US 201600.46955A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0046955A1 Wilkerson et al. (43) Pub. Date: Feb. 18, 2016

(54) P-COUMAROYL-COA:MONOLIGNOL Related U.S. Application Data TRANSFERASE (60) Provisional application No. 61/576,515, filed on Dec. (71) Applicants: John Sedbrook, Bloomington, IL (US); 16, 2011. BOARD OF TRUSTEES OF MICHIGAN STATE UNIVERSITY, O O East Lansin, MI (US); WISCONSIN Publication Classification ALUMNI RESEARCH FOUNDATION, Madison, WI (US) (51) Int. Cl. CI2N 5/82 (2006.01) (72) Inventors: Curtis Wilkerson, Swartz Creek, MI CI2N IS/II3 (2006.01) (US); John Ralph, Madison, WI (US); CI2N 9/10 (2006.01) Saunia Withers, Durham, NC (US); (52) U.S. Cl. John Sedbrook, Bloomington, IL (US) CPC ...... CI2N 15/8255 (2013.01); C12N 15/8218 (2013.01); C12N 9/1029 (2013.01): CI2N (73) Assignees: Board of Trustees of Michigan State 15/I 137 (2013.01); C12N 23 10/14 (2013.01) University, East Lansing, MI (US); Wisconsin Alumni Research Foundation, Madison, WI (US); The (57) ABSTRACT Board of Trustees of Illinois State University, Normal, IL (US) The invention relates to nucleic acids encoding a p-couma royl-CoA:monolignol transferase and to inhibitory nucleic (21) Appl. No.: 14/365,744 acids adapted to inhibit the expression and/or translation of a p-coumaroyl-CoA:monolignol transferase RNA. Inhibition (22) PCT Filed: Dec. 14, 2012 of p-coumaroyl-CoA:monolignol transferase in plants (86). PCT No.: PCT/US2O12/069902 improves the incorporation of monolignol ferulates into the lignin of plants, giving rise to plant biomass that is more S371 (c)(1), easily processed into useful products such as paper and bio (2) Date: Jun. 16, 2014 fuels. Patent Application Publication Feb. 18, 2016 Sheet 1 of 47 US 2016/0046955 A1

* HC- FIG, Aiii,FIG 1A1 to C OMe O - O OM HO

CMe

Med C OH

OH OMe

FIG. IAI Patent Application Publication Feb. 18, 2016 Sheet 2 of 47 US 2016/0046955 A1

HO HO ? OMe

MeO HO C OH HO HO OMe

hor? C KX-OMe HO HO C

(-oiC ( OMe HO C H O CH

OH MeO C O OMe HO HC) Y OH S. OH HC C HO CMe O 8- ) v to-1-(O ) MeO OH O OMe (CHO) HO

OMe OH FIG, 1A2 Patent Application Publication Feb. 18, 2016 Sheet 3 of 47 US 2016/0046955 A1

CH MO OM OH FIG. IB1 HO FIG, IBT O OH MO HO O MO OM

OH HO CMe O OH MC HO O OMe

OH

HO OH

MeO O OH HO G OMe

HC O Key-OMe C

FIG. IB1 Patent Application Publication Feb. 18, 2016 Sheet 4 of 47 US 2016/0046955 A1

HO OMe OH

MeC) OMe O OH OMe HO OH OMe FIG. IB2 Patent Application Publication Feb. 18, 2016 Sheet 5 of 47 US 2016/0046955 A1

s g s g s s OW Patent Application Publication Feb. 18, 2016 Sheet 6 of 47 US 2016/0046955 A1

g s s s s OW Patent Application Publication Feb. 18, 2016 Sheet 7 of 47 US 2016/0046955 A1

[udd] V@'9IH

Patent Application Publication Feb. 18, 2016 Sheet 9 of 47 US 2016/0046955 A1

Patent Application Publication Feb. 18, 2016 Sheet 10 of 47 US 2016/0046955A1

s s g s g s s OW Patent Application Publication Feb. 18, 2016 Sheet 11 of 47 US 2016/0046955A1

S N |||s y

|||s * S are:23 s SCS

n -- esco IOI y TNF | - | l

OW Patent Application Publication Feb. 18, 2016 Sheet 12 of 47 US 2016/0046955A1

Patent Application Publication Feb. 18, 2016 Sheet 13 of 47 US 2016/0046955A1

g s g s s Patent Application Publication Feb. 18, 2016 Sheet 14 of 47 US 2016/0046955A1

s Patent Application Publication Feb. 18, 2016 Sheet 15 of 47 US 2016/0046955A1

Patent Application Publication Feb. 18, 2016 Sheet 16 of 47 US 2016/0046955A1 sss --MOM s s

y ce 92 s

ge - 9 en ca

C

gd ge ad ad ge Ced es ge ded Mad N. ea ed y ed ed ed Ced e Patent Application Publication Feb. 18, 2016 Sheet 17 of 47 US 2016/0046955A1

Superdex.75 gel filtration fractions 19 20 21 22 23 24 25 26 we an as an arre as we we

FIG. 8 Patent Application Publication Feb. 18, 2016 Sheet 18 of 47 US 2016/0046955A1

Y () O. O. 92: d

)-o C)if

s d Q sO ed 5 O. O.

\, y 3O ON S SA -1

O C O O O

S s O : : Patent Application Publication Feb. 18, 2016 Sheet 19 of 47 US 2016/0046955A1

WT1 FMT9 FMT13 WT1 FMT9FMT13 un- un- un- WT1 FMT9 FMT13 WT1 FMT9 FMT13 input input input boundboundbound wash wash wash eluate eluate eluate

FIG, 10A

AU 0.3 --

: 2: WTPOPLAR : LEAF EXTRACT

O

0.3 --

EXPRESSINGPOPLAR LEAF EXTRACT

o ------ow-or------2 4 6 " ) 12 14 MINUTES FIG, 10B Patent Application Publication Feb. 18, 2016 Sheet 20 of 47 US 2016/0046955A1

ARABIDOPSISLEAFRT-PCR Kb PLUS EMPTY VECTOR AtFMT DNA

S. X s S. S. S.

s

1 --ARABDOPSIS EMPTY WECTOR EXTRACT

& we are as K. Exa, ea. A aar ax...'ar as a. as aa: aaa, a -as-as-s-s-s-s-s-ra as- as ar... r * r *

2

: s +ARABIDOPSIS iii. FMTEXTRACT s 3

MINUTES FIG, 11B Patent Application Publication Feb. 18, 2016 Sheet 21 of 47 US 2016/0046955A1

A Hibiscus cannabinus FMT protein purification fraction fraction kDa soluble insoluble 29 3O

SO

25

FIG, 12A Patent Application Publication Feb. 18, 2016 Sheet 22 of 47 US 2016/0046955A1

s : s s : s s : s : s s s ; : s : s .

S. l,f v.- S. K N as : sh (L) ; : + t ; : ; : : :; :i. on ass a o : : : ; : x: OO retic - E. it: a reiss SS S : - gi'er. d --- saaxa ... " retrix: " -era- . wesi . i ski w'i' * si : ... v. ... it' se- s *'''..., t *w-ana-. : s terra " (N R S s s s s s .-----r ANT- k re-ra. s

k -. . . s r - R s : s s ; : S s : s s ; : s s S s * , s s s K s R s s R ; : S - S s s - s s : : & : s S d

Patent Application Publication Feb. 18, 2016 Sheet 25 of 47 US 2016/0046955A1

ACCACCATCACCACCACCTCGAAGGTCTTGAGCTCCATCTCCGGCGACGGCGGCGACGAC GACGACGACGGCGAGGAGGAGCTAGTAGCTAGCTGAGCCAGACAGCATGGGGTTCGCGGT GGTGAGGACGAACCGGGAGTTCGTGCGGCCGAGCGCGGCGACGCCGCCGTCGTCCGGCGA GCTGCTGGAGCTGTCCATCATCGACCGCGTGGTGGGGCTCCGCCACCTGGTGCGGTCGCT GCACATCTTCTCCGCCGCCGCCCCGAGCGGCGGCGACGCCAAGCCGTCGCCGGCGCGGGT GATCAAGGAGGCGCTGGGGAAGGCGCTGGTGGACTACTACCCGTTCGCGGGGAGGTTCGT GGACGGCGGCGGCGGGCCGGGGAGCGCCCGCGTGGAGTGCACCGGCGAGGGCGCCTGGTT CGTGGAGGCCGCCGCCGGCTGCAGCCTCGACGA CGTGAACGGCCTCGACCACCCGCTCAT GATCCCCGAGGACGACCTCCTCCCCGAOGCCGCCCCCGGTGTCCACCCCCTCGACCCCC CCTCATGATGCAGGTATAATACTACCCGTATACGTACGTTTCTACGTACGTAAGTACGTG CTATACTTGCGAGCAGACAAAAACAAATAAAATCGGTAACAACAATTAACCATCCAGTTA TGCTTACAACTAATTCAAATTATCTTAATTAATTAAAACTGTCCGGCTAATTAAGTGATT ATTAAGGGTGTGTTTTTATCACATCTTCCCGACTGGTACTCCCTCATTTTCCACACGGAT GTTTTACAACTGCAAACGGTACGTATTACAGAAAAAAGTTATATATAAAATTGTTTT AAAATCATATTAATCTATTTTTAAGTTTATTTTAGCTAATAGTTAAATAAACACGCGCTA ACGGATCATTATGTTTTGTGTGTGGGGAGAAAGTTTCTAACCTCCACCTCTAAACACA GCATAATTGTTGGTACGTAGGGCCTATTCACTTTAACGCAAAAAAAGAACCTTACCAAGT TGCCAAAATTTTGGTAGGATTTCTTATATAGTTACTAAAATTTGATAG CAAACAAATAT AACCACTTTTTTATAACTTTACCAAAATTTGCTAAGATTGAAAATGGCATCAAAGTGAAC AGGCCCGTATACGTACGGAGAATGCTGACCTCTCCGGATGATACCTTTAATTTTTCACTT GTGTGGATGTGCACACATGTACGAGGACGAACACATTCA AACCCGTGAAGATTTTAATAT GTGGACGAACTCGATCTATGGTATTGTTGCTGACGAATTAATTACAAAAGTGCTCAAGGA GTTATGTAACTATAAGAACAAAACTATATATGTTTGCCCAAGTAGAAATATATACGAACA AAAACACAGACATGAATAGAACCTACGCGTACGTACAATGTGCCATTACATGCATGTAC ACAATCATTAGCTAGTGTCCTGGATTATATTCAGTCAATTATAACTTTCTAGAAATTAG GTACTAATATATGTATGACTCTCAAACTGTAGTCATGCTTGTGTCAAGTTATAATTAAGT ACAATAATCACACCGATTTATTTTACATAAAGTACAGTAGGATTCAAGATAAG ACTGAGC TATATAGTACTAGGCAGGATGATGAGCTAGCTAGAGCTTAGTGCTCAACATAAACTAGTT GGAGCGTG (CACTG CAATTTTCAAAGTAAAATTAGTTAATTTGCACAGGTGAAGTTGATC CTGTCAGGTAGGTAAGCTCACCAA CTCCAAAGATTGGACAGAATGAAGCATCTGTGGAAG TGAAAGCAGTTGCGTTGGCGTAAGACCACACTAACCAGAGAACTCATAATACAAAATACA TAACAGCACACAATTTATATTGTGTATATATATATATATATATATATATATATGATGT ATGTATGTATGTATGTATTCTAACTGTGTTATCCAATTTTTAAGAAATTTCATCTTTTCA AAAGTAGTAGTATTTGAGTGATGCATGTGCACGTTTTTAGATATGTACATATACCTCATC TACTTTAAAAAAAAAAAATTTTATACAGAGTCGGAACACTAAGCTTAACACTGAT ATCTGACGATAGCATGACGGGATGAGCTTGTCATCAATTGCAGCAGGGCAATTAGGCATG TAAACTGGGGCCATTGATTTCTGTCGAGCACACTATGCTTTCCCTGTCTTATTCTGCCTA

FIG, 14C1 Patent Application Publication Feb. 18, 2016 Sheet 26 of 47 US 2016/0046955A1

ACTTAACACTAATATTTGACACACTATCAATTGTTAGCTATTGATATGGCAGTTTGACAT CGACCCTGCTCCATCATTATTACTGCATGCCCGCCCATTCGATGATTGACTTGACCAAAC CCACAAGTGCAAATTGGAAAATTAATAATTAATAATTAGCAAGAAAAAATCCATC AGGGATTCAGGATCAGGTCATGGATGTAATCACTCTCAAACATAG CAATCATTGTGCTT ATGGTCCAAGTGATCATTCCCCCTAATCAACAA CTCGCTTGCTAG CAAGACGTCCCTTCG AATGGATTATTTGATAGCTAGAGCATATCACCTTGCACTTCACCACTCCCCTTATGCAGA GTGTACGTATGTCTAACCAGAATCTAGTGGTGAGCGTAAAAGATCAAAGTG CCCTTATCA ATAACAAAATACTCCGTAATACATTTGGTGGATATATAGGTATATAAGTATTAAAGGAAT AAAACTTTCAAATTTGTGGATTCTAATAAAAACTAATATTAATTTTGATAAACCTGAATT GTAGATACTCTAACTTAGGGTAGTAGTTGAAGCATGCAAAGCTCTAAAAATATATATGAA TTTCGGCGTGTTTATATATATTTCTCCGTGGATATAAAAGCTTAAAATTTATAATCATTT TATGATGATCAGGTGACGGAGTTCAGTTGCGGAGGGTTCGTGGTGGGCCTGATCTCGGTG CACACGATGGCGGACGGGCTAGGGGCCGGGCAGTTCATCAACGCGGTGGGCGACTACGCC CGCGGGCTGGACAGGCCGAGGGTGAGCCCGGTCTGGGCCCGCGAGGCCATCCCGAGCCCG CCGAAGCTGCCCCCGGGCCCGCCGCCGGAGCTGAAGATGTTCCAGCTCCGCCACGTCACC GCCGACCTGAGCCTGGACAGCATCAACAAGGCCAAGTCCGCCTACTTCGCCGCCACCGGC CACCGCTGCTCCACCTTCGACGTCGCCATCGCCAAGACGTGGCAGGCGCGCACCCGCGCG CTCCGCCTCCCGGAACCCACCTCCCGCGTCAACCTCTGCTTCTTCGCCAACACCCGCCAC CTCATGGCCGGCGCCGCCGCCTGGCCCGCACCCGCCGCCGGCGGCAATGGCGGCAATGGG TTCACGGCAA CGCTTCACCCGGTGTCGGGGTGGCGGAGAGCGGGGCGGTGGAGGCG GCGGACGTGGCCGGGGTGGTGGGGATGAACGGGAGGCGAAGGCGAGGCTGCCGGCGGAC TTCGCGCGGTGGGCGGTGGCCGACTTCAGGGAGGATCCGTACGAGCTGAGCTTCACGTAC GATTCCCTGTTCGTCTCCGACTGGACGCGGCTGGGGTTCCTGGAGGCGGACTACGGGTGG GGGCCGCCGTCGCACGTCATACCCTTCGCGTACACCCGTTCAGGCCGTCGCCATCAC GGCGCGCCGCCGGTGCCCAAGACCGGCGCCCGGATCATGACGCAGTGCGTCGAGGACGAC CACCTGCCGGCGTTCAAGGAGGAGATCAAGGCCTTCGACAAGTAAAATGCTTGTGAAATG TGAACTTTGTTATTGTTACTACTTCTATGGGCTCGTTGCTCAATGGGCTTTTTTTTGCTT TTGTTTTGTGTGTGTGGGCCGACACGATTGGTCAAAAGGGATTTGGTGGAGGCCCAGTTG TAATAAGATGGTCCACGCATCATGGATTAATCGTTAATTGTAAGGTAGTACTACACGGAT TTGTTAACAAGGAATAAGTTCACTTGGTGACCCAGTGA

FIG, 14C2 Patent Application Publication Feb. 18, 2016 Sheet 27 of 47 US 2016/0046955A1

ATGGGATTTGCTGTTGTCCGCACAAACCGTGAATTTGTTCGCCCCTCGG CAGCTACCCCACCATCATCCGGCGAATTATTGGAATTATCAATCATTGATC GTGTAGTTGGTCTCCGTCATCTGGTTCGTTCTTTACATATTTTTTCTGCAG CTGCACCATCTGGCGGTGATGCAAAACCCTCCCCGGCTCGCGTTATTAA AGAAGCATTGGGCAAAGCACTTGTAGACTACTATCCTTTCGCAGGTCGT TTCGTTGACGGCGGCGGCGGTCCGGGCAGTGCGCGTGTAGAATGTACC GGTGAAGGTGCTTGGTTTGTAGAAGCAGCTGCTGGATGTTCATTAGAC GATGTCAATGGCTTAGATCATCCATTAATGATTCCTGAAGACGATCTCTTA CCCGATGCAGCCCCTGGCGTTCACCCACTGGATTTACCGTTAATGATGCA AGTTACTGAATTTTCATGCGGCGGTTTTGTTGTTGGCTTGATTAGCGTCC ACACAATGGCTGACGGTTTAGGCGCAGGCCAATTTATCAATGCAGTAGG CGATTATGCTCGTGGCCTCGACCGTCCGCGTGTTAGCCCGGTATGGGCA CGCGAAGCCATTCCTAGCCCTCCGAAGTTACCACCCGGTCCACCTCCCG AATTAAAAATGTTCCAACTTCGTCATGTGACAGCCGATTTGTCTCTCGATT CTATCAACAAGGCGAAATCAGCGTATTTTGCAGCCACCGGTCATCGTTG CTCCACATTCGACGTCGCTATTGCAAAAACATGGCAAGCCCGCACTCGT GCCCTTCGTCTCCCAGAACCAACGTCACGTGTTAACCTGTGTTTTTTTGC TAATACCCGCCATTTAATGGCAGGCGCAGCGGCCTGGCCCGCTCCAGCA GCCGGAGGTAATGGTGGCAACGGCTTCTATGGCAATTGTTTCTACCCGG TGTCTGTTGTGGCCGAATCAGGTGCAGTTGAAGCGGCAGATGTGGCAG GTGTTGTTGGTATGATCCGTGAGGCCAAAGCCCGTCTCCCAGCCGATTT TGCACGTTGGGCAGTTGCCGATTTTCGCGAAGACCCTTATGAACTTTCA TTTACATATGATTCCTTGTTTGTCTCAGATTGGACTCGTTTAGGATTTCTC GAAGCTGATTATGGTTGGGGCCCACCCTCTCATGTAATTCCTTTCGCATA TTACCCGTTTATGGCGGTAGCTATCATCGGCGCTCCTCCAGTTCCAAAAA CCGGCGCACGTATTATGACTCAGTGTGTAGAAGATGATCATTTACCAGCG TTTAAAGAAGAAATTAAAGCCTTCGATAAGTGA

FIG, 14D Patent Application Publication Feb. 18, 2016 Sheet 28 of 47 US 2016/0046955 A1

Patent Application Publication Feb. 18, 2016 Sheet 29 of 47 US 2016/0046955 A1

Åå [][]I Patent Application Publication Feb. 18, 2016 Sheet 30 of 47 US 2016/0046955 A1

VZI’0IH {{ZI’01), —————?

000€ 000|| BOTSI Patent Application Publication Feb. 18, 2016 Sheet 31 of 47 US 2016/0046955A1

s

3

kara . s - le 3 ": ar 5 e setts, Patent Application Publication Feb. 18, 2016 Sheet 32 of 47 US 2016/0046955A1

S

o

QCS vs S S

L tes .

ckx --- RS r S. S. . . Lo ------8. Patent Application Publication Feb. 18, 2016 Sheet 33 of 47 US 2016/0046955 A1 u?IIIU?III

- - (W) 23ue quosq. (nW) 2.3Lie qIosqw Patent Application Publication Feb. 18, 2016 Sheet 34 of 47 US 2016/0046955 A1 Patent Application Publication Feb. 18, 2016 Sheet 35 of 47 US 2016/0046955A1

SSSSSSSSSSS . a a . . . . . &S.S.S.; ;&E --- a-- a-- a-- a-- a---

S, SS383&SSSSSSS&S ISSSSSSSSE&SSSSSSE&SSSSSSSSSS ESSES&S&S&S&S&SSSSSSSSSSSSSSS888&ESSKS as as as Scar as as as as as Star as as as Sax as as a fax as as as as as Stax as Sax as Sar as Star as as as as axes ar&as as as

is 38&SS388x33:8&E SSESSESSESSESSESSEE S&SSSSSSSSSSSSSSs - a -Saara as a sea as a sa as as as as as as a Sasa as a Sasara aas as a reas a as a

ESSESXSSSSSSESSESS: ESSESSESSE&E&SSSSSSSSS& S&SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSE3 - a -a as Sassa ara aa as as a Sasaras a Sa aña al-Saar as a sa as a as a ca'a assaga as a

SS&SSSSSSSSSS&&.8&SSSSSSSSS&E&SSESSESS: S S&SSSSSSSSSSS&SSSSS&&.83.38 SSSESSSSSSSSSSSSSSSSSSSSSSSS --S------.S.--S----.S.------.S.------.S.------.S.----.S.------

S888SSS&Ex88.88S-888&S.S.S.S&S&S.S.S.S.S.: SSSSSSSSSCCESSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS --&------S.--&-- ~ S------.S.------S ------

S&S&EiS&ESS&SR&S&S&E&&&. SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS LVLVL Sirr ... . S.LVLV LVLVL sVLV VLVL Sirr LVLVL Sr. LVL Sir VLL Sir terr LVL SSVLV VV R VLV LVV *LVLV LVV S. VLV VLVL &LVL VLVL S.LV LVLVL&r VLVL E. LV LVLVL LVV LVLVL S VV LVLVL Star

&&SSSS$8&SC&S&S$8&SE&SSS&S&SS8&SE&E Sy:SSSSSSSESSSSSSSSSSSSSSSSS&ESSSSSSS: ------E ------S-S - a ra

S. C&:33:3,888&SC&ESCS883.SSESS&&S$88. Ex8&K8&SES-88&S388:338&SE&S&S&S&&. ---.S.--8-- - - ...S.- ...... 3-...... S.- ...... si......

