The Molecular Regulation of MAP3K1 in Eyelid

Development

A dissertation submitted to the Graduate School

of the University of Cincinnati in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

Department of Environmental Health

of the College of Medicine

2011

by

Esmond N. Geh

Doctor of Medicine, Kharkov Medical Institute

June 1994

Committee Chair: Ying Xia, Ph.D.

Abstract

Tissue morphogenesis is a highly organized and evolutionarily conserved process controlled by the temporal and tissue-specific activation of signal transduction pathways.

The transient closure and then reopening of eyelid is an essential step for vertebrate ocular surface morphogenesis. In mice, eyelid closure takes place at embryonic day 16 (E16), while the closed eyelids re-open at post-natal day 12-14 (P12-14). The temporary closed eyelid is believed to provide a microenvironment favorable for the immature cornea, lens and retina to develop. The mitogen-activated protein kinase kinase kinase 1 (MAP3K1) plays a crucial role in eyelid morphogenesis. Previous studies from our laboratory have shown that MAP3K1 is responsible for the transmission of morphogenetic activin B signals to Jun N-terminal kinases (JNKs), which in turn phosphorylates transcription factor c-JUN to regulate gene expression events involved in eyelid closure. MAP3K1 ablation in mice results in defective embryonic eyelid closure and an obvious eye open at birth (EOB) phenotype. Our previous studies also show that MAP3K1 is highly expressed in the leading edge of the eyelid epithelium just prior to the onset of eyelid closure. The central hypothesis of this dissertation is that activation of Map3k1 gene promoter and expression serves as a critical determinant factor for embryonic eyelid closure. We test this hypothesis by addressing the following pertinent questions.

1. What are the factors responsible for induction of MAP3K1 expression? We tested

various eyelid morphogenetic factors on their abilities to induce the Map3k1 promoter

activity. Our results show that activation of EGFR by its ligands and by microtubule

depolymerizing agents could induce MAP3K1 expression.

ii

2. What are the intracellular signaling pathways that lead to activation of Map3k1

promoter? We established an EGFR/TGFα-RhoA/ROCK signaling cascade that led

to induction of c-JUN. c-JUN in turn bound to and activated the Map3k1 promoter.

3. Are epigenetic mechanisms involved in the regulation of the Map3k1 promoter?

Because the Map3k1 promoter sequence has extremely high CpG content, it could be

regulated by epigenetic mechanisms. We showed that both DNA methylation and

histone acetylation were involved in regulation of the Map3k1 promoter.

4. What are the consequences of MAP3K1 expression? MAP3K1 is an intracellular

protein kinase, involved in the JNK-c-JUN cascade activation. We showed that one of

the downstream events of MAP3K1 was transcriptional activation of AP-1 and the

induction of AP-1 target gene, such as Pai-1, during eyelid development.

iii iv

Acknowledgement

I would like to thank the members of my dissertation committee, Drs. Alvaro Puga

Winston Kao, Jun Ma, and Peter Stambrook for all of your support and suggestions. I

particularly want to thank Dr. Peter Stambrook for the training grant support, without which

this dissertation would not have been possible.

I especially want to express my sincere gratitude to my advisor, Dr. Ying Xia, for the

wonderful opportunity to work on this project. I can’t count the number of times she made

me remember an old African saying, “do not vacillate or you will be stuck in between doing something, having something and being nothing”. Over the years, she has led me to the right direction each time I wavered.

I also would like to thank the following former and current lab members; Maureen

Mongan, Atsushi Takatori, Zhimin Peng, Liang Chen, Qinghang Meng, Chang Jin and

Jingcai Wang. I enjoyed every moment we spent together in the lab, at lab meetings,

seminars and journal clubs. Thank you all for the challenging questions, engaging

discussions and valuable technical assistance you have offered me during the past several

years.

Finally, my deepest gratitude goes to my wife, Emilee Geh, for her unconditional love,

endless support and tremendous sacrifice during all these years. I also would like to thank

my kids, Miranda, David, and Desmond for giving me the opportunity to look at life through

their eyes… it is amazing. Thank you all very much.

v

Table of contents

Abstract ...... ii

Acknowledgement ...... v

Table of contents ...... vi

List of Figures ...... ix

Abbreviations ...... x

Chapter I: Introduction ...... 1

Mammalian eyelid development ...... 2

Molecular networks in the control of eyelid morphogenesis ...... 3

MAPK signaling cascade ...... 4

MAP3K1 signaling ...... 4

MAP3K1 in eyelid development and cell migration ...... 7

MAP3K1 integrates multiple signaling pathways in developing eyelids ...... 8

Chapter II: Experimental Methods...... 10

Antibodies, Reagents and plasmids ...... 11

Cloning of the mouse Map3k1 promoter ...... 11

Cell culture ...... 12

Transfection, adenoviral infection and luciferase assay ...... 12

vi

β-glo assays ...... 14

Cell lysate preparation and Western blot analyses ...... 14

Chromatin Immunoprecipitation (ChIP) Analyses ...... 15

Reverse transcription and quantitative PCR ...... 16

Experimental animal, immunohistochemistry and whole mount X-gal staining ...... 16

Statistical analysis ...... 17

Chapter III: Molecular Pathways that lead to MAP3K1 Expression ...... 18

Establishing experimental systems for studying MAP3K1 induction ...... 19

Induction of MAP3K1 expression by ligands of the EGF receptor ...... 20

Induction of MAP3K1 expression by microtubule depolymerizers ...... 20

The EGFR and RhoA signaling pathways are involved in MAP3K1 induction ...... 21

RhoA facilitates MAP3K1 mediated eyelid closure in vivo...... 22

Summary of Chapter III ...... 23

Chapter IV: Characterization of the Map3k1 promoter ...... 25

Cloning of the Map3k1 promoter ...... 26

The SRC and RhoA are involved in the activation of the Map3k1 promoter ...... 26

MAP3K1 is involved in its own promoter activation ...... 27

Identification of the minimal Map3k1 promoter ...... 29

Summary of Chapter IV ...... 30

Chapter V: Molecular Regulation of the Map3k1 promoter ...... 31

vii

cJun regulates the Map3k1 promoter ...... 32

Modification of the Map3k1 promoter by DNA methylation ...... 33

The Map3k1 promoter modulation by histone acetylation ...... 35

Chapter VI: The cJUN-MAP3K1-cJUN regulatory loop ...... 37

Kinase activity of MAP3K1 is required for JNK and c-JUN phosphorylation ...... 38

Kinase activity of MAP3K1 is required for optimal AP-1 activity ...... 38

MAP3K1 enzyme activity is required for PAI-1 induction ...... 39

Chapter VII: Discussion and future directions ...... 41

The signaling pathways that lead to MAP3K1 expression ...... 42

Transcriptional and epigenetic regulation of Map3k1 promoter...... 44

MAP3K1-dependent downstream signaling pathways ...... 45

Health significance ...... 46

Figures and figure legends ...... 48

References ...... 72

viii

List of Figures

Figure 1: Molecular networks in the control of eyelid morphogenesis ...... 49

Figure 2: MAPK signal transduction cascade ...... 50

Figure 3: Measuring endogenous MAP3K1 expression ...... 51

Figure 4: Induction of endogenous MAP3K1 promoter activity by EGFR ligands ...... 53

Figure 5: Induction of MAP3K1 expression by microtubule depolymerizing agents ...... 54

Figure 6: EGFR and Rho kinase signaling pathways are involved in MAP3K1 induction ...... 55

Figure 7: Cloning of pMap3k1-luc reporter plasmid ...... 56

Figure 8: Signaling pathways of Map3k1 promoter activation ...... 57

Figure 9: MAP3K1 regulates its own promoter activity ...... 58

Figure 10: MAP3K1 is mainly localized in the nucleus ...... 59

Figure 11: Membrane targeting of MAP3K1 abolishes the effect on its own promoter ...... 60

Figure 12: Characterization of the exogenous Map3k1 promoter ...... 61

Figure 13: c-JUN regulates the Map3k1 promoter ...... 63

Figure 14: Epigenetic regulation of the Map3k1 promoter ...... 65

Figure 15: Histone modification of the Map3k1 promoter ...... 66

Figure 16: The kinase activity of MAP3K1 is required for the activation of the JNK-c-JUN cascade ...... 67

Figure 17: The kinase activity of MAP3K1 is required for optimal AP-1 activity ...... 68

Figure 18: MAP3K1 enzyme activity is required for PAI-1 induction ...... 70

ix

Abbreviations

Ac-H4 - Acetylated histone H4.

ActB - Activin B.

AP-1 - Activator protein 1.

As - Arsenic.

Aza - 5-aza-2'deoxycytidine.

Bcr-Abl - Fusion protein of Bcr and Abl genes.

BMP - Bone morphogenic factor.

BMPR - BMP receptor.

ChIP - Chromatin immunoprecipitation.

CHX - Cyclohexamide.

Col - Colchicine.

Cre - causes recombination.

CREB - cAMP-responsive element binding protein.

CytoD - Cytochalasin D.

DKK - Dickkopf relate protein.

DMEM - Dulbecco`s Modified Eagle Medium.

E13 - Embryonic day 13.5.

EGFP - Enhanced green fluoresent protein.

EGFR - Epithelial growth factor receptor.

EOB - Eye open at birth.

ERK - Extracellular signal regulated kinase.

x

ESCs - Embryonic stem cells.

FGF10 - Fibroblast growth factor.

FGFR - Fibroblast growth factor receptor.

FOXL2 - Forkhead box L2.

FRA-2 - Fos related antigen 2.

G418 - Active Geneticin.

GAPDH - Glyceraldehyde-3-phosphate dehydrogenase.

Grhl3 - Grainy head-like 3.

HB-EGF - heparin binding epithelial growth factor.

HDAC - Histone deacetylase.

HEK 293 - Human embronic kidney 293 cells.

HRP - Horse radish peroxide.

IgG - Immunoglobulin G.

IKK - I kappa B kinase.

JNK - JUN N-terminal kinase.

LE - Lens epithelia.

LIF - Leukemia inhibitory factor.

MAP2K - Mitogen activated protein kinase kinase.

MAP3K1 - Mitogen activated kinase kinase kinase 1.

MAPK - Mitogen activated protein kinase.

MEFs - Mouse embronic fibroblast.

Mek - mitogen-activated protein kinase/extracellular signal-regulated kinase.

MEKK1 - MAPK/Erk kinase kinase 1

xi

NaB - Sodium bytyrate.

NF-κB - Nuclear factor kB.

NLS - Nuclear localization signal.

Noco - Nocodazol.

Pai-1- Plasminogen activator inhibitor.

PBS - Phosphate buffered saline.

PCR - Polymerase chain reaction. pfu - Plaque-forming units. p-H3 - Phosphorylate histone H3.

PHD - Plant homeodomain, 7

Pol II - RNA polymerase II.

QPCR - Quantitative PCR.

RhoA - Ras homolog gene family, member A.

RIPA - Radioimmunoprecipitation assay.

RLU - Relative light units. ,

ROCK - Rho asociated kinase.

SRE - Serum response element.

SRF - Serum response factor.

STAT3 - Signal transducer and activator of transcription 3.

Tax - Taxol.

TGFα-transforming growth factor alpha.

TNF-α - Tumor necrosis factor alpha.

TORC1 - Transducer of regulated CREB activity 1. ,

xii

TSA - Trichostatin A.

Vin - Vinblastin.

X-GAL - X galactosidase.

ΔKD - Kinase inactive.

β-GAL - beta galactosidase.

xiii

Chapter I: Introduction

1

Mammalian eyelid development

An essential step in mammalian eyelid development is the transient closure and re- opening of the eyelid (Findlater et al., 1993). Mouse eyelid formation initiates at day 13 of gestation (E13) when the surface ectoderm adjacent to the developing cornea folds into the lid buds. The eyelid fold continues to extend over the developing cornea and fibroblasts begin to appear in the eyelid stroma. The closure of the eyelid happens between E15.5 and E16.5, when the outermost layer of the eyelid epidermis at the developing end starts to elongate and migrate towards the center of the eye. Ultimately, the upper and lower eyelids fuse to form a closed eyelid that covers the corneal surface. Following epithelial fusion, the dermis surrounded by epidermis gradually extends toward the epithelial junction, thus completing the formation of the protective eyelid barrier over the cornea (Harris and Juriloff, 1986; Findlater et al., 1993).

Mouse eyelid remains closed until 12-14 days after birth when the lid fusion breaks down as a consequence of epithelial cell apoptosis and necrosis at the fusion junction. Mice defective in embryonic eyelid closure exhibit an eye open at birth (EOB) phenotype. These mice also exhibit various ocular pathologies, including inflammation, corneal damage and destruction of lacrimal glands (Carroll et al., 1998; Fujii et al., 1995; Mann et al., 1993; Teramoto et al., 1988).

The development of human eyelid undergoes similar processes. Studies of 64 human fetuses show the formation of eyelid folds at 6-8 weeks of fetal life and eyelid development and fusion occurs at 2-5 months of gestation. The closure of the eyelid results in formation of the conjunctival sac, which provides a microenvironment favorable for the maturation and development of cornea and lens. Different from mice, human eyelids re-open and become mature in utero (Sevel, 1988), so that humans are born normally with their eyelid open. Hence, defects in eyelid closure in humans could only be detected in fetuses, making the defects difficult to

2 trace. As a result, human developmental diseases linked to defective eyelid closure have not yet been identified. In this regard, studies in mice, showing complex genetic and signaling networks in the regulation of eyelid closure, should provide vital clues to identify genetic mutation and diseases caused by defective eyelid development in humans (Xia and Karin, 2004).

Molecular networks in the control of eyelid morphogenesis

Many genes have been shown to be important for embryonic eyelid closure, because their gain-of-function or loss-of-function mutations in mice results in EOB. The easily traceable nature of the EOB phenotype leads to identification of a great number of signaling and molecular factors essential for embryonic eyelid closure (Xia and Kao, 2004). So far, the identified “eyelid closure factors” include extracellular morphogenetic factors, Activin βB, TGFα, HB-EGF, BMP,

DKK2 and FGF10 (Luetteke et al., 1993; Mine et al., 2005; Schrewe et al., 1994; Vassalli et al.,

1994; Wankell et al., 2001; Zhang et al., 2003), cell surface receptors, EGFR, FGFR and BMPR

(Li et al., 2001; Naoe et al., 2010), intracellular kinases, MAP3K1, ROCKI/II and JNKs, (Huang et al., 2009; Shimizu et al., 2005; Takatori et al., 2008; Thumkeo et al., 2005; Yujiri et al., 2000) and nuclear transcription factors, c-JUN, FRA-2, FOXL2, Grhl3, and SMAD nuclear transcription factors, (Li et al., 2003; McHenry et al., 1998; Uda et al., 2004; Yu et al., 2008;

Zenz et al., 2003). Detailed analyses of these mice have led to an emerging picture of a complex signaling network in the control of eyelid morphogenesis (Figure 1). All factors appear to be indispensable, yet it is not completely understood how these factors interact and crosstalk to modulate the morphogenesis of eyelid. Recently, it is shown that the BMP-SMAD pathway may establish crosstalks with the Notch and MAP3K1-JNK pathways to regulate embryonic eyelid closure (Huang et al., 2009), suggesting multiple signaling pathways may interact to coordinate developmental eyelid closure.

3

MAPK signaling cascade

In mammals, the MAPK pathway is composed of three major groups, including the extracellular signal regulated kinases (ERKs), the c-Jun N-terminal kinases (JNKs), and the p38

(Davis, 2000). Members of the MAPK family are important for regulating diverse cell functions, such as apoptosis, differentiation, proliferation and migration. The MAPKs are controlled by a three-tiered signal transduction cascade, composed of a MAP3K, a MAP2K and a MAPK. The

MAP3K receives signals from upstream cues and in turn phosphorylates and activates the

MAP2K and thereafter the MAPK (

Figure 2).

Within each MAPK module, the MAP3Ks provide specificity in signal transduction

(Winter-Vann and Johnson, 2007). The MAP3K superfamily consists of more than 20 protein kinases that have sequence similarities within their kinase domains but differ in their regulatory regions. This arrangement allows each MAP3Ks to receive specific cues by interacting with upstream factors through their regulatory domains (Christerson et al., 2002; Fanger et al., 1997;

Pomérance et al., 1998; Russell et al., 1995; Su et al., 1997) and activating downstream

MAP2K–MAPK through their kinase domain (Nakamura and Johnson, 2003; Nihalani et al.,

2001; Xia et al., 1998). The activated MAPKs phosphorylate and activate effector molecules in cytoplasm and nucleus that become ultimately responsible for regulating gene expression (Cobb and Goldsmith, 1995). With such a hierarchical organization, the MAPK modules are involved in a large number of signaling processes and diverse cell responses.

MAP3K1 signaling

MAPK kinase kinase 1 {MAP3K1, also known as MEK kinase 1 (MEKK1)} is a serine/threonine protein kinase of the MAP3K superfamily. Compelling evidence indicates that 4

MAP3K1 is involved in the regulation of diverse functions in a tissue- and cell-type-specific

manner. Most effects of MAP3K1 depend on its kinase activity, which upon induction by

upstream cues leads to the phosphorylation and activation of the MAP2K-MAPK cascades. In most cases, MAP3K1 preferentially activates MAP2K4 and MAP2K7, which are upstream

activators for the c-Jun N-terminal Kinases (JNKs) and/or p38 MAPKs (Davis, 2000; Xia et al.,

1998; Yan et al., 1994; Yujiri et al., 1998), but in a few studies MAP3K1 was shown to regulate the extracellular signal-regulated kinase (ERK) MAPKs MAP2K1 and MAP2K2 (Karandikar et al., 2000; Lu et al., 2002; Witowsky and Johnson, 2003). Furthermore, some reports suggest that

MAP3K1 can phosphorylate the IκB kinases IKKα and IKKβ and induce activation of nuclear factor-κB (NF-κB) downstream of tumor necrosis factor-α (TNF-α) (Lee et al., 1997; Nemoto et al., 1998).

MAP3K1 also participates in the modulation of immune responses. In T cells, MAP3K1 negatively regulates T-cell-mediated autoimmune diseases and virus-specific immune responses

(Gao et al., 2004; Labuda et al., 2006; Venuprasad et al., 2006). In B cells, MAP3K1 is required for maintaining normal germinal center formation and for thymus-dependent antigen-induced B cell proliferation and antibody production (Gallagher et al., 2007). In fetal development,

MAP3K1 is probably a modifier for definitive erythropoiesis. The Map3k1 knockout fetuses in

C57/BL6 but not 129 x C57/BL6 mixed background die of anemia, due to defective enucleation

activity and insufficient macrophage-mediated nuclear DNA destruction (Bonnesen et al., 2005).

In addition to its physiological roles, MAP3K1 might participate in several pathological

processes. First, in Bcr-Abl oncogene-transformed mouse embryonic stem cells, MAP3K1 is

required for Bcr-Abl-induced STAT3 activation and LIF-independent self-renewal, suggesting a

role in Bcr-Abl-mediated leukemogenesis (Nakamura et al., 2005). Second, in mice with

5

transgenic Gαq overexpression in cardiomyocytes, MAP3K1 is required for the induction of

cardiac hypertrophy (Minamino et al., 2002; Cuevas et al., 2006).

In vitro studies have shown that the full-length MAP3K1 is a pro-survival and anti-

apoptotic factor, because loss of endogenous MAP3K1 expression results in greater apoptosis of

ESCs in response to hyperosmolarity and microtubule disruption (Yujiri et al., 1998, 1999) and of cardiomyocytes in response to hydrogen peroxide (Minamino et al., 1999). However, earlier studies based mainly on overexpression analyses have shown that MAP3K1 may contribute to apoptosis in response to genotoxins and detachment from the extracellular matrix (anoikis)

(Cardone et al., 1997; Widmann et al., 1998). These stress signals induce MAP3K1 cleavage by a DEVD motif-specific caspase, resulting in a 91 kDa fragment (amino acids 857-1493 in mouse

MAP3K1) containing the kinase domain. The kinase domain of MAP3K1 relocates to soluble cellular compartments to further stimulate caspase activity and apoptosis (Schlesinger et al.,

2002). Correspondingly, overexpression of the kinase domain of MAP3K1 is sufficient to induce apoptosis in a kinase-activity-dependent manner (Johnson et al., 1996).

Other possible mechanisms through which MAP3K1 contributes to apoptosis include promoting the expression of Fas and Fas ligand (Faris et al., 1998) and mediating c-Jun ubiquitination and degradation (Lu et al., 2002; Xia et al., 2007). In addition, the MAP3K1 PHD domain exhibits E3 ubiquitin ligase activity toward ERK1/2. MAP3K1 directly associates with

ERK1/2 and mediates the polyubiquitination and degradation of ERK1/2 in response to stress stimuli such as sorbitol treatment, which is required for the onset of sorbitol-induced apoptosis

(Lu et al., 2002). Collectively, the available evidence suggests that the endogenous MAP3K1 is involved in anti-apoptotic signaling in a cell-type- and stimuli-dependent manner, but that when overexpressed, MAP3K1 may become pro-apoptotic (Gibson et al., 1999).

6

Apart from its role in the MAPK signaling, MAP3K1 has been found to directly interact

with and/or phosphorylate transcription factors, such as STAT3, and co-factors, such as transducer of regulated CREB activity 1 (TORC1) and p300 (Lim and Cao, 2001; See et al.,

2001; Siu et al., 2008). These observations raise the possibility that MAP3K1 could directly

modulate the transcription machinery.

MAP3K1 in eyelid development and cell migration

The most apparent function of MAP3K1 is the control of eyelid closure during fetal

development. While both Map3k1ΔKD/ΔKD and MAP3K1-null mice survive embryonic

development, they display an EOB phenotype (Yujiri et al., 2000; Zhang et al., 2003). Detailed

characterization of the knockout mice indicates that MAP3K1 is required for transmitting

Activin B signals to the activation of JNK, which in turn leads to phosphorylation of

transcription factor c-JUN in developing eyelid epithelium. Activation of the MAP3K1-

mediated JNK-c-JUN pathway is required for induction of actin polymerization and expression

of genes involved in epithelial cell migration. Therefore, insufficient activation of this pathway

in the MAP3K1 knockout mice prevents epithelial cell migration and embryonic eyelid closure.

In addition to the developing eyelid epithelium, MAP3K1 is shown to regulate cell

migration of mouse embryonic stem cells (ESCs), embryonic fibroblasts (MEFs), smooth muscle

cells and primary keratinocytes (Cuevas et al., 2003; Li et al., 2005; Xia et al., 2000; Yujiri et al.,

2000; Zhang et al., 2003). As a consequence of impaired migration, the Map3k1ΔkD/ΔkD and/or

MAP3K1-null mice display slower skin wound healing (Deng et al., 2006), more severe nickel-

induced acute lung injury (Mongan et al., 2008) and abnormal vascular remodeling (Li et al.,

2005).

7

MAP3K1 integrates multiple signaling pathways in developing eyelids

Recent work in compound mutant mice has shed light on the role of JNKs in eyelid

development. Mammals have three distinct Jnk genes, two of which, Jnk1 and Jnk2, are

ubiquitously expressed, whereas expression of the third, JNK3, is restricted to the brain (Kyriakis

et al., 1995). Gene ablation studies indicate that the JNKs, especially the co-expressed JNK1 and

JNK2, are functionally redundant. None of the individual Jnk gene knockout mice exhibit an

eyelid phenotype (Dong et al., 1998; Sabapathy et al., 2001); however, the compound Jnk1-/-

Jnk2+/- mutant mice suffer defective closure of optical fissure and eyelid and die shortly after

birth, providing the first indication that the mammalian JNK is involved in tissue closure during

development (Weston et al., 2003). The connection between JNK and MAP3K1 in eyelid

closure is later clearly established in the Map3k1+/-Jnk1-/- and Map3k1+/-Jnk1+/-Jnk2+/- triple hemizygous mice that exhibit an EOB phenotype, in contrast, the Map3k1+/+Jnk1-/- and

Map3k1+/+Jnk1+/-Jnk2+/- mice have normal eyelid development (Takatori et al., 2008). The

haploinsufficiency of Map3k1 in the Jnk1-/- and Jnk1+/-Jnk2+/- backgrounds suggests that

MAP3K1 expression level and its downstream JNK activation is critical for eyelid closure.

Defective EGFR signaling is commonly associated with EOB, which occurs in mice with genetic knockout of EGFR itself, its ligands, TGFα and HB-EGF, and factors, such as FGF10, c-

JUN and Grhl3, which may regulate ligand expression (Li et al., 2003; Luetteke et al., 1993;

Miettinen et al., 1995; Mine et al., 2005; Tao et al., 2006; Yu et al., 2008). In the context of eyelid development, the EGFR and MAP3K1-JNK pathways are functionally similar in that they both control the migration of eyelid tip epithelial cells; however, the molecular interactions between the two pathways have never been established (Xia and Karin, 2004).

8

In the course of previous work, we found that MAP3K1 was highly expressed in the

developing eyelid epithelial cells prior to eyelid closure (Zhang et al., 2003). We hypothesized that “eyelid morphogenetic factors” might induce MAP3K1 expression, thereby acting upstream

of the MAP3K1-JNK cascades during eyelid development. In this thesis, by investigating the

molecular mechanisms that control MAP3K1 expression, we report that TGFα/EGFR signals,

acting through RhoA and ROCK, induce c-JUN and the c-JUN-mediated activation of the

Map3k1 promoter. Once expressed, MAP3K1 is responsible for activation of the JNK-c-JUN

pathway and induction of AP-1 responsive genes. Thus, MAP3K1 serves as the focal point of an

intracrine regulatory loop connecting the TGFα/EGFR/RhoA-c-JUN and JNK-c-JUN-AP-1

pathways in the control of eyelid morphogenesis.

9

Chapter II: Experimental Methods

10

Antibodies, Reagents and plasmids

Anti-MAP3K1 was as described previously (Xia et al., 2000). The mammalian expression plasmids for dominant active RhoA [RhoA(V14)] and dominant negative RhoA

[RhoA(N19)] were described elsewhere (Minden et al., 1995). The dominant negative c-JUN, lacking N-terminal DNA binding domain, was a gift from Dr. A. Aronheim and the AP-1-luc plasmids were as described (Hibi et al., 1993).

The β-glo and luciferase assay reagents, and antibodies for phospho-JNK and luciferase were from Promega. Antibodies for β-galactosidase were from Immunology Consultants

Laboratory, phospho-c-JUN was from Cell Signaling, p-H3, c-JUN, JNK, FRA1, FRA2, ELK-1,

β-actin, Pol II and Ac-H4 were from Santa Cruz Biotechnology and anti-PAI-1 was from

American Diagnostica. The chemical inhibitors for JNK (SP600125), EGFR (AG1478), ERK

(PD98059 and U0126), ROCK (Y27632), and protein synthesis [cycloheximide (CHX)] were from Calbiochem. Activin B (ActB), EGF and TGFα were from R&D Systems, Inc. Colchicine

(Col), taxol (Tax), vinblastin (Vin), nocodazol (Noco), cytochalsin D (CytoD) and arsenic (As) were from Sigma.

Cloning of the mouse Map3k1 promoter

The mouse bacterial artificial chromosome clone (RP-24-114k21) obtained from

BACPAC Resources CHORI (Children's Hospital Oakland Research Institute) was used as template DNA for Polymerase Chain Reaction (PCR) to amplify the promoter region of the mouse Map3k1 gene. The PCR product was separated by agarose gel electrophoresis and further amplified using appropriate primers flanked by HindIII and XhoI restriction sites. The resultant

PCR fragment was cut with restriction enzymes and subcloned into the promoterless pGL3-Basic vector (Promega) containing the firefly luciferase reporter (luc) gene. PCR-based mutagenesis 11

was further performed to create 5’ deletion constructs of the Map3k1 promoter. The deletion

mutants were confirmed by restriction enzyme digestion mapping and the final identity of the

various fragments was confirmed by automated sequencing. The primers used for this study

include:

mMap3k1-1900 5'-CTACTCGAGGCCTATGGAGGCCAGA;

mMap3k1-277, 5'-CTACTCGAGCCGGTCTCGCACTACCTG;

mMap3k1-105, 5'-CTACTCGAGCAGCGCGCGCCCGCCCAC;

mMap3k1-38, 5'-CTACTCGAGCCTCCCCCGCAGGCACGAG;

mMap3k1-194, 5'-GATCAAGCTTGTGGGAGGGCAGGGGCAAT; mMap3k1-1, 5'-AAGCTTCTCTCGCGGGCTACATT.

Sequences that generate restriction enzyme sites for Xho I (CTCGAG) and Hind III (AAGCTT)

are underlined.

Cell culture

Primary mouse embryonic fibroblasts (MEFs) were isolated from E13.5 embryos derived

from C57Bl/6 mice and prepared as described previously (Giroux et al., 1999). Briefly, embryos

were isolated, and the head and liver were removed. The embryonic tissues were washed twice

in PBS, minced with a razor blade and trypsinized at 37 oC for 15 min. The cells were then

resuspended and seeded in 10 cm plates containing DMEM supplemented with 10% serum and

50U/50μg/ml Penicillin/Streptomycin. The cells were maintained in culture following the 3T3

protocol to generate fibroblasts. Human Embryonic Kidney 293 (HEK 293) and Hela cells were cultured under the same conditions as MEFs. All cell lines were maintained in a humidified incubator containing 5% CO2 and at 37 degrees Celsius.

Transfection, adenoviral infection and luciferase assay

12

Cells plated in 24-well tissue culture plates at 1×105 cells/well were grown for 16 h

before transfection. Transfection was carried out using Lipofectamine Plus reagent (Invitrogen,

Carlsbad), 0.5 μg luciferase reporter and 0.1 μg β-galactosidase plasmids/well, following the

manufacturer’s instructions. Twenty-four hours after transfection, cells were starved from serum overnight and subjected to the indicated treatments for 16 hours. Lysates were collected with

Passive Lysis Buffer (Promega) according to the manufacturer’s instructions. Luciferase and β-

gal activities were evaluated in quadruplicate using luciferase assay substrate (Promega) and β-

gal substrates, respectively, and the luminescence/absorbance were recorded with a SpectraMax

M5 plate reader (Molecular Devices, Sunnyvale, CA). Fold induction was calculated as the

difference in relative light units (RLU) /β-gal activity for induced cells relative to the uninduced

(untreated) cells assayed at the same time.

To measure luciferase activity in mouse tissues, the newborn mice were euthanatized and

eyelid, skin, brain, lung, heart, thymus, liver, spleen, kidney and brown adipose tissues were

collected and homogenized in lysis buffer (Promega). The homogenate was incubated for 4 h at

4°C and the supernatant was subjected to luciferase assay according to the manufacturer’s

instructions (Promega), and protein concentration measurement using the Bradford method (Bio-

Rad). Luciferase activity was normalized to protein concentration to determine relative luciferase

units per μg protein. The dual luciferase assay was performed by using Dual-Luciferase

Reporter Assay System (Promega) according to the manufacturer’s instructions.

To generate stable transfectants, we selected cells 48 h after transfection by growing the

cells in a complete medium containing 800 μg/mL G418 (Life Technologies). Cells derived

from the individual colonies after transfection and drug selections were obtained using a 200 μl

pipet tip. The stable transfectants were further expanded and used in subsequent experiments.

13

Adenoviruses were used at 100 pfu/cell for infection of 60% confluent cells. Viral

infection was carried out in serum free DMEM for 2 hours with gentle agitation in 15 minute

intervals. Following infection, the cells were washed with PBS and maintained in DMEM with

10% FBS for another 48 hours.

β-glo assays

To evaluate the expression of MAP3K1-β-gal fusion proteins, the wild type, Map3k1+/ΔKD and Map3k1ΔKD/ΔKD fibroblasts were cultured in 24 well plates, either untreated or treated with

stimuli for various times. The β-gal under the control of the Map3k1 promoter in these cells was

evaluated using the Beta Glo Assay System (Promega), which measures the β-gal activity by

using the substrate β-galactopyranosyl-luciferin to yield oxyluciferin when cleaved by β-

galactosidase, hence the readout is in light units. The protein concentrations were determined

using the Bradford method (Bio-Rad). The experiments were done in quadruplicate and the

Luminescence/absorbance was determined with a SpectraMax M5 (Molecular Devices,

Sunnyvale, CA). The relative β-galactosidase activity was normalized to protein concentration

to determine relative light units per mg protein, while fold induction was calculated as compared

to that in untreated cells.

Cell lysate preparation and Western blot analyses

Cells were washed twice with ice cold PBS and lysed using RIPA lysis buffer (25 mM

Tris·HCl, pH 7.4 50 mM NaCl, 0.5% Na deoxycholate, 2% NP40, 0.2% SDS, 1µM

phenylmethylsulfonyl fluoride, 50µg/ml aprotinin, 50 µM leupeptin). Lysates were boiled in 5X

loading buffer (63 mM Tris HCl, 10% glycerol, 2% SDS, 0.0025% bromophenol blue, pH 6.8) for 10 minuntes after which 50 μg (200 μg for MAP3K1) total protein were loaded per lane and separated by SDS-PAGE. Following an overnight transfer into nitrocellulose membrane

14

(Millipore), the blots were then blocked in 5% milk and probed using specific primary antibodies prior to incubation with HRP conjugated secondary antibody (Santa Cruz). The membranes were then incubated for 10 minutes in West Pico Supersignal HRP substrate (Pierce). Exposure was performed with the ChemiDoc imaging system (UVP) and the photographs acquired and quantified using Labworks 4.5 software (UVP).

Chromatin Immunoprecipitation (ChIP) Analyses

ChIP was performed following procedures previously described (Schnekenburger et al.,

2007) with slight modifications. Briefly, confluent mouse fibroblasts were either untreated or treated with TGF-α and colchicine for various time points as indicated. The cells were cross- linked with (1%) formaldehyde for 10 minutes and lysed with cytoplasmic lysis buffer and centrifuged. The nuclei pellet was then resuspended in nuclei lysis buffer and subjected to sonication to shear the chromatin to a size range of 300 - 800 bp using the Bioruptor sonicator

(Diagenode, Sparta, NJ). Following sonication, the sheared chromatin were pre-cleared with proteinA agarose/salmon sperm DNA (Upstate Biotechnology) for 1 h at 4°C, and subjected to chromatin immunoprecipitation using antibodies against c-JUN, RNA polII, Ac-H4 and goat IgG for 1 h at 4°C followed by the addition of protein A agarose beads for an overnight incubation.

After extensive washing, the precipitates were eluted from the beads by incubation with elution buffer (50 mM NaHCO3 and 1% SDS) with mild vortexing. The cross-linking was reversed and the samples were sequentially digested with RNase A and proteinase K. The DNA was then purified using the QIAquick PCR purification kit (QIAGEN, Valencia, CA) and subjected to real-time PCR using the following primers: for the mouse Map3k1 promoter, flanking a region between -120 to +24, 5’-CGCCCGCGCCCTCGGCAGCA, 5’-

GCGATCGCCCGCCGCCGCCGCCATT, and for the mouse Pai-1 promoter, flanking a region

15

betwen -287 and -121, 5’-TGAAGCAGGAGTGTCCTGAG, and 5’-

AGCCATCAGTGCGGTAAGTTC.

Relative differences in QRT-PCR among samples were determined using the ΔΔCt

method. The ΔCt value for each sample was determined using the cycle threshold (CT) value

(obtained from the means of replicates) from the input DNA, to normalize ChIP assay results.

The ΔΔCt was calculated by subtracting ΔCt values of the treated samples from the corresponding experimental ΔCt.

Reverse transcription and quantitative PCR

Total RNA was extracted by using TRIzol reagents (QIAGEN Sciences, Maryland) and

RNA (20 µg) was reverse transcribed to cDNA using random hexamer primers and the

Stratascript enzyme following the instruction from the company (Invitrogen, Carlsbad).

Aliquotes of the cDNA was amplified for 40 cycles using an Opticon 2 thermal cycler system

(Biorad) and SYBER Green QPCR Master Mix (Stratagene). Gene specific primers were

designed using PrimerQuest software (Integrated DNA Technologies). The conditions for the

amplification were optimized for specific PCR reactions. At the end of the PCR the samples

were subjected to melting curve analysis. Expression levels were calculated as a ratio of the

mRNA for the gene of interest to the mRNA for glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) in the same sample. All reactions were performed at least three times in quadruplets.

Oligonucleotides used as the specific primers to amplify mouse genes cDNA were as following:

mMap3k1kd, 5’ CCCCAGCATCCGGATGATGT and 5’ GTCCCTCAGCTGCAGGTGG; β-

Gal, 5’ GGCAGGGTGAAACGCAGGTC and 5’ CATTTTCAATCCGCACCTCGC; mouse

Pai-1, 5’ AGCTTCCTAGCTGGAGGTAT and 5’ AGAGGGAGAGAGAGAAAAGC.

Experimental animal, immunohistochemistry and whole mount X-gal staining

16

The Map3k1ΔKD/ΔKD mice were mated with RhoA+/FLe-Cre to generate

Map3k1+/ΔKDRhoA+/FLe-Cre. These mice were then mated with Map3k1+/ΔKDRhoAF/F and fetuses were analyzed by E17.5. The Map3k1ΔKD/ΔKD mice were mated with Map3k1+/ΔKDAP-1-luc mice and the fetuses were analyzed at E15.5 or at birth. All procedures were following a protocol approved by the Institutional Animal Care and Use Committee at the University of Cincinnati.

For immunostaining, the E15.5-E16.5 fetuses were embedded in O.C.T. compound

(Sakura) and frozen sections (7 mm) were prepared according to standard procedures. The sections were subjected to immunohistochemistry as described (Takatori et al., 2008) using anti- luciferase (1:500) and anti-β-galactosidase (1:250). For whole-mount X-gal staining, the E17.5 fetuses and adult tissues were used for procedures described (Henkemeyer et al., 1996) photographed using a Leica MZ16 F stereomicroscope with a ×0.5 plan objective.

Statistical analysis

Statistical comparisons were performed with Student's two-tailed paired t test and analysis of variance (ANOVA). Values of *p<0.05, ** p<0.01 and *** p<0.001 were considered statistically significant.

17

Chapter III: Molecular Pathways that lead to MAP3K1 Expression

18

Establishing experimental systems for studying MAP3K1 induction

ΔKD The Map3k1 allele contains a bacterial β-galactosidase gene knocked in the Map3k1

ΔKD locus, replacing the exons coding for MAP3K1 kinase domain. The resultant Map3k1 allele

produces a kinase-inactive fusion protein containing an N-terminal MAP3K1 and C-terminal β-

GAL, i.e. MAP3K1-ΔKD-β-gal (Figure 3A). The expression of the fusion protein is under the

control of the endogenous Map3k1 promoter.

To examine the endogenous Map3k1 promoter activity, we performed whole mount X-

GAL staining to detect the β-GAL expression in the E15.5 fetuses of wild type, Map3k1+/ΔKD and

Map3k1 ΔKD/ΔKD (Figures 3B and 3C). Strong X-GAL staining (blue, Figure 3C) was detected in

the Map3k1 ΔKD/ΔKD, but much reduced staining was detected in the Map3k1+/ΔKD fetuses,

suggesting biallelic contribution of Map3k1 to its expression levels. No X-GAL staining was

seen in the wild type fetuses, which did not express the MAP3K1-ΔKD-β-GAL fusion proteins.

To evaluate MAP3K1 expression quantitatively, we measured the β-gal activity (Figure

3D) in mouse embryonic fibroblasts (MEFs) generated from the wild type, Map3k1+/ΔKD and

Map3k1 ΔKD/ΔKD fetuses. Basal β-gal activity was very low in wild type cells, but was

significantly higher in Map3k1+/ΔKD cells. The activities further increased by approximately 1.8

fold in the Map3k1 ΔKD/ΔKD cells, confirming that biallelic Map3k1 promoter activation

contributed to the overall levels of the MAP3K1-ΔKD-β−GAL protein expression. Similar

results were obtained by imunoblotting measuring expression of the fusion protein (Figure 3E)

and by RT-PCR measuring Map3k1 transcripts (Figure 3F) using primers specific for either the

kinase domain of Map3k1 or the LacZ genes. The results obtained from these series of

19 experiments indicate that MAP3K1-ΔKD-β−GAL expression can be traced in fibroblasts at the levels of RNA, protein and β-gal activity.

Induction of MAP3K1 expression by ligands of the EGF receptor

During fetal development, specific morphogenetic signals are likely responsible for the highly enriched MAP3K1 in developing eyelid epithelium (Zhang et al., 2003). We used the cell system established above to examine several eyelid morphogenic factors, known to be expressed in the developing eyelid epithelial cells, on their abilities to induce MAP3K1 expression

(Berkowitz et al., 1996; Mine et al., 2005; Tao et al., 2005; Vassalli et al., 1994). By measuring

β-gal activity, we found that TGFα and EGF, both ligands of the EGF receptors, caused an obvious induction of MAP3K1 expression in Map3k1ΔKD/ΔKD fibroblasts; however, activin βB and TGFβ, both acting through the TGFβ receptors, and FGF10 acting through the FGF receptor, did not have such an effect (Figure 4A). Consistent with this observation, TGFα caused an immediate induction of Map3k1 transcripts in wild type cells and β-Gal mRNA in

Map3k1ΔKD/ΔKD cells, suggesting that ligands of EGFR might activate the Map3k1 gene at a transcriptional level (Figure 4B).

Induction of MAP3K1 expression by microtubule depolymerizers

In adult tissues, MAP3K1 expression has been detected in various cell types (Mongan et al., 2008). Specifically, abundant β-GAL positive cells were detected in the wall of blood vessels of liver, lung and arota, and in the airway epithelium of the lung (Figure 5A). This pattern of expression suggests that air and blood flow-induced mechanical stress, known to cause reorganization of cytoskeleton, may induce MAP3K1 expression (McGarry et al., 2005). We

20 thus tested cytoskeleton disrupting chemicals on their abilities to induce MAP3K1. The

Map3k1ΔKD/ΔKD fibroblasts were treated with a number of microtubule depolymerizers, including

2-methoxyestradiol, podophyllotoxin, colchicines, nocodazole and vinblastin, a microtubule stabilizer, Taxol, and an actin disruptor, cytochalasin D, and β-GAL activities were examined.

While the microtubule disruptors caused a significant induction of β-GAL activities, the actin disruptor did not have such an effect (Figure 5B).

Microtubule disruption leads to mitotic arrest, involving a number of molecular changes, such as intracellular protein accumulation (Kokkinakis et al., 2006). To determine whether increased MAP3K1 was due to mitotic arrests, we measured phospho-histone H3 (p-H3), a mitotic specific marker in cells treated with microtubule toxins. All microtubule toxins caused a marked increase of p-H3; however, they had different effects on MAP3K1 expression (Figures

5B and 5C). Only the microtubule depolymerizers induced β-GAL activities and MAP3K1-

ΔKD-β-GAL expression, whereas, the microtubule stabilizer did not. Furthermore, colchicine was similar to TGFα, in inducing MAP3K1 through transcriptional mechanisms, because induction was abolished by a transcription blocker actinomycin D, similar to cycloheximide, a protein synthesis inhibitor (Figure 5D). Thus, induction of MAP3K1 is not due to M phase protein accumulation, but is likely due to transcriptional activation of the Map3k1 gene by microtubule depolymerization.

The EGFR and RhoA signaling pathways are involved in MAP3K1 induction

To identify the signaling pathways responsible for MAP3K1 induction, we pretreated the

Map3k1ΔKD/ΔKD fibroblasts with various pathway inhibitors prior to treatment with TGFα for different times. We showed that TGFα caused a clear induction of MAP3K1-ΔKD-β-GAL,

21 which was abundant at 6 h and less so at 24 h of treatment (Figure 6A). Pretreatment of the cells with an EGFR inhibitor, AG1478, completely blocked the induction, whereas, pretreatment with a Rho kinase inhibitor, Y27632, prevented the induction at 24 h. In contrast, pretreatment with the ERK and the JNK pathway inhibitors, U0126 and SP600125, respectively, had no effect on

MAP3K1 induction.

Previous studies by Samarakoon et al. showed that colchicine could activate EGFR

(Samarakoon et al., 2009) raising the possibility that EGFR activation by colchicine was responsible for MAP3K1 induction. To test this possibility, we measured MAP3K1-ΔKD-β-

GAL expression in Map3k1ΔKD/ΔKD fibroblasts. Expression of MAP3K1-ΔKD-β-GAL was detected at 6 h and became more abundant at later time points of colchicine treatment (Figure

6B). Interestingly, pretreatment of cells with an EGFR inhibitor completely blocked MAP3K1-

ΔKD-β-GAL induction. To further test this possibility, we measured β-GAL activity in the

Map3k1ΔKD/ΔKD fibroblasts treated with colchicine in the presence and absence of various kinase inhibitors (Figure 6C). Inhibitors of EGFR and Rho kinases both significantly reduced β-GAL activities; however, the inhibitor of TGFβ receptors did not have an effect on β-GAL induction.

Taken together, our results suggest that eyelid morphogenes (TGFα) and microtubule depolymerization may act through the EGFR and Rho kinase to signal the Map3k1 gene induction and protein expression.

RhoA facilitates MAP3K1 mediated eyelid closure in vivo.

If Rho signals were crucial for MAP3K1 expression, we expect that mice lacking RhoA, a major upstream activator of Rho kinases, would have reduced MAP3K1 expression and β-GAL activity. To test this, we used transgenic mice with the RhoA gene ablation in surface ectoderm that differentiates into the ocular surface epithelia (RhoAF/F/LE-Cre) during fetal development

22

(Ashery-Padan et al., 2000; Huang et al., 2009; Joo et al., 2010). After crossing with Map3k1ΔKD strain, we analyzed the developing fetuses at E17.5, a stage when eyelid is normally closed.

Regardless of the RhoA status, all Map3k1+/+ fetuses had closed eyelid, while the Map3k1ΔKD/ΔKD fetuses had open eyelid, confirming an essential role of MAP3K1 in eyelid closure. The

Map3k1+/ΔKD fetuses also had their eyelid closed like the wild type fetuses; however, RhoA

deletion in the Map3k1+/ΔKD background rendered the otherwise normal eyelid development

somewhat defective. All the Map3k1+/ΔKD/RhoAF/F/LE-Cre fetuses displayed a partial “eyelid

open”, a phenomena less severe than that in Map3k1ΔKD/ΔKD, but clearly distinct from the

completely closed eyelid in wild type and RhoAF/F/Le-Cre fetuses (Figure 6D). Interestingly, the

eyelids of the Map3k1+/ΔKDRhoAF/F/Le-Cre mice were eventually closed at birth,

indistinguishable from the wild type mice, suggesting that RhoA ablation merely delays, but

does not blunt embryonic eyelid closure in the Map3k1+/ΔKD mice. Whole mount X-gal staining

of the fetuses confirmed that RhoA ablation caused a slight reduction, but not total abolishment

of MAP3K1-ΔKD-β-GAL expression in developing eyelid epithelium. Hence, the genetic

evidence for the first time reveals a role of RhoA in eyelid development and suggests that RhoA

acts as an accessory molecule for MAP3K1 signaling and contributes to embryonic eyelid

closure.

Summary of Chapter III

Taken together, our in vitro studies have shown that activation of EGFR by its ligands and by

microtubule disrupting agents can induce MAP3K1 expression through activation of the

downstream RhoA/ROCK cascades. Our in vivo studies confirmed that knocking out RhoA in

Map3k1 hemizygotes decreases MAP3K1 expression and delays eyelid closure in the developing

23 fetuses. These results suggest that the EGFR/RhoA/ROCK-mediated signaling cascades can regulate MAP3K1 expression and that the level of MAP3K1 expression is critical for eyelid closure during embryonic development.

24

Chapter IV: Characterization of the Map3k1 promoter

25

Cloning of the Map3k1 promoter

In order to understand how MAP3K1 expression is activated by various signaling

pathways, we looked into the transcriptional regulation of the Map3k1 promoter. We cloned a

1.9 kb segment 5’ to the Map3k1 translation initiation site into a promoter-less luciferase reporter

vector pGL3 (Figure 7A). The pMap3k1(-1900-1)-luc plasmid was transfected into HEK293, treated with various cytoskeletal disrupting agents and cell lysates were examined for luciferase activity. Consistent with their roles in induction of the endogenous protein expression,

colchicine and nocodazole, both microtubule disruptors, caused a 2-fold induction of luciferase

activity while taxol, a microtubule stabilizer, and cytochalasin D, an actin disruptor, did not

(Figure 7B).

The SRC and RhoA are involved in the activation of the Map3k1 promoter

In order to identify the upstream signaling molecules responsible for the activation of the

Map3k1 promoter, we tested various kinases and GTPases (Chen et al., 2003; Du et al., 2004;

Gallagher et al., 2004) on their ability to induce the Map3k1 promoter. By transient transfection, we found that a constitutive active RhoA, the Src tyrosine kinase, likely an upstream activator of

RhoA (Nagao et al., 1999), and ROCK1, a downstream effector of RhoA, all stimulated the pMap3k1 luc activity, while Ras and Raf did not (Figure 8A).

To explore whether RhoA is required for activation of the Map3k1 promoter, we measured the pMap3k1-luc activities in the presence or absence of dominant active (RhoA V14), dominant negative (RhoA N19) RhoA and colchicine treatment. We showed that dominant active RhoA V14 caused an obvious induction of the Map3k1 exogenous promoter in the absence of colchicine. Conversely, dominant negative RhoA N19 blocked promoter activation

26 induced by colchicine (Figure 8B). Taken together, our results suggest that RhoA activation can potentiate Map3k1 promoter activation.

MAP3K1 is involved in its own promoter activation

Similar to Src, RhoA and ROCK, we found that overexpression of MAP3K1 caused elevated luciferase expression from the Map3k1-luc vector (Figure 8A). This observation suggests that MAP3K1 may induce its own promoter activity. To further test this idea, we infected the Map3k1ΔKD/ΔKD fibroblasts with adenoviruses to deliver cDNAs encoding MAP3K1, or IKK-β and EGFP as controls, and measured β−galactosidase activity as a surrogate for

MAP3K1-ΔKD-β-GAL expression. Our results showed that Ad-MAP3K1 infected cells had an obvious increase in β−galactosidase activity while Ad-IKK-β and Ad-EGFP infected cells did not (Figure 9A).

MAP3K1 is a large protein composed of 1493 amino acids. The protein contains a kinase domain located at the C-terminus (aa 1223-1489), and a PHD domain and proline rich regions at

N-terminus (aa 1-1223). To map the MAP3K1 domain that is responsible for its own promoter activation, we generated a series of MAP3K1 truncated proteins (Figure 9B) and examined their abilities to induce the Map3k1-luc. We found that overexpression of the full length wild type

MAP3K1 (MAP3K1-WT), full length kinase inactive MAP3K1 (MAP3K1-KM) and the

MAP3K1 N-terminal (MAP3K1-N3.1) domain all caused a marked induction of Map3k1 promoter activity (Figure 9C). However, overexpression of the C-terminal kinase domain of

MAP3K1, either in its kinase active or kinase inactive forms, did not affect the Map3k1 promoter activity. Based on these observations, we suggest that induction of Map3k1 promoter can be enhanced by overexpression of the N-terminal domain of MAP3K1.

27

One possible explanation for the above observation is that MAP3K1 N-terminal domain may act as a transcription factor to regulate its own promoter based on the findings by Islam et al. who showed that MAP3K1 can function as a transcription factor independent of its kinase activity (Islam et al., 2010). To test this possibility, we examined whether MAP3K1 could be detected in the nucleus. In eukaryotes, proteins are usually targeted to the nucleus by specific nuclear localization signals (NLS). The NLS are comprised of short stretches of basic amino acid residues located within the proteins, the best characterized of which have been nuclear transcription factors (Jans et al., 2000; Sorokin et al., 2007). In silico analysis of the MAP3K1 sequence with POSRTII program found the sequence RRKR, amino acids 278-281 located in the amino-terminal region of the MAP3K1 protein, to be a putative NLS (Figure 10A). Similar functional NLSs have been identified in sequences coding for a wide variety of proteins including p21, p50 and EGFR (Hsu and Hung, 2007; Lin et al., 1995; Rodríguez-Vilarrupla et al., 2002). To examine whether MAP3K1 was localized in the nucleus, we performed immunostaining using anti-β-gal in Map3k1ΔKD/ΔKD fibroblasts. As shown in Figure 10B, we observed both cytoplasmic and nuclear fluorescent signals with the later being more intense indicating that a significant portion of MAP3K1 was localized in nucleus of the cell. To determine whether the increased nuclear fluorescence observed in fibroblasts actually reflected nuclear accumulation of MAP3K1, we analyzed Hela cells stably transfected with a vector expressing a MAP3K1-EGFP fusion protein. The cells were subjected to subcellular fractionation and western blot analysis. As shown in Figure 10C, the amount of MAP3K1-

EGFP protein was approximately ten fold greater in the nuclear fraction than in the cytoplasmic fraction. Together, the above results indicate that a subpopulation of MAP3K1 is localized in the nucleus.

28

To determine whether nuclear localization is crucial for MAP3K1 to activate its own

promoter, we hypothesized that targeting MAP3K1 to plasma membrane would blunt its ability to induce pMap3k1-luc. We used expression vectors for a membrane-targeted MAP3K1

(MAP3K1-M), a fusion protein with the C-terminal amino acids of Ha-Ras (Schlesinger et al.,

2002), which encodes the HA-Ras CAAX sequence that targets the proteins to plasma membranes (Hancock et al., 1991). We also used expression vectors for a membrane-targeting site mutated MAP3K1 (MAP3K1-mutM), in which the CAAX sequence is mutated and thus cannot target MAP3K1 to the membrane (Figure 11A). When cotransfected with Map3k1-luc into HEK293 cells, the MAP3K1-M failed to induce Map3k1 promoter activity over control

(Figure 11B), while the mutated membrane targeted MAP3K1-mutM strongly induced luciferase expression. These results suggest that membrane targeting of MAP3K1 abolishes its ability to activate the Map3k1 promoter. Although further studies are required to demonstrate that nuclear localization is required for MAP3K1 to positively regulate its own promoter activities, my findings suggest that MAP3K1 may have an auto-regulatory role on its own promoter, a function independent of its kinase activity but dependent on the presence of its amino terminal regulatory domain where the NLS is located.

Identification of the minimal Map3k1 promoter

To narrow down the promoter sequences responsible for induction, we generated a series

of deletion mutants of the pMap3k1(-1900)-luc backbone using standard cloning techniques

(Figure 12A). Transfection of deletion mutants in HEK293 cells led to the identification of a

narrow promoter region between -38 bp and -105 bp from the translation start site that was

highly responsive to colchicine, whereas, the sequences -277 to -194 bp, lacking this region, was

completely unresponsive (Figure 12B). In silico analyses of the promoter sequences revealed

29 three DNA segments that were evolutionarily conserved among human, mouse and rat (Figure

12C). Within the proximal conserved segment, three putative AP-1 binding sites were located at

-25, -49 and -67 bp upstream of the translation initiation site. This observation is appealing, because several AP-1 proteins, such as c-JUN and FRA-2, are crucial for embryonic eyelid closure (Li et al., 2003; McHenry et al., 1998; Zenz et al., 2003).

Summary of Chapter IV

We have demonstrated that the transcriptional activation of the Map3k1 promoter is mediated by

SRC, RhoA, ROCK and MAP3K1. While activation of the SRC-RhoA-ROCK cascades leads to

Map3k1 promoter induction, MAP3K1 regulates its own promoter through a mechanism dependent on its protein nuclear translocation, but independent of its own kinase domain. The kinase inactive MAP3K1 N-terminal domain, containing a NLS, seems to be involved in promoter activation. It is yet to be determined whether the N-terminal domain of MAP3K1 acts as a transcription factor by itself or it acts like a scaffold organizing transcription complexes for promoter activation. More importantly, we have characterized that Map3k1 minimal promoter contains AP-1 binding elements, suggesting a potential role of AP-1 proteins in MAP3K1 induction.

30

Chapter V: Molecular Regulation of the Map3k1 promoter

31

cJun regulates the Map3k1 promoter

Based on the promoter characteristics, we hypothesized that induction of AP-1 proteins

may lead to Map3k1 promoter activation. To test this hypothesis, we tested a series of transcription factor driven luciferase reporter systems following treatment with colchicine.

Similar to its ability to induce the Map3k1-luc, colchicine caused significant induction of AP1- and SRE- (serum response element) luc. In contrast, it did not activate the NFkB-luc and SBE- luc (smad binding element) reporters (Figure 13A). It is worth noting that TPA-induced response element (TRE)-luc contains 1X while the AP1-luc contains 3X tandem repeats of the

AP1 binding sequence (TGAGTCAG). Accordingly, colchicine caused the induction of luciferase approximately three times higher of AP1-luc than that of the TRE-luc (Figure 13A)

supporting the idea that induction by colchicine was mediated through AP-1 components.

Based on these observations, we suggest that induction of MAP3K1 promoter by TGF-α

and colchicine might be mediated through activation of AP-1- and SRE-mediated gene

transcription. The AP-1 family of transcription factors consist of homo- or heterodimers formed

by proteins of the Jun (c-Jun, JunB and JunD), Fos (c-Fos, FosB, Fral and Fra2) and activating

transcription factor (ATF) (B-ATF, ATF2, ATF3, JDPl and JDP2) (Karin et al., 1997; Vesely et

al., 2009). The SRE (serum response element) is the cis acting DNA element to which SRF

(serum response factor) binds. The activity of SRF has been shown to be increased in cells upon

treatment with colchicine (Kumar et al., 1995) and is mediated by AP1 proteins (c-JUN and

cFos) in regulating the transcription of a number of genes (Paradis et al., 1996; Morgan and

Birnie, 1992). We therefore examined whether TGF-α and colchicine, both activators of

MAP3K1 expression, could induce the expression of components of AP-1, such as c-JUN, Fra-1

and Fra-2, and cFos. The expression of c-JUN was significantly induced, whereas the expression

32

of other AP-1 members, including FRA-1, FRA-2 and c-FOS, and the expression of ELK1, was

unaffected by colchicine treatment of Map3k1ΔKD/ΔKD fibroblasts (Figure 13B).

To determine any of these protein induction could be related to MAP3K1 expression, we performed regression analysis of the expression values obtained by quantifying the Western blotting results (n=20) and generated a line fit plot. These analyses revealed a significant correlation (r=0.8015) between MAP3K1 and c-JUN expression (Figure 13C), while none of the

other AP-1 protein expression correlated well with that of MAP3K1. Furthermore, pretreatment

of wild type and Map3k1ΔKD/ΔKD fibroblasts with the EGFR inhibitor, a condition that prevented

MAP3K1 expression also blocked c-JUN induction by TGFα and colchicine (Figure 13D).

Moreover, a dominant negative c-JUN blocked induction of the pMap3k1(-1900-1)-luc by

colchicine and RhoA (Figure 13E). Collectively, these results point to an essential role of c-JUN

as a downstream effector of EGFR and RhoA in Map3k1 promoter activation.

To determine whether c-JUN was directly involved in Map3k1 promoter regulation, we

performed chromatin immunoprecipitation (ChIP) assay. Thus, wild type and Map3k1ΔKD/ΔKD

fibroblasts were treated with TGFα, followed by crosslinking and precipitation using anti-c-JUN.

The proximal Map3k1 promoter in the precipitates was identified by real-time RT-PCR. We found that TGFα caused a significant increase of c-JUN binding to the Map3k1 promoter, in

parallel to RNA polymerase II recruitment, indicative of promoter activation (Figure 13F).

Modification of the Map3k1 promoter by DNA methylation

Reversible epigenetic modification is a common mechanism for regulating

developmental gene expression. Currently, epigenetics is defined as heritable changes in gene expression that occur without alterations in DNA sequence (Anway et al., 2005). The most common mechanisms known to regulate the epigenome are DNA methylation and histone

33

modification (Cheung and Lau, 2005; Morris, 2005). In general terms, promoter DNA

methylation and histone deacetylation configure transcriptionally repressive chromatin, responsible for gene silencing; whereas, removal of these modifications signifies promoter activation and gene induction.

Transciptional silencing by DNA methylation involves 5-methylation of cytosine

residues on DNA strands. These methylated CpG residues in the mammalian genome are

usually clustered in CpG islands located within the gene promoter region. Promoter associated

CpG island is a region of genomic DNA with a GC percentage that is greater than 50% and with

an observed/expected CpG ratio greater than 60% (Fatemi et al., 2005; Nervi et al., 2001). The methylated CpG islands either directly interfere with the binding of transcriptional factors to their respective cis elements or are associated with changes in the chromatin structure resulting in the suppression of gene expression (Baylin and Herman, 2000; Tate and Bird, 1993). We analyzed 2000 bp upstream of the TSS of the mouse Map3k1 gene using the MethPrimer program (Figure 14A). As a result, two genomic regions (-550, -397 and -293, -57) was found fitting the definition of a CpG island, with G + C content greater than 80%. Because CpG islands colocalize with the promoters and enhancers in approximately half of the human genes,

we believe that the region in the genomic sequence proximal to the TSS (-293 to -57) primarily

constitutes part of the Map3k1 promoter/enhancer. This corresponds to the -105 bp fragment of the Map3k1 promoter that was previously found to be highly responsive to MAP3K1 induction by colchicine (Figure 12B).

To test whether the CpG islands of Map3k1, with extremely high CpG dinucleotides, are prone to methylation-mediated suppression, we measured the Map3k1 promoter-driven ß-gal activity in Map3k1ΔKD/ΔKD fibroblasts treated with a demethylating agent, 5-aza-2'-deoxycytidine

34

(Aza). Treatment of cells with 5 μM Aza for 2 and 6 weeks did not show any changes in β-gal expression; however, after growing the cells in the presence of Aza for 24 weeks, we detected a significant elevation of β-gal activity (Figure 14B). These observations suggest that demethylation agents cause a slow re-activation of the silenced Map3k1 promoter in fibroblasts.

The Map3k1 promoter modulation by histone acetylation

In general, histone modifications act in concert with other epigenetic processes, including

DNA methylation and chromatin remodeling, to shape the overall chromatin structure and

modify its functional state. We tested whether histone acetylation resulted in an increase in

MAP3K1 expression. HEK 293 cells were transfected with pMap3k1(1900)-luc and ß-gal

plasmids for 24 h and then treated with HDAC inhibitors sodium butyrate (NaB) and trichostatin

A (TSA). The results showed that sodium butyrate induced Map3k1 promoter by 14 fold while

TSA induced it by approximately 8-fold (Figure 15A).

Histone H4 acetylation (Ac-H4) is known to play a primary role in the structural changes

that mediate enhanced binding of transcription factors to their recognition sites within nucleosomes (Vettese-Dadey et al., 1996). Accordingly, Ac-H4 was induced by TGFα at the

endogenous Map3k1 promoter, consistent with the observation that inhibition of histone

deacetylase with sodium butyrate or trichostatin A significantly increased luciferase expression

in pMap3k1 (-1900)-luc transfected HEK293 cells (Figure 15B). The Map3k1 promoter

characterization leads to the conclusion that promoter activation involves HDAC inactivation

and histone acetylation, which may set the stage for c-JUN binding and RNA PolII recruitment

to activate gene transcription.

Taken together, these results indicates that epigenetic modifications, both DNA

methylation and histone deacetylation, take place at the Map3k1 promoter and are responsible for

35 the transcriptional silencing of MAP3K1 expression and removing such modifications markedly increases promoter activity.

Summary of Chapter V

In this chapter, we show that c-JUN is involved in Map3k1 promoter activation.

Treatment of MEF cells with TGFα causes the induction of MAP3K1 expression by inducing the recruitment of c-JUN together with Pol2 to the Map3k1 promoter. Furthermore, the induction of

MAP3K1 expression by 5-aza-2'-deoxycytidine, increase in promoter activity by NaB and TSA and the detection of acetylated Histone 4 in the Map3k1 promoter demonstrate that DNA mythelation and histone acetylation are mechanisms involved in Map3k1 promoter regulation.

36

Chapter VI: The cJUN-MAP3K1-cJUN regulatory loop

37

Kinase activity of MAP3K1 is required for JNK and c-JUN phosphorylation

While the above data strongly suggest that c-JUN is an upstream regulator of MAP3K1

expression, our previous studies have shown that MAP3K1 is actually upstream of a JNK-c-JUN

module, because loss of MAP3K1 kinase domain prevents phosphorylation of JNK and c-JUN in

the developing eyelid epithelium (Zhang et al., 2003). To determine whether MAP3K1 is

required for c-JUN phosphorylation, we examined wild type and Map3k1ΔKD/ΔKD fibroblasts

treated with cholchicine for JNK and c-JUN phosphorylation. Colchicine treatment did not

change JNK expression, but it caused a time-dependent gradual induction of phospho-JNK that

was most abundant at 24 h of treatment in wild type cells and was completely absent in

Map3k1ΔKD/ΔKD cells (Figure 16A). In contrast, colchicine treatment caused c-JUN induction in both wild type and Map3k1ΔKD/ΔKD cells, consistent with previous observations. Interestingly,

colchicine also caused the induction of a subpopulation of slower migrating c-JUN, which took place only in wild type, but not in Map3k1ΔKD/ΔKD cells. As the level of the slower migrating c-

JUN corresponded well with that of phospho-JNK, we confirmed that this subpopulation

represents phospho-c-JUN by using an anti-p-c-JUN for Western blot analyses. Quantification

of the Western blotting data clearly revealed that JNK and c-JUN phosphorylation took place predominantly in wild type, but not in Map3k1ΔKD/ΔKD cells (Figure 16B), indicating that the

kinase domain of MAP3K1 is required for JNK and c-JUN phosphorylation. On the other hand,

c-JUN expression was induced by colchicine in both wild type and Map3k1ΔKD/ΔKD cells.

Kinase activity of MAP3K1 is required for optimal AP-1 activity

38

c-JUN is a member of the AP-1 family of transcription factors, which form various

homo- and hetero-dimers and bind to specific DNA elements to regulate inducible gene

expression. Since JNK-mediated c-JUN phosphorylation involves transcriptional activation of

AP-1 promoters (Baker et al., 1992), we examined whether MAP3K1 has an effect on AP-1

transcriptional activity. We transfected wild type and Map3k1ΔKD/ΔKD fibroblasts with the AP-1-

luc construct and measured luciferase expression after treatment with colchcine (Figure 17A).

Compared to luciferase induction in wild type cells, induction in Map3k1ΔKD/ΔKD was significantly lower, suggesting that MAP3K1 activity is required for optimal AP-1 promoter activation. In contrast, transfection of the pMap3k1 (-1900-1)-luc showed moderate decrease of luciferase expression in the Map3k1ΔKD/ΔKD cells, consistent with our previous observation that the kinase activity of MAP3K1 is not crucial for activation of its own promoter (Figure 9C).

To further confirm the downstream effects of MAP3K1, we examined AP-1 activity in

developing eyelids in vivo. We generated compound transgenic mice harboring an AP-1-

luciferase reporter gene in Map3k1+/ΔKD and Map3k1ΔKD/ΔKD genetic backgrounds. By

immunofluorescence microscopy, we detected luciferase expression in the developing eyelid,

with the expression level in Map3k1ΔKD/ΔKD fetuses lower than in Map3k1+/ΔKD fetuses (Figure.

17B). Direct measurement of luciferase activity in tissue lysates confirmed that MAP3K1 ablation reduced AP-1 activity in the eyelid but not so much in the skin of newborn pups (Figure

17C).

MAP3K1 enzyme activity is required for PAI-1 induction

AP-1 activation led to the induction of downstream target genes, one of which, the

plasminogen activator inhibitor 1 (Pai-1), is induced by colchicine and TGFα and dependent on

39

the JNK-AP-1 axis for induction (Pontrelli et al., 2004; Samarakoon et al., 2009). In the

developing eyelid epithelium, PAI-1 expression was abundant in wild type fetuses, and much

less so in Map3k1ΔKD/ΔKD fetuses (Figure 18A). In fibroblasts, colchicine caused the strong

induction of the active chromatin mark Ac-H4 at the Pai-1 promoter (Figure 18B) and strongly induced Pai-1 mRNA in wild type but not in Map3k1ΔKD/ΔKD cells (Figure 18C).

Summary of Chapter VI

Taking these in vitro and in vivo findings together, we conclude that the kinase activity of

MAP3K1 is critically needed for activation of the JNK-c-JUN pathway, induction of AP-1

activity and PAI-1 expression.

40

Chapter VII: Discussion and future directions

41

The signaling pathways that lead to MAP3K1 expression

Embryonic eyelid closure is a well characterized morphogenetic process of the vertebrate

eye and its defect in mice leads to a distinct and easily traceable EOB phenotype. Based on data from genetically manipulated mice that exhibit EOB, two signaling mechanisms emerge as

critical regulators of eyelid closure (Xia and Karin, 2004). One is the MAP3K1-JNK-c-JUN

pathway activated by activin B; the other is the EGFR pathway activated by a number of EGFR

ligands. While both pathways are essential for eyelid closure, how they crosstalk to coordinate

the same morphogenetic process has remained a mystery. In this thesis, we show that MAP3K1

provides the critical link between the two pathways. On the one hand, the TGFα/EGFR-RhoA-

c-JUN pathway converges on the Map3k1 promoter, resulting in promoter activation and

elevated MAP3K1 expression; on the other hand, the kinase activity of MAP3K1 is required for

activation of the JNK-c-JUN pathway, leading to increased AP-1 activity and target gene

expression. Thus, MAP3K1 is able to integrate diverse signals at different levels to coordinate

eyelid development.

Embryonic eyelid closure begins with the appearance of rounded periderm cells at the

margins of eyelid epithelium leading edge. The fact that MAP3K1 is highly expressed in the

developing eyelid epithelium and in specific cell types of adult tissues strongly suggests that its

expression is induced by selective developmental factors and physiological conditions. In a

sequence of in vitro experiments, we identified microtubule depolymerization and TGFα as initiating signals that act through the EGFR-ROCK/RhoA cascades for MAP3K1 induction.

There is clear in vivo evidence to support a role for EGFR in eyelid development, as EGFR knockout mice display a number of developmental problems, including defective eyelid formation (Miettinen et al., 1995). Additionally, knocking out ROCKI and ROCKII, the two

42 major downstream effectors of RhoA, and CDH1, the activator of the anaphase-promoting complex that regulates RhoA, both lead to EOB, although direct involvement of RhoA itself in eyelid development had not been established (Naoe et al., 2010; Thumkeo et al., 2005). Ours is the first demonstration that genetic interactions between RhoA and MAP3K1 control eyelid development and that RhoA acts as an accessory molecule for optimal MAP3K1 function.

Although loss of RhoA in the developing ocular surface epithelium does not affect eyelid development by itself, it delays eyelid closure in Map3k1 hemizygotes. Since the Map3k1 gene is biallelically activated, and accordingly, hemizygotes have half amount of MAP3K1, we propose that further MAP3K1 reduction by RhoA ablation in hemizygotes would cross a critical threshold, making it insufficient for eyelid closure. It is also possible that RhoA potentiates

MAP3K1 activity within a protein complex to facilitate eyelid closure (Gallagher et al., 2004).

We explored this possibility using an overexpression system and our result indicates that

MAP3K1 potentially regulates its own promoter independent of its kinase activity (Figure 9C) and therefore RhoA.

In addition to RhoA, our results suggest that several signaling factors, including Src,

ROCK and MAP3K1 itself in the control of Map3k1 promoter. MAP3K1 induces its own promoter activity independent of its kinase domain. Because a significant portion of MAP3K1 is found located in the nucleus, it is possible that MAP3K1 is directly involved in transcriptional regulation of its own promoter. In this context, it is interesting to note that MAP3K1 is indeed found to interact with a number transcription regulators, including STAT3, TORC1 and p300

(Lim and Cao, 2001; See et al., 2001; Siu et al., 2008). Hence, we suggest that MAP3K1 may act as a scaffold protein, recruiting transcription factors and organizing transcription complexes

43 to its gene promoter. This idea needs to be further tested using a CHIP assay or a CHIP-on-

CHIP experiment to pull down MAP3K1 in association with the Map3k1 promoter.

Transcriptional and epigenetic regulation of Map3k1 promoter

MAP3K1 expression depends on c-JUN, an immediate early response factor known to be induced by the TGFα/EGFR and RhoA/ROCK signaling cascades (Marinissen et al., 2004;

Marshall, 1995). c-JUN has an established role in embryonic eyelid closure, as shown by the fact that keratinocyte-specific c-JUN ablation leads to EOB (Li et al., 2003; Zenz et al., 2003). It was suggested that c-JUN may regulate the expression of HB-EGF and EGFR, essential factors for eyelid closure. Here we find that c-JUN targets yet another eyelid closure factor, MAP3K1.

In this case, c-JUN directly binds to the Map3k1 promoter, likely via AP-1-consensus sequences located in the proximal promoter region. Engagement of c-JUN with the promoter is associated with a number of epigenetic marks, such as acetylation of histone H4 and RNA pol II recruitment, characteristic of open chromatin structure and promoter activation. Importantly, this function of c-JUN is independent of its phosphorylation (Radler-Pohl et al., 1993). Because c-JUN is induced by the TGFα/EGFR pathway and its induction leads to MAP3K1 expression, we conclude that the MA3K1-c-JUN axis provides a molecular bridge connecting two developmental pathways during eyelid closure.

Our results strongly suggest that the Map3k1 promoter activity is silenced by epigenetic

DNA methylation (Figure 14). Two pieces of evidence support this idea. First, extremely high levels of CpG dinucleotides prone to methylation are present in the 5’ flanking region of both mouse and human Map3k1 promoter (Figure14A); second, the demethylating agent 5-aza increases the activity of the mouse Map3k1 promoter (Figure14B). An ongoing research project in the lab is to use bisulfite sequencing to confirm promoter methylation status. Complete DNA

44

demethylation usually occurs within 2 to 3 cell cycles. It is therefore puzzling that re-activation

of the Map3k1 promoter occurred after prolonged treatment (approximaly 6 weeks) with the

demythelating agent 5-azacytidine. It is possible that re-activation of the Map3k1 promoter requires more complex and perhaps indirect mechanisms, such as demethylation of DNA, histones and other proteins.

Consistent with the observation that histone deacetylase inhibitors did induce Map3k1 promoter activity (Figure 15A), we detected the presence of acetyl-H4 in the Map3k1 5’ flanking region in response to TGFα treatments (Figure 15B). In addition to histones, acetylation may take place on non-histone proteins. A growing list of acetylated proteins in the cytoplasmic and nuclear compartments has been identified, with acetylation leading to changes in protein stability, protein-protein interaction, DNA binding and cellular localization (Minucci and Pelicci,

2006). Thus, Map3k1 promoter activation may be the result of acetylation-mediated activation of other transcription factors. Alternatively, the Map3k1 promoter may also be subjected to the regulation by other post-translational modifications on histone tails, including phosphorylation, glycosylation, SUMOylation and ubiquitylation (Marks et al., 2001). These modifications may act in concert with methylation and acetylation to induce chromatin structural changes and gene expression. Identification of other regulatory mechanisms of the Map3k1 promoter is a direction of future studies.

MAP3K1-dependent downstream signaling pathways

Once expressed, MAP3K1 receives signals from another eyelid closure factor, activin B,

which induces the MAP3K1-JNK signaling cascade (Zhang et al., 2003). We find that stimuli-

induced JNK phosphorylation is indeed abolished in MAP3K1 deficient cells. Our previous studies show that MAP3K1 is haploinsufficient for eyelid closure in Jnk1-/- and Jnk1+/-Jnk2+/-

45

mice, supporting the existence of a MAP3K1-JNK1/2 axis in the control of eyelid closure

(Takatori et al., 2008). The involvement of JNK in embryonic eyelid closure was independently

confirmed in compound mutant mice Jnk1–/– Jnk2–/+ that are born with open eyes (Weston et al.,

2003). One consequence of MAP3K1-mediated JNK activation is the phosphorylation of c-JUN

at serine 63/73 (Hibi et al., 1993; Yujiri et al., 2000). In a striking contrast to the induction of c-

JUN protein expression, which is independent of MAP3K1’s kinase activity, the induction of its

phosphorylation requires MAP3K1 activity. Stimuli-induced c-JUN phosphorylation is

significantly reduced in cells that have a MAP3K1 lacking the kinase domain, and several

phospho-c-JUN-dependent events, such as AP-1 activity and PAI-1 expression, are markedly

decreased in MAP3K1-deficient cells and in developing eyelid epithelium. Interestingly, neither

the transgenic mice expressing a phosphorylation site mutated c-JUN nor the Pai-1 knockout

mice display EOB, raising the possibility that phosphorylation of c-JUN and expression of AP-1-

target genes are not extremely crucial for eyelid closure (Behrens et al., 1999; Providence and

Higgins, 2004). The downstream events through which the MAP3K1-JNK signaling cascades regulate developmental eyelid closure remain to be identified.

Health significance

Transient lid closure and reopening is a common morphogenetic process that also takes place in humans. In humans, the formation of eyelid folds begins at 6-8 weeks of fetal life, followed by lid fusion during the 9th week with the fusion breaking at the 20th week of gestation. It is entirely possible that eyelid closure is essential to ensure proper ocular surface

morphogenesis, while its defect might be associated with developmental disorders and congenital

eye diseases. Unlike in mice, however, the eyelid closure and re-opening process in humans is

accomplished in utero, making its deficiency difficult to detect. For that reason, clinical

46 diagnosis of eyelid closure defects in humans and identification of possible associated developmental diseases present a challenge that may have to rely on a genetic approach for resolution. In this context, investigation the molecular network that regulates eyelid development in mice may provide information to develop diagnostic tools to identify the molecular and genetic basis of birth defect in humans.

Maternal exposure to the environmental toxicant chlorpyrofos, the most widely used organophosphate insecticide, has been linked to a defect in eyelid closure in mice (Deacon et al.,

1980; Tian et al., 2005). On the other hand, popular pharmaceutical compounds, such as retinoic acid, cortisone and thyroxine (Juriloff, 1987; Juriloff and Harris, 1993), cause accelerated eyelid closure in mice. These observations suggest that besides genetic factors, environmental conditions that the pregnant mother exposed to will influence eyelid developmental closure. An intriguing hypothesis is that developmental eyelid closure depends on a complex signaling regulatory network that is modified by genetic, epigenetic and environmental events. As a result of gene-environmental interaction, disturbance of this network leads to impaired eyelid closure and causes birth defects of the eye. Understanding the molecular regulation of the signaling network will lead to development of useful prognostic tools for congenital ocular diseases. It will also provide useful information for prevention of birth defects caused by abnormal fetal eyelid development.

47

Figures and figure legends

48

Figure 1: Molecular networks in the control of eyelid morphogenesis

49

Stimulus Mitogens Cytokines/Stress

A-Raf, B-Raf, MAP3K1MAP3K1-6, 9-13, TAK(MAP3K7), MAPKKK Raf1, Mos, Tpl2 MLTK, SPRK TAO1-3

MAPKK MEK1/2 MKK4/7 MKK3/6

MAPK ERK JNK p38

Cytoplasm Nucleus Substrates p90RSK, Elk-1, c-myc Jun, ATF2, Elk-1 ATF1, 2, MEF2, NF-kB

Figure 2: MAPK signal transduction cascade

50

Promoter KD *** *** A D 3 Map3k1

Gene 2 Map3k1ΔKD Lac Z

Protein 1 MAP3K1-β-GAL Light Units Units Light (X10000) B 0 WT M1+/ΔKD M1ΔKD/ΔKD

E WT M1+/ΔKD M1ΔKD/ΔKD β‐GAL

β‐ACTIN MAP3K1 KD primers F M1KD primers Lac Z primers 1.2 Lac Z primers * ** 1 C WT Map3k1+/ΔKD Map3k1 ΔKD /ΔKD 0.8 0.6 0.4 Fold Induction 0.2 0 WT M1+/ΔKD M1ΔKD/ΔKD

Figure 3: Measuring endogenous MAP3K1 expression

(A) Drawing depicts the wild type (Map3k1) and Map3k1ΔKD alleles. The later was used for the

generation of Map3k1ΔKD mice, expressing a fusion protein MAP3K1-β-GAL under the control

of the endogenous Map3k1 promoter. (B) Genotyping PCR of the wild type, Map3k1+/ΔKD and

Map3k1ΔKD/ΔKD fibroblast using lacZ and MAP3K1 kinase domain (KD) specific primers. (C)

Measurement of β-gal expression using whole mount X-GAL staining in E15.5 fetuses carrying

51

the wild type, Map3k1+/ΔKD and Map3k1ΔKD/ΔKD alleles. Lysates from wild type, Map3k1+/ΔKD

and Map3k1ΔKD/ΔKD fibroblasts were used for (D) β-Glo assay and (E) Western blotting with

antibodies for β-gal and β-actin. (F) Total RNA was isolated from wild type, Map3k1+/ΔKD and

Map3k1ΔKD/ΔKD fibroblasts and real-time RT-PCR was performed using primers specific for

Map3k1 and β-Gal genes. The fold induction was calculated based on cycle differences (∆Ct) in

comparison to mouse Gapdh with the values for each homozygous allele as 1. Data are presented

as the mean values ± S.E. from at least 4 independent experiments and statistic analyses were

done by comparing to the values in wild type or control cells.

52

A 2 **

1.5 *

1

0.5 Fold Induction

0 Ctrl TGFα EGF TGFβ ActB IGF FGF10

B 3.5 ** * Map3k1 3 β-gal 2.5 2 1.5 1

Fold Induction 0.5 0 TGFα (hr) 02614

Figure 4: Induction of endogenous MAP3K1 promoter activity by EGFR ligands

(A) The Map3k1ΔKD/ΔKD fibroblasts were treated with various growth factors (100 ng/ml) for 24

h and β-gal activity was determined. (B) Total RNA was isolated from wild type (solid black bar) and Map3k1ΔKD/ΔKD fibroblasts (stripped bar) treated for various lengths of time with TGF-

α (100 ng/ml) and real-time RT-PCR was performed using primers specific for Map3k1 and β-

Gal genes. The fold induction was calculated based on cycle differences (∆Ct) in comparison to mouse Gapdh and the values in control cells. Data are presented as the mean values ± S.E. from at least 4 independent experiments and statistic analyses were done by comparing to the values in wild type or control cells.

53

A Liver Lung Aorta C Ctrl Col Vin As Tax β-GAL

p-H3

β-ACTIN

B 3 *** D 2.5 *** *** 2.5 *** *** *** 2 2 1.5 1.5 +Colchicine 1 1

Fold Induction Fold 0.5 0.5 Fold Induction Fold 0 0 Ctrl Col Vin Podo 2-ME Tax Cyto D Ctrl Col Act D CHX

Figure 5: Induction of MAP3K1 expression by microtubule depolymerizing agents

(A) Whole mount X-gal staining the liver, lung and heart from the Map3k1ΔKD/ΔKD mice and the

tissue (liver) or their sections (lung and heart) were photographed. Arrows point at β-gal

positive staining. (B) Lysates of the Map3k1ΔKD/ΔKD fibroblasts treated with or without 1 μM

colchicine (Col), Vinblastin (Vin), Podophyllotoxin (Podo 2-methoxyestradiol (2-ME), Taxol

(Tax) and Cytochalasin D (Cyto D) for 18 h were analyzed by β-glo assay. (C) Map3k1ΔKD/ΔKD fibroblasts were treated with 1 μM colchcine (Col), Vinblastin (Vin), Arsenic (As) and Taxol

(Tax) for 18 h. Cell lysates were analyzed by Western blotting with antibodies for β-gal, phospho-H3 and β-actin. (D) The β-gal activity was determined in lysates of Map3k1ΔKD/ΔKD fibroblasts following treatment with colchicines (1 μM) in the presence and absence of inhibitors of transcription (ActD, 5 μM) and translation (CHX, 5 μM) as indicated for 18 h. The results are average of at least 4 independent experiments and statistic analyses were done by comparing to the values in control cells.

54

Ctrl AG U0126 Y SP C A 2 TGFα (h) 06246 24 6 24 6246 24 1.5 β-GAL ** ** 1 3.4 2.1 1.4 1.2 3.1 3.6 4.3 1.1 2.7 2.6 1 β-ACTIN 0.5 6 Fold Induction 0 4 - 2 AG Y SB 0 Ctrl Colchicine

F/F +/+ B Ctrl AG D RhoA / Le-cre RhoA Col (h) 061224 61224 β-GAL 1 1.3 2.5 2.4 1.5 0.6 0.5 Map3k1+/+ Map3k1+/ΔKD Map3k1Δ KD/ΔKD Map3k1Δ KD/ΔKD β-ACTIN 3 2

Fold Fold 1 Map3k1+/ΔKD Map3k1+/ΔKD Map3k1Δ KD/ΔKD Map3k1Δ KD/ΔKD

Induction 0

Figure 6: EGFR and Rho kinase signaling pathways are involved in MAP3K1 induction

Map3k1ΔKD/ΔKD fibroblasts were pretreated with chemical inhibitors for EGFR (AG1478, 5 μM),

ERK (U0126, 10 μM), ROCK (Y-27632, 10 μM), JNK (SP600125, 10 μM) and TGFbR

(SB505124, 10 μM), prior to treatment with (A) TGFα (100 ng/ml) and (B) colchicine (1 μM) for various times as indicated. The cell lysates were subjected to (A and B) Western blot analyses with antibodies for β-gal and β-actin. Based on β-gal/β-actin level, fold induction over the control was calculated and represented in accompanying bar graphs. (C) β-gal activity of lysates from Map3k1ΔKD/ΔKD fibroblast after treatment with colchicine (Col, 1 μM) with or without various pathway inhibitos. (D) The E17.5 fetuses of various genotypes were photographed before (top row) and after whole mount X-gal staining (bottom row). The wild type mice have closed eyelid, but the Map3k1ΔKD/ΔKD and the triple transgenic

Map3k1+/ΔKDRhoAF/F Le-cre mice have eyelids completely or partially open (arrows).

55

A TSS Map3k1promoter -1900 -1 Insert into pGL3

Hind III Xho I

Deletion mutants pGL3 basic Luciferase

B 2.5 ** ** 2

1.5

1

Fold Induction Fold 0.5

0 Ctrl Col Noco Tax Cyto D Figure 7: Cloning of pMap3k1-luc reporter plasmid (A) A -1900 bp fragment from TSS of the mouse Map3k1 gene was cloned into pGL3 promoter

less luciferase reporter vector. (B) HEK293 cells were transfected with pMap3k1(1900)-luc

plasmid and were treated with colchicine, nocodazole, taxol and cytochalasin D (each 1 μM) for

18 h. The cell lysates were used to measure luciferease activity and fold induction were calculated.

56

A 3 ** ** 2.5

2 * * 1.5 1

Fold Induction Fold 0.5 0

B 3 ** 2.5 **

2

1.5

1 ** Fold Induction 0.5

0 Colchicine - + + -

RhoA N19 --+-

RhoA V14 ---+

Figure 8: Signaling pathways of Map3k1 promoter activation (A) HEK293 cells were co-transfected with expression vectors for various proteins as indicated together with the pMap3k1(1900)-luc. Cell lysates were subjected to luciferase assays and fold induction was calculated relative to the pCDNA control. (B) The HEK293 cells were co- transfected with expression vectors for active RhoA (V14) and dominant negative RhoA(N19) plasmids together with the pMap3k1(1900)-luc. Cell lysates were subjected to luciferase assays and fold induction was calculated relative to the vector control.

57

AC2.5 8 ** 2 6 *** 1.5 ***

Fold Fold 1 4 Induction 0.5 **

Fold Induction 2 0 Ad-EGFP + + + 0 Ad-MAP3K1 -++ Ad-IKKβ --- pMap3k1-luc + ++++ pEGFP + - - - - B MAP3K1 MAP3K1-WT + -- - - 1 1513 WT MAP3K1-KM - - + - - KM N3.1 MAP3K1-N3.1 - -- -+ Δ MAP3K1-∆ - - --+

Figure 9: MAP3K1 regulates its own promoter activity (A) Schematic showing various constructs of the MAP3K1 plasmids. (B) HEK293 cells were transfected with 1.9 kb pMap3k1(1900)-Luc promoter reporter together with the various constructs of MAP3K1 plasmids. Cell lysates were examined for luciferase activity and the fold induction represents luciferase activity over pEGFP transfected cells. Results represent average of at least 4 experiments and statistical analyses were done by comparing to values in control cells. (C) Map3k1ΔKD/ΔKD cells were infected with adenoviruses encoding MAP3K1, IKK-β and

EGFP. β-galactosidase activity, representing the levels of MAP3K1-β-GAL, was assayed as described in experimental methods section and fold induction was calculated relative to the

EGFP vector control.

58

A 1 MAP3K1 1513 aa Wild type

275 - PGVRRKRVSPVPFQSGRITPPP NLS B Β-gal DAPI Merge

Map3k1-/- cells

C TCL Cytosol Nuclear Anti-EGFP

Anti-MKK4

Figure 10: MAP3K1 is mainly localized in the nucleus (A) Schematic representation identifying the NLS sequence in the MAP3K1 amino terminal. (B)

Map3k1ΔKD/ΔKD MEFs were used for immunoflourescent staining using anti-β-gal (green) and

DAPI (blue). (C) MAP3K1-EGFP stably transfected HeLa cells were subjected to fractionation and Western blotting was done using anti-GFP, detecting the MAP3K1-EGFP mainly in the nucleus, and anti-MKK4, detecting a cytoplasmic protein marker.

59

A FL MAP3K1-M CAAX

FL MAP3K1-mut M CxxX

B 2.5 2 * 1.5 1 0.5 Fold Induction Fold 0 pMap3k1-luc + ++ pCDNA + - - MAP3K1-M - + - MAP3K1-mut M - - +

Figure 11: Membrane targeting of MAP3K1 abolishes the effect on its own promoter (A) Schematic showing various constructs of the MAP3K1 plasmids, expressing the MAP3K1 with myristalation sequence (CAAX) or with a mutated myristalation sequence (CxxX). (B)

HEK293 cells were transfected with 1.9 kb pMap3k1(1900)-Luc promoter reporter together with the various constructs of MAP3K1 plasmids. Cell lysates were examined for luciferase activity and the fold induction represents luciferase activity over pEGFP transfected cells. Results represent average of at least 4 experiments and statistical analyses were done by comparing to values in control cells.

60

A ABCDEF GHI Lanes: (A) 1 kbp Marker (B) -1900bp (C) -900 bp (D) -607 bp (E) -403 bp (F) -277 bp (G) -105 bp (H) -38 bp (I) 50 bp Marker

B *** -1900-1

-277-194 Control ** -277-1 Colchicine ** -105-1 -38-1 PGL3-b

0 5 10 15 20 25 Fold Induction C CR-3 CR-2 CR-1 Mouse -1630-1342 -782-680 -68-1 bp

Human -1865-1678 -1041-934 -69-1 bp

Rat -1585-1398 -743-640 -68-1 bp

Figure 12: Characterization of the exogenous Map3k1 promoter (A) Restriction enzymes (HindIII and XhoI) were used to digest various luciferase plasmids

containing different lengths of the promoter. The slower migrating fragment in each lane is the vector backbone (approximately 4000 bp) and the faster migrating fragment represents the

inserts of various deletions mutants of the Map3k1 promoter. Shown in lane B is the digested

61 pMap3k1(1900)-luc reporter plasmid. (B) HEK293 cells were transfected with plasmids of various deletion mutants of the pMap3k1-luc, followed by treatment with colchicine (1 μM) for

18 h. Cell lysates were examined for luciferase activity and the fold induction represents luciferase activity over pGL3 basic. Results represent average of at least 4 experiments and statistical analyses were done by comparing to values in untreated cells. (C) In silico analyses of the 2000 bp sequences upstream of the translation initiation site of the mouse, human and rat

MAP3K1 gene. Three regions (boxes) were found to be highly conserved (CR) across species and their locations relative to the translation initiation sites are marked.

62

A D Ctrl AG 4 *** 061224 61224 ** *** 3 Colchicine

2 TGFα *

1 E *** *

Fold Induction Fold 2.5 2 0 1.5 1 0.5 B 0 TGFα Col Induction Fold Col - + + - - Time(h) 026 14 2 6 14 RhoA(V14) --- ++ β-GAL DN-JUN -- ++- c-JUN F 6 ELK-1 control 5 ** FRA-1 ** TGFα 2 h TGFα 14h FRA-2 4 *** C 3 10 * R² = 0.8015 2 7.5

5 chromatin input Fold increase over 1 c-JUN 2.5 0 0 Pull-down 02.557.5 c-JUN PolII Antibody β-GAL

Figure 13: c-JUN regulates the Map3k1 promoter (A) Relative luciferase activities were determined in 293 cells transfected with specific promoter-driven luciferase reporters with or without colchicine (1 μM) treatment for 24 h. (B)

Map3k1ΔKD/ΔKD fibroblasts were treated with TGF-α (100 ng/ml) or colchicine (1 μM) for various times and cell lysates were analysed by Western blotting using various antibodies as

63

indicated. (C) Regression analysis was performed on the values obtained by quantifying the

intensity of MAP3K1-gal and c-JUN bands on Western blotting (n=20) and a line fit plot was

generated. (D) Map3k1ΔKD/ΔKD cells were pretreated with an inhibitor of EGFR, AG1478 (5

μM), prior to treatment with TGF-α (100 ng/ml, top pannel) or colchicine (1 μM, buttom pannel) for various times as indicated. The cell lysates were subjected to Western blotting using anti-c-JUN. (E) HEK293 cells were transfected with pMap3k1-luc together with plasmids for active RhoA [RhoA(V14)] and/or dominant negative c-JUN. The cells were either untreated or treated with colchicine (1 μM) for 24 h and cell lysates were examined for luciferase activities.

Fold induction was calculated based on the pMap3k1-luc activity in untreated cells. (F)

Map3k1ΔKD/ΔKD fibroblasts were treated with TGF-α (100 ng/ml) for various times and the cell

lysates were used for ChIP assay with antibodies to Pol II, c-JUN, and goat IgG as a negative

control. The precipitated chromatin DNA was examined by real-time PCR using primers

spaning the Map3k1 promoter region. The values represent fold change over non-specific IgG

control.

64

A

B 3 Control 5-Aza 2.5 ** ** 2

1.5

1 Fold Induction 0.5

0 2 wks 6 wks 24 wks 36 wks

Figure 14: Epigenetic regulation of the Map3k1 promoter

(A) MethPrimer was used to analyze 1kb of Map3k1 gene upstream the translation start site

(TSS). The results show two hotspots, one from -57 to -293 bp, the other from -397 to 550 bp

upstream from TSS. The darker blue colors indicate the CpG hotspots. (B) The Map3k1ΔKD/ΔKD fibroblasts were grown in medium containing concentrations of 5-aza as indicated for various times. The cell lysates were used to measure β-glo activity and protein concentration. The relative β-glo level/μg protein was calculated and the fold induction over control determined.

65

AB15 8 *** 7 ***

6

10 5 *** 4

3 * 2 5 input chromatin Fold increase over Fold Induction Fold 1

0 Ctrl 2 hr 14 hr 0 TGFα Ctrl NaB TSA

Figure 15: Histone modification of the Map3k1 promoter (A) The Map3k1-luc plasmid was transfected into 293 cells together with the CMV-β-gal

plasmids for 24 h. Following exposure to sodium butyrate (NaB, 5 mM) and Trichosporin A

(TSA, 5 μM) in FBS-free medium for 24 h, luciferase and β-gal activities were measured. Fold

induction was calculated by comparing luciferase levels in cells treated with NaB and TSA to the

untreated (control) cells. Results are average of at least 4 independent experiments. (B)

Map3k1ΔKD/ΔKD fibroblasts were treated with TGF-α (100 ng/ml) for various times and the cell

lysates were used for ChIP assay with antibodies to AcH4 and goat IgG as a negative control.

The precipitated chromatin DNA was examined by real-time PCR using primers spanning the

Map3k1 promoter region. The values represent fold change over non-specific IgG control.

66

A Wild type Map3k1ΔKD/ΔKD Col (h) 0 2 6 12 24 0261224 β-gal p-JNK t-JNK

cJUN

p-cJUN

β-actin

B pJNK/JNK pJUN/JUN 30 10

20 5 10 Fold Induction Fold 0 0 Col (h) 0 26 12 24 026 1224 Wild type Map3k1ΔKD/ΔKD

Figure 16: The kinase activity of MAP3K1 is required for the activation of the JNK-c-

JUN cascade

Wild type and Map3k1ΔKD/ΔKD fibroblasts were treated with colchicine (1 μM) for different times.

(A) The cell lysates were analyzed by Western blotting using antibodies for β-gal, phospho- and total-JNK, phospho- and total-c-JUN and β-actin, and (B) the results of Western blotting were quantified for the intensity of phospho- and total JNK (left panel) and phospho- and total c-JUN bands.

67

A 5 Wild type M1ΔKD/ΔKD 4 3 ** *** 2

Fold Induction Fold 1 0 Map3k1-luc AP-1-luc B β-gal Luc Merge

Map3k1+/ΔKD/ AP-1-LUC

Map3k1ΔKD/ΔKD/AP-1-LUC

C 10000 Wild type M1ΔKD/ΔKD 1000 * 100

Relative luc 10

0 Eyelid skin

Figure 17: The kinase activity of MAP3K1 is required for optimal AP-1 activity

(A) The wild type and Map3k1ΔKD/ΔKD fibroblasts were transfected with pMap3k1-luc or AP1-luc plasmids together with phRL-TK. After treatment with cholchicine (1 μM) for 24 h, the cell lysates were analyzed for firefly and Renilla luciferase activity. Firefly luciferase was normalized to Renilla luciferase activity and fold induction was calculated in comparison to cells without colchicine treatment. Results represent average of at least 2 experiments and 8

68

transfections. (B) The AP-1-luc transgenic fetuses at E15.5 on the Map3k1+/ΔKD (M1+/ΔKD) and

Map3k1ΔKD/ΔKD (M1ΔKD/ΔKD) genetic background were subjected to immunofluorescence staining

to detect the expression of MAP3K1-β-gal fusion protein (left panels, green) and luciferase

(middle panels, red) in the developing eyelid epithelium. Nuclei were stained with DAPI (right

panels, blue). (C) Tissue lysates from eyelids and skin of newborn pups were applied to

luciferase assay. Luciferase activity was normalized to protein concentration to determine

relative luciferase units per μg protein. Results represent average of at least 3 samples. The

Map3k1ΔKD/ΔKDAP1-luc eyelid showed significant reduction of luciferase activity compared to

wild type (** p<0.01).

69

A Wild type Map3k1ΔKD/ΔKD

PAI-1

B 10 Wild type Map3k1ΔKD/ΔKD *** 8

6 ** 4

Fold Induction 2

0 Col (h) 062 14

C 5 Wild type Map3k1ΔKD/ΔKD 4 *

3

2 Fold change change Fold in occupancy 1

0 Col (h) 0 14 AcH4

Figure 18: MAP3K1 enzyme activity is required for PAI-1 induction

(A) Tissue sections from wild type and Map3k1ΔKD/ΔKD fetuses at E16 were subjected to immunohistochemistry using anti-PAI-1. PAI-1 expression was identified in the eyelid epithelium (brown, arrows), being more abundant in wild type than Map3k1ΔKD/ΔKD fetuses. The bar represents 50 μm. Wild type (solid bar) and Map3k1ΔKD/ΔKD fibroblasts (open bar) were

70

treated with colchicine (1 μM) for the indicated times, and were used for (B) ChIP assay with

antibodies to AcH4 and goat IgG as a negative control. The precipitated chromatin DNA was

examined by qPCR using primers spanning the mouse Pai-1 promoter region. The values

represent fold change over nonspecific IgG control and an average of at least 4 experiments, and

(C) RNA isolated from the cells were analyzed by real-time PCR for expression of Pai-1. The

relative expression levels were calculated based on cycle differences (∆Ct) in comparison to that

of mouse Gapdh. Fold induction was calculated in comparision to control. Data are presented as

the mean values ± S.E. from at least 4 independent experiments. Statistical analyses were done by comparing the mean values in treated cells to that in control cells.

71

References

72

Anway, M.D., A.S. Cupp, M. Uzumcu, and M.K. Skinner. 2005. Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science. 308:1466-1469.

Ashery-Padan, R., T. Marquardt, X. Zhou, and P. Gruss. 2000. Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye.

Genes Dev. 14:2701-2711.

Baker, S.J., T.K. Kerppola, D. Luk, M.T. Vandenberg, D.R. Marshak, T. Curran, and C. Abate.

1992. Jun is phosphorylated by several protein kinases at the same sites that are modified in serum-stimulated fibroblasts. Mol. Cell. Biol. 12:4694-4705.

Baylin, S.B., and J.G. Herman. 2000. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet. 16:168-174.

Behrens, A., M. Sibilia, and E.F. Wagner. 1999. Amino-terminal phosphorylation of c-Jun regulates stress-induced apoptosis and cellular proliferation. Nat. Genet. 21:326-329.

Berkowitz, E.A., K.B. Seroogy, J.A. Schroeder, W.E. Russell, E.P. Evans, R.F. Riedel, H.K.

Phillips, C.A. Harrison, D.C. Lee, and N.C. Luetteke. 1996. Characterization of the mouse transforming growth factor alpha gene: its expression during eyelid development and in waved 1 tissues. Cell Growth Differ. 7:1271-1282.

Bonnesen, B., C. Orskov, S. Rasmussen, P.J. Holst, J.P. Christensen, K.W. Eriksen, K. Qvortrup,

73

N. Odum, and T. Labuda. 2005. MEK kinase 1 activity is required for definitive erythropoiesis in the mouse fetal liver. Blood. 106:3396-3404.

Cardone, M.H., G.S. Salvesen, C. Widmann, G. Johnson, and S.M. Frisch. 1997. The regulation of anoikis: MEKK-1 activation requires cleavage by caspases. Cell. 90:315-323.

Carroll, J.M., N.C. Luetteke, D.C. Lee, and F.M. Watt. 1998. Role of integrins in mouse eyelid development: studies in normal embryos and embryos in which there is a failure of eyelid fusion.

Mech. Dev. 78:37-45.

Chen, J.C., S. Zhuang, T.H. Nguyen, G.R. Boss, and R.B. Pilz. 2003. Oncogenic Ras leads to

Rho activation by activating the mitogen-activated protein kinase pathway and decreasing Rho-

GTPase-activating protein activity. J. Biol. Chem. 278:2807-2818.

Cheung, P., and P. Lau. 2005. Epigenetic regulation by histone methylation and histone variants.

Mol. Endocrinol. 19:563-573.

Christerson, L.B., E. Gallagher, C.A. Vanderbilt, A.W. Whitehurst, C. Wells, R. Kazempour,

P.C. Sternweis, and M.H. Cobb. 2002. p115 Rho GTPase activating protein interacts with

MEKK1. J. Cell. Physiol. 192:200-208.

Cobb, M.H., and E.J. Goldsmith. 1995. How MAP kinases are regulated. J. Biol. Chem.

270:14843-14846.

74

Cuevas, B.D., A.M. Winter-Vann, N.L. Johnson, and G.L. Johnson. 2006. MEKK1 controls

matrix degradation and tumor cell dissemination during metastasis of polyoma middle-T driven

mammary cancer. Oncogene. 25:4998-5010.

Cuevas, B.D., A.N. Abell, J.A. Witowsky, T. Yujiri, N.L. Johnson, K. Kesavan, M. Ware, P.L.

Jones, S.A. Weed, R.L. DeBiasi, Y. Oka, K.L. Tyler, and G.L. Johnson. 2003. MEKK1 regulates calpain-dependent proteolysis of focal adhesion proteins for rear-end detachment of migrating fibroblasts. EMBO J. 22:3346-3355.

Davis, R.J. 2000. Signal transduction by the JNK group of MAP kinases. Cell. 103:239-252.

Deacon, M.M., J.S. Murray, M.K. Pilny, K.S. Rao, D.A. Dittenber, T.R. Hanley, and J.A. John.

1980. Embryotoxicity and fetotoxicity of orally administered chlorpyrifos in mice. Toxicol. Appl.

Pharmacol. 54:31-40.

Deng, M., W. Chen, A. Takatori, Z. Peng, L. Zhang, M. Mongan, R. Parthasarathy, M. Sartor,

M. Miller, J. Yang, B. Su, W.W. Kao, and Y. Xia. 2006. A role for the mitogen-activated protein kinase kinase kinase 1 in epithelial wound healing. Mol. Biol. Cell. 17:3446-3455.

Dong, C., D.D. Yang, M. Wysk, A.J. Whitmarsh, R.J. Davis, and R.A. Flavell. 1998. Defective

T cell differentiation in the absence of Jnk1. Science. 282:2092-2095.

75

Du, J., B. Jiang, R.J. Coffey, and J. Barnard. 2004. Raf and RhoA cooperate to transform

intestinal epithelial cells and induce growth resistance to transforming growth factor beta. Mol.

Cancer Res. 2:233-241.

Fanger, G.R., N.L. Johnson, and G.L. Johnson. 1997. MEK kinases are regulated by EGF and

selectively interact with Rac/Cdc42. EMBO J. 16:4961-4972.

Faris, M., K.M. Latinis, S.J. Kempiak, G.A. Koretzky, and A. Nel. 1998. Stress-induced Fas

ligand expression in T cells is mediated through a MEK kinase 1-regulated response element in the Fas ligand promoter. Mol. Cell. Biol. 18:5414-5424.

Fatemi, M., M.M. Pao, S. Jeong, E.N. Gal-Yam, G. Egger, D.J. Weisenberger, and P.A. Jones.

2005. Footprinting of mammalian promoters: use of a CpG DNA methyltransferase revealing nucleosome positions at a single molecule level. Nucleic Acids Res. 33:e176.

Findlater, G.S., R.D. McDougall, and M.H. Kaufman. 1993. Eyelid development, fusion and subsequent reopening in the mouse. J. Anat. 183 ( Pt 1):121-129.

Fujii, S., N. Hatakenaka, M. Kaneda, and S. Teramoto. 1995. Morphogenetic study of the eyelids in NC-eob mice fetuses with an open-eyelid malformation at birth. Lab. Anim. Sci. 45:176-180.

Gallagher, E., T. Enzler, A. Matsuzawa, A. Anzelon-Mills, D. Otero, R. Holzer, E. Janssen, M.

Gao, and M. Karin. 2007. Kinase MEKK1 is required for CD40-dependent activation of the

76

kinases Jnk and p38, germinal center formation, B cell proliferation and antibody production.

Nat. Immunol. 8:57-63.

Gallagher, E.D., S. Gutowski, P.C. Sternweis, and M.H. Cobb. 2004. RhoA binds to the amino

terminus of MEKK1 and regulates its kinase activity. J. Biol. Chem. 279:1872-1877.

Gao, M., T. Labuda, Y. Xia, E. Gallagher, D. Fang, Y. Liu, and M. Karin. 2004. Jun turnover is controlled through JNK-dependent phosphorylation of the E3 ligase Itch. Science. 306:271-275.

Gibson, S., C. Widmann, and G.L. Johnson. 1999. Differential involvement of MEK kinase 1

(MEKK1) in the induction of apoptosis in response to microtubule-targeted drugs versus DNA damaging agents. J. Biol. Chem. 274:10916-10922.

Giroux, S., M. Tremblay, D. Bernard, J.F. Cardin-Girard, S. Aubry, L. Larouche, S. Rousseau, J.

Huot, J. Landry, L. Jeannotte, and J. Charron. 1999. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr.

Biol. 9:369-372.

Hancock, J.F., K. Cadwallader, H. Paterson, and C.J. Marshall. 1991. A CAAX or a CAAL motif

and a second signal are sufficient for plasma membrane targeting of ras proteins. EMBO J.

10:4033-4039.

Harris, M.J., and D.M. Juriloff. 1986. Eyelid development and fusion induced by cortisone

77 treatment in mutant, lidgap-Miller, foetal mice. A scanning electron microscope study. J

Embryol Exp Morphol. 91:1-18.

Henkemeyer, M., D. Orioli, J.T. Henderson, T.M. Saxton, J. Roder, T. Pawson, and R. Klein.

1996. Nuk controls pathfinding of commissural axons in the mammalian central nervous system.

Cell. 86:35-46.

Hibi, M., A. Lin, T. Smeal, A. Minden, and M. Karin. 1993. Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes

Dev. 7:2135-2148.

Hsu, S., and M. Hung. 2007. Characterization of a novel tripartite nuclear localization sequence in the EGFR family. J. Biol. Chem. 282:10432-10440.

Huang, J., L.K. Dattilo, R. Rajagopal, Y. Liu, V. Kaartinen, Y. Mishina, C. Deng, L. Umans, A.

Zwijsen, A.B. Roberts, and D.C. Beebe. 2009. FGF-regulated BMP signaling is required for eyelid closure and to specify conjunctival epithelial cell fate. Development. 136:1741-1750.

Islam, M.R., T. Jimenez, C. Pelham, M. Rodova, S. Puri, B.S. Magenheimer, R.L. Maser, C.

Widmann, and J.P. Calvet. 2010. MAP/ERK kinase kinase 1 (MEKK1) mediates transcriptional repression by interacting with polycystic kidney disease-1 (PKD1) promoter-bound p53 tumor suppressor protein. J. Biol. Chem. 285:38818-38831.

78

Jans, D.A., C.Y. Xiao, and M.H. Lam. 2000. Nuclear targeting signal recognition: a key control

point in nuclear transport? Bioessays. 22:532-544.

Johnson, N.L., A.M. Gardner, K.M. Diener, C.A. Lange-Carter, J. Gleavy, M.B. Jarpe, A.

Minden, M. Karin, L.I. Zon, and G.L. Johnson. 1996. Signal transduction pathways regulated by mitogen-activated/extracellular response kinase kinase kinase induce cell death. J. Biol. Chem.

271:3229-3237.

Joo, J., Y.H. Kim, N.W. Dunn, and S.P. Sugrue. 2010. Disruption of mouse corneal epithelial differentiation by conditional inactivation of pnn. Invest. Ophthalmol. Vis. Sci. 51:1927-1934.

Juriloff, D.M. 1987. Maternal treatment with cortisone accelerates eyelid closure and other developmental fusion processes in fetal mice. Development. 100:611-618.

Juriloff, D.M., and M.J. Harris. 1993. Retinoic acid, cortisone, or thyroxine suppresses the mutant phenotype of the eyelid development mutation, lgMl, in mice. J. Exp. Zool. 265:144-152.

Karandikar, M., S. Xu, and M.H. Cobb. 2000. MEKK1 binds raf-1 and the ERK2 cascade components. J. Biol. Chem. 275:40120-40127.

Karin, M., Z.G. Liu, and E. Zandi. 1997. AP-1 function and regulation. Curr. Opin. Cell Biol.

9:240-246.

79

Kokkinakis, D.M., A.G. Brickner, J.M. Kirkwood, X. Liu, J.E. Goldwasser, A. Kastrama, C.

Sander, D. Bocangel, and S. Chada. 2006. Mitotic arrest, apoptosis, and sensitization to chemotherapy of melanomas by methionine deprivation stress. Mol. Cancer Res. 4:575-589.

Kumar, C.C., J.H. Kim, P. Bushel, L. Armstrong, and J.J. Catino. 1995. Activation of smooth muscle alpha-actin promoter in ras-transformed cells by treatments with antimitotic agents: correlation with stimulation of SRF:SRE mediated gene transcription. J. Biochem. 118:1285-

1292.

Kyriakis, J.M., J.R. Woodgett, and J. Avruch. 1995. The stress-activated protein kinases. A novel

ERK subfamily responsive to cellular stress and inflammatory cytokines. Ann. N. Y. Acad. Sci.

766:303-319.

Labuda, T., J.P. Christensen, S. Rasmussen, B. Bonnesen, M. Karin, A.R. Thomsen, and N.

Odum. 2006. MEK kinase 1 is a negative regulator of virus-specific CD8(+) T cells. Eur. J.

Immunol. 36:2076-2084.

Lee, F.S., J. Hagler, Z.J. Chen, and T. Maniatis. 1997. Activation of the IkappaB alpha kinase complex by MEKK1, a kinase of the JNK pathway. Cell. 88:213-222.

Li, C., H. Guo, X. Xu, W. Weinberg, and C.X. Deng. 2001. Fibroblast growth factor receptor 2

(Fgfr2) plays an important role in eyelid and skin formation and patterning. Dev. Dyn. 222:471-

483.

80

Li, G., C. Gustafson-Brown, S.K. Hanks, K. Nason, J.M. Arbeit, K. Pogliano, R.M. Wisdom, and

R.S. Johnson. 2003. c-Jun is essential for organization of the epidermal leading edge. Dev. Cell.

4:865-877.

Li, Y., T. Minamino, O. Tsukamoto, T. Yujiri, Y. Shintani, K. Okada, Y. Nagamachi, M. Fujita,

A. Hirata, S. Sanada, H. Asanuma, S. Takashima, M. Hori, G.L. Johnson, and M. Kitakaze.

2005. Ablation of MEK kinase 1 suppresses intimal hyperplasia by impairing smooth muscle cell migration and urokinase plasminogen activator expression in a mouse blood-flow cessation model. Circulation. 111:1672-1678.

Lim, C.P., and X. Cao. 2001. Regulation of Stat3 activation by MEK kinase 1. J. Biol. Chem.

276:21004-21011.

Lin, Y.Z., S.Y. Yao, R.A. Veach, T.R. Torgerson, and J. Hawiger. 1995. Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J. Biol. Chem. 270:14255-14258.

Lu, Z., S. Xu, C. Joazeiro, M.H. Cobb, and T. Hunter. 2002. The PHD domain of MEKK1 acts as an E3 ubiquitin ligase and mediates ubiquitination and degradation of ERK1/2. Mol. Cell.

9:945-956.

Luetteke, N.C., T.H. Qiu, R.L. Peiffer, P. Oliver, O. Smithies, and D.C. Lee. 1993. TGF alpha

81 deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell.

73:263-278.

Mann, G.B., K.J. Fowler, A. Gabriel, E.C. Nice, R.L. Williams, and A.R. Dunn. 1993. Mice with a null mutation of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop corneal inflammation. Cell. 73:249-261.

Marinissen, M.J., M. Chiariello, T. Tanos, O. Bernard, S. Narumiya, and J.S. Gutkind. 2004. The small GTP-binding protein RhoA regulates c-jun by a ROCK-JNK signaling axis. Mol. Cell.

14:29-41.

Marks, P., R.A. Rifkind, V.M. Richon, R. Breslow, T. Miller, and W.K. Kelly. 2001. Histone deacetylases and cancer: causes and therapies. Nat. Rev. Cancer. 1:194-202.

Marshall, C.J. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell. 80:179-185.

McGarry, J.G., J. Klein-Nulend, and P.J. Prendergast. 2005. The effect of cytoskeletal disruption on pulsatile fluid flow-induced nitric oxide and prostaglandin E2 release in osteocytes and osteoblasts. Biochem. Biophys. Res. Commun. 330:341-348.

McHenry, J.Z., A. Leon, K.I. Matthaei, and D.R. Cohen. 1998. Overexpression of fra-2 in transgenic mice perturbs normal eye development. Oncogene. 17:1131-1140.

82

Miettinen, P.J., J.E. Berger, J. Meneses, Y. Phung, R.A. Pedersen, Z. Werb, and R. Derynck.

1995. Epithelial immaturity and multiorgan failure in mice lacking epidermal growth factor

receptor. Nature. 376:337-341.

Minamino, T., T. Yujiri, P.J. Papst, E.D. Chan, G.L. Johnson, and N. Terada. 1999. MEKK1 suppresses oxidative stress-induced apoptosis of embryonic stem cell-derived cardiac myocytes.

Proc. Natl. Acad. Sci. U.S.A. 96:15127-15132.

Minamino, T., T. Yujiri, N. Terada, G.E. Taffet, L.H. Michael, G.L. Johnson, and M.D.

Schneider. 2002. MEKK1 is essential for cardiac hypertrophy and dysfunction induced by Gq.

Proc. Natl. Acad. Sci. U.S.A. 99:3866-3871.

Minden, A., A. Lin, F.X. Claret, A. Abo, and M. Karin. 1995. Selective activation of the JNK

signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs.

Cell. 81:1147-1157.

Mine, N., R. Iwamoto, and E. Mekada. 2005. HB-EGF promotes epithelial cell migration in

eyelid development. Development. 132:4317-4326.

Minucci, S., and P.G. Pelicci. 2006. Histone deacetylase inhibitors and the promise of epigenetic

(and more) treatments for cancer. Nat. Rev. Cancer. 6:38-51.

83

Mongan, M., Z. Tan, L. Chen, Z. Peng, M. Dietsch, B. Su, G. Leikauf, and Y. Xia. 2008.

Mitogen-activated protein kinase kinase kinase 1 protects against nickel-induced acute lung injury. Toxicol. Sci. 104:405-411.

Morgan, I.M., and G.D. Birnie. 1992. The serum response element and an AP-1/ATF sequence immediately downstream co-operate in the regulation of c-fos transcription. Cell Prolif. 25:205-

215.

Morris, K.V. 2005. siRNA-mediated transcriptional gene silencing: the potential mechanism and

a possible role in the histone code. Cell. Mol. Life Sci. 62:3057-3066.

Nakamura, K., and G.L. Johnson. 2003. PB1 domains of MEKK2 and MEKK3 interact with the

MEK5 PB1 domain for activation of the ERK5 pathway. J. Biol. Chem. 278:36989-36992.

Nakamura, Y., T. Yujiri, R. Nawata, K. Tagami, and Y. Tanizawa. 2005. MEK kinase 1 is essential for Bcr-Abl-induced STAT3 and self-renewal activity in embryonic stem cells.

Oncogene. 24:7592-7598.

Naoe, H., K. Araki, O. Nagano, Y. Kobayashi, J. Ishizawa, T. Chiyoda, T. Shimizu, K.

Yamamura, Y. Sasaki, H. Saya, and S. Kuninaka. 2010. The anaphase-promoting complex/cyclosome activator Cdh1 modulates Rho GTPase by targeting p190 RhoGAP for degradation. Mol. Cell. Biol. 30:3994-4005.

84

Nemoto, S., J.A. DiDonato, and A. Lin. 1998. Coordinate regulation of IkappaB kinases by mitogen-activated protein kinase kinase kinase 1 and NF-kappaB-inducing kinase. Mol. Cell.

Biol. 18:7336-7343.

Nervi, C., U. Borello, F. Fazi, V. Buffa, P.G. Pelicci, and G. Cossu. 2001. Inhibition of histone deacetylase activity by trichostatin A modulates gene expression during mouse embryogenesis without apparent toxicity. Cancer Res. 61:1247-1249.

Nihalani, D., D. Meyer, S. Pajni, and L.B. Holzman. 2001. Mixed lineage kinase-dependent JNK activation is governed by interactions of scaffold protein JIP with MAPK module components.

EMBO J. 20:3447-3458.

Paradis, P., W.R. MacLellan, N.S. Belaguli, R.J. Schwartz, and M.D. Schneider. 1996. Serum response factor mediates AP-1-dependent induction of the skeletal alpha-actin promoter in ventricular myocytes. J. Biol. Chem. 271:10827-10833.

Pomérance, M., M.C. Multon, F. Parker, C. Venot, J.P. Blondeau, B. Tocqué, and F.

Schweighoffer. 1998. Grb2 interaction with MEK-kinase 1 is involved in regulation of Jun- kinase activities in response to epidermal growth factor. J. Biol. Chem. 273:24301-24304.

Pontrelli, P., E. Ranieri, M. Ursi, G. Ghosh-Choudhury, L. Gesualdo, F. Paolo Schena, and G.

Grandaliano. 2004. jun-N-terminal kinase regulates thrombin-induced PAI-1 gene expression in proximal tubular epithelial cells. Kidney Int. 65:2249-2261.

85

Providence, K.M., and P.J. Higgins. 2004. PAI-1 expression is required for epithelial cell migration in two distinct phases of in vitro wound repair. J. Cell. Physiol. 200:297-308.

Radler-Pohl, A., S. Gebel, C. Sachsenmaier, H. König, M. Krämer, T. Oehler, M. Streile, H.

Ponta, U. Rapp, and H.J. Rahmsdorf. 1993. The activation and activity control of AP-1 (fos/jun).

Ann. N. Y. Acad. Sci. 684:127-148.

Rodríguez-Vilarrupla, A., C. Díaz, N. Canela, H.P. Rahn, O. Bachs, and N. Agell. 2002.

Identification of the nuclear localization signal of p21(cip1) and consequences of its mutation on

cell proliferation. FEBS Lett. 531:319-323.

Russell, M., C.A. Lange-Carter, and G.L. Johnson. 1995. Direct interaction between Ras and the kinase domain of mitogen-activated protein kinase kinase kinase (MEKK1). J. Biol. Chem.

270:11757-11760.

Sabapathy, K., T. Kallunki, J.P. David, I. Graef, M. Karin, and E.F. Wagner. 2001. c-Jun NH2- terminal kinase (JNK)1 and JNK2 have similar and stage-dependent roles in regulating T cell apoptosis and proliferation. J. Exp. Med. 193:317-328.

Samarakoon, R., C.E. Higgins, S.P. Higgins, and P.J. Higgins. 2009. Differential requirement for

MEK/ERK and SMAD signaling in PAI-1 and CTGF expression in response to microtubule disruption. Cell. Signal. 21:986-995.

86

Schlesinger, T.K., C. Bonvin, M.B. Jarpe, G.R. Fanger, J. Cardinaux, G.L. Johnson, and C.

Widmann. 2002. Apoptosis stimulated by the 91-kDa caspase cleavage MEKK1 fragment requires translocation to soluble cellular compartments. J. Biol. Chem. 277:10283-10291.

Schnekenburger, M., L. Peng, and A. Puga. 2007. HDAC1 bound to the Cyp1a1 promoter blocks histone acetylation associated with Ah receptor-mediated trans-activation. Biochim. Biophys.

Acta. 1769:569-578.

Schrewe, H., M. Gendron-Maguire, M.L. Harbison, and T. Gridley. 1994. Mice homozygous for a null mutation of activin beta B are viable and fertile. Mech. Dev. 47:43-51.

See, R.H., D. Calvo, Y. Shi, H. Kawa, M.P. Luke, Z. Yuan, and Y. Shi. 2001. Stimulation of p300-mediated transcription by the kinase MEKK1. J. Biol. Chem. 276:16310-16317.

Sevel, D. 1988. A reappraisal of the development of the eyelids. Eye (Lond). 2 ( Pt 2):123-129.

Shimizu, Y., D. Thumkeo, J. Keel, T. Ishizaki, H. Oshima, M. Oshima, Y. Noda, F. Matsumura,

M.M. Taketo, and S. Narumiya. 2005. ROCK-I regulates closure of the eyelids and ventral body wall by inducing assembly of actomyosin bundles. J. Cell Biol. 168:941-953.

Siu, Y., Y. Ching, and D. Jin. 2008. Activation of TORC1 transcriptional coactivator through

MEKK1-induced phosphorylation. Mol. Biol. Cell. 19:4750-4761.

87

Sorokin, A.V., E.R. Kim, and L.P. Ovchinnikov. 2007. Nucleocytoplasmic transport of proteins.

Biochemistry Mosc. 72:1439-1457.

Su, Y.C., J. Han, S. Xu, M. Cobb, and E.Y. Skolnik. 1997. NIK is a new Ste20-related kinase

that binds NCK and MEKK1 and activates the SAPK/JNK cascade via a conserved regulatory

domain. EMBO J. 16:1279-1290.

Takatori, A., E. Geh, L. Chen, L. Zhang, J. Meller, and Y. Xia. 2008. Differential transmission of

MEKK1 morphogenetic signals by JNK1 and JNK2. Development. 135:23-32.

Tao, H., K. Ono, H. Kurose, S. Noji, and H. Ohuchi. 2006. Exogenous FGF10 can rescue an eye-

open at birth phenotype of Fgf10-null mice by activating activin and TGFalpha-EGFR signaling.

Dev. Growth Differ. 48:339-346.

Tao, H., M. Shimizu, R. Kusumoto, K. Ono, S. Noji, and H. Ohuchi. 2005. A dual role of FGF10

in proliferation and coordinated migration of epithelial leading edge cells during mouse eyelid

development. Development. 132:3217-3230.

Tate, P.H., and A.P. Bird. 1993. Effects of DNA methylation on DNA-binding proteins and gene

expression. Curr. Opin. Genet. Dev. 3:226-231.

Teramoto, S., S. Fujii, A. Yoshida, and Y. Shirasu. 1988. Morphological and genetic

88

characteristics of the open-eyelid mutant spontaneously occurring in NC-strain mice. Jikken

Dobutsu. 37:455-462.

Thumkeo, D., Y. Shimizu, S. Sakamoto, S. Yamada, and S. Narumiya. 2005. ROCK-I and

ROCK-II cooperatively regulate closure of eyelid and ventral body wall in mouse embryo. Genes

Cells. 10:825-834.

Tian, Y., H. Ishikawa, T. Yamaguchi, T. Yamauchi, and K. Yokoyama. 2005. Teratogenicity and

developmental toxicity of chlorpyrifos. Maternal exposure during organogenesis in mice.

Reprod. Toxicol. 20:267-270.

Uda, M., C. Ottolenghi, L. Crisponi, J.E. Garcia, M. Deiana, W. Kimber, A. Forabosco, A. Cao,

D. Schlessinger, and G. Pilia. 2004. Foxl2 disruption causes mouse ovarian failure by pervasive

blockage of follicle development. Hum. Mol. Genet. 13:1171-1181.

Vassalli, A., M.M. Matzuk, H.A. Gardner, K.F. Lee, and R. Jaenisch. 1994. Activin/inhibin beta

B subunit gene disruption leads to defects in eyelid development and female reproduction. Genes

Dev. 8:414-427.

Venuprasad, K., C. Elly, M. Gao, S. Salek-Ardakani, Y. Harada, J. Luo, C. Yang, M. Croft, K.

Inoue, M. Karin, and Y. Liu. 2006. Convergence of Itch-induced ubiquitination with MEKK1-

JNK signaling in Th2 tolerance and airway inflammation. J. Clin. Invest. 116:1117-1126.

89

Vesely, P.W., P.B. Staber, G. Hoefler, and L. Kenner. 2009. Translational regulation mechanisms of AP-1 proteins. Mutat. Res. 682:7-12.

Vettese-Dadey, M., P.A. Grant, T.R. Hebbes, C. Crane- Robinson, C.D. Allis, and J.L.

Workman. 1996. Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J. 15:2508-2518.

Wankell, M., B. Munz, G. Hübner, W. Hans, E. Wolf, A. Goppelt, and S. Werner. 2001.

Impaired wound healing in transgenic mice overexpressing the activin antagonist follistatin in the epidermis. EMBO J. 20:5361-5372.

Weston, C.R., A. Wong, J.P. Hall, M.E.P. Goad, R.A. Flavell, and R.J. Davis. 2003. JNK initiates a cytokine cascade that causes Pax2 expression and closure of the optic fissure. Genes

Dev. 17:1271-1280.

Widmann, C., S. Gibson, and G.L. Johnson. 1998. Caspase-dependent cleavage of signaling proteins during apoptosis. A turn-off mechanism for anti-apoptotic signals. J. Biol. Chem.

273:7141-7147.

Winter-Vann, A.M., and G.L. Johnson. 2007. Integrated activation of MAP3Ks balances cell fate in response to stress. J. Cell. Biochem. 102:848-858.

Witowsky, J.A., and G.L. Johnson. 2003. Ubiquitylation of MEKK1 inhibits its phosphorylation

90 of MKK1 and MKK4 and activation of the ERK1/2 and JNK pathways. J. Biol. Chem.

278:1403-1406.

Xia, Y., C. Makris, B. Su, E. Li, J. Yang, G.R. Nemerow, and M. Karin. 2000. MEK kinase 1 is critically required for c-Jun N-terminal kinase activation by proinflammatory stimuli and growth factor-induced cell migration. Proc. Natl. Acad. Sci. U.S.A. 97:5243-5248.

Xia, Y., Z. Wu, B. Su, B. Murray, and M. Karin. 1998. JNKK1 organizes a MAP kinase module through specific and sequential interactions with upstream and downstream components mediated by its amino-terminal extension. Genes Dev. 12:3369-3381.

Xia, Y., J. Wang, S. Xu, G.L. Johnson, T. Hunter, and Z. Lu. 2007. MEKK1 mediates the ubiquitination and degradation of c-Jun in response to osmotic stress. Mol. Cell. Biol. 27:510-

517.

Xia, Y., and W.W. Kao. 2004. The signaling pathways in tissue morphogenesis: a lesson from mice with eye-open at birth phenotype. Biochem. Pharmacol. 68:997-1001.

Xia, Y., and M. Karin. 2004. The control of cell motility and epithelial morphogenesis by Jun kinases. Trends Cell Biol. 14:94-101.

Yan, M., T. Dai, J.C. Deak, J.M. Kyriakis, L.I. Zon, J.R. Woodgett, and D.J. Templeton. 1994.

Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1.

91

Nature. 372:798-800.

Yu, Z., A. Bhandari, J. Mannik, T. Pham, X. Xu, and B. Andersen. 2008. Grainyhead-like factor

Get1/Grhl3 regulates formation of the epidermal leading edge during eyelid closure. Dev. Biol.

319:56-67.

Yujiri, T., G.R. Fanger, T.P. Garrington, T.K. Schlesinger, S. Gibson, and G.L. Johnson. 1999.

MEK kinase 1 (MEKK1) transduces c-Jun NH2-terminal kinase activation in response to changes in the microtubule cytoskeleton. J. Biol. Chem. 274:12605-12610.

Yujiri, T., S. Sather, G.R. Fanger, and G.L. Johnson. 1998. Role of MEKK1 in cell survival and activation of JNK and ERK pathways defined by targeted gene disruption. Science. 282:1911-

1914.

Yujiri, T., M. Ware, C. Widmann, R. Oyer, D. Russell, E. Chan, Y. Zaitsu, P. Clarke, K. Tyler,

Y. Oka, G.R. Fanger, P. Henson, and G.L. Johnson. 2000. MEK kinase 1 gene disruption alters cell migration and c-Jun NH2-terminal kinase regulation but does not cause a measurable defect in NF-kappa B activation. Proc. Natl. Acad. Sci. U.S.A. 97:7272-7277.

Zenz, R., H. Scheuch, P. Martin, C. Frank, R. Eferl, L. Kenner, M. Sibilia, and E.F. Wagner.

2003. c-Jun regulates eyelid closure and skin tumor development through EGFR signaling. Dev.

Cell. 4:879-889.

92

Zhang, L., W. Wang, Y. Hayashi, J.V. Jester, D.E. Birk, M. Gao, C. Liu, W.W. Kao, M. Karin, and Y. Xia. 2003. A role for MEK kinase 1 in TGF-beta/activin-induced epithelium movement and embryonic eyelid closure. EMBO J. 22:4443-4454.

93

Acknowledgments:

Most of the work in chapter III and VI has has been submitted for publication. The authors include; Esmond Geh, Qinghang Meng, Maureen Mongan, Jingcai Wang, Atsushi Takatori,

Alvaro Puga, Richard Lang and Ying Xia. The research was supported by the NIH grants

EY15227 (YX), NIEHS T32 ES07250 and F31EY019458 (EG). We thank Drs. Jay Tichelaar for providing the AP-1-Luc mice, Ami Aronheim for c-JUN expression vector.

Chapter IV was presented at the 2009 Annual ARVO (Association for Research in Vision and

Ophthalmology) meeting, Fort Lauderdale, Florida (May 6, 2009). The authors were; Esmond

Geh, Chang Jin and Ying Xia. The work was supported by NIH grants EY15227 (YX), NIEHS

T32 ES07250.

Chapter V was presented at the 2010 Annual ARVO (Association for Research in Vision and

Ophthalmology) meeting, Fort Lauderdale, Florida (April 2010). The authors were; Esmond

Geh and Ying Xia. The work was supported by NIH grants EY15227 (YX), NIEHS T32

ES07250.

94