir2Δ::LEU2 sir3:Δ:LEU2 hmrΔ::URA3 SUM1‐1 ORC1::3HA‐HIS3 lys2 pLR805 pDM9 (ARS/CEN URA3 HHT1 HHF1) pDM18 (ARS/CEN TRP1 HHT2 HHF2) pLR805 (ARS/CEN TRP1 HMRa‐Gal4)

6 SI E. T. Prescott, A. Safi, and L. N. Rusche

Table S2 Plasmids used in this study Plasmid Description Vector Source pDM18 HHT2 HHF2 pRS414 Duina and Winston 2004 pDM9 HHT1 HHF1 pRS416 Duina and Winston 2004 pGAD424 GAD pGAD424 Bartel et al. 2003 pJR2291 3myc‐SUM1‐1 pRS412 Rusche and Rine, 2001 pJR2292 3myc‐SUM1 pRS412 Rusche and Rine, 2001 pLR047 3HA‐SUM1‐1 pRS415 Safi and Rusche, 2008 pLR052 3HA‐SUM1 pRS415 Safi and Rusche, 2008 pLR615 HHT2 E73G HHF2 pRS414 pLR619 HHT2 K4I HHF2 pRS414 pLR640 HHT2 HHF2 I21V pRS414 pLR805 HMRa‐Gal4 pRS414 pRH01 GAD‐SUM1 pGAD424 Sutton et al. 2001 pRH02 GAD‐SUM1‐1 pGAD424 Sutton et al. 2001 pTT93 LexA‐ORC5 pBTM116 Sutton et al. 2001

E. T. Prescott, A. Safi, and L. N. Rusche 7 SI

Table S3 Plasmids obtained in the screen for histone mutations that disrupt Sum1‐1 silencing Histone H3 Plasmid Mutations >10X 10X WT pLR602 Q76R Q76R pLR603 F78L, T80A, S102P T80A F78L pLR604 T3A, Q76R Q76R T3A pLR605 R2G, Q76R R2G, Q76R pLR606 T3S, S10P, K64R, I112V T3S pLR607 E73G, K79R E73G K79R pLR608 K14R, E73D, K115R E73D K14R, K115R pLR609 Q76R, S135T Q76R pLR610b K4R K4R pLR611 T3A, T6A, R17G, K37R T3A, R17G T6A pLR612 K4E K4E pLR613 K9R, E73G, T80N E73G K9R pLR614 R2S R2S pLR615a E73G E73G pLR616 K18E, E73K E73K pLR617 R2G R2G pLR618 A1P, E73G, V117A E73G V117A pLR619 K4I K4I pLR620 A1V, K4R K4R pLR621 E73G, K121R E73G pLR623 T80A T80A pLR624 Q5L, Q76R Q76R pLR625 K4R, K27N, S31P, L60Q K4R pLR626 K79E K79E pLR627 R8G, I74V, Q76R, F78S, F84L, S87T Q76R R8G pLR628 R17G, L70S R17G, L70S pLR629 A25V, Q68R, K125I Q68R pLR630 A1T, G12A, D77G A1T pLR631 R2G, A88T, E133G R2G pLR632 K4R, R63G, F67L, R134S K4R pLR635 S31F, Q76R, K125R Q76R pLR636 R8K, R17S, R128G R8K, R17S pLR637 K4R, T11S, Q19R, K23R, L70S K4R L70S K23R

8 SI E. T. Prescott, A. Safi, and L. N. Rusche

Table S3 (cont) Plasmids obtained in the screen for histone mutations that disrupt Sum1‐1 silencing Histone H3 Plasmid Mutations >10X 10X WT pLR684 A1G, R17W, V71A, K79E K79E A1G, R17W pLR685 R8G, G13R R8G pLR686 K4R, stop136W, insert I137, stop138 K4R pLR687 K36R, L96S K36R Total 71 10 12 9 a H3 E73G was isolated 2 independent times, b H3 K4R was isolated 3 independent times

Histone H4 Plasmid Mutations >10X 10X WT pLR638 R17C, H18R, S47A, R55G H18R, R55G S47A pLR639 R19G, I26T R19G, I26T pLR640 I21V I21V pLR641 H18P H18P pLR642 I26F, R55G, F61L R55G F61L pLR643 R55G, V70A R55G pLR644 H18R, R19G, K31R, R55G R19G H18R, R55G K31R pLR645 R23G, V57A, T96A R23G pLR646 R23G, T73A, K77R R23G K77R pLR647 S1P, H18R, R23G H18R, R23G pLR648 I26T, F61L I26T F61L Total 18 4 3 4

Plasmids containing 1 to 6 amino acid mutations were recovered in a screen. For each plasmid, individual histone mutations were tested until a mutation or combination of mutations could be identified that resulted in a 10‐fold or greater loss of silencing.

E. T. Prescott, A. Safi, and L. N. Rusche 9 SI

Table S4 Histone mutations that disrupt Sum1‐1 silencing Histone H3 Histone H4 Plasmid Mutation Phenotype Plasmid Mutation Phenotype pLR617 R2G 1,000X pLR760 R17Ga 1,000X pLR614 R2S 1,000X pLR761 H18Ga 1,000X pLR708 T3S 1,000X pLR641 H18P 1,000X pLR747 K4Ab 10,000X pLR697 R19G 100X pLR612 K4E 100X pLR640 I21V 10,000X pLR619 K4I 1,000X pLR764 D24Pa 10,000X pLR610 K4R 100X pLR678 I26T 100X JD‐E11 R72Ga 100,000X pLR765 G28Pa 10,000X pLR715 E73D 1,000X pLR615 E73G 10,000X Sum1‐1 screen pLR716 E73K 10,000X lrs/H4 tail residuesa JD‐E12 A75Va 100X alanine scanningb pLR602 Q76R 1,000X JD‐E2 K79Qa 100X

14 histone H3 and 8 histone H4 mutations were found to disrupt Sum1‐1 silencing by more than 10‐fold. The observed decrease in mating as determined using a semi‐quantitative mating assay is shown, along with the method of identification for each mutation.

10 SI E. T. Prescott, A. Safi, and L. N. Rusche

Table S5 Histone mutations that do not disrupt Sum1‐1 silencing Histone H3 Histone H4 Plasmid Mutation Phenotype Plasmid Mutation Phenotype JD‐G4 R2A 10X JD‐A3 R3A WT JD‐G5 R2K WT JD‐A5 K5A WT pLR0748 K4Q 10X JD‐A8 K8A WT JD‐G8 K9A WT JD‐A11 K12A WT JD‐G10 K9Q WT JD‐B2 K16A WT JD‐G9 K9R WT JD‐B5 K20A WT JD‐G11 S10A WT pLR0762 K20G 10X JD‐H1 T11A WT JD‐B8 K31A WT JD‐H3 K14A 10X JD‐B12 S47E WT JD‐H5 K14Q WT JD‐C1 K59A 10X JD‐H6 R17A WT JD‐C4 K77A WT JD‐H8 K18A WT pLR0749 R78G WT JD‐H11 K23A WT JD‐C7 K79A WT JD‐2A2 R26A WT JD‐F7 K79M 10X JD‐2A4 K27A WT pLR0750 T80A 10X JD‐2A7 S28A WT JD‐F8 V81A WT JD‐2A9 K36A WT JD‐C10 K91A WT pLR0713 K42R WT JD‐D1 R92A WT JD‐D3 R52A WT JD‐D6 R53A WT lrs/H4 tail residues JD‐D9 K56A 10X alanine scanning JD‐D11 K56Q WT JD‐D10 K56R WT JD‐D12 K79A 10X JD‐F4 L82S WT JD‐F5 R83G 10X JD‐E3 K115A WT JD‐E6 T118A WT JD‐E8 K122A WT

49 histone H3 and 25 histone H4 residues did not disrupt Sum1‐1 silencing more than 10‐ fold. The observed decrease in mating, as determined using a semi‐quantitative mating assay, is shown, along with the method of identification for each mutation.

E. T. Prescott, A. Safi, and L. N. Rusche 11 SI

Table S6 Oligonucleotides used in this study Target Sequence 5' HMRa E silencer ‐ 1kb GCAATGACTAGAGAACTATCG 3' HMRa E silencer ‐ 1kb GATCTGAAGGTTCAGTAACTC 5' HMRa E silencer GCAATAGATCATGTACTAAAC 3' HMRa E silencer CGGAATCGAGAATCTTCG 5' HMRa a1 promoter CAATACATCTCCTTATATCAAAG 3' HMRa a1 promoter CAATCTCAGTACCTAGAATG 5' HMRa I silencer CTATGTGTTTATACAATTGC 3' HMRa I silencer GTTGATCATAAGTCTCTTC 5' HMRa I silencer + 1kb CTACAATGCAACCCCAC 3' HMRa I silencer + 1kb TCGACGTCGGATTTGCG 5' PHO5 ORF CTTGAACGATGATTACGAG 3' PHO5 ORF CAAGAAGTCACGAGCATG 5' ATG1 downstream CCAGCTCTTTTATACCTGGATGG 3' ATG1 downstream CCAAAGGCAAGTACTAAACGCAAC 5' ORC1 ORF CCAGAACGTCAGCTAGGC 3' ORC1 ORF GTCGTTTCCAGCCGCATC 5' NTG1 ORF GACTCCAGATCAGACAAGAAC 3' NTG1 ORF CAAGGTTCCTCGATTTAGTG 5' SUM1 ORF CTGGCAAAGGAGAAAGGCG 3' SUM1 ORF ACCGCATGCAGGATGGTG 5' RFM1 ORF ACGTTCACAGTCTAGACTGGGG 3' RFM1 ORF TCAGACCTTCTACGTGACTCCAA 5' HST1 ORF GGATTCTGTGATGACGTGGCC 3' HST1 ORF TATTTCCGTACAGTTGTAATC

12 SI E. T. Prescott, A. Safi, and L. N. Rusche

REFERENCES

BELL, S. P., J. MITCHELL, J. LEBER, R. KOBAYASHI and B. STILLMAN, 1995 The multidomain structure of Orc1p reveals similarity to

regulators of DNA replication and transcriptional silencing. Cell 83: 563‐568.

CHANG, F., J. F. THEIS, J. MILLER, C. A. NIEDUSZYNSKI, C. S. NEWLON et al., 2008 Analysis of chromosome III replicators reveals an

unusual structure for the ARS318 silencer origin and a conserved WTW sequence within the origin recognition

complex binding site. Mol Cell Biol 28: 5071‐5081.

DAI, J., E. M. HYLAND, D. S. YUAN, H. HUANG, J. S. BADER et al., 2008 Probing nucleosome function: a highly versatile library of

synthetic histone H3 and H4 mutants. Cell 134: 1066‐1078.

FRY, C. J., A. NORRIS, M. COSGROVE, J. D. BOEKE and C. L. PETERSON, 2006 The LRS and SIN domains: two structurally equivalent but

functionally distinct nucleosomal surfaces required for transcriptional silencing. Mol Cell Biol 26: 9045‐9059.

JOHNSON, L. M., P. S. KAYNE, E. S. KAHN and M. GRUNSTEIN, 1990 Genetic evidence for an interaction between SIR3 and histone H4 in

the repression of the silent mating loci in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 87: 6286‐6290.

KAYNE, P. S., U. J. KIM, M. HAN, J. R. MULLEN, F. YOSHIZAKI et al., 1988 Extremely conserved histone H4 N terminus is dispensable for

growth but essential for repressing the silent mating loci in yeast. Cell 55: 27‐39.

SCHNEIDER, B. L., W. SEUFERT, B. STEINER, Q. H. YANG and A. B. FUTCHER, 1995 Use of polymerase chain reaction epitope tagging for

protein tagging in Saccharomyces cerevisiae. Yeast 11: 1265‐1274.

E. T. Prescott, A. Safi, and L. N. Rusche 13 SI