S&SSEESSESSESSESSSSSSSSSSSS S&SSSSSSSSSSSSSSSSSSSSS

SEESSESSSSSSSSESSESSE&ESSESSEES&S SSSSSSSSSSSSSSSSSSSSS - - -3-car - Sr. -----8------&---, -, -?r------e.g. --8-- - S - S - c.

ESSSSSS&S$8&SE&S&ESSEES:X::::::::::::E& SSSSSSSSSSSSSSSSSSSSSSSSS

rSr. are n Sri na n'a narrar na narray was or narra ran narrow no row no

SSSSSSSSSSSSSS&SCE&E&SSSSSSSSSSSSSSSSSS&S&S

FIG, 20B1 Patent Application Publication Feb. 18, 2016 Sheet 36 of 47 US 2016/0046955A1

&:S&SSES&SES&S&SRSS&SE&SSSSSSSSSSSSSSSSS&SC& - Sorror. -- or-. ---, -er ram ------, Sr. - Sr. -- or SS

& 888&2&SE&SSXSSSSSSSSSSSSSSS8iS$3&SSSSSSSSE383 S &SESSSSSSSSSSSSSSSSSSSSSSSSSSSSS -- 3-8-F.-S-S------8. --&-8-8-3-83-8-- - - -S.--&-8. --

Sssssssssss&S&&SSS is: Si:Sissississis&SSSS& SSSSSSSSSKCSES&EE&E&SSSSSSSSSSSSSXSS ...... W...... &...... S...S...... S...S. ...:...... S. ... &...... &...... &r...... &r......

SSSSSSSSSCE&SS&SSSSSSS&E&SSE8:38:S&SSSSSS: SSSSSSSSSSSSSSESSESSESSESE ... -----...--...-----...----- 8...... S.--.S.-----...-R.----...- ... R.----...--...-----...--...----...- ...

SSSSSSSSSSR&R&SS&sississis SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS cre. -- Sir race r. ------$... . S.-- S.--ir rester criter re. ------S

SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSIs: SSSSSSSSSSSSSSSSSSSSSS&&SSSSSSS&S&S -- a------Sax-a------& Sea. Six

& S. &S$$$:S&ESSSSSSSSSSSSSS&SSSSSS&SR388,838&S S &&.:38&S&S3&S&SSSSSS&&SS:SS&E&SS&S -8-- - - -Am Sr. -----...-a, -8-- - - -a-, --, -, Sr., Sr. ------8-mm. - - - - S ---Yo Si

K&ES&SE&S388&SE&SS3888SSSSSSSS Kiss&SS&S&SSSSSSSSSSSSSS&SSSSSSSS&SSSSSSSSSSSSS: ---...------...------...--S-...----...-----...------S-...------...----. ---.S.------...--S--.

S.SESSSSSSSSSSSX:SKEE&EE&SSSSS&S&SSSSS SSS38&S&S&SS&C&ESSE&SSSSSSSSSSSX&E88. cers cars creas is scrats rises cars creas rests car cases refers Saskar Sacres Sar as as cers arrassssss cers

&&.88&S$3.8&&.38:88&SC8:338&S$88.888&8 &SS388. SSESSESS&SSES&ESE&&E:3&SSS:8:SS&S&E& ran now arm was winn Sow were m n n n win a row or now on Six mSre now war man narran

SiSSSSSSSSSSSSSSSSSESSSSSSSSSSSSSSSSSSSS&&SS&ESSESSE&E SSSSSSSSSSSSSSSSSSSSSSS&SSSSSSKESESSEE&E ~ :- -8-S-S------~...~~~~.S.--S-S-- ~~~~~&s------&--S-S-S-- ~~

SESSSSSSS

FIG, 20B2 Patent Application Publication Feb. 18, 2016 Sheet 37 of 47 US 2016/0046955A1

FIG, 2OB3

Patent Application Publication Feb. 18, 2016 Sheet 39 of 47 US 2016/0046955 A1

4 B Wild type Construct 61 independent transgenic lines FIG.22A

PV rNA 4B Wild Type

FIG, 22B Patent Application Publication Feb. 18, 2016 Sheet 40 of 47 US 2016/0046955A1

100 cr. p-coumarate Ferulate

80 ------SGe.8 StG 22 p=0.005 SiGe 106

S G S G S G PMT RNAi 48 PMT RNAi 7A Wild Type Construct 61 lines

FIG. 23B Patent Application Publication Feb. 18, 2016 Sheet 41 of 47 US 2016/0046955 A1

YN (N

RS

Natasaaaaaaaaaaaaaaaaaaaaaaaataaaaaaaaaaiiaaaaaaaaaaaaaaaaaaaaaii.

'-kai.a.s.l...... i.d.------...--...------..i.a.s.l.i.a.s.l.i.a.s.l...s.l.i.a.l.i.a.s.l.....

Patent Application Publication Feb. 18, 2016 Sheet 42 of 47 US 2016/0046955A1

Citrus Sinensis (Orange1.1g014O78m; peptide SEQ ID NO:29; nucleic acid Sequence SEQ ID NO: 47) 991 gag CtaCCtgttgaatttgCtaagtaCatgaatggagattittaCC E L P V E F A K Y M N G D F T 1036 aggaacggtdagga CCCattCCCCCCaCCtCtggCttata CaaCa R N G E D P F A P P L A Y T T 1081 ttgtttatatoaga.gtggggaCgactgggattoaaccagattgaC L F I S E W G R L G F N Q. I D 1126 tatgggtgggg.cCCtCCtgtCCaC9tgg tacCaattcaaggCtCg Y G W G P P W H V V P I O G S 1171 agtattatto.cggttggCattgtgggttcgatgcc.gttgcCCaaa S I I P W G I

Sorghum bicolor (Sb10g 023160.1; peptide SEQ ID NO:30; nucleic acid sequence SEQ ID NO: 48) 1036 gCq.CggtggagCQCgggggaCaCCggCggCQ toga CCCG taCC9g A R W S A G D T G G W D P Y R 1081 at CaCQtcggaCtaCCggaCgCtgCtggtgtCGgaCtggtCGCgg I T S D Y R T L L V S D W S R 1126 CtCgggittCgCggaggtggaCtacgggtggggctgCCCC9tgCaC L G F A E W D Y G W G C P V H 1171 gtCdtcCCgCtCaCCaacCtCgaCtaCatCGCgaCgtgCatCCtg V V P L T N L. D Y I A T C I

Zea mays (GRMZM2G060210 TO1; peptide SEQ ID NO:31; nucleic acid sequence SEQ ID NO:49) 1036 gaggacqCCg a CCCCtaCCagatCaCCtCCQaCtaCCggaCq.Ctg E D A D P Y Q I T S D Y R T L 1081 CtggtgtcqgaCtggaCgCq.gCtgggCttCgCG gaggtggaCtaC L V S D W T R L G F A E W D Y 1126 ggCtggggCCCgCCCgCCCaC9tggtgCCgCtgaCgaacttggaC G W G P P A H V V P L T N L D 1171 tacatCGCCaCotgCatC

FIG. 25A Patent Application Publication Feb. 18, 2016 Sheet 43 of 47 US 2016/0046955A1

Bachypodium distachyon (Bradi4g.06067.1; peptide SEQ ID NO:32; nucleic acid sequence SEQ ID NO:50) 1036 ttaggaggaggaggggCtggggataagatgaagtttgtgCaggat L G G G G A G D K M K F W Q D 1081 gatcct tatgagctdaggtttgagcataatgtgttgtttgttgtcg D P Y E L R F E H N W. L. F W S 1126 gattggaCCaggCttgggttcttggaggtggaCtatggCtggggC D W T R L G E L E W D Y G W G 1171 gtgCCtagCCatgttataCCtttcaattatgcggaCtacatggCg V P S H W I P E N Y A D Y M. A 1216 gtCGCggtgctCGgtgctCCqCCggCgCCggtgaaggggaCtCgg W. A V

Oryza sativa (LOCOSO5g19910.1; peptide SEQ ID NO:33; nucleic acid sequence SEQ ID NO:51) 1036 ggggatgtgaaagttgatcCCtacgCattgaCatttgaacaCaat G D V K W D P Y A. L T E E H N 1081 gtgCtttttgtgtctgattggacqaggittaggattcttCqaggta W. L. F W S D W T R L G F F. E. W. 1126 gaCtatgggtggggtaCaCCtaatCaCatCataCCattoactitat D Y G W G T P N H I I P F T Y 1171 g CagaCtaCatgg CagtCGCagtgCttggtgCtCCaCCaatgCCa A D Y M A. W. A. V.

Panicum virgatum (Pavirv00015375m; peptide SEQ ID NO:34; nucleic acid sequence SEQ ID NO:52) 901 gggggattotatggcaactgcttctaccCagtttctgtgacggCC G G F Y G N C F Y P W S W T A 946 actgctgaggatgttgtcactgcagggittgcttgatgtgatcagg T A E D W W T A G L L D W I R 991 atgataaggaatgggaaggCCaggCttCCCCtggagttttCCaag M I R N G K. A R L P L E F S K 1036 togg CagCaggggatgtgagtgtggatCCataCCagttgaCattt W A A G D V S W D P Y O L T F 1081 gag CacaacgtgttgtttgttgtctgattggaCgagaCttgggttC E H N W. L. F W S D W T R L G F 1126 toCgaggttgactatogg togggtocaccqgatcatatogtocca S E W D Y G W G A P D H I W P 1171 ttCaCCtatgcagaCtaCatggCq.gtggCggttcttggggCtCCG F T Y. A D Y M A V A W

FIG, 25B Patent Application Publication Feb. 18, 2016 Sheet 44 of 47 US 2016/0046955A1

Sorghum bicolor (Sb08g.005680.1; peptide SEQ ID NO:35; nucleic acid sequence SEO ID NO:53) 1036 tttgCCaaatggtCCatgggtgatgtgaagg taga CCCatatoaa F A K W S M G D V K W D P Y O 1081 CtgaCattcaag CaCaatgttctgtttgttgtctgattggaCqagg L. T. F. K. H. N. W. L. F W S D W T R 1126 CttggattctttgaggttgactatoggtggggtgtaCCaaaCCat L. G E E E W D Y G W G W P N H 1171 atCataCCtttCaCttatgcagaCtaCatggCtgtag Cagttctt I I P F T Y. A D Y M A V A V

Zea mays (GRMZM2G130728 TO1; peptide SEQ ID NO:36; nucleic acid sequence SEQ ID NO:54) 1036 acgggcaatgtgaaagtag accCatatoaactaacattcaagCaC T G N V K W D P Y O L T F K H 1081 aatgttctatttgtgtCCgattggaCaC9gCttggattCtttgaa N V L. F W S D W T R L G F F E 1126 gttgactatogg togggtotaCCaaacCatatcCtCCCtttCact V D Y G W G W P N H I L. P. F. T 1171 tatgcagactaCatggCtgtag CagttcttggagctCCaCCgtCt Y A D Y M A V A. W.

Bachypodium distachyon (Bradi2.g36910.1; peptide SEQ ID NO:37; nucleic acid sequence SEQ ID NO:55) 1036 gCCaggCtggCoggggacqtggCOaggtogg CCG togg CGGOtto A R L A G D V A. R. W. A. W G G F 1081 gag CaggacCCCtacgagCtgaCCttCaCCtacgaCtCCCtCttC E O D P Y E L T F T Y D S L F 1126 gtgtC9gaCtggaCCaggCtgggCtttCtagaggcCgaCtaCggg W S D W T R L G F L E A D Y G 1171 togggg CCCCCggCCCaCtggtgCCCttCtcgitatCaCCCCttC W G P P A H V V P E S Y H P F 1216 atggCtgttgcCgtCatcggCgCaCCgCCCaagCCCaagCtcggC M A V A W

FIG. 25C Patent Application Publication Feb. 18, 2016 Sheet 45 of 47 US 2016/0046955A1

Oryza sativa (LOC OSO5g.04584.1; peptide SEQ ID NO:38; nucleic acid sequence SEQ ID NO:56) 1036 gtgggCgggittCgaggagga CCCCtacgagCtgaCCttCaCCtaC V G G F E E D P Y E L T F T Y 1081 gactCCCtcttCgtotCCgactggacgcggctcggCttcctagac D S L. F W S D W T R L G F L D 1126 gCCgactatggCtggggcacgCCgtCdCacqtCgtgCCgttctOC A D Y G W G T P S H. W. W P F S 1171 tacCaCCCgttCatggCCgtCGCCgtCatCq.gCgCgCCgCCggCg Y H P F M A V A V

Setaria italica (SiO22109m; peptide SEQ ID NO:39; nucleic acid sequence SEQ ID NO:57) 991 C9gCtggCCgCggaCttCgCgCggtgggCgggCggagggittCgag R. L. A. A D F A R W A G G G F E 1036 cqCgacCCctacgagctoaccttcacctacgactCgctOttogto R D P Y E L T F T Y D S L. F W 1081 toCgaCtogacqCq.gctCCQQttCCtggaggCqgaCtaCQQQ tog S D W T R L G F L E A D Y G W 1126 ggCacqCCq.g.cgcacgtCCtgCCCttctCqtacCaCCCCttCatg G T P A H W L P E S Y H P F M 1171 gCCgtCGCCqtCatcqgagCdCCgCCGg CqCCCaagCCCGgagCd A W A W

Panicum virgatum (Pavirv00037046m; peptide SEQ ID NO:40; nucleic acid sequence SEQ ID NO:58) 991 gCGCggtgggCggCGggCgggttCgagCQCgaCCCCtacgagCtC A R W A A G G F E R D P Y E L 1036 accttcagotacgacticgctCttcgtotCCGactggacgcggct T. F. S. Y D S L. F W S D W T R L. 1081 gggttcCtggaggCGgaCtacgggtgggg.cgCgCCggCdCacgtC G F L E A D Y G W G A P A H V 1126 gtgCCCttctoCtaCCaCCCCttCatggCCgtCgCCgtCatcqgC V P F S Y H P F M A V A V

FIG, 2.5D Patent Application Publication Feb. 18, 2016 Sheet 46 of 47 US 2016/0046955A1

Sorghum bicolor (Sb09g.002910.1; peptide SEQ ID NO:41; nucleic acid sequence SEQ ID NO:59) 1036 togg Cq.gCgggCgggtttgatCGggacCCCtacgagctCaCCttC W A A G G F D R D P Y E L T F 1081 acctacgaCtCCCtCttCqtctCCQactggacqaggCtagggittC T Y D S L. F W S D W T R L G F 1126 CtCgaggCtgaCtatggCtgggg CaCQCCgacgCaC9tCgtgCCg L E A D Y G W G T P T H W W P 1171 ttCtcqtacCaCCCqttCatggCCgtCGCCgtCatcgggg CQCCG F S Y H P F M A V A V

Zea mays (GRMZM2G028104 TO1; peptide SEQ ID NO:42; nucleic acid sequence SEQ ID NO: 60) 1036 gCggg.cggCttCgaCCgCgaCCCCtacgagctCaCCttCaCCtaC A G G F D R D P Y E L T F T Y 1081 gactCgctCttcgtotCCgactggacgc.gc.ctoggCttCctCgag D S L. F W S D W T R L G F L E 1126 gC9gaCtaC9gCtgggg CaCCCC9aCaCaC9tcCtgCCCttCtCC A D Y G W G T P T H W L P F S 1171 taCCaCCCCttCatggCCgtCGCCqtcatCdgCdCCCCCCCtaag Y H P F M A V A V

Setaria italica (SiO05037m; peptide SEQ ID NO:43; nucleic acid sequence SEQ ID NO: 61) 1036 CCggCggagttcgCgCggtgggCggCgggggagCtCgtC9gggtC P A E F A R W A A G E L W G V 1081 gaggacCCCtacq agCto CCqttCQCqtacgaggCQCtattogto E D P Y E L P F A Y E A L. F V 1126 toggactggaCgCggCttgggttcCaggaag.cggaCtaCgggtgg S D W T R L G F O E A D Y G W 1171 ggtgggCCttCCCacqtgataCCtttggCttatcacCCgCacatg G G P S H W I P L A Y H P H M 1216 CCCatCgCCatC9tCggtgCaCCgCCggCgCCaC9gatgggggtC P I A I

FIG. 25E Patent Application Publication Feb. 18, 2016 Sheet 47 of 47 US 2016/0046955A1

Oryza sativa (LOC OS 01g18744.1; peptide SEQ ID NO:44; nucleic acid sequence SEQ ID NO: 62) 1036 ttCgCdCq.gtgggCq.gtggCCqaCttCagg gaggatCCCtaCCag F A R W A V A D F R E D P Y E 1081 CtgagcttCaC9taCqattCCCtgttcgtCtCCCaCtggacgCgg L S F T Y D S L. F W S D W T R 1126 CtggggttCCtggagg CogactacgggtgggggcCGCCGtcgCaC L G F L E A D Y G W G P P S H 1171 gtCatacCCttcqCg tactaccCqttcatggCCgtogcCatcatC W I P E A Y Y P F M A V A I

Setaria italica (Si004231m; peptide SEQ ID NO:45; nucleic acid sequence SEQ ID NO: 63) 1036 CtcgtggagaaggacCCCtacgagCtgaCCttittCgtacgagtCG L V E K D P Y E L T F S Y E S 1081 CtgttcgtgtC9gaCtggaCCCggCtggggittCCtggaCgCtgaC L. F W S D W T R L G F L D A D 1126 tacggCtgggggaCqCCgttgCaggtgata CCCtttacgtaCCaC Y G W G T P L Q W I P F T Y H 1171 CCGgcCatgCCCatCGCCatcatCagCdCgCCgCCggCgCCCaag P A M P I A I

Panicum virgatum (PavirvOOO66580m; peptide SEQ ID NO:46; nucleic acid sequence SEQ ID NO: 64) 829 gCGCggCtCCCCgCCgagttcgCgCq.gtgggCggCgggCgagCtC A R L P A E, F A R W A A G E L 874 gtgg.cgcaggaccCCtacgagctgagcttcacgtacgagtcgctg V. A. O. D P Y E L S F T Y E S L 919 ttCgtgtCGgaCtggacqCggCtggggttcCtggaggCggaCtaC F V S D W T R L G F L E A D Y 964 ggCtgggg CaCQCCggagCaggtgataCCCttCgCgtaCCaCCCg G W G T P E O V I P F A Y H P 1009 to CatgCCCatCdCq.gtCatcq gCCCgCCgCCggCqCCCaagacg C M P I A W I

FIG. 25F US 2016/0046955 A1 Feb. 18, 2016

P-COUMAROYL-COAMONOLGNOL incorporated into the plants lignins, generating a plant with TRANSFERASE lignin that is even more readily cleavable than a plant that 0001. This application claims benefit of the filing date of expresses feruloyl-CoA:monolignol transferase without inhi U.S. Provisional Application Ser. No. 61/576,515, filed Dec. bition of p-coumaroyl-CoA:monolignol transferase. 16, 2011, the contents of which are specifically incorporated 0008. One aspect of the invention is a transgenic plant with herein by reference in their entirety. a knockdown or knockout of the plant's endogenous p-cou 0002 This application is related to U.S. Patent Applica maroyl-CoA:monolignol transferase gene. The plant can also tion Ser. No. 61/366,977, filed Jul 23, 2010, and PCT/ have a feruloyl-CoA:monolignol transferase nucleic acid US2011/044981, filed Jul. 22, 2011, the contents of both of operably linked to a promoter functional in cells of the trans which are specifically incorporated herein by reference in genic plant. For example, the feruloyl-CoA:monolignol their entireties. This application is also related to published transferase nucleic acid can be a transgene or recombinant U.S. patent application Ser. No. 12/830,905, filed Jul. 6, 2010 nucleic acid introduced into the plant. Hence, the plant with and to U.S. Patent Application Ser. No. 61/213,706, filed Jul. the knockdown or knockout of the plant's endogenous p-cou 6, 2009, the contents of both of which are specifically incor maroyl-CoA:monolignol transferase gene can express feru porated herein by reference in their entireties. loyl-CoA:monolignol transferase. Such an endogenous 0003. This invention was made with government support p-coumaroyl-CoA:monolignol transferase gene can hybrid from Grant No. DE-FC02-07ER64494 awarded by the U.S. ize to a nucleic acid with a sequence selected from the group Department of Energy, Office of Biological and the Environ consisting of SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, mental Research (BER) Office of Science. The government 47-63 and 64. Such an endogenous p-coumaroyl-CoA:mono has certain rights in the invention. lignol transferase gene can have at least 50% sequence iden tity with a nucleic acid sequence selected from the group BACKGROUND OF THE INVENTION consisting of SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 0004 Lignin is an important cell wall component that 47-63 and 64. provides structural Support to plants and is needed for plant 0009. The knockdown or knockout of the plants endog vascular tissue function. It is one of the most abundant enous p-coumaroyl-CoA:monolignol transferase gene can be organic polymers on Earth, constituting about 30% of non a mutation selected from the group consisting of a point fossil organic carbon and from a quarter to a third of the dry mutation, a deletion, a missense mutation, insertion or a non mass of wood. Because the chemical structure of lignin is sense mutation in the endogenous p-coumaroyl-CoA:mono difficult to degrade by chemical and enzymatic means, lignin lignol transferase gene. Such a knockdown or knockout muta makes the task of producing paper and biofuels from plant tion can, for example, be a point mutation, a deletion, a cell walls difficult. missense mutation, insertion or a nonsense mutation in the 0005. Therefore, researchers continue to search for prod endogenous p-coumaroyl-CoA:monolignol transferase gene, ucts and processes that will enable humans to effectively where the gene encodes a polypeptide with at least 60% control insects or modify their behavior without negative sequence identity to an amino acid sequence selected from effects. the group consisting of SEQID NO: 17, 24, 29-45 and 46. 0010. The knockdown or knockout of the plants endog SUMMARY OF THE INVENTION enous p-coumaroyl-CoA:monolignol transferase gene can 0006. The invention relates to increasing the amount of also be mediated by expression of at least one inhibitory monolignol ferulates in plant lignins, to generate biomass that nucleic acid comprising a nucleic acid sequence with at least contains readily cleavable lignin. Lignins that contain mono 90% sequence identity to either strand of a nucleic acid com lignol ferulates are more readily cleaved than lignins that prising a sequence selected from the group consisting of SEQ contain other types of monolignols such as p-coumarate con ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64. jugates. According to the invention, inhibition or reduction of the activity of a newly isolated acyltransferase, called the 0011 Such knockdown or knockout of the plant's endog p-coumaroyl-CoA:monolignol transferase (also called PMT. enous p-coumaroyl-CoA:monolignol transferase gene or a monolignol coumarate transferase) can improve the reduces acylation of monolignols with p-coumarate. For incorporation of monolignol ferulates into lignins, yielding a example, the knockdown or knockout can reduce acylation of plant with lignin that is even more readily processed into monolignols with p-coumarate, where the monolignols are useful products such as paper and biofuels. selected from the group consisting of p-coumaryl alcohol, 0007. The p-coumaroyl-CoA:monolignol transferase coniferyl alcohol and sinapyl alcohol. The knockdown or gene is newly isolated and produces monolignol p-coumarate knockout can reduce acylation of monolignols with p-couma conjugates, which are a part of plant lignins. Applicants co rate by at least by 10%, or by at least by 20%, or by at least by pending U.S. Patent Application Ser. Nos. 61/366,977. 30%, or by at least by 40%, or by at least by 50%, or by at least 61/213,706, 12/830,905, PCT/US2011/044981, describe iso by 60%, or by at least by 70%, or by at least by 80%, or by at lation and use of the feruloyl-CoA:monolignol transferase least by 90%. (FMT, also called a monolignol ferulate transferase) nucleic 0012 Such transgenic plants can have a feruloyl-CoA: acids and enzymes that incorporate ferulates (not p-couma monolignol transferase nucleic acid encoding an amino acid rates) into plant lignin, to yield alignin has an altered struc sequence selected from the group consisting of SEQ ID ture/content and is more easily and economically processed NO:2, 9, 20 and 21. The feruloyl-CoA:monolignol trans into useful products Such as biofuels and paper. When p-cou ferase nucleic acid can be operably linked to a promoter maroyl-CoA:monolignol transferase expression or activity is selected from the group consisting of a poplar xylem-specific inhibited in a plant that expresses feruloyl-CoA:monolignol secondary cell wall specific cellulose synthase 8 promoter, transferase, greater amounts of monolignol ferulates are cauliflowermosaic virus promoter, Z10 promoter from a gene US 2016/0046955 A1 Feb. 18, 2016

encoding a 10 kD Zein protein, Z27 promoter from a gene 0019. Another aspect of the invention is a method of incor encoding a 27 kD Zein protein, pea rbcS gene, or anactin porating monolignol ferulates into lignin of a plant compris promoter from rice. 1ng: 0013 The transgenic plant can be plant from a variety of 0020 a) obtaining one or more plant cells stably trans species. For example, the transgenic plant can be a grass formed with a feruloyl-CoA:monolignol transferase species. The transgenic plant species can be selected from the nucleic acid operably linked to a promoter to generate at species consisting of Miscanthus giganteus, Panicum virga least one transformed plant cell; tum (Switchgrass), Zea mays (corn), Oryza sativa (rice), Sac 0021 b) mutating the at least transformed plant cell to charum sp. (Sugar cane), Triticum sp. (wheat), Avena sativa generate at least one transformed mutant plant cell with (oats), Pennisetum glaucum (pearl millet), Setaria italica a knockout or knockdown mutation of the plant cells (foxtail millet), Sorghum sp. (e.g., Sorghum bicolor), Bam endogenous p-coumaroyl-CoA:monolignol transferase buseae species (bamboo), Sorghastrum nutans (indiangrass), gene. Tripsacum dactyloides (eastern gamagrass), Andropogon 0022 c) regenerating one or more of the transformed gerardi (big bluestem), Schizachyrium scoparium (little mutant plant cells into at least one transgenic plant. bluestem), Bouteloua curtipendula (Sideoats grama), Sil The endogenous p-coumaroyl-CoA:monolignol transferase phium terebinthinaceum (prairie rosinweed), Pseudoroegn genes can hybridize to a nucleic acid with a sequence selected eria spicata (bluebunch wheatgrass) Sorghum bicolor (sor from the group consisting of SEQID NO:16, 18, 19, 22, 23, ghum) and Bachypodium distachyon (purple false brome). 25, 26, 27, 28, 47-63 and 64. For example, the endogenous 0014. Such transgenic plants can be fertile. One or more p-coumaroyl-CoA:monolignol transferase gene has at least seeds can be collected from Such transgenic plants. Hence, 50% sequence identity, with a nucleic acid sequence selected the invention provides transgenic seeds, plant cells and from the group consisting of SEQID NO:16, 18, 19, 22, 23, plants. 25, 26, 27, 28, 47-63 and 64. 0015. Another aspect of the invention is an inhibitory 0023. A method of inhibiting expression and/or transla nucleic acid that includes a DNA or RNA comprising a tion of p-coumaroyl-CoA:monolignol transferase RNA in a nucleic acid sequence with at least 90% sequence identity to plant cell comprising: either strand of a nucleic acid comprising a sequence selected 0024 a) contacting or transforming plant cells with an from the group consisting of SEQID NO:16, 18, 19, 22, 23, expression cassette to generate transformed plant cells, 25, 26, 27, 28, 47-63 and 64. Another aspect of the invention wherein the expression cassette comprises a segment is an expression cassette that includes a nucleic acid segment encoding at least one inhibitory nucleic acid with encoding the inhibitory nucleic acid operably linked to a nucleic acid sequence with at least 90% sequence iden promoter functional in a host cell. Another aspect of the tity to either strand of a nucleic acid comprising a invention is an isolated cell includes Such an inhibitory sequence selected from the group consisting of SEQID nucleic acid or such an expression cassette. The isolated cell NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64; and can be a microorganism or a plant cell. For example, the 0.025 b) regenerating the transformed plant cells into at isolated cell can be a grass plant cell. Other examples of least one transgenic plant, wherein an inhibitory nucleic species include plant cells selected from the species consist acid is adapted to inhibit the expression and/or transla ing of Miscanthus giganteus, Panicum virgatum (Switch tion of a p-coumaroyl-CoA:monolignol transferase grass), Zea mays (corn), Oryza sativa (rice), Saccharum sp. mRNA is expressed in at least one transgenic plant in an (Sugar cane), Triticum sp. (wheat), Avena sativa (oats), Pen amount Sufficient to incorporate monolignol ferulates nisetum glaucum (pearl millet), Setaria italica (foxtail mil into the lignin of the transgenic plant. let), Sorghum sp. (e.g., Sorghum bicolor), Bambu.seae species The plant cells in such a method can be stably transformed (bamboo), Sorghastrum nutans (indiangrass), Tripsacum with a feruloyl-CoA:monolignol transferase nucleic acid dactyloides (eastern gamagrass), Andropogon gerardii (big operably linked to a promoter. bluestem), Schizachyrium scoparium (little bluestem), 0026. Another aspect of the invention is an isolated Bouteloua curtipendula (Sideoats grama), Silphium terebin nucleic acid encoding a p-coumaroyl-CoA:monolignol trans thinaceum (prairie rosinweed), Pseudoroegneria spicata ferase, wherein the nucleic acid can selectively hybridize to a (bluebunch wheatgrass), Sorghum bicolor (sorghum), and DNA or RNA with any of the SEQID NO:16, 18, 19, 22, 23, Bachypodium distachyon (purple false brome). A transgenic 25, 26, 27, 28, 47-63 and 64 sequences. For example, in some plant can be generated from or include Such isolated cells. embodiments, the nucleic acid can selectively hybridize to a 0016. Another aspect of the invention is a method of incor DNA or RNA with any of the SEQID NO:16, 18, 19, 22, 23, porating monolignol ferulates into lignin of a plant compris 25, 26, 27, 28, 47-63 and 64 sequences under physiological 1ng: conditions. In other embodiments, the nucleic acid can selec 0017 a) obtaining one or more plant cells having a tively hybridize to a DNA or RNA with any of the SEQ ID knockout or knockdown of the plant cells' endogenous NO:16, 18, 19, 22,23, 25, 26, 27, 28,47-63 and 64 sequences p-coumaroyl-CoA:monolignol transferase gene; under stringent hybridization conditions. In some embodi 0018 b) regenerating one or more of the plant cells into ments, the Stringent hybridization conditions comprise a at least one transgenic plant. wash in 0.1xSSC, 0.1% SDS at 65° C. Such an isolated The method can include stably transforming the one or more nucleic acid can have at least about 90% sequence identity plant cells with an expression cassette comprising a feruloyl with any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, CoA:monolignol transferase nucleic acid operably linked to a 47-63 and 64 sequences. In some embodiments, the isolated promoter to generate one or more transformed plant cells with nucleic acid with any of the SEQID NO:16, 18, 19, 22, 23, 25, the endogenous p-coumaroyl-CoA:monolignol transferase 26, 27, 28, 47-63 and 64 sequences encodes a rice p-couma knockout or knockdown mutation, before regenerating the royl-CoA:monolignol transferase, for example, an Oryza cells into at least one transgenic plant. sativa p-coumaroyl-CoA:monolignol transferase. US 2016/0046955 A1 Feb. 18, 2016

0027. In some embodiments, the p-coumaroyl-CoA: sequences, or any complement thereof, under physiological monolignol transferase nucleic acid encodes a p-coumaroyl conditions present in a plant in vivo. The expression cassette CoA:monolignol transferase polypeptide that includes a SEQ can further comprise a selectable marker gene. In some ID NO:17, 24, 29-45 or 26 sequence. In other embodiments, embodiments, the expression cassette further comprises plas the nucleic acids can, for example, encode a p-coumaroyl mid DNA. For example, the expression cassette can be within CoA:monolignol transferase that can catalyze the synthesis an expression vector. Promoters that can be used within such of monolignol p-coumarate(s) from a monolignol(s) and expression cassettes include promoters functional during p-coumaroyl-CoA with at least about 50%, of the activity of plant development or growth. a p-coumaroyl-CoA:monolignol transferase with the SEQID 0034. Another aspect of the invention is a plant cell that NO:17, 24, 29-45 or 26. includes an expression cassette comprising one of the feru 0028 Such p-coumaroyl-CoA:monolignol transferases loyl-CoA:monolignol transferase nucleic acids described can catalyze the synthesis of monolignol p-coumarates from herein that is operably linked to a promoter functional in a monolignol(s) and p-coumaroyl-CoA. For example, the host cell. Such as a plant cell. Such a nucleic acid can be a monolignol can be coniferyl alcohol, p-coumaryl alcohol, nucleic acid that can selectively hybridize to a DNA with Sinapyl alcohol or a combination thereof, and the p-couma either or both of the SEQID NO:1 and 8 sequences. In some royl-CoA:monolignol transferase can, for example, synthe embodiments, the plant cell can also include an expression size coniferyl p-coumarate, p-coumaryl p-coumarate, Sinapyl cassette comprising any of the mutating or inhibitory nucleic p-coumarate or a combination thereof. acids described herein, wherein the mutating or inhibitory 0029. As described in more detail herein, the p-couma nucleic acid(s) is operably linked to a promoter functional in royl-CoA:monolignol transferase nucleic acids and polypep a host cell. The plant cell can have an endogenous p-couma tides produce monolignol p-coumarates that can compete royl-CoA:monolignol transferase gene knockdown or knock with monolignol ferulates for incorporation into lignin. How out, so that little or no functional PMT enzyme is synthesized ever, lignin that contains monolignol ferulates is more readily by the plant cell. The plant cell can be a monocot cell. The cleavable than lignin that contains little or no monolignol plant cell can also be a gymnosperm cell. For example, the ferulates. As described herein, plants with increased percent ages of monolignol ferulates can be generated by inhibiting plant cell can be a maize, grass or Softwood cell. In some the expression or activity of p-coumaroyl-CoA:monolignol embodiments, the plant cell is a dicot cell. For example, the transferase. plant cell can be a hardwood cell. 0030. One aspect of the invention is a transgenic plant cell, 0035 Another aspect of the invention is a plant that plant or seed comprising a p-coumaroyl-CoA:monolignol includes an expression cassette comprising one of the feru transferase knockdown mutation. For example, Such a knock loyl-CoA:monolignol transferase nucleic acids described down mutation can be generated by recessive gene disruption herein that is operably linked to a promoter functional in a and dominant gene silencing. host cell. Such as a plant cell. The plant can have an endog 0031. Another aspect of the invention is a transgenic plant enous p-coumaroyl-CoA:monolignol transferase gene cell comprising a mutating or an inhibitory nucleic acid knockdown or knockout, so that little or no functional PMT capable of hybridizing to a p-coumaroyl-CoA:monolignol enzyme is synthesized by the plant cell. Such a feruloyl-CoA: transferase nucleic acid underplant physiological conditions. monolignol transferase nucleic acid can be a nucleic acid that The nucleic acid can include a sequence that is homologous or can selectively hybridize to a DNA with either or both of the complementary to the p-coumaroyl-CoA:monolignol trans SEQ ID NO:1 and 8 sequences. In some embodiments, the ferase nucleic acid sequences described herein. For example, plant can also include an expression cassette comprising any the mutating or the inhibitory nucleic acid can selectively of the inhibitory nucleic acids described herein, wherein the hybridize to a DNA or RNA with any of the SEQID NO:16, inhibitory nucleic acid(s) is operably linked to a promoter 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences (or a functional in a host cell. Such a plant can be a monocot. The sequence complementary to any of the SEQ ID NO:16, 18, plant can also be a gymnosperm. For example, the plant can 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences) under be a maize, grass or Softwood plant. In some embodiments, physiological conditions present in a plant in vivo. the plant is a dicot plant. For example, the plant can be a 0032. Another aspect of the invention is a transgenic plant hardwood plant. cell comprising a mutating or an inhibitory nucleic acid 0036) Another aspect of the invention is a plant seed that adapted to hybridize to a p-coumaroyl-CoA:monolignol includes an expression cassette comprising one of the feru transferase nucleic acid. The nucleic acid can include a loyl-CoA:monolignol transferase nucleic acids described sequence that is homologous or complementary to the p-cou herein that is operably linked to a promoter functional in a maroyl-CoA:monolignol transferase nucleic acid sequences host cell. Such as a plant cell. The plant seed can have an described herein. For example, the mutating or inhibitory endogenous p-coumaroyl-CoA:monolignol transferase gene nucleic acid selectively hybridizes to a DNA or RNA with any knockdown or knockout, so that little or no functional PMT of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and enzyme is synthesized by a plant grown from the seed. Such 64 sequences (or any complement thereof) under physiologi a feruloyl-CoA:monolignol transferase nucleic acid can be a cal conditions present in a plant in vivo. nucleic acid that can selectively hybridize to a DNA with 0033. Another aspect of the invention is an expression either or both of the SEQID NO:1 and 8 sequences. In some cassette comprising one of the mutating or inhibitory nucleic embodiments, the plant seed can include an expression cas acids described herein, where the mutating or inhibitory sette comprising any of the inhibitory nucleic acids described nucleic acid is operably linked to a promoter functional in a herein, wherein the inhibitory nucleic acid(s) is operably host cell. Such a nucleic acid can be a nucleic acid that can linked to a promoter functional in a host cell. Such a plant selectively hybridize to a DNA or RNA with any of the SEQ seed can be a monocot. The plant seed can also be a gymno ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sperm. For example, the plant seed can be a maize, grass or US 2016/0046955 A1 Feb. 18, 2016

Softwood plant seed. In some embodiments, the plant seed is Such stable transformation can increase incorporation of a dicot plant. For example, the plant seed can be a hardwood monolignol ferulates into the lignin of the transgenic plant, plant seed. for example, by at least by 1%, or by at least 2%, or by at least 0037 Another aspect of the invention is a method for 3%, or by at least 5% relative to the control plant that has not incorporating monolignol ferulates into lignin of a plant that been stably transformed with the mutating or inhibitory includes: nucleic acid. Such an inhibitory nucleic acid can, for 0038 a) obtaining one or more plant cells each having a example, be a nucleic acid that can selectively hybridize to knockout or knockdown of the plant cells' endogenous any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 p-coumaroyl-CoA:monolignol transferase gene; and 64 sequences. In some embodiments, the method can also 0039 b) stably transforming the one or more plant cells include stably transforming the plant cells with an expression with an expression cassette comprising feruloyl-CoA: cassette comprising any of the feruloyl-CoA:monolignol monolignol transferase nucleic acid to generate one or transferase nucleic acids described herein that are operably more transformed plant cells; linked to a promoter functional in a host cell. 0040 c) regenerating one or more of the transformed 0046 Such methods can be used to generate transgenic plant cells into at least one transgenic plant, plants that are fertile. The method can further include recov 0041 wherein the knockout or knockdown of the ering transgenic seeds from the transgenic plants, wherein the plant cells endogenous p-coumaroyl-CoA:monoli transgenic seeds include the mutating or inhibitory nucleic gnol transferase gene increases incorporation of acid, and/or the nucleic acid encoding a feruloyl-CoA:mono monolignol ferulates into the lignin of at least one of lignol transferase. The plant so generated can contain mono the transgenic plants compared to a control plant that lignol ferulates within its lignin. does not have such a knockout or knockdown but is 0047 Another aspect of the invention is a method for stably transformed with the expression cassette com incorporating monolignol ferulates into lignin of a plant that prising feruloyl-CoA:monolignol transferase nucleic includes: acid. 0.048 a) stably transforming plant cells with the expres The knockout or knockdown of the plant or plant cells sion cassette comprising one of the feruloyl-CoA:mono endogenous p-coumaroyl-CoA:monolignol transferase gene lignol transferase nucleic acids described herein togen can increase incorporation of monolignol ferulates into the erate transformed plant cells; lignin of a plant, for example, by at least by 1%, or by at least 0049 b) regenerating the transformed plant cells into at 2%, or by at least 3%, or by at least 5% relative to the control least one transgenic plant, whereinferuloyl-CoA:mono plant. The endogenous p-coumaroyl-CoA:monolignol trans lignol transferase is expressed in at least one transgenic ferase gene can, for example, selectively hybridize to a plant in an amount Sufficient to incorporate monolignol nucleic acid with any of the SEQID NO:16, 18, 19, 22,23, 25, ferulates into the lignin of the transgenic plant. 26, 27, 28, 47-63 and 64 sequences. The endogenous p-cou For example, such a nucleic acid can be a nucleic acid that can maroyl-CoA:monolignol transferase gene can, for example, selectively hybridize to a DNA with either or both of the SEQ have a percentage of sequence identity with a nucleic acid ID NO:1 and 8 sequences. The plant cells can have a knockout having any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, or knockdown of the plant cells endogenous p-coumaroyl 28, 47-63 and 64 sequences, such as at least 40% sequence CoA:monolignol transferase gene. In some embodiments, the identity, at least 45% sequence identity, at least 50% sequence method can also include stably transforming the plant cells identity, at least 55% sequence identity, at least 60% sequence with an expression cassette comprising any of the inhibitory identity, at least 65% sequence identity, at least 70% sequence nucleic acids described herein, wherein the inhibitory nucleic identity, at least 75% sequence identity, at least 80% sequence acid(s) is operably linked to a promoter functional in a host identity, at least 85% sequence identity, at least 90% sequence cell. Such a method can be used to generate a transgenic plant identity, at least 95% sequence identity, or at least 97% that is fertile. The method can further include recovering sequence identity with a nucleic acid having any of the SEQ transgenic seeds from the transgenic plant, wherein the trans ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 genic seeds include the nucleic acid encoding a feruloyl Sequence. CoA:monolignol transferase. 0042 Another aspect of the invention is a method for 0050. The method for incorporating monolignol ferulates incorporating monolignol ferulates into lignin of a plant that into lignin of a plant can also include breeding the fertile includes: transgenic plant to yield a progeny plant, where the progeny 0043 a) stably transforming one or more plant cells plant has an increase in the percentage of monolignol feru with any of the mutating nucleic acids described herein lates in the lignin of the progeny plant relative to the corre or with an expression cassette comprising any of the sponding untransformed plant. inhibitory nucleic acids described herein (e.g., a mutat 0051. Another aspect of the invention is a lignin isolated ing or an inhibitory nucleic acid adapted to hybridize to from the transgenic plant that has a knockout or knockdown a p-coumaroyl-CoA:monolignol transferase nucleic of the plant's endogenous p-coumaroyl-CoA:monolignol acid) to generate transformed plant cells; transferase gene and/or any of the feruloyl-CoA:monolignol 0044 b) regenerating the transformed plant cells into at transferase isolated nucleic acids described herein. The plant least one transgenic plant, from which the lignin is obtained can have any of the inhibi 0045 wherein the mutating nucleic acid or the inhibi tory of mutating nucleic acids described herein. Lignin in tory nucleic acid inhibits expression of a p-coumaroyl Such a plant can include at least 1% monolignol ferulate. In CoA:monolignol transferase nucleic in at least one other embodiments, the lignin in the plant can include at least transgenic plant in an amount Sufficient to incorporate 2% monolignol ferulate, or at least 5% monolignol ferulate, monolignol ferulates into the lignin of the transgenic or at least 10% monolignol ferulate, or at least 10% monoli plant. gnol ferulate, or at least 20% monolignol ferulate, or at least US 2016/0046955 A1 Feb. 18, 2016

25% monolignol ferulate. In further embodiments, the lignin the like. For example, the plant, plant cell or seed can also be in the plant includes about 1-30% monolignol ferulate, or any of the grass species or strains recited in FIG. 20 or Table about 2-30% monolignol ferulate. 2. 0052 Another aspect of the invention is a method of mak DESCRIPTION OF THE DRAWINGS ing a product from a transgenic plant comprising: (a) provid ing a transgenic plant that has a knockout or knockdown of the 0055 FIGS. 1A1, 1A2, 1B1 and 1B2 illustrate structural plant's endogenous p-coumaroyl-CoA:monolignol trans models for some types of lignin polymers. FIGS. 1A1 and ferase gene and/or that includes an isolated nucleic acid that 1A2 show examples of lignin structures with 25 units that encodes a feruloyl-CoA:monolignol transferase; and (b) pro may be found in a softwood (spruce). FIGS. 1B1 and 1B2 cessing the transgenic plant's tissues under conditions suffi show examples of lignin structures with 20 units that may be cient to digest to the lignin; to thereby generate the product present in a hardwood (poplar). Ralph, J., Brunow, G., and from the transgenic plant, wherein the transgenic plants tis Boerjan, W. (2007) Lignins. In: Rose, F., and Osborne, K. Sues comprise lignin having an increased percent of monoli (eds). Encyclopedia of Life Sciences, DOI: 10.1002/ gnol ferulates relative to a corresponding untransformed 9780470015902.a0020104, John Wiley & Sons, Ltd., Chich plant. The transgenic plant can have a mutating and/or an ester, UK. The softwood lignin is generally more branched inhibitory nucleic acid to knockout or knockdown of the and contains a lower proportion of B-ether units. Note that plant's endogenous p-coumaroyl-CoA:monolignol trans each of these structures represents only one of billions of ferase gene. The corresponding untransformed plant can be a possible isomers Ralph, J., Lundquist, K., Brunow, G., Lu, plant of the same species, strain and/or accession as the trans F., Kim, H., Schatz, P. F., Marita, J. M., Hatfield, R. D., Ralph, formed plant. The conditions Sufficient to digest to the lignin S. A., Christensen, J. H., and Boerjan, W. Lignins: natural can include conditions sufficient to cleave ester bonds within polymers from oxidative coupling of 4-hydroxyphenylpro monolignol ferulate-containing lignin. In some embodi panoids. (2004) Phytochem. Revs. 3(1), 29-60. Thus, these ments, the conditions sufficient to digest to the lignin include structures are merely illustrative of some of the linkage types mildly alkaline conditions. In some embodiments, the condi that may be present different lignins. An “S” within a ring tions sufficient to digest to the lignin include contacting the indicates a syringyl unit while a “G” within a unit indicates a transgenic plant's tissues with ammonia for a time and a guaiacyl unit. temperature sufficient to cleave ester bonds within monoli 0056 FIG. 2A-2B show HPLC traces of assay mixtures gnol ferulate-containing lignin. In some embodiments, the generated to test for feruloyl-CoA:monolignol transferase conditions sufficient to digest to the lignin would not cleave activity using coniferyl alcohol and feruloyl-CoA as sub substantially any of the ether and carbon-carbon bonds in Strates. The UV 340 trace is the dashed line while the UV 280 lignin from a corresponding plant that does not contain the trace is the solid line. FIG. 2A is a no enzyme control assay isolated nucleic acid encoding the feruloyl-CoA:monolignol while FIG. 2B shows the HPLC-separated assay results when transferase. the feruloyl-CoA:monolignol transferase enzyme from Angelica sinensis is present in the assay mixture. The peaks 0053. Therefore, the invention embraces mutating nucleic are numbered to distinguish the separated components of the acids and nucleic acids encoding an inhibitory nucleic acid assay as follows: 1) coniferyl alcohol (at about 4.4 min); 2) adapted to inhibit the expression and/or translation of p-cou feruloyl-CoA (at about 5.4 min); 3) ferulic acid (about about maroyl-CoA:monolignol transferase nucleic acids, as well as 6.0 min); and 4) coniferyl ferulate (at about 9.8 min) expression cassettes, plant cells and plants that have Such 0057 FIG. 3A-3B illustrate the NMR identification of inhibitory nucleic acids, and methods of making and using coniferyl ferulate (CAFA). FIG. 3A shows the assigned pro Such nucleic acids. The mutating nucleic acids and/or the ton NMR spectrum of the product isolated from a reaction of inhibitory nucleic acids can be made and/or used in conjunc coniferyl alcohol and feruloyl-CoA using the feruloyl-CoA: tion with feruloyl-CoA:monolignol transferase nucleic acids monolignol transferase from Angelica sinensis. FIG. 3B is a to improve the incorporation of monolignol ferulates into 2D 'H-C correlation (HSQC) spectrum of the same pro plant lignins. Alternatively, the plant cells having a knockout duced coniferyl ferulate, further authenticating the product; or knockdown of the plant cells endogenous p-coumaroyl the tabulated 'C NMR data are from the 1D C NMR CoA:monolignol transferase gene can be stably transformed spectrum with the quaternary (non-protonated) carbons with feruloyl-CoA:monolignol transferase nucleic acids to assigned by long-range H-C correlation (HMBC) spectra improve the incorporation of monolignol ferulates into plant (not shown). These spectra (and proton and carbon data) lignins. match those from authentic (synthesized) coniferyl ferulate. 0054. In some embodiments, the plant, plant cell or seed 0.058 FIG. 4A-4B shows HPLC separation of assay com produced or used in the methods described herein is a grass ponents where the assay was for feruloyl-CoA:monolignol species such as a Miscanthus giganteus, Panicum virgatum transferase (FMT) activity using feruloyl-CoA and p-cou (Switchgrass), Zea mays (corn), Oryza sativa (rice), Saccha maryl alcohol as substrates. The UV 340 trace is the dashed rum sp. (Sugar cane), Triticum sp. (wheat), Avena sativa line while the UV 280 trace is the Solid line. FIG. 4A shows (oats), Pennisetum glaucum (pearl millet), Setaria italica the results of a no-enzyme control assay while FIG. 4B shows (foxtail millet), Sorghum sp. (e.g., Sorghum bicolor), Bam the results of the assay with the feruloyl-CoA:monolignol buseae species (bamboo), Sorghastrum nutans (indiangrass), transferase from Angelica sinensis. The peaks are numbered Tripsacum dactyloides (eastern gamagrass), Andropogon to distinguish the separated components of the assay as fol gerardi (big bluestem), Schizachyrium scoparium (little lows: 1) p-coumaryl alcohol (at about 3.5 min), 2) feruloyl bluestem), Bouteloua curtipendula (Sideoats grama), Sil CoA (at about 5.5 min), and 3) p-coumaryl ferulate (at about phium terebinthinaceum (prairie rosinweed), Pseudoroegn 9.0 min). eria spicata (bluebunch wheatgrass), Sorghum bicolor (sor 0059 FIG. 5A-5B shows HPLC separation of assay com ghum), Bachypodium distachyon (purple false brome), and ponents where the assay was for feruloyl-CoA:monolignol US 2016/0046955 A1 Feb. 18, 2016

transferase (FMT) activity using sinapyl alcohol and feruloyl illustrates the results obtained from a poplar leaf extract FMT CoA as substrates. The UV 340 trace is the dashed line while enzyme assay. UPLC traces are of control and transgenic the UV 280 trace is the Solid line. FIG. 5A shows the results Poplar leaf extracts, where the transgenic Poplar trees express of a no-enzyme control assay while FIG.5B shows the results the YFP-FMT from Angelica sinensis. The absorbance of the of the assay with the feruloyl-CoA:monolignol transferase substrates coniferyl alcohol (1) and feruloyl-CoA (2) are from Angelica sinensis. The peaks are numbered to distin shown along with the FMT product, coniferyl ferulate (3), guish the separated components of the assay as follows: 1) was detected at 280 nm (solid line) and 340 nm (dotted line). sinapyl alcohol (at about 4.4 min); 2) feruloyl-CoA (at about The top panel shows results obtained for wild-type Poplar leaf 5.5 min); and 3) sinapyl ferulate (at about 9.4 min). extracts (containing no Angelica sinensis FMT nucleic acids) 0060 FIG. 6A-6B shows HPLC separation of assay com while the bottom panel shows results obtained from extracts ponents where the assay was for feruloyl-CoA:monolignol of transgenic poplar leaves that express the Angelica sinensis transferase (FMT) activity using coniferyl alcohol and p-cou FMT. Coniferyl ferulate (3) was detected only with the leaf maroyl-CoA as substrates. The UV 340 trace is the dashed extract from YFP-FMT Poplar. line while the UV 280 trace is the Solid line. FIG. 6A shows 0065 FIG. 11A-11B illustrates that transgenic Arabidop the results of a no-enzyme control assay while FIG. 6B shows sis express an enzymatically active Angelica Sinensis feru the results of the assay with the feruloyl-CoA:monolignol loyl-CoA:monolignol transferase. FMT expression is dem transferase from Angelica sinensis. The peaks are numbered onstrated by Reverse Transcriptase PCR in Arabidopsis leaf. to distinguish the separated components of the assay as fol FMT enzymatic activity is demonstrated within the Arabi lows: 1) coniferyl alcohol and p-coumaroyl-CoA (at about dopsis stem. FIG. 11A illustrates the products of Reverse 4.4 min), the overlapping peaks cause a slight UV 280 asym Transcriptase PCR that were amplified from Arabidopsis metry due to the coniferyl alcohol elution only slightly before leaves transformed with empty vector or with a vector the p-coumaroyl-CoA, and 3) coniferyl p-coumarate (at expressing the FMT transcript, when reverse transcriptase is about 9.4 min). added (+RT) or not added (-RT) to the PCR reaction mixture. 0061 FIG. 7A-7B shows HPLC separation of assay com A PCR product of the expected size for FMT (1326 base ponents where the assay was for feruloyl-CoA:monolignol pairs) is visible only in the reaction containing total RNA transferase (FMT) activity using caffeoyl-CoA and coniferyl from Arabidopsis transformed with the Angelica sinensis alcohol as substrates. The UV 340 trace is the dashed line FMT when the reverse transcriptase is present. FIG. 11B while the UV 280 trace is the Solid line. FIG. 7A shows the provides representative UPLC traces showing FMT activity results of a no-enzyme control assay while FIG.7B shows the in ground stems from Arabidopsis transformed with the FMT results of the assay with the feruloyl-CoA:monolignol trans from Angelica sinensis, when the FMT enzyme assay is ferase from Angelica sinensis. The peaks are numbered to employed (bottom panel). The absorbance for each of the distinguish the separated components of the assay as follows: substrates, coniferyl alcohol (1) and feruloyl-CoA (2) and for 1) coniferyl alcohol (at about 4.4 min); and 2) caffeoyl-CoA the product, coniferyl ferulate (3), was measured at 280 nm (at about 2.4 min). (solid line) and 340 nm (dotted line). Control reactions were 0062 FIG. 8 illustrates SDS-PAGE analysis of size exclu conducted with stems expressing empty vector (top panel). sion chromatography fractions from immobilized metal ion Coniferyl ferulate (3) is detected only when protein from the affinity chromatography (IMAC) purified feruloyl-CoA: transformed Arabidopsis-FMT stems was added. monolignol transferase. The term UF is an abbreviations for unfractionated purified feruloyl-CoA:monolignol trans 0.066 FIG. 12A-12B illustrate the expression, purification ferase. The numbers 19 through 26 represent Superdex.75 gel and enzyme activity for FMT from Hibiscus cannabinus. filtration fractions. The symbol (-) identifies fractions with FIG. 12A illustrates Hibiscus cannabinus FMT expression in no feruloyl-CoA:monolignol transferase activity while the E. coli BL21 cells (Invitrogen). The Hibiscus cannabinus symbols (+), (++) and (+++) mark fractions with progres FMT was expressed with an N-terminal 6xHis tag in the sively increased activity. pDEST17 vector (Invitrogen) and the soluble protein (-50 0063 FIG. 9 illustrates the synthetic scheme used to pre kDa) was purified over a Ni" columnusing an AKTA purifier pare authentic coniferyl ferulate, employing (i) acetic anhy (GE Healthcare). Fractions containing purified protein (frac dride, pyridine; (ii) thionyl chloride; (iii) borane/tert-buty tions 29 and 30) were assayed for FMT activity. FIG. 12B lamine; (iv) triethylamine, dimethylaminopyridine; and (v) shows the products of an FMT enzyme assay after UPLC pyrrolidine. separation and detection by absorbance at 280 nm (solid line) 0064 FIG. 10A-10B illustrates that transgenic Poplar tree and 340 nm (dotted line) for the substrates coniferyl alcohol leaves express an enzymatically active Angelica sinensis (1) and feruloyl-CoA (2). A control reaction with no enzyme feruloyl-CoA:monolignol transferase. The Poplar trees were is shown at the top. The reaction containing the Hibiscus genetically modified using standard procedures to incorpo cannabinus FMT enzyme is shown in the bottom panel. The rate the Angelica sinensis FMT nucleic acids described production of coniferyl ferulate (3) is visible only when the herein. FIG. 10A illustrates GFP-trap Mag enrichment and Hibiscus cannabinus FMT enzyme is present in the assay detection of FMT expression in the leaves of transgenic pop (bottom panel). The product and Substrate peaks were iden lar trees that express FMT that has been N-terminally tagged tified by comparison to synthetic standards. with Yellow Fluorescent Protein (YFP-FMT). A western blot 0067 FIG. 13 shows an alignment of the Hibiscus can is shown of electrophoretically separated fractions obtained nabinus (lower sequence, SEQID NO:20) and Angelica sin after GFPtrap (Chromotek) enrichment of YFP-FMT from ensis (upper sequence, SEQID NO:21) feruloyl-CoA:mono the leaves of the transgenic poplar trees that express YFP lignol transferase sequences. As illustrated, the Hibiscus FMT. The FMT9 and FMT13 lanes contain extracts from two cannabinus and Angelica sinensis feruloyl-CoA:monolignol different genetically modified Poplar trees. FMT expression transferases share only about 23% sequence identity. When was detected using anti-GFP antibodies (Abcam). FIG. 10B similar amino acid Substitutions are considered, the Hibiscus US 2016/0046955 A1 Feb. 18, 2016

cannabinus and Angelica sinensis feruloyl-CoA:monolignol shows IMAC-purified fractions 18-20 (f18, f19 and f20). The transferases share only about 41% sequence similarity. right panel shows Superdex 75 gel filtration fractions assayed 0068 FIGS. 14A-D provide examples of p-coumaroyl for PMT enzyme activity, where lanes labeled with one or CoA:monolignol transferase (PMT, also called a monolignol more plus (+) indicate fractions with PMT activity, and the coumarate transferase) sequences. FIG. 14A shows an lane labeled with a minus sign (-) indicates no activity mea example of an amino acid sequence (SEQ ID NO:17) of an Sured. Oryza sativa p-coumaroyl-CoA:monolignol transferase. (0072 FIG. 18A-B illustrate that the PMT-catalyzed reac FIG. 14B shows an example of a nucleic acid sequence (SEQ tion between Sinapyl alcohol 1S and p-coumaroyl-CoA 2a ID NO:16) for a coding region of the SEQID NO:17 Oryza produced the Sinapyl p-coumarate conjugate 3Sa as authen sativa p-coumaroyl-CoA:monolignol transferase. FIG. 14C1 ticated by 1D proton (horizontal projection) and 2D COSY and FIG. 14C2 show an example of a genomic nucleic acid NMR. FIG. 18A shows that the crude product generated by sequence (SEQID NO:18) for a coding region of the SEQID PMT contains Sinapyl p-coumarate 3Saas a major product, as NO:17 Oryza sativa p-coumaroyl-CoA:monolignol trans determined by comparison of its proton and 2D COSYNMR ferase. The SEQID NO: 18 genomic sequence continues from spectra (Solid black lines) with the spectra of authentic (Syn FIG. 14C1 to FIG. 14C2. FIG. 14D shows an example of a thetic) sinapyl p-coumarate 3Sa shown in FIG. 18B. nucleic acid sequence (SEQ ID NO:19) for the SEQ ID (0073 FIG. 19A-D illustrate HPLC chromatographs from NO:17 Oryza sativa p-coumaroyl-CoA:monolignol trans analyses of PMT enzyme assay mixtures with no enzyme and ferase that has been codon-optimized for expression. with purified rice OsPMT (+PMT) enzyme added. The UV 0069 FIG. 15 illustrates standard lignin biosynthetic path absorbance was monitored at 280 nM (black) and at 340 nM way in angiosperms, adapted from Vanholme et al. (Lignin (blue) for the following reactions. FIG. 19A shows the chro engineering. in CURR OPIN PLANT BIOL (2008)). Currently matographs for a reaction mixture of p-coumaroyl-CoA 2a understood pathways for synthesis of monolignol p-couma with sinapyl alcohol 1S to evaluate whether sinapyl p-cou rate conjugates 3 are shown. The predominant route toward marate 3Sa is made. FIG. 19B shows the chromatographs for the three main monolignols 1 is shown, with some of the more a reaction mixture of p-coumaroyl-CoA2a with p-coumaryl minor pathways in gray. The various routes through the path alcohol 1H to evaluate whether p-coumaryl p-coumarate 3Ha way have been reviewed by Boerjan et al. (Lignin biosynthe is made. FIG. 19C shows the chromatographs for a reaction of sis. in ANNU REVPLANT BIOL (2003) and by Ralph et al. (Phy caffeoyl-CoA2b with sinapyl alcohol 1S to evaluate whether tochemistry Reviews 3, 29-60 (2004)). Abbreviations used sinapyl caffeate 3Sb is made. FIG. 19D shows the chromato include: 4CL, 4-coumarate:CoA ligase; HCT, p-hydroxycin graphs for a reaction mixture of caffeoyl-CoA2b with p-cou namoyl-CoA: quinate shikimate p-hydroxycinnamoyl trans maryl alcohol 1H to evaluate whether p-coumaryl caffeate ferase; C3H, p-coumarate 3-hydroxylase; CCoAOMT, caf 3Hb is made. feoyl-CoA O-methyltransferase: CCR, cinnamoyl-CoA (0074 FIG. 20A-B shows identification of a Brachypo reductase: FSH, ferulate/coniferaldehyde 5-hydroxylase; dium distachyon p-coumaroyl-CoA: monolignol transferase COMT, caffeic acid/5-hydroxyconiferaldehyde O-methyl gene, its relationship to the rice p-coumaroyl-CoA: monoli transferase; CAD, cinnamyl alcohol dehydrogenase; POD, a gnol transferase gene, and the sequence of the Brachypodium generic peroxidase (generating the radicals required for distachyon p-coumaroyl-CoA: monolignol transferase monomer polymerization to lignin); PMT. p-coumaroyl cDNA and protein. FIG. 20A is a schematic diagram listing CoA: monolignol transferase. Compound numbers are as and illustrating the relationship of grass genes related to the explained in Example 6. rice p-coumaroyl-CoA: monolignol transferase (OsPMT1) 0070 FIG. 16 shows a phylogenetic tree of HXXXD acyl gene. Methods for generating this relationship tree are those transferases related to the rice p-coumaroyl-CoA: monoli described above for FIG. 16. FIG. 20B1-20B3 shows gnol transferase (OSPMT1) gene. Angiosperm sequences sequences for the Brachypodium distachyon p-coumaroyl related to OsPMT (bold) were obtained using Phytozome 7 CoA: monolignol transferase cDNA with untranslated 5' and and aligned using the multiple sequence alignment program 3' sequences (top sequence, SEQID NO:22), the cDNA cod MUSCLE 3.8.31. The resulting alignment was input into the ing region (middle sequence, SEQID NO:23) and the amino program TREEPUZZLE 5.2 with default settings to produce acid sequence (bottom sequence, SEQID NO:24). Note that a phylogenetic tree. A dendrogram was produced using the the sequences extend from FIG. 20B1 to FIG. 20B3. program Dendroscope (Ouyang et al., Nucleic Acids 0075 FIG. 21 is a schematic diagram of the Brachypo Research 35, D883-D887 (2007); Edgar, BMC Bioinformat dium distachyon p-coumaroyl-CoA: monolignol transferase ics 5: 113 (2004); Schmidt et al., Bioinformatics 18(3): 502 gene, showing the regions selected for targeting by RNA 504 (2002); Huson et al., Bioinformatics 8: 460 (2007): interference by RNAi it 1 (construct 60), RNAi #2 (construct Mitchellet al., Plant Physiol. 144(1): 43-53 (2007). 61), RNAi #3 (construct 124), and RNAi #4 (construct 125). (0071 FIG. 17A-B illustrate heterologous expression of 0076 FIG.22A-22B show that p-coumaroyl-CoA: mono the rice p-coumaroyl-CoA: monolignol transferase in E. coli. lignol transferase expression can be reduced by RNAi knock FIG. 17A shows a chromatogram obtained by fast protein down without adversely affecting Brachypodium distachyon liquid chromatography (FPLC) showing immobilized metal plant growth. FIG. 22A graphically illustrates reduction of ion affinity chromatography (IMAC) purification of p-coumaroyl-CoA: monolignol transferase expression by expressed soluble PMT from E. coli represented in black, RNAi knockdown in two transgenic Brachypodium dis with the buffer gradient represented in gray, and the collected tachyon plants independently transformed with RNAi con fractions below. FIG. 17B shows proteins electrophoretically struct 61. p-Coumaroyl-CoA: monolignol transferase expres separated by SDS-Polyacrylamide gels electrophoresis. In sion was detected by quantitative reverse transcription the panel to the left, soluble and insoluble protein fractions polymerase chain reaction (real-time PCR). FIG.22B shows from E. coli are visible upon induction of PMT at time Zero that transgenic RNAi knockdown plants (PMT RNAi 4B) (TO), and after 18 h of induction (T18). The middle panel have comparable growth to wild type. US 2016/0046955 A1 Feb. 18, 2016

0077 FIG.23A-23B illustrate the levels of monolignols in late-containing lignin, whereas other acyltransferases can that p-coumaroyl-CoA: monolignol transferase knockdown compete with and inhibit the production of ferulate-contain Brachypodium distachyon plant cell walls. FIG. 23A graphi ing lignin. By stimulating the expression or activity of feru cally illustrates reduced p-coumarate levels in RNAi knock late-incorporation acyltransferases, and inhibiting the down plant transformants 4B and 7A, but fairly normal levels expression or activity of acyltransferases that reduce the offerulate compared to wild type cell walls. The plant tissues incorporation of monolignol ferulates into lignin, plants with were treated with base and then analyzed by use of gas chro optimal amounts of readily cleavable lignin can be generated. matography-flame ionization detector. FIG. 23B graphically Acyltransferases that Increase Monolignol Ferulate Incorpo illustrates reduced levels of syringyland guaiacil in the RNAi ration knockdown plants, especially plant 7A, compared to wild I0084. Feruloyl-CoA:monolignol transferases improve the type Brachypodium distachyon. Plant tissues were subjected incorporation of monolignol ferulates into lignin by synthe to thioacidolysis to cleave ether linkages in lignin. sizing monolignol ferulates from any of three monolignols 0078 FIG. 24A-24C shows 2D-NMR analysis of plant (p-coumaryl, coniferyl and Sinapyl alcohols). For example, cell walls, illustrating that p-coumarate and Syringyl levels the feruloyl-CoA:monolignol transferases described herein are reduced in RNAi knockdown plant cell walls. FIG. 24A can synthesize coniferyl ferulate from coniferyl alcohol and shows the 2D-NMR spectrum of wild type Brachypodium feruloyl-CoA, as shown below. distachyon plant cell wall extracts. FIG. 24B shows the 2D-NMR spectrum of RNAi knockdown Brachypodium dis tachyon plant cell wall extracts. FIG. 24C is a knockdown OH versus wild type difference spectrum showing reduced levels of the darker-highlighted moieties (syringyl and p-couma rate; red in the original) and the increased levels of the lighter highlighted moieties (pyridine; gray in the original) com pared to wild type. -- 007.9 FIG. 25A-25F show amino acid and nucleotide sequences with potential p-coumaroyl-CoA: monolignol transferase function. These sequences can be used as targets O for knockout and knockdown of endogenous p-coumaroyl CoA: monolignol transferase genes. OH CH 0080. Unless defined otherwise, all technical and scien coniferyl alcohol tific terms used herein have the same meaning as commonly CH O understood by one of ordinary skill in the art to which this O invention belongs. Unless mentioned otherwise, the tech CoA niques employed or contemplated herein are standard meth Her odologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not HO limiting. The following description and the information in feruloyl-CoA Appendix I is presented by way of illustration and does not OH limit the scope of the invention. DETAILED DESCRIPTION OF THE INVENTION O 0081. The invention provides nucleic acids and methods O CH useful for altering lignin structure, lignin attachment to plant components and/or the lignin content in plants. Plants with Such altered lignin structure/attachment/content are more 21 O easily and economically processed into useful products Such as biofuels and paper. Acyl-CoA Dependent Acyltransferases 0082 Plant acyl-CoA dependent acyltransferases consti O tute a large but specific protein superfamily, named BAHD. OH CH Members of this family take an activated carboxylic acid (i.e., coniferyl ferulate a CoA thioester form of the acid) as an acyl donor and either an alcohol or, more rarely, a primary amine, as an acyl accep tor and catalyze the formation of an ester or an amide bond, The feruloyl-CoA:monolignol transferases enable produc respectively. The acyl donors and acyl acceptors that act as tion of plants with lignin that is readily cleaved and/or substrates for BAHD acyltransferases are quite diverse, and removed, for example, because the lignin in these plants different BAHD family members exhibit a range of substrate contains monolignol ferulates Such as coniferyl ferulate specificities. (CAFA) that have ester linkages (rather than ether or carbon I0083. The invention relates to BAHD acyltransferase carbon linkages). nucleic acids and enzymes that enable the production of I0085. The terms “feruloyl-CoA:monolignol transferase transgenic plants with altered lignin. As described herein, (s) and “monolignol ferulate transferase(s) and the abbre Some acyltransferases actively generate easily cleaved feru viation “FMT are used interchangeably herein. US 2016/0046955 A1 Feb. 18, 2016

0086 Nucleic acids encoding the feruloyl-CoA:monoli I0087. The SEQID NO: 1 nucleic acid encodes an Angelica gnol transferases that are useful for making coniferyl ferulate Sinensis clone Dd 155 pdest17 feruloyl-CoA:monolignol (and other monolignol ferulates) were isolated from the roots transferase enzyme with the following amino acid sequence of Angelica sinensis as clone Da155 pdest17. The coding (SEQID NO:2). region of the Angelica sinensis clone Dd 155 pdest17 has the following nucleic acid sequence (SEQID NO:1). MTIMEVOVVS KKMVKPSVPT PDHHKTCKLT AFDOIAPPDO

4. WPIIYFYNSS NIHNIREOLV KSLSETLTKF YPLAGRFVOD ATGACGATCA TGGAGGTTCA AGTTGTATCT AAGAAGATGG 8 GFYVDCNDEG WLYWEAEVNI, PLNEFIGOAK KNIOLINDLV TAAAGCCATC AGTTCCGACT CCTGACCACC ACAAGACTTG 12 PKKNFKDIHS YENPIWGLOM SYFKCGGLAI CMYLSHVVAD CAAATTGACG GCATTCGATC AGATTGCTCC TCCGGATCAA 16 GYTAAAFTKE WSNTTNGIIN GDOLVSSSPI NFELATLVPA 12 GTTCCCATTA TTTACTTCTA CAACAGCAGC AACATCCACA 2O RDLSTWIKPA. WMPPSKIKET. KWWTRRFLFD ENAISAFKDH 16 ATATTCGCGA GCAATTGGTA AAATCCTTGT CCGAAACTCT 24 VIKSESVNRP TRVEVVTSVL WKALINOSKL PSSTLYFHLN AACCAAGTTT TATCCATTAG CTGGAAGATT TGTTCAAGAT 28 FRGKTGINTP PLDNHFSLCG NFYTOWPTRF RGGNOTKODL 24 GGTTTCTATG TCGATTGTAA TGATGAAGGG GTCTTGTACG 32 ELHELWKLLR GKLRNTLKNC SEINTADGLF LEAASNFNII 28 TAGAAGCTGA AGTTAACATT CCGCTAAACG AATTCATCGG 36 OEDLEDEOVD VRIFTTLCRM PLYETEFGWG KPEWVTIPEM 32 ACAAGCAAAG AAAAATATAC TATCAA TGATCTTGTT 4 O HLEIVFLLDT KCGTGIEALV SMDEADMLOF ELDPTISAFA 36 CCGAAAAAAA ACTTCAAGGA TAT CATTCA TATGAAAATC 44 S 4 O CAATAGTGGG ATTACAGATG AGT ATTTCA AGTGTGGTGG I0088. Other nucleic acids encoding the feruloyl-CoA: 44 ACTTGCTATT TGCATGTATC TTTCGCATGT TGTAGCTGAT monolignol transferases that are useful for making coniferyl 48 GGATATACAG CAGCAGCATT CAC CAAAGAG TGGTCTAACA ferulate (and other monolignol ferulates) were isolated from the stem of Hibiscus cannabinus (Kenaf). The coding region 52 CAACCAATGG CATCATCAAT GGCGATCAAC TAGTTTC TTC of the Hibiscus cannabinus (Kenaf) has the following nucleic 56 TTCTCCGATT AACTTCGAAT TGGCAACTCT AGTCCCAGCT acid sequence (SEQ ID NO:8).

60 AGAGATTTAT CGACGGTGAT CAAGCCAGCC GTGATGCCAC ATGGCAACCC ACAGCACTAT CATGTTCTCA GTCGATAGAA 64 CATCAAAGAT CAAGGAAACC AAGGTTGTCA CAAGGAGGTT 4. ACGATGTCGT GTTTGTCAAA CCCTTCAAAC CTACACCCTC 68 TCTGTTCGAT GAAAATGCGA TATCAGCTTT CAAAGACCAT 8 ACAGGTTCTA TCTCTCTCCA CCATCGACAA TGATCCCAAC 72 GTCATCAAAT CCGAAAGCGT TAACCGGCCT ACACGGGTGG 12 CTTGAGATCA TGTGCCATAC TGTTTTTGTG TATCAAGCCA 76 AAGTTGTGAC ATCTGTGTTA TGGAAGGCTC TGATCAACCA 16 ATGCCGATTT CGATGTTAAG CCCAAGGATC CAGCTTCCAT GTCTAAGCTT CCAAGTTCTA CACTATATTT TCACCTCAAC 2O AATCCAGGAA GCACTCTCCA AGCTCTTGGT TTATTACTAT 84 TTTAGAGGGA AAACAGGCAT CAACACCCCA CCGCTAGATA 24 CCCTTAGCGG GGAAGATGAA. GAGGGAGACC GATGGAAAAC

88 ATCATTTTTC GCTTTGCGGA AACTTTTACA CTCAGGTTCC 28 TTCGAATCGC TTGCACTGCC GACGATAGCG TGCCCTTCTT

92 TACAAGGTTC AGGGGGGGAA ATCAAACAAA. ACAGGATTTG 32 AGTAGCCACC GCCGATTGCA AGCTCTCGTC GTTGAACCAC

96 GAATTGCATG AATTGGTCAA GTTGTTGAGA GGAAAGTTGC 36 TTGGATGGCA. TAGATGTTCA. TACCGGGAAA GAATTCGCCT

OO GTAACACTCT GAAGAATTGC TCCGAAATTA ACACTGCCGA 4 O TGGATTTTGC ATCCGAATCC GACGGTGGCT ATTATCACCC

TGGGCTGTTC CTGGAAGCAG CTAGTAATTT CAATATTATA 44 TCTGGTCATG CAGGTGACGA AGTTCATATG CGGAGGGTTC

CAGGAAGATT TGGAGGACGA ACAAGTGGAT GTTCGGATTT 48 ACCATCGCTT TGAGTTTATC GCACTCGGTT TGTGATGGCT

12 TTACAACGTT GTGTAGGATG CCTTTGTATG AAACTGAGTT 52 TCGGTGCAGC. TCAGATCTTT CAAGCATTGA CCGAGCTCGC 56 AAGTGGCAGG AACGAGCCCT CCGGTTAAACC CGTGTGGGAG 16 TGGGTGGGGA AAACCAGAAT GGGTTACCAT TCCAGAGATG 60 AGGCAACTAT TAGTGGCGAA ACCGGCCGAG GAAATCCCTC CATTTGGAGA TAGTGTTTCT TTTGGACACT AAATGTGGGA 64 GGTCGATTGT CGATAAGGAC TTGTCGGCAG CTTCACCGTA 24 CTGGTATTGA GGCATTAGTG AGCATGGATG AAGCAGATAT 68 TCTGCCGACA ACCGACATAG TCCATGCCTG CTTTTATGTA 28 GCTTCAGTTT GAACTTGATC CCACCATCTC TGCTTTCGCT 72 ACCGAGGAGA GTATAAAAAC ACTGAAAATG AATCTGATCA. 32 TCCTAG US 2016/0046955 A1 Feb. 18, 2016 10

- Continued 761 AAGAAAGCAA AGATGAGAGT ATAACCAGTC TCGAGGTCCT OH CoA1 S O 8O1 TTCAGCCTAT ATATGGAGAG. CAAGGTTTAG AGCATTGAAA

841 TTGAGTCCAG ATAAAACCAC AATGCTCGGC ATGGCCGTAG 2 21

881 GCATACGACG CACCGTGAAA CCACGGTTGC CCGAAGGATA -- He

921 CTACGGGAAT GCTTTCACCT CGGCAAATAC GGCCATGACC

961. GGGAAGGAAC TCGACCAAGG ACCGCTCTCG AAAGCTGTGA

OO1 AACAAATCAA. GGAGAGCAAA. AAGCTTGCTT CGGAGAATGA OH OH O41 CTATATCTGG AACTTGATGA, GCATTAACGA GAAGCTGAGA p-coumaryl alcohol p-coumaryl-CoA

O81 GAACTGAATT CGAAGTTCGA AGCGGCCGCC GGTTCAACCA OH 121 TGGTCATAAC AGATTGGAGG CGGTTGGGAC TATTGGAAGA

161 TGTGGATTTT GGATGGAAAG GTAGCGTAAA CATGATACCA

2O1 CTGCCGTGGA ACATGTTCGG GTACGTGGAT TTGGTTCTTT O 241 TATTGCCTCC TTGTAAACTG GACCAATCGA TGAAAGGCGG

281 TGCTAGAGTG TTGGTTTCCT TTCCCACGGC TGCTATTGCC 21 O 321 AAATTCAAGG AAGAAATGGA TGCTCTCAAA CATGATAACA

361. AGGTTGCCGG CGATGCTCTA GTGATCTAG I0089. The SEQID NO:8 nucleic acid encodes a Hibiscus cannabinus (Kenaf). feruloyl-CoA:monolignol transferase enzyme with the following amino acid sequence (SEQ ID OH NO:9). p-coumaryl p-coumarate

MATHSTIMFS WDRNDVVFVK PFKPTPSOVL, SLSTIDNDPN OH S O 4. LEIMCHTVFW YOANADFDWK PKDPASI IOE ALSKLLWYYY CoA1

8 PLAGKMKRET DGKLRIACTA. DDSWPFLWAT ADCKLSSLNH

12 LDGIDVHTGK EFALDFASES DGGYYHPLVM OVTKFICGGF -- -e- 16 TIALSLSHSV CDGFGAAOIF OALTELASGR NEPSVKPWWE

2O ROLLWAKPAE EIPRSIVDKD LSAASPYLPT TDIVHACFYV OCH 24 TEESIKTLKM NLIKESKDES ITSLEWLSAY IWRARFRALK OH OH 28 LSPDKTTMLG MAWGIRRTWK PRLPEGYYGN AFTSANTAMT coniferyl alcohol p-coumaryl-CoA 32 GKELDQGPLS KAVKOIKESK KLASENDYIW NLMSINEKLR

36 ELNSKFEAAA GSTMWITDWR RLGLLEDWDF GWKGSWNMIP OH

4 O LPWNMFGYVD LVLLLPPCKL DOSMKGGARV LVSFPTAAIA

44 KFKEEMDALK HDNKWAGDAL WI Acyltransferases that Decrease Monolignol Ferulate Incor poration 0090 Nucleic acids encoding a p-coumaroyl-CoA:mono lignol transferase (PMT, also called a monolignol coumarate transferase) that can inhibit the incorporation of coniferyl ferulate (and other monolignol ferulates) into lignin. One example of a p-coumaroyl-CoA:monolignol transferase gene was isolated from rice (Oryza sativa). This PMT gene expresses a BAHD acyltransferase that catalyzes the acyla OCH tion of monolignols (e.g., p-coumaryl alcohol, coniferyl alco OH hol and/or Sinapyl alcohol) with p-coumarate, for example, as coniferyl p-coumarate illustrated below.

US 2016/0046955 A1 Feb. 18, 2016 13

- Continued - Continued 3361 TTCTACGGCA ACTGCTTCTA CCCGGTGTCG GTGGTGGCGG 76.1 CTATTGCAAA AACATGGCAA GCCCGCACTC GTGCCCTTCG

34 O1. AGAGCGGGGC GGTGGAGGCG GCGGACGTGG CCGGGGTGGT 8O1 TCTCCCAGAA CCAACGTCAC GTGTTAACCT GTGTTTTTTT

3441 GGGGATGATA CGGGAGGCGA AGGCGAGGCT GCCGGCGGAC 841 GCTAATACCC GCCATTTAAT GGCAGGCGCA. GCGGCCTGGC

3 481 TTCGCGCGGT GGGCGGTGGC CGACTTCAGG GAGGATCCGT 881 CCGCTCCAGC AGCCGGAGGT AATGGTGGCA ACGGCTTCTA

3.21 ACGAGCTGAG. CTTCACGTAC GATTCCCTGT TCGTCTCCGA 921 TGGCAATTGT TTCTACCCGG, TGTCTGTTGT GGCCGAATCA

3561. CTGGACGCGG CTGGGGTTCC TGGAGGCGGA CTACGGGTGG 961 GGTGCAGTTG AAGCGGCAGA TGTGGCAGGT GTTGTTGGTA

36O1 GGGCCGCCGT CGCACGTCAT ACCCTTCGCG TACTACCCGT 1 OO1 TGATCCGTG.A. GGCCAAAGCC CGTCTCCCAG CCGATTTTGC

36.41 TCATGGCCGT CGCCATCATC GGCGCGCCGC CGGTGCCCAA 1041 ACGTTGGGCA GTTGCCGATT TTCGCGAAGA CCCTTATGAA

3 681 GACCGGCGCC CGGATCATGA, CGCAGTGCGT CGAGGACGAC 1081. CTTTCATTTA CATATGATTC CTTGTTTGTC. TCAGATTGGA

3721 CACCTGCCGG CGTTCAAGGA. GGAGATCAAG GCCTTCGACA 1121 CTCGTTTAGG ATTTCTCGAA GCTGATTATG GTTGGGGCCC

3761 AGTAAAATGC TTGTGAAATG TGAACTTTGT TATTGTTACT 1161 ACCCTCTCAT GTAATTCCTT TCGCATATTA. CCCGTTTATG

3801 ACTTCTATGG GCTCGTTGCT CAATGGGCTT TTTTTTGCTT 1201 GCGGTAGCTA TCATCGGCGC TCCTCCAGTT CCAAAAACCG

38.41 TTGTTTTGTG TGTGTGGGCC GACACGATTG GTCAAAAGGG 1241 GCGCACGTAT TATGACT CAG TGTGTAGAAG ATGATCATTT

3881 ATTTGGTGGA. GGCCCAGTTG TAATAAGATG GTCCACGCAT 1281 ACCAGCGTTT AAAGAAGAAA TTAAAGCCTT CGATAAGTGA 3921. CATGGATTAA TCGTTAATTG TAAGGTAGTA CTACACGGAT 0.095 As described in more detail herein, nucleic acids encoding p-coumaroyl-CoA:monolignol transferase can be 3961 TTGTTAACAA. GGAATAAGTT CACTTGGTGA CCCAGTGA targeted for inhibition, knockdown or knockout. For example, p-coumaroyl-CoA:monolignol transferase nucleic acids that 0094. A nucleic acid sequence for the SEQ ID NO:17 are endogenous within various species of plant cells, seeds Oryza sativa p-coumaroyl-CoA:monolignol transferase that and plants can be targeted for knockout by mutation using has been optimized for expression has the following nucleic mutagens or recombinant technology. Endogenous p-couma acid sequence (SEQ ID NO:19). royl-CoA:monolignol transferase gene that can be targeted for inhibition, knockdown or knockout include, for example, nucleic acids that include any of the SEQID NO:16, 18, 19, ATGGGATTTG. CTGTTGTCCG CACAAACCGT GAATTTGTTC 22, 23, 25, 26, 27, 28,47-63 and 64 p-coumaroyl-CoA:mono 4. GCCCCTCGGC AGCTACCCCA CCATCATCCG GCGAATTATT lignol transferase sequences. In addition, inhibitory nucleic acids that are homologous, identical and/or complementary 8 GGAATTATCA ATCATTGATC GTGTAGTTGG TCTCCGTCAT to any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 p-coumaroyl-CoA:monolignol transferase 12 CTGGTTCGTT CTTTACATAT TTTTTCTGCA GCTGCACCAT nucleic acids can be used to inhibit the expression of p-cou 16 CTGGCGGTGA TGCAAAACCC. TCCCCGGCTC GCGTTATTAA maroyl-CoA:monolignol transferase. Knockout of Endogenous p-Coumaroyl-CoA:Monolignol 2O AGAAGCATTG. GGCAAAGCAC TTGTAGACTA CTATCCTTTC Transferase Nucleic Acids 24 GCAGGTCGTT TCGTTGACGG CGGCGGCGGT CCGGGCAGTG (0096. Also provided herein are partial or full PMT knock out mutant plants and partial or full PMT knockout plant 28 CGCGTGTAGA ATGTACCGGT GAAGGTGCTT GGTTTGTAGA cells. "Knockout” means that a plant has a mutation in an endogenous gene (a PMT gene) that Substantially reduces or 32 AGCAGCTGCT GGATGTTCAT TAGACGATGT CAATGGCTTA deletes the expression of function of the protein encoded by 36 GATCATCCAT TAATGATTCC TGAAGACGAT CTCTTACCCG the gene compared to a wild-type plant that has no Such mutation. For example, a knockout mutation can reduce PMT 4 O ATGCAGCCCC TGGCGTTCAC CCACTGGATT TACCGTTAAT expression by about 80%, or by 90%, or by 95%, or by 98%, 44 GATGCAAGTT ACTGAATTTT CATGCGGCGG TTTTGTTGTT or by 99%, or by 100%. 0097 “Knockdown” means that the expression or func 48 GGCTTGATTA. GCGTCCACAC AATGGCTGAC GGTTTAGGCG tion of an endogenous gene is partially reduced. Knockdown 52 CAGGCCAATT TATCAATGCA GTAGGCGATT ATGCTCGTGG can be accomplished by mutation of the endogenous gene so that a protein with reduced function is expressed, or by intro 56 CCTCGACCGT CCGCGTGTTA. GCCCGGTATG GGCACGCGAA duction of an inhibitory RNA that reduces production of the active protein. For example, a knockdown can reduce PMT 6 O GCCATTCCTA GCCCTCCGAA GTTACCACCC GGTCCACCTC expression by at least 10%, or by 20%, or by 30%, or by 40%, 64 CCGAATTAAA AATGTTCCAA CTTCGTCATG TGACAGCCGA or 50%, or by 60%, or by 70%. While knockdown is generally understood to only partially reduce the function of a gene, as 68 TTTGTCTCTC GATTCTATCA ACAAGGCGAA ATCAGCGTAT illustrated herein PMT expression can be reduced by intro 72 TTTGCAGCCA CCGGTCATCG TTGCTCCACA TTCGACGTCG duction of an inhibitory nucleic acid by about 95%. 0.098 Plants, plant cells and seeds can have the knockout and/or knockdown mutation. Plants, plant cells and seeds also US 2016/0046955 A1 Feb. 18, 2016

can have an inhibitory nucleic acid that reduces PMT expres 0103) The methods provided herein can also include one sion. PMT inhibitory nucleic acids can lead to, complete or or more of the following steps: mutagenizing plant cells or partial reduction expression of PMT. Nucleic acid sequences seeds (e.g. EMS mutagenesis, T-DNA insertion, mutation via that can facilitate partial and full knockout of PMT in plant recombinant insertion or replacement of defective cells and plants are also provided herein, and are referred to as sequences), pooling of plant individuals or plant DNA, PCR PMT mutating nucleic acids. amplification of a region of interest, heteroduplex formation 0099. The endogenous mutant knockout or knockdown and high-throughput detection, identification of a mutant PMT nucleic acid molecules can include one or more muta plant or DNA, and/or sequencing of mutant nucleic acid tions, such as one or more missense mutations, nonsense products. It is understood that other mutagenesis and selec mutations, STOP codon mutations, insertion mutations, dele tion methods may also be used to generate such mutant plants. tion mutation, frameshift mutations and/or splice site muta 0104 Instead of inducing mutations in PMT alleles, natu tions. Basically, an endogenous knockout or knockdown ral (spontaneous) mutant alleles may be identified by meth PMT nucleic acid can include any mutation that results in ods available in the art. For example, ECOTILLING may be little or no expression of the PMT protein, or in expression of used (Henikoffetal. 2004, Plant Physiology 135(2): 630-6) to a PMT protein that has at least one amino acid insertion, screen a plurality of plants or plant parts for the presence of deletion and/or substitution relative to the wild type protein natural mutant PMT alleles. As for the mutagenesis tech resulting in a non-functional PMT protein or no PMT protein niques above, preferably Poaceae species are screened, so at all. Such mutations result in a partial or full knockout PMT that the identified PMT allele can subsequently be introduced allele. It is, however, understood that mutations in certain into other Poaceae species, such as any of those listed above, parts of the protein are more likely to result in a non-func by crossing (inter- or intraspecific crosses) and selection. In tional PMT protein, such as mutations leading to truncated ECOTILLING natural polymorphisms in breeding lines or proteins. Such truncated proteins can have one or more of the related species are screened for by the TILLING methodol functional amino acid residues or significant portions of the ogy described above, in which individual or pools of plants functional domains deleted or replaced. are used for PCR amplification of the PMT target, heterodu plex formation and high-throughput analysis. This can be 0100 Thus in one embodiment, nucleic acid sequences followed by selecting individual plants having a required comprising one or more of the mutations described above are provided (in isolated form), as well as plants, plant cells, plant mutation that can be used Subsequently in a breeding program parts and plant seeds endogenously comprising Such to incorporate the desired mutant allele. 01.05 The identified mutant alleles can be sequenced and sequences. Mutant PMT alleles may be generated (for the sequence can be compared to the wild type allele to example, induced by chemical or recombinant mutagenesis) identify the mutation(s). Optionally, whether a mutant allele and/or identified using a range of methods available in the art functions as a partial or full knockout PMT mutant allele can (for example using PCR based methods to amplify part or all be tested as described herein. Using this approach a plurality of the mutant PMT genomic DNA or cDNA). of mutant PMT alleles (and Poaceae plants comprising one or 0101 Mutant PMT alleles may be generated and/or iden more of these) can be identified. The desired mutant alleles tified using a range of available methods. For example, partial can then be combined with the desired wild type alleles by or full knockout of PMT function can be induced by chemical crossing and selection methods. A single plant comprising the or insertional mutagenesis, recombinant technology, and desired number of mutant PMT and the desired number of other available techniques. Mutagens such as ethyl methane wild type and or knockout PMT alleles is generated. Sulfonate, radiation, Agrobacterium tumefaciens-mediated 0106 Mutant PMT alleles or plants comprising mutant T-DNA transformation, transposon mutagenesis, Zinc finger PMT alleles can be identified or detected by methods avail nuclease (ZFN)-mediated targeting of natural genes by able in the art, such as direct sequencing, PCR based assays or homologous recombination, and variations thereof can be hybridization based assays. Alternatively, methods can also used. In some embodiments, the Rapid Trait Development be developed using the specific mutant PMT allele specific System (RTDSTM) developed by Cibus can be employed (see, sequence information provided herein. Such alternative website at cibus.com/pdfs/Cibus Brochure.pdf). detection methods include linear signal amplification detec 0102 Plant seeds or plant cells comprising one or more tion methods based on invasive cleavage of particular nucleic mutant PMT alleles can be generated and identified using acid structures, also known as InvaderTM technology, (as other methods, such as the “Delete-a-geneTM method that described e.g. in U.S. Pat. No. 5,985,557 “Invasive Cleavage employs PCR to screen for deletion mutants generated by fast of Nucleic Acids, U.S. Pat. No. 6,001,567 “Detection of neutron mutagenesis (reviewed by Li and Zhang, 2002, Funct Nucleic Acid sequences by Invader Directed Cleavage, incor Integr Genomics 2:254-258), by the TILLING (Targeting porated herein by reference), RT-PCR-based detection meth Induced Local Lesions IN Genomes) method that identifies ods, such as Taqman, or other detection methods, such as EMS-induced point mutations using denaturing high-perfor SNPlex. Briefly, in the InvaderTM technology, the target muta mance liquid chromatography (DHPLC) to detect base pair tion sequence may e.g. be hybridized with a labeled first changes by heteroduplex analysis (McCallum et al., 2000, nucleic acid oligonucleotide comprising the nucleotide Nat Biotech 18:455, and McCallumetal. 2000, Plant Physiol. sequence of the mutation sequence or a sequence spanning 123, 439-442), etc. As mentioned, TILLING uses high the joining region between the 5' flanking region and the throughput Screening for mutations (e.g. using Cell cleavage mutation region and with a second nucleic acid oligonucle of mutant-wildtype DNA heteroduplexes and detection using otide comprising the 3' flanking sequence immediately down a sequencing gel system). The use of TILLING to identify stream and adjacent to the mutation sequence, wherein the plants or plant parts comprising one or more mutant PMT first and second oligonucleotide overlap by at least one nucle alleles and methods for generating and identifying Such otide. The duplex or triplex structure that is produced by this plants, plant organs, tissues and seeds is encompassed herein. hybridization allows selective probe cleavage with an enzyme US 2016/0046955 A1 Feb. 18, 2016

(Cleavase R) leaving the target sequence intact. The cleaved knockdown the expression or function of a p-coumaroyl labeled probe is subsequently detected, potentially via an CoA:monolignol transferase having 50% or more sequence intermediate step resulting in further signal amplification. identity to any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 0107 Full or partial knockout mutant PMT nucleic acid 27, 28, 47-63 and 64 sequences. For example, a mutating sequences can, for example, be generated in various species nucleic acid can mutate or replace an endogenous p-couma of the Poaceae family of grasses (also called Gramineae or royl-CoA:monolignol transferase gene having 50% or more true grasses). Poaceae are a large and nearly ubiquitous fam sequence identity to any of the SEQID NO:16, 18, 19, 22, 23, ily of monocotyledonous flowering plants. See the list of 25, 26, 27, 28, 47-63 and 64 sequences. genera within the Poaceae family at the website theplantlist. 0110. In one embodiment, an inhibitory nucleic acid may org/browse/A/Poaceae/. Grass species with PMT knockout be an oligonucleotide that will hybridize to a p-coumaroyl mutations can include species such as Miscanthus giganteus CoA:monolignol transferase nucleic acid under intracellular, Panicum virgatum (Switchgrass), Zea mays (corn), Oryza physiological or stringent conditions. The oligonucleotide is sativa (rice), Saccharum sp. (Sugar cane), Triticum sp. capable of reducing expression of a nucleic acid encoding the (wheat), Avena sativa (oats), Pennisetum glaucum (pearl mil p-coumaroyl-CoA:monolignol transferase. A nucleic acid let), Setaria italica (foxtail millet), Sorghum sp. (e.g., Sor encoding a p-coumaroyl-CoA:monolignol transferase may ghum bicolor), Bambu.seae species (bamboo), (thatch), be genomic DNA as well as messenger RNA. For example, in Sorghastrum nutans (indiangrass), Tripsacum dactyloides some embodiments, the inhibitory nucleic acid can hybridize (eastern gamagrass), Andropogon gerardii (big bluestem), to any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, Schizachyrium scoparium (little bluestem), Bouteloua cur 47-63 and 64 sequences, or to a complementary Strand of any tipendula (Sideoats grama), Silphium terebinthinaceum (prai of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and rie rosinweed), Pseudoroegneria spicata (bluebunch wheat 64 sequences. The inhibitory nucleic acid may, for example, grass), Sorghum bicolor (sorghum), Bachypodium be incorporated into a plasmid vector or viral DNA. The distachyon (purple false brome), and the like. Poaceae nucleic inhibitory nucleic acid may be single stranded or double acids can be isolated, mutated and reintroduced or used to stranded, circular or linear. The inhibitory nucleic acid may knockout the endogenous PMT gene in various plant species. also have a stem-loop structure. Loss of PMT function can augment biofuel production from 0111. A mutating nucleic acid can, for example, have two Such species. segments that are complementary to a targeted p-coumaroyl 0108. Following mutagenesis, plants are grown from the CoA:monolignol transferase gene. For example, the seg treated seeds, or regenerated from the treated cells using ments of a mutating nucleic acid can hybridize to any of the available techniques. For instance, mutagenized seeds may be SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 planted in accordance with conventional growing procedures sequences, or to a complementary strandofany of the SEQID and, following self-pollination, seed is formed on the plants. NO:16, 18, 19, 22, 23, 25,26,27,28,47-63 and 64 sequences. Alternatively, doubled haploid plantlets may be extracted Such a mutating nucleic acid can hybridize via those two from treated microspore or pollen cells to immediately form segments to an endogenous p-coumaroyl-CoA:monolignol homozygous plants. Seeds formed as a result of Such self transferase gene within a plant cell and replace or mutate pollination or seeds from Subsequent generations may be segments of the endogenous p-coumaroyl-CoA:monolignol harvested and screened for the presence of mutant PMT alle transferase gene. For example, a mutating nucleic acid can les, using techniques that are available in the art, for example include two segments, referred to segment A and segment B, polymerase chain reaction (PCR) based techniques (amplifi that are separately selected from any of the PMT nucleic acid cation of the PMT alleles) or hybridization based techniques, sequences described herein, with a non-PMT nucleic acid e.g. Southern blot analysis, BAC library screening, and the segment between segments A and B. The non-PMT nucleic like, and/or direct sequencing of PMT alleles. To screen for acid sequence has at least one nucleotide that can replace at the presence of point mutations (e.g., Single Nucleotide Poly least one nucleotide in vivo within an endogenous plant PMT. morphisms or SNPs) in mutant PMT alleles, available SNP Segment B is selected from a region that is downstream (3') to detection methods can be used, for example oligo-ligation the segment A sequence. The structure of mutating nucleic based techniques, single base extension-based techniques, acid, for example, can be as follows: Such as pyrosequencing, or techniques based on differences 0112 (Segment A)-(non-PMT segment)-(Segment B) in restriction sites, such as TILLING. 0113 wherein: 0114 Segment A is a nucleic acid that can hybridize Inhibitory and Mutating Nucleic Acids to an endogenous PMT gene in vivo at a position 3' to 0109. In another embodiment, the invention relates to an the region where Segment B hybridizes; inhibitory nucleic acid that can reduce the expression and/or 0115 non-PMT segment is a nucleic acid that can translation of p-coumaroyl-CoA:monolignol transferase in a replace part of an endogenous PMT gene in vivo when plant or plant cell. In other embodiments, the invention relates segments A and B are hybridized to the endogenous to mutating nucleic acids that can knockout the expression of PMT gene; and Segment B is a nucleic acid that can a p-coumaroyl-CoA:monolignol transferase in a plant or hybridize to an endogenous PMT gene in vivo at a plant cell. For example, the inhibitory nucleic acid that can position 5' to the region where Segment A hybridizes. reduce the expression and/or translation of a p-coumaroyl Segments A and B are each separately about 15-50 nucle CoA:monolignol transferase having any of the SEQ ID otides in length, or about 16-40 nucleotides in length, or about NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 sequences. 17-30 nucleotides in length, or about 18-25 nucleotides in The inhibitory nucleic acid can, for example, reduce the length, or any number of nucleotides in length between 15-50 expression of a p-coumaroyl-CoA:monolignol transferase by nucleotides. any amount such as, for example, by 2%. 5%, 10%, 20%, 40% 0116. The non-PMT segment is at least one nucleotide in or more than 40%. Mutating nucleic acid can knockout or length. However, the non-PMT segment can also be 1-10,000 US 2016/0046955 A1 Feb. 18, 2016

nucleotides in length, or 1-1000 nucleotides in length, or I0122) Inhibitory nucleic acids include, for example, 1-100 nucleotides in length, or 1-50 nucleotides in length, or ribozymes, antisense nucleic acids, interfering RNA, 1-20 nucleotides in length, or 5-50 nucleotides in length, or microRNA, small interfering RNA (siRNA), and combina any numerical value or range within 1-10000 nucleotides in tions thereof. length. I0123. An antisense nucleic acid molecule is typically single-stranded that is complementary to the target nucleic 0117 Such a mutating nucleic acid can introduce point acid (a nucleic acid encoding a p-coumaroyl-CoA:monoli mutations into the endogenous PMT gene, or it can replace gnol transferase). The antisense nucleic acid may function in whole parts of the endogenous PMT gene. an enzyme-dependent manner or, more frequently, by Steric 0118. The inhibitory or mutating nucleic acids can be blocking. Steric blocking antisense, which are RNase-Hinde polymers of ribose nucleotides or deoxyribose nucleotides. pendent, interferes with gene expression or other mRNA For example, inhibitory and/or mutating nucleic acids may dependent cellular processes by binding to a target mRNA include naturally-occurring nucleotides as well as synthetic, and getting in the way of other processes. 0.124. An antisense oligonucleotide can be complemen modified, or pseudo-nucleotides. The inhibitory and/or tary to a sense nucleic acid encoding a p-coumaroyl-CoA: mutating nucleic acids can include modified nucleotides Such monolignol transferase protein. For example, it may be as phosphorothiolates; 2'-O alkyl-containing nucleotides, and complementary to the coding strand of a double-stranded nucleotides having a detectable label such as P. biotin or cDNA molecule or complementary to an mRNA sequence. It digoxigenin. The inhibitory and mutating nucleic acids can may be complementary to an entire coding strand or to only a include peptide nucleic acid (PNA), locked nucleic acid portion thereof. It may also be complementary to all or part of (LNA) and morpholino nucleotide sequences. the noncoding region of a nucleic acid encoding a p-couma 0119 Such inhibitory or mutating nucleic acids can be of royl-CoA:monolignol transferase protein. The non-coding varying lengths. For example, an inhibitory oligonucleotide region includes the 5' and 3' regions that flank the coding can be more than 13 nucleotides, or more than 14 nucleotides, region, for example, the 5' and 3' untranslated sequences. An or more than 15 nucleotides, or more than 16 nucleotides, or antisense oligonucleotide is generally at least six nucleotides more than 17 nucleotides in length. Mutating nucleic acids be in length, but may be about 8, 12, 15, 20, 25, 30, 35, 40, 45, or of similar length but are often longer than inhibitory nucleic 50 nucleotides long. Longer oligonucleotides may also be acids. For example, a mutating nucleic acid can be more than used. 30 nucleotides in length. 0.125. An antisense oligonucleotide may be prepared using methods known in the art, for example, by expression 0120. An inhibitory or mutating nucleic acid that can from an expression vector encoding the antisense oligonucle reduce the expression and/or activity of a p-coumaroyl-CoA: otide or from an expression cassette. For example, an anti monolignol transferase nucleic acid, may include segments sense nucleic acid can be generated simply by flipping over that are completely complementary and/or completely iden the coding region of an mRNA, thereby allowing a regulatory tical to the p-coumaroyl-CoA:monolignol transferase nucleic sequence (e.g., a promoter) to transcribe the “wrong DNA acid (e.g., a DNA or RNA). Alternatively, some variability Strand. The transcript So-produced is an antisense RNA, between the sequences may be permitted. An inhibitory or which will bind and inactivate the RNA produced by the mutating nucleic acid that can inhibit or knockout a p-cou normal gene. maroyl-CoA:monolignol transferase nucleic acid can hybrid (0.126 RNA interference (also referred to as “RNA-medi ize to the p-coumaroyl-CoA:monolignol transferase nucleic ated interference') (RNAi) is an effective mechanism by acid under intracellular conditions or under stringent hybrid which gene expression can be reduced or eliminated. Double ization conditions. For example, an inhibitory or mutating stranded RNA (dsRNA) or single stranded RNA has been nucleic acid can be sufficiently complementary to inhibit observed to mediate the reduction, which is a multi-step pro expression of, or to recombine and replace, an endogenous cess (for details of single stranded RNA methods and com p-coumaroyl-CoA:monolignol transferase nucleic acid. positions see Martinez et al., Cell, 110(5):563 (2002)). Intracellular conditions refer to conditions such as tempera dsRNA activates post-transcriptional gene expression Sur ture, pH and salt concentrations typically found inside a cell, veillance mechanisms that appear to function to defend cells for example, a living plant cell. from virus infection and transposon activity (Fire et al., 0121 Inhibitory nucleic acids (e.g., oligonucleotides) Nature, 391:806-811 (1998); Grishok et al., Cell, 106: 23-34 and/or mutating nucleic acids can include, for example, 2, 3, (2001); Ketting et al., Cell, 99:133-141 (1999); Lin and 4, or 5 or more stretches of contiguous nucleotides that are Avery, Nature,402:128-129 (1999); Montgomery et al., Proc. precisely complementary to a p-coumaroyl-CoA:monolignol Natl. Acad. Sci. USA, 95:15502-07 (1998); Sharp and transferase nucleic acid coding sequence, each separated by a Zamore, Science, 287:2431-2433 (2000): Tabara et al., Cell, stretch of contiguous nucleotides that are not complementary 99:123-132 (1999)). Activation of these mechanisms targets to adjacent coding sequences, may inhibit the function of a mature, dsRNA-complementary mRNA for destruction. The p-coumaroyl-CoA:monolignol transferase nucleic acid. In double stranded RNA reduces the expression of the gene to general, each stretch of contiguous nucleotides is at least 4, 5, which the dsRNA corresponds. 6, 7, or 8 or more nucleotides in length. Non-complementary I0127. For example, RNAi can be made from two oligo intervening sequences may be 1, 2, 3, or 4 nucleotides in nucleotides consisting of partially complementary length. One skilled in the art can easily use the calculated sequences. The oligonucleotides can be made recombinantly, melting point of an oligonucleotide or nucleic acid hybridized for example, from one or two expression cassettes and/or to a nucleic acid target to estimate the degree of mismatching expression vectors. that will be tolerated for inhibiting or mutating expression of I0128 RNAi has some advantages including high specific a particular target nucleic acid. ity, ease of movement across cell membranes, and prolonged US 2016/0046955 A1 Feb. 18, 2016 down-regulation of the targeted gene. (Fire et al., 1998: 0.133 SiRNAs also may be produced in vivo by cleavage Grishok et al., 2000; Ketting et al., 1999; Lin et al., 1999; of double-stranded RNA introduced directly or via a trans Montgomery et al., 1998: Sharp et al., 2000; Tabara et al., gene or virus. Further information on selection and properties 1999). Moreover, dsRNA has been shown to silence genes in of inhibitory nucleic acids is provided in the next section. a wide range of systems, including plants, protozoans, fungi, I0134. The inhibitory nucleic acid may also be a ribozyme. C. elegans, Trypanasoma, Drosophila, and mammals (Gr A ribozyme is an RNA molecule with catalytic activity and is ishok et al., 2000; Sharp, Genes Dev., 13:139-141 (1999); capable of cleaving a single-stranded nucleic acid such as an Sharp et al., 2000; Elbashir et al., Nature, 411:494-498 mRNA that has a homologous region. See, for example, Cech, (2001)). Science 236: 1532-1539 (1987); Cech, Ann. Rev. Biochem. 0129. Small interfering RNAs (siRNAs) or short hairpin 59:543-568 (1990); Cech, Curr. Opin. Struct. Biol. 2: 605 RNAs (shRNAs) can also be used to specifically reduce 609 (1992); Couture and Stinchcomb, Trends Genet. 12:510 p-coumaroyl-CoA:monolignol transferase expression Such 515 (1996). A ribozyme may be used to catalytically cleave a that the level of p-coumaroyl-CoA:monolignol transferase PMT mRNA transcript and thereby inhibit translation of the polypeptides is reduced. siRNAs are double-stranded RNA mRNA. See, for example, Haseloffet al., U.S. Pat. No. 5,641, molecules that mediate post-transcriptional gene silencing in 673. A ribozyme having specificity for a PMT nucleic acid a sequence-specific manner. See, for example, Hamilton & may be designed based on the nucleotide sequence of any of Baulcombe, Science 286 (5441): 950-2 (1999); see also, the the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and website at www.ambion.com/techlib/hottopics/rnai/rnai 64 sequences. Methods of designing and constructing a may2002 print.html (last retrieved May 10, 2006). Once ribozyme that can cleave an RNA molecule in trans in a incorporated into an RNA-induced silencing complex, highly sequence specific manner have been developed and siRNA mediate cleavage of the homologous endogenous described in the art. See, for example, Haseloffet al., Nature mRNA transcript by guiding the complex to the homologous 334:585-591 (1988). A ribozyme may be targeted to a specific mRNA transcript, which is then cleaved by the complex. RNA by engineering a discrete “hybridization” region into 0130 For example, siRNA can be made from two partially the ribozyme. The hybridization region contains a sequence or fully complementary oligonucleotides. Alternatively, short complementary to the target RNA that enables the ribozyme hairpin RNA (shRNA) can be employed that is a one oligo to specifically hybridize with the target. See, for example, nucleotide that forms a double-stranded region by folding Gerlach et al., EP 321.201. The target sequence may be a back onto itself via a tight hairpin turn. The siRNA and/or segment of about 5, 6,7,8,9, 10, 12, 15, 20, or 50 contiguous shRNA may have sequence identity, sequence complementa nucleotides selected from a nucleic acid having any of the rity and/or be homologous to any region of the p-coumaroyl SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 CoA:monolignol transferase mRNA transcript. The region of sequences. Longer complementary sequences may be used to sequence homology or complementarity may be 50 nucle increase the affinity of the hybridization sequence for the otides or less in length, less than 45 nucleotides, less than 40 target. The hybridizing and cleavage regions of the ribozyme nucleotides, less than 35 nucleotides, less than 30 nucle can be integrally related; thus, upon hybridizing to the target otides, or less than 25 nucleotides in length. In some embodi RNA through the complementary regions, the catalytic ments, the region of sequence homology or complementarity region of the ribozyme can cleave the target. Thus, an existing of a siRNA or shRNA may be about 21 to 23 nucleotides in ribozyme may be modified to target a PMT mRNA by modi length. fying the hybridization region of the ribozyme to include a 0131 SiRNA is typically double stranded and may have sequence that is complementary to the target PMT. Alterna two-nucleotide 3' overhangs, for example, 3' overhanging UU tively, an mRNA encoding a PMT may be used to select a dinucleotides. Methods for designing siRNAs are known to catalytic RNA having a specific ribonuclease activity from a those skilled in the art. See, for example, Elbashiretal. Nature pool of RNA molecules. See, for example, Bartel & Szostak, 411: 494-498 (2001); Harborth et al. Antisense Nucleic Acid Science 261:14-11-1418 (1993). Drug Dev. 13: 83-106 (2003). Typically, a target site that 0.135 Inhibitory and mutating nucleic acids can be gener begins with AA, has 3' UU overhangs for both the sense and ated by recombinant means, for example, by expression from antisense siRNA strands, and has an approximate 50% G/C an expression cassette or expression vector. Alternatively, the content is selected. SiRNAs may be chemically synthesized, inhibitory or mutating nucleic acids can also be prepared by created by in vitro transcription, or expressed from an siRNA chemical synthesis using naturally-occurring nucleotides, expression vector or a PCR expression cassette. See, e.g., the modified nucleotides or any combinations thereof. In some website at www.ambion.com/techlib/tb/tb 506 html (last embodiments, these nucleic acids are made from modified retrieved May 10, 2006). nucleotides or non-phosphodiester bonds, for example, that 0.132. When a shRNA is expressed from an expression are designed to increase biological stability of the nucleic vector or a PCR expression cassette, the insert encoding the acid or to increase intracellular stability of the duplex formed shRNA may be expressed as an RNA transcript that folds into between the inhibitory or mutating nucleic acids and endog an shRNA hairpin. Thus, the shRNA transcript may include a enous nucleic acids. Naturally-occurring nucleotides include sense siRNA sequence that is linked to its reverse comple the ribose or deoxyribose nucleotides adenosine, guanine, mentary antisense siRNA sequence by a spacer sequence that cytosine, thymine and uracil. Examples of modified nucle forms the loop of the hairpin as well as a string of Us at the otides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 3' end. The loop of the hairpin may be of various lengths. For 5-iodouracil, hypoxanthine, Xanthine, 4-acetylcytosine, example, the loop can be 3 to 30 nucleotides in length, or 3 to 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylami 23 nucleotides in length. Examples of nucleotide sequences nomethyl-2-thiouridine, 5-carboxymethylaminomethylu for the loop include AUG, CCC, UUCG, CCACC, CTCGAG, racil, dihydrouracil, beta-D-galactosylqueosine, inosine, AAGCUU, CCACACC and UUCAAGAGA (SEQ ID NO: N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 18). 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, US 2016/0046955 A1 Feb. 18, 2016

3-methylcytosine, 5-methylcytosine, N6-adenine, 7-meth sequences. As described herein, the nucleic acid is adapted to ylguanine, 5-methylaminomethyluracil, 5-methoxyaminom encode a feruloyl-CoA:monolignol transferase and/or inhibit ethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxy a p-coumaroyl-CoA:monolignol transferase nucleic acid. carboxymethyluracil, 5-methoxyuracil, 2-methythio-N6 0.141. The feruloyl-CoA:monolignol transferase nucleic isopentenyladeninje, uracil-5-oxyacetic acid, Wybutoxosine, acids of the invention include any nucleic acid that can selec pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiou tively hybridize to a nucleic acid with any of SEQID NO:1 or racil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-ox 8 acetic acid methylester, uracil-5-oxacetic acid, 5-methyl-2- 0142. The term “selectively hybridize” includes hybrid thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3) ization, under Stringent hybridization conditions, of a nucleic w, and 2,6-diaminopurine. Thus, inhibitory or mutating acid sequence to a specified nucleic acid target sequence (e.g., nucleic acids may include modified nucleotides, as well as SEQ ID NO:1, SEQ ID NO:8, SEQ ID NO:16, SEQ ID natural nucleotides Such as combinations of ribose and deox NO:18, SEQ ID NO:19, SEQ ID NO:22, SEQ ID NO:23, yribose nucleotides, and inhibitory or mutating nucleic acids SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID of the invention may be of any length sufficient to inhibit or NO:28, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, mutate an endogenous nucleic acid. SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID 0.136 Such inhibitory or mutating nucleic acids can be NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, homologous and/or complementary to any of the SEQ ID SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 sequences. NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, Such inhibitory or mutating nucleic acids can also have at and/or SEQID NO:64) to a detectably greater degree (e.g., at least 50%, or at least 55%, or at least 60%, or at least 65%, or least 2-fold over background) than its hybridization to non at least 70%, or at least 75%, or at least 80%, or at least 85%, target nucleic acid sequences. Such selective hybridization or at least 90%, or at least 95%, or at least 98% sequence Substantially excludes non-target nucleic acids. Selectively identity or sequence complementarity to any of the SEQID hybridizing sequences typically have about at least 40% NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 sequences. sequence identity, or at least 50% sequence identity, or at least 60% sequence identity, or at least 70% sequence identity, or Related Acyltransferases 60-99% sequence identity, or 70-99% sequence identity, or 0137 The nucleic acids described herein also allow iden 80–99% sequence identity, or 90-95% sequence identity, or tification and isolation of related nucleic acids and their 90-99% sequence identity, or 95-97% sequence identity, or encoded enzymes that can facilitate production of altered 97-99% sequence identity, or 100% sequence identity (or lignins in plants. Such nucleic acids can encode or hybridize complementarity) with each other. In some embodiments, a to BAHD acyltransferases and fragments thereof. In addition, selectively hybridizing sequence has about at least about 50% as described herein, inhibitory or mutating nucleic acids can sequence identity or complementarity with any of SEQ ID be used to inhibit or destroy the expression of a p-coumaroyl NO:1, SEQID NO:8, SEQID NO:16, SEQID NO: 18 and/or CoA:monolignol transferase nucleic acid, reduce the amount SEQID NO:19. of p-coumaroyl-CoA:monolignol transferase enzyme trans 0143. Thus, for example, the nucleic acids of the invention lated, and/or mutate an endogenous of p-coumaroyl-CoA: include those with about 500 of the same nucleotides as any of monolignol transferase gene so that an encoded enzyme is not the SEQID NO:16, 18, 19, 22, or 23 sequences, or include produced or has substantially no activity. The procedures about 600 of the same nucleotides as any of the SEQ ID described below can be employed to make an inhibitory or NO:16, 18, 19, 22, or 23 sequences, or about 700 of the same mutating nucleic acid. nucleotides as any of the SEQ ID NO:16, 18, 19, 22, or 23 0138 For example, related nucleic acids can be isolated sequences, or about 800 of the same nucleotides as any of the and identified by use of the SEQID NO:1, 8, 16, 18, 19, 22, SEQID NO:16, 18, 19, 22, or 23 sequences, or about 900 of 23, 25, 26, 27, 28, 47-63 and 64 nucleic acid sequences and/or the same nucleotides as any of the SEQID NO:16, 18, 19, 22. by hybridization to DNA and/or RNA isolated from other or 23 sequences, or about 1000 of the same nucleotides as any plant species using the SEQID NO:1, 8, 16, 18, 19, 22, 23, 25, of the SEQID NO:16, 18, 19, 22, or 23 sequences, or about 26, 27, 28, 47-63 and 64 nucleic acids as probes. The 1100 of the same nucleotides as any of the SEQIDNO:16, 18, sequence of the acyltransferase enzyme (e.g., SEQID NO:2. 19, 22, or 23 sequences, or about 1200 of the same nucle 9, 17, 20, 21, 24, 29-45 and/or 46) can also be examined and otides as any of the SEQ ID NO:16, 18, 19, 22, or 23 used a basis for designing alternative acyltransferase nucleic sequences, or about 1300 of the same nucleotides as any of the acids. SEQ ID NO:16, 18, 19, 22, or 23 sequences, or about 500 0139 For example, the sequence of a p-coumaroyl-CoA: 1325 of the same nucleotides as any of the SEQIDNO:16, 18, monolignol transferase nucleic acid (e.g., SEQID NO:16, 18. 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences. The 19, 22, 23, 25, 26, 27, 28, 47-63 and/or 64) can be examined identical nucleotides can be distributed throughout the and used a basis for designing inhibitory or mutating nucleic nucleic acid or the encoded protein, and need not be contigu acids for reducing the expression of p-coumaroyl-CoA: OUS monolignol transferase. 0144. The nucleic acids of the invention include those with 0140. The p-coumaroyl-CoA:monolignol transferase about 70 of the same nucleotides as any of the SEQID NO:25, nucleic acids of the invention include any nucleic acid that 26, 27, 28, 47-63 and 64 sequences, or any with about 60 of can selectively hybridize to a nucleic acid with any of SEQID the same nucleotides as any of the SEQID NO:25, 26, 27, 28. NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 sequences. 47-63 and 64 sequences, or any with about 50 of the same In another embodiment, the inhibitory or mutating nucleic nucleotides as any of the SEQ ID NO:25, 26, 27, 28, 47-63 acids can also include any nucleic acid that can selectively and 64 sequences, or any with about 40 of the same nucle hybridize to either strand of a nucleic acid with any of the otides as any of the SEQID NO:25, 26, 27, 28, 47-63 and 64 SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or any with about 30 of the same nucleotides as US 2016/0046955 A1 Feb. 18, 2016

any of the SEQ ID NO:25, 26, 27, 28, 47-63 and 64 (or complementary) nucleotides as any of the SEQID NO:16, sequences. The identical nucleotides can be distributed 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or throughout the nucleic acid or the encoded protein, and need about 39 of the same (or complementary) nucleotides as any not be contiguous. of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 sequences, or about 40 of the same (or complementary) 0145. In some embodiments, an inhibitory or mutating the nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, nucleic acid of the invention can include a sequence that is 26, 27, 28, 47-63 and 64 sequences, or about 41 of the same Substantially identical or complementary to a nucleic acid (or complementary) nucleotides as any of the SEQID NO:16, with any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or 47-63 and 64 sequences. For example, an inhibitory or mutat about 42 of the same (or complementary) nucleotides as any ing the nucleic acid of the invention can include those with of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and about 15 of the same (or complementary) nucleotides as any 64 sequences, or about 43 of the same (or complementary) of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, 64 sequences, or about 16 of the same (or complementary) 26, 27, 28, 47-63 and 64 sequences, or about 44 of the same nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, (or complementary) nucleotides as any of the SEQID NO:16, 26, 27, 28, 47-63 and 64 sequences, or about 17 of the same 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or (or complementary) nucleotides as any of the SEQID NO:16, about 45 of the same (or complementary) nucleotides as any 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and about 18 of the same (or complementary) nucleotides as any 64 sequences, or about 15-50 of the same (or complementary) of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, 64 sequences, or about 19 of the same (or complementary) 26, 27, 28, 47-63 and 64 sequences. nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or about 20 of the same 0146 Note that ifa value of a variable that is necessarily an (or complementary) nucleotides as any of the SEQID NO:16, integer, e.g., the number of nucleotides or amino acids in a 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or nucleic acid or protein, is described as a range, e.g., 90-99% about 21 of the same (or complementary) nucleotides as any sequence identity what is meant is that the value can be any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and integer between 90 and 99 inclusive, i.e., 90,91, 92,93, 94, 64 sequences, or about 22 of the same (or complementary) 95.96, 97,98 or 99, or any range between 90 and 99 inclusive, nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, e.g., 91-99%, 91-98%, 92-99%, etc. 26, 27, 28, 47-63 and 64 sequences, or about 23 of the same 0147 In some embodiments, related nucleic acid hybrid (or complementary) nucleotides as any of the SEQID NO:16, ize to the nucleic acids described herein under “stringent 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or conditions” or “stringent hybridization conditions.” In other about 24 of the same (or complementary) nucleotides as any embodiments, an inhibitory or mutating nucleic acid can of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and hybridize to the nucleic acids described herein under “physi 64 sequences, or about 25 of the same (or complementary) ological conditions.” “stringent conditions' or 'stringent nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, hybridization conditions.” 26, 27, 28, 47-63 and 64 sequences, or about 26 of the same 0.148. The term “physiological conditions” refers to salt (or complementary) nucleotides as any of the SEQID NO:16, and temperature conditions that are commonly present in a 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or live plant in Vivo, for example, in a growing plant or seedling. about 27 of the same (or complementary) nucleotides as any Inhibitory or mutating nucleic acids can, for example, hybrid of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and ize to an endogenous nucleic acid (e.g., an mRNA arising 64 sequences, or about 28 of the same (or complementary) from a nucleic acid with any of the SEQID NO:16, 18, 19, 22, nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, 23, 25, 26, 27, 28, 47-63 and 64 sequences or a genomic DNA 26, 27, 28, 47-63 and 64 sequences, or about 29 of the same with any of SEQID NO:16, 18 or 19 sequences) under plant (or complementary) nucleotides as any of the SEQID NO:16, physiological conditions. In some embodiments, under Such 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or plant physiological conditions, the inhibitory or mutating about 30 of the same (or complementary) nucleotides as any nucleic acids selectively hybridize to a mRNA with any of the of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 64 sequences, or about 31 of the same (or complementary) sequences, but do not significantly hybridize to a SEQ ID nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, NO:1 or a SEQID NO:8 mRNA. 26, 27, 28, 47-63 and 64 sequences, or about 32 of the same 014.9 The terms “stringent conditions' or “stringent (or complementary) nucleotides as any of the SEQID NO:16, hybridization conditions' include conditions under which a 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or probe will hybridize to its target sequence to a detectably about 33 of the same (or complementary) nucleotides as any greater degree than other sequences (e.g., at least 2-fold over of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and background). Stringent conditions are somewhat sequence 64 sequences, or about 34 of the same (or complementary) dependent and can vary in different circumstances. By con nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, trolling the Stringency of the hybridization and/or washing 26, 27, 28, 47-63 and 64 sequences, or about 35 of the same conditions, target sequences that have up to 100% comple (or complementary) nucleotides as any of the SEQID NO:16, mentarity to an inhibitory or mutating nucleic acid can 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences, or hybridize (homologous probing) to a probe for identifying a about 36 of the same (or complementary) nucleotides as any new inhibitory or mutating nucleic acid. Alternatively, strin of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and gency conditions can be adjusted to allow some mismatching 64 sequences, or about 37 of the same (or complementary) in sequences so that lower degrees of sequence similarity are nucleotides as any of the SEQID NO:16, 18, 19, 22, 23, 25, detected (heterologous probing). The probe can be approxi 26, 27, 28, 47-63 and 64 sequences, or about 38 of the same mately 15-500 nucleotides in length, but can vary greatly in US 2016/0046955 A1 Feb. 18, 2016 20 length from about 18 nucleotides to equal to the entire length nucleic acids. For example, if the desired degree of mismatch of the target sequence. In some embodiments, the probe is ing results in a T of less than 45°C. (aqueous solution) or 32 about 10-50 nucleotides in length, or about 15-50 nucleotides C. (formamide solution) it is preferred to increase the SSC in length, or about 16-45 nucleotides in length, or about 18-25 concentration so that a higher temperature can be used. nucleotides in length. 0153. An extensive guide to the hybridization of nucleic 0150 Typically, stringent conditions will be those where acids is found in Tijssen, LABORATORY TECHNIQUES IN BIOCHEM the salt concentration is less than about 1.5 MNaion (or other ISTRY AND MOLECULAR BIOLOGY HYBRDIZATION WITH NUCLEIC salts), typically about 0.01 to 1.0 MNaion concentration (or ACID PROBEs, part 1, chapter 2. “Overview of principles of other salts), at pH 7.0 to 8.3 and the temperature is at least hybridization and the strategy of nucleic acid probe assays.” about 30° C. for shorter probes (e.g., 10 to 50 nucleotides)and Elsevier, N.Y. (1993); and in CURRENT PROTOCOLS IN MOLECULAR at least about 60° C. for longer probes (e.g., greater than 50 BIOLOGY, chapter 2, Ausubel, et al., eds, Greene Publishing nucleotides). Stringent conditions may also be achieved with and Wiley-Interscience, New York (1995). the addition of destabilizing agents such as formamide or 0154) Unless otherwise stated, in the present application Denhardt's Solution. Exemplary low stringency conditions high stringency is defined as hybridization in 4xSSC, 5xDen include hybridization with a buffer solution of 30 to 35% hardt's (5g Ficoll, 5g polyvinypyrrolidone, 5 g bovine serum formamide, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at albumin in 500 ml of water), 0.1 mg/ml boiled salmon sperm 37° C., and a wash in 1xSSC to 2xSSC (where 20xSSC is 3.0 DNA, and 25 mM Na phosphate at 65° C., and a wash in M. NaCl, 0.3 M trisodium citrate) at 50 to 55° C. Exemplary 0.1XSSC, 0.1% SDS at 65° C. moderate stringency conditions include hybridization in 40 to 0155 The following terms are used to describe the 45% formamide, 1M NaCl, 1% SDS at 37°C., and a wash in sequence relationships between two or more nucleic acids or 0.5xSSC to 1xSSC at 55 to 60° C. Exemplary high stringency nucleic acids or polypeptides: (a) “reference sequence.” (b) conditions include hybridization in 50% formamide, 1M “comparison window, (c) “sequence identity.” (d) "percent NaCl, 1% SDS at 37°C., and a wash in 0.1xSSC at 60 to 65° age of sequence identity” and (e) “substantial identity.” C. Specificity is typically a function of post-hybridization 0156. As used herein, “reference sequence' is a defined washes, where the factors controlling hybridization include sequence used as a basis for sequence comparison (e.g., any the ionic strength and temperature of the final wash solution. of the SEQID NO:1, 8, 16, 18, 19, 22, 23, 25, 26, 27, 28, 0151. For DNA-DNA hybrids, the T can be approxi 47-63 and 64 sequences). The reference sequence can be a mated from the equation of Meinkoth and Wahl (Anal. Bio nucleic acid sequence (e.g., any of the SEQID NO:1, 8, 16, chem. 138:267-84 (1984)): 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences) or an T=81.5°C.+16.6(log M)+0.41 (% GC)-0.61(% for amino acid sequence (e.g., any of the SEQID NO:2, 9, 17, 20, mamide)-500/L 21, 24, 29-45 and 46 sequences). A reference sequence may where M is the molarity of monovalent cations; % GC is the be a subset or the entirety of a specified sequence. For percentage of guanosine and cytosine nucleotides in the example, a reference sequence may be a segment of a full DNA, 96 formamide is the percentage of formamide in the length cDNA or of a genomic DNA sequence, or the complete hybridization solution, and L is the length of the hybrid in cDNA or complete genomic DNA sequence, or a domain of a base pairs. The T is the temperature (under defined ionic polypeptide sequence. strength and pH) at which 50% of a complementary target 0157. As used herein, "comparison window' refers to a sequence hybridizes to a perfectly matched probe. The T is contiguous and specified segment of a nucleic acid or an reduced by about 1°C. for each 1% of mismatching. Thus, the amino acid sequence, wherein the nucleic acid/amino acid T hybridization and/or wash conditions can be adjusted to sequence can be compared to a reference sequence and hybridize to sequences of the desired sequence identity. For wherein the portion of the nucleic acid/amino acid sequence example, if sequences with greater than or equal to 90% in the comparison window may comprise additions or dele sequence identity are sought, the T can be decreased 10°C. tions (i.e., gaps) compared to the reference sequence (which Generally, stringent conditions are selected to be about 5°C. does not comprise additions or deletions) for optimal align lower than the thermal melting point (T) for the specific ment of the two sequences. The comparison window can vary sequence and its complement at a defined ionic strength and for nucleic acid and polypeptide sequences. Generally, for pH. However, severely stringent conditions can include nucleic acids, the comparison window is at least 16 contigu hybridization and/or a wash at 1, 2, 3 or 4°C. lower than the ous nucleotides in length, and optionally can be 18, 20,30,40. thermal melting point (T). Moderately stringent conditions 50, 100 or more nucleotides. For amino acid sequences, the can include hybridization and/or a wash at 6, 7, 8, 9 or 10°C. comparison window is at least about 15 amino acids, and can lower than the thermal melting point (T). Low stringency optionally be 20, 30, 40, 50, 100 or more amino acids. Those conditions can include hybridization and/or a wash at 11, 12. of skill in the art understand that to avoid a high similarity to 13, 14, 15 or 20° C. lower than the thermal melting point (T). a reference sequence due to inclusion of gaps in the nucleic Using the equation, hybridization and wash compositions, acid or amino acid sequence, a gap penalty is typically intro and a desired T, those of ordinary skill can identify and duced and is subtracted from the number of matches. isolate nucleic acids with sequences related to any of the SEQ 0158 Methods of alignment of nucleotide and amino acid ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences for comparison are well known in the art. The local sequences. Similarly, those of ordinary skill can identify and homology algorithm (BESTFIT) of Smith and Waterman, isolate inhibitory or mutating nucleic acids with sequences (1981) Adv. Appl. Math 2:482, may permit optimal alignment that effectively inhibit the expression of a nucleic acid that of compared sequences; by the homology alignment algo includes any of the SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, rithm (GAP) of Needleman and Wunsch, (1970).J. Mol. Biol. 28, 47-63 and 64 sequences. 48:443-53; by the search for similarity method (Tfasta and 0152 Those of skill in the art also understand how to vary Fasta) of Pearson and Lipman, (1988) Proc. Natl. Acad. Sci. the hybridization and/or wash solutions to isolate desirable USA 85:2444; by computerized implementations of these US 2016/0046955 A1 Feb. 18, 2016 algorithms, including, but not limited to: CLUSTAL in the BLAST 2.0 suite of programs using default parameters (Alts PC/Gene program by Intelligenetics, Mountain View, Calif., chul, et al., (1997) Nucleic Acids Res. 25:3389-402). GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wis 0162. As those of ordinary skill in the art will understand, consin Genetics Software Package, Version 8 (available from BLAST searches assume that proteins can be modeled as Genetics Computer Group (GCGTM programs (Accelrys, random sequences. However, many real proteins comprise Inc., San Diego, Calif.)). The CLUSTAL program is well regions of nonrandom sequences, which may be homopoly described by Higgins and Sharp (1988) Gene 73:237-44: meric tracts, short-period repeats, or regions enriched in one Higgins and Sharp, (1989) CABIOS 5:151-3: Corpet, et al., or more amino acids. Such low-complexity regions may be (1988) Nucleic Acids Res. 16:10881-90; Huang, et al., (1992) aligned between unrelated proteins even though other regions Computer Applications in the Biosciences 8:155-65 and of the protein are entirely dissimilar. A number of low-com Pearson, et al., (1994) Meth. Mol. Biol. 24:307-31. An plexity filter programs can be employed to reduce Such low example of a good program to use for optimal global align complexity alignments. For example, the SEG (Wooten and ment of multiple sequences is PileUp (Feng and Doolittle, Federhen, (1993) Comput. Chem. 17:149-63) and XNU (1987) J. Mol. Evol., 25:351-60, which is similar to the (C. sub. 1-ayerie and States, (1993) Comput. Chem. 17:191 method described by Higgins and Sharp. (1989) CABIOS 201) low-complexity filters can be employed alone or in 5:151-53 (and is hereby incorporated by reference). The combination. BLAST family of programs that can be used for database 0163 The terms “substantial identity” indicates that an similarity searches includes: BLASTN for nucleotide query inhibitory or mutating nucleic acid, a polypeptide, or a related sequences against nucleotide database sequences; BLASTX nucleic acid comprises a sequence with between 55-100% for nucleotide query sequences against protein database sequence identity to a reference sequence, with at least 55% sequences; BLASTP for protein query sequences against pro sequence identity, or at least 60%, or at least 70%, or at least tein database sequences: TBLASTN for protein query 80%, or at least 90% or at least 95% sequence identity or any sequences against nucleotide database sequences; and percentage of range between 55-100% sequence identity rela TBLASTX for nucleotide query sequences against nucle tive to the reference sequence over a specified comparison otide database sequences. See, Current Protocols in Molecu window. Optimal alignment may be ascertained or conducted lar Biology, Chapter 19, Ausubel, et al., eds. Greene Publish using the homology alignment algorithm of Needleman and ing and Wiley-Interscience, New York (1995). Wunsch, Supra. 0159 GAP uses the algorithm of Needleman and Wunsch, 0164. An indication that two polypeptide sequences are (1970).J. Mol. Biol. 48:443-53, to find the alignment of two substantially identical is that both polypeptides have p-cou complete sequences that maximizes the number of matches maroyl-CoA:monolignol transferase activity, meaning that and minimizes the number of gaps. GAP considers all pos both polypeptides can synthesize monolignol p-coumarates sible alignments and gap positions and creates the alignment from a monolignol and p-coumaroyl-CoA. The polypeptide with the largest number of matched bases and the fewest gaps. that is Substantially identical to a p-coumaroyl-CoA:monoli It allows for the provision of a gap creation penalty and a gap gnol transferase including one or more of the SEQID NO:17, extension penalty in units of matched bases. GAP makes a 24, 29-45 or 46 sequences may not have exactly the same profit of gap creation penalty number of matches for each gap level of activity as the p-coumaroyl-CoA:monolignol trans it inserts. If a gap extension penalty greater than Zero is ferase that includes the SEQ ID NO:17, 24, 29-45 or 46 chosen, GAP must, in addition, make a profit for each gap sequence. Instead, the Substantially identical polypeptide inserted of the length of the gap times the gap extension may exhibit greater or lesser levels of p-coumaroyl-CoA: penalty. Default gap creation penalty values and gap exten monolignol transferase activity than the p-coumaroyl-CoA: sion penalty values in Version 10 of the Wisconsin Genetics monolignol transferase that includes the SEQID NO:17, 24. Software Package are 8 and 2, respectively. The gap creation 29-45 or 46 sequence, as measured by assays available in the and gap extension penalties can be expressed as an integer art or described herein (see, e.g., Examples). For example, the selected from the group of integers consisting of from 0 to Substantially identical polypeptide may have at least about 100. Thus, for example, the gap creation and gap extension 40%, or at least about 50%, or at least about 60%, or at least penalties can be 0,1,2,3,4,5,6,7,8,9, 10, 15, 20,30,40, 50 about 70%, or at least about 80%, or at least about 90%, or at O. O. least about 95%, or at least about 97%, or at least about 98%, or at least about 100%, or at least about 105%, or at least about 0160 GAP presents one member of the family of best 110%, or at least about 120%, or at least about 130%, or at alignments. There may be many members of this family. GAP least about 140%, or at least about 150%, or at least about displays four figures of merit for alignments: Quality, Ratio, 200% of the activity of the p-coumaroyl-CoA:monolignol Identity and Similarity. The Quality is the metric maximized transferase that includes the SEQID NO:17, 24, 29-45 or 46 in order to align the sequences. Ratio is the quality divided by sequence when measured by similar assay procedures. the number of bases in the shorter segment. Percent Identity is 0.165 Alternatively, substantial identity is present when the percent of the symbols that actually match. Percent Simi second polypeptide is immunologically reactive with anti larity is the percent of the symbols that are similar. Symbols bodies raised against the first polypeptide (e.g., a polypeptide that are across from gaps are ignored. A similarity is scored with the SEQID NO:17, 24, 29-45 or 46 sequence). Thus, a when the scoring matrix value for a pair of symbols is greater polypeptide is Substantially identical to a first polypeptide, for than or equal to 0.50, the similarity threshold. The scoring example, where the two polypeptides differ only by a conser matrix used in Version 10 of the Wisconsin Genetics Software Vative Substitution. In addition, a polypeptide can be substan Package is BLOSUM62 (see, Henikoff and Henikoff, (1989) tially identical to a first polypeptide when they differ by a Proc. Natl. Acad. Sci. USA 89:10915). non-conservative change if the epitope that the antibody rec 0161 Unless otherwise stated, sequence identity/similar ognizes is substantially identical. Polypeptides that are “sub ity values provided herein refer to the value obtained using the stantially similar share sequences as noted above except that US 2016/0046955 A1 Feb. 18, 2016 22

Some residue positions, which are not identical, may differ by from plant fibers by delignification reactions are typically conservative amino acid changes. expensive, can be polluting and generally require use of high 0166 The p-coumaroyl-CoA:monolignol transferase temperatures and harsh chemicals largely because the struc polypeptides of the present invention may include the first 21, ture of lignin is impervious to mild conditions. Plants with 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33,34, 35,36, 37,38, altered lignin structures that could be more readily cleaved 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55, under milder conditions would reduce the costs of papermak 56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71,72, ing and make the production of biofuels more competitive 73,74, 75,76, 77,78, 79,80, 81, 82,83, 84,85, 86, 87, 88,89, with currently existing procedures for producing oil and gas 90,91, 92,93, 94, 95, 96, 97,98 and 99 N-terminal amino acid fuels. residues of the SEQ ID NO:17, 24, 29-45 or 46 sequence 0169 Plants make lignin from a variety of subunits or sequence. Alternatively, the p-coumaroyl-CoA:monolignol monomers that are generally termed monolignols. Such pri transferase polypeptides of the present invention may include mary monolignols include p-coumaryl alcohol, coniferyl the first 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, alcohol, and Sinapyl alcohol. 35,36, 37,38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69, 70,71, 72,73,74, 75,76, 77,78, 79,80, 81, 82, 83, 84,85, OH 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98 and 99 C-terminal amino acid residues of the SEQ ID NO:17, 24, 21 29-45 or 46 sequence. Thep-coumaroyl-CoA:monolignol transferase polypeptides of the present invention may include 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, 38,39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, 72, 73,74, 75,76, 77,78, 79,80, 81,82, 83, 84,85, 86, 87,88, OH 89, 90,91, 92,93, 94, 95, 96, 97,98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, p-coumaryl alcohol and 125 amino acid residues flanking the SEQID NO:29-45 OH or 46 sequence. Lignin 0167 Lignin broadly refers to a biopolymer that is typi cally part of secondary cell walls in plants. Lignin is a com plex moderately cross-linked aromatic polymer (see, e.g., O FIG. 1). Lignin may also be covalently linked to hemicellu loses. Hemicellulose broadly refers to a class of branched OH CH Sugar polymers composed of pentoses and hexoses. Hemicel coniferyl alcohol luloses typically have an amorphous structure with up to OH hundreds or thousands of pentose units and they are generally at least partially soluble in dilute alkali. Cellulose broadly refers to an organic compound with the formula (CHOs) where Z is an integer. Cellulose is a linear polysaccharide that can include linear chains of beta-1-4-linked glucose residues of several hundred to over ten thousand units. 0168 Lignocellulosic biomass represents an abundant, O O inexpensive, and locally available feedstock for conversion to CH, OH CH carbonaceous fuel (e.g., ethanol, biodiesel, biofuel and the like). However, the complex structure of lignin, which Sinapyl alcohol includes ether and carbon-carbonbonds that bind together the various subunits of lignin, and the crosslinking of lignin to Monolignols destined for lignin polymerization in normal other plant cell wall polymers, make it the most recalcitrant of plants can be preacylated with acetate, p-hydroxybenzoate, or plant polymers. Thus, significant quantities of lignin in a p-coumarate (Ralph et al., Phytochem. Rev. 3:29-60 (2004)). biomass can inhibit the efficient usage of plants as a source of p-Coumarates acylate the Y-position of phenylpropanoid side fuels and other commercial products. Gaining access to the chains mainly found in the Syringyl units of lignin. Studies carbohydrate and polysaccharide polymers of plant cells for indicate that monolignols, primarily Sinapyl alcohol, are use as carbon and energy sources therefore requires signifi enzymatically pre-acylated with p-coumarate prior to their cant energy input and often harsh chemical treatments, espe incorporation into lignin, indicating that the monolignol cially when significant amounts of lignin are present. For p-coumarate conjugates, coniferyl p-coumarate and Sinapyl example, papermaking procedures in which lignin is removed p-coumarate, can also be monomer precursors of lignin. US 2016/0046955 A1 Feb. 18, 2016 23

ferulate have not been identified in natural plant lignins, but OH Some types of plants make them as secondary metabolites during, among other things, lignin biosynthesis. Paula et al. Tetrahedron 51: 12453-12462 (1994); Seca et al., Phy tochemistry 56: 759-767 (2001): Hsiao & Chiang, Phy tochemistry 39: 899-902 (1995); Li et al., Planta Med. 72: O 278-280 (2005). The structures of coniferyl ferulate and sinapyl ferulate are shown below. 2 O

OH

O O O

CH, OH CH3 O CH3 Sinapyl p-coumarate While monolignol p-coumarate-derived units may comprise 21 O up to 40% of the lignin in some grass tissues, the p-coumarate moiety from Such conjugates does not enter into the radical coupling (polymerization) reactions occurring during lignifi cations. Instead, the p-coumarate moieties Substantially remain as terminal units with an unsaturated side chain and a O free phenolic group (Ralph et al., J. Am. Chem. Soc. 116: 9448-9456 (1994); Hatfield et al., J. Sci. Food Agric. 79: OH CH3 891-899 (1999)). Thus, the presence of sinapyl p-coumarate coniferyl ferulate conjugates produces a lignin core with terminal p-couma OH rate groups and no new bonds in the backbone of the lignin polymer, resulting in a lignin that is not significantly more easily cleaved. O 0170 In contrast to p-coumarate, ferulate esters do undergo radical coupling reactions underlignification condi O CH tions. Model ferulates, such as the ferulate shown below (where R is CH-CH-CH , a Sugar, a polysaccharide, pectin, cell-wall (arabino)Xylan or other plant component), 21 O readily undergo radical coupling reactions with each other and with lignin monomers and oligomers to form cross linked networks.

O O RO O CH, OH CH Sinapyl ferulate 0172 For example, the feruloyl-CoA:monolignol trans ferases described herein biosynthesize coniferyl ferulate from coniferyl alcohol and feruloyl-CoA as shown below. O

OH CH3 OH ferulate If present during lignification, ferulates can become bound into the lignin by ether, ester and C C bonds. Although such ferulate moieties are no more extractable or cleavable from -- the lignin structure than other lignin units, the ester itself can be readily cleaved. Upon cleavage of such ester bonds, other plant cell wall components can be released. For example, an O arabinoxylan (hemicellulose) chain can be released from a ferulate-mediated lignin attachment by cleaving the ester. OH CH3 0171 Ferulate-monolignol ester conjugates (unlike their coniferyl alcohol p-coumarate analogs). Such as coniferyl ferulate or Sinapyl US 2016/0046955 A1 Feb. 18, 2016 24

-continued within monolignol ferulate-rich lignins can be cleaved by CH3 O milder alkaline and/or acidic conditions than the conditions O typically used to break down the lignin of plants that are not N CoA -e- rich in monolignol ferulates. For example, mildly alkaline conditions involving use of ammonia may be used to cleave the ester bonds within monolignol ferulate-rich lignins, HO whereas such conditions would not cleave substantially any feruloyl-CoA of the ether and carbon-carbon bonds in normal lignins. See OH also, U.S. patent application Ser. No. 12/830.905, filed Jul. 6, 2010 and to U.S. Patent Application Ser. No. 61/213,706, filed Jul. 6, 2009, the contents of both of which are specifi O cally incorporated herein by reference in their entireties.

O CH Transgenic Plants 0177. In order to engineer plants with lignins that contain 21 O significant levels of monolignol ferulates, one of skill in the art can introduce inhibitory or mutating nucleic acids that reduce the expression and/or translation of p-coumaroyl CoA:monolignol transferase. Those of skill in the art can also introduce feruloyl-CoA:monolignol transferases or nucleic acids encoding Such feruloyl-CoA:monolignol transferases O into the plants. OH CH 0.178 For example, one of skill in the art can inject PMT inhibitory or mutating nucleic acids, and/or inject feruloyl coniferyl ferulate CoA:monolignol transferase enzymes into young plants or into plants cells. The incorporation of monolignol ferulates into the lignin of 0179 Alternatively, one of skill in the art can generate plants allows the cell wall materials and lignin to be readily genetically-modified plants that contain mutant (knockout) cleaved or processed into useful products. See also, U.S. PMTorinhibitory PMT nucleic acids, as well as nucleic acids Patent Application No. 61/213,706, the contents of which are encoding feruloyl-CoA:monolignol transferases within their specifically incorporated herein by reference in their entirety. Somatic and/or germ cells. Such genetic modification can be 0173 The monolignol ferulates made by the methods and accomplished by procedures available in the art. For example, feruloyl-CoA:monolignol transferases described herein can one of skill in the art can prepare an expression cassette or be incorporated by radical coupling into plant lignins. Both expression vector that can express one or more PMT inhibi the monolignol and the ferulate moieties can undergo Such tory/mutating nucleic acids and/or one or more encoded feru coupling, resulting in alignin that can be complex. However, loyl-CoA:monolignol transferase enzymes. Plant cells can be such double-ended-incorporation still yields readily cleav transformed by the expression cassette or expression vector, able ester linkages that have been engineered into the back and whole plants (and their seeds) can be generated from the bone of the lignin polymer network. Esters are readily cleaved plant cells that were successfully transformed with the PMT under much less stringent conditions by the same chemical inhibitory/mutating nucleic acids and/or with the feruloyl processes used to cleave lignin, but the lignin resulting from CoA:monolignol transferase nucleic acids. Some procedures the methods described herein is significantly easier to cleave, for making Such genetically modified plants and their seeds and provides more facile and less costly access to the plant are described below. cell wall polysaccharides. See also, “Method for modifying 0180 Promoters: lignin structure using monolignol ferulate conjugates. U.S. 0181. The PMT inhibitory/mutating nucleic acids and/or Patent Application No. 61/213,706. the feruloyl-CoA:monolignol transferase nucleic acids can be 0.174 Lignins can be degraded by chemical or enzymatic operably linked to a promoter, which provides for expression means to yield a variety of Smaller monomers and oligomers. of an inhibitory PMT RNA, a mutant PMT RNA and/or a While enzymatic processes are generally preferred because functional mRNA from the feruloyl-CoA:monolignol trans they do not require high temperatures and harsh chemicals, ferase nucleic acids. The promoter is typically a promoter Such enzymatic processes have previously not been as effec functional in plants and/or seeds, and can be a promoter tive at Solubilizing lignin moieties away from valuable plant functional during plant growth and development. A PMT cell constituents (e.g., polysaccharides and carbohydrates). inhibitory/mutating nucleic acid and/or a feruloyl-CoA: 0.175. According to the invention, plants with the feruloyl monolignol transferase nucleic acid is operably linked to the CoA:monolignol transferase nucleic acids and/or enzymes promoter when it is located downstream from the promoter, to described herein Supply monolignol ferulates for facile ligni thereby form an expression cassette. The PMT inhibitory/ fication in plants, thereby yielding plants with lignins that are mutating nucleic acids can be separately regulated from the more readily cleaved or processed to release cellulose, hemi feruloyl-CoA:monolignol transferase nucleic acids by use of celluloses and lignin breakdown products. separate promoters and/or separate expression cassettes. 0176 Conditions for releasing the cellulose, hemicellulo 0182 Most endogenous genes have regions of DNA that ses and lignin breakdown products from plants containing the are known as promoters, which regulate gene expression. feruloyl-CoA:monolignol transferase nucleic acids and/or Promoter regions are typically found in the flanking DNA enzymes described herein include conditions typically upstream from the coding sequence in both prokaryotic and employed for cleaving ester bonds. Thus, the ester bonds eukaryotic cells. A promoter sequence provides for regulation US 2016/0046955 A1 Feb. 18, 2016 of transcription of the downstream gene sequence and typi (2000)). Briefly, a plasmid containing a promoter such as the cally includes from about 50 to about 2,000 nucleotide base 35S CaMV promoter can be constructed, for example, as pairs. Promoter sequences also contain regulatory sequences described in Jefferson (Plant Molecular Biology Reporter Such as enhancer sequences that can influence the level of 5:387-405 (1987)) or obtained from Clontech Lab in Palo gene expression. Some isolated promoter sequences can pro Alto, Calif. (e.g., pFBI121 or p3I221). Typically, these plas vide for gene expression of heterologous DNAs, that is a mids are constructed to have multiple cloning sites having DNA different from the native or homologous DNA. specificity for different restriction enzymes downstream from 0183 Promoter sequences are also known to be strong or the promoter. The PMT inhibitory/mutating nucleic acid and/ weak, or inducible. A strong promoter provides for a high or feruloyl-CoA:monolignol transferase nucleic acids can be level of gene expression, whereas a weak promoter provides Subcloned downstream from the promoter using restriction for a very low level of gene expression. An inducible pro enzymes and positioned to ensure that the DNA is inserted in moter is a promoter that provides for the turning on and off of proper orientation with respect to the promoter so that the gene expression in response to an exogenously added agent, DNA can be expressed as sense or antisense RNA. Once the or to an environmental or developmental stimulus. For PMT inhibitory/mutating nucleic acid and/or feruloyl-CoA: example, a bacterial promoter such as the P promoter can monolignol transferase nucleic acid is operably linked to a be induced to vary levels of gene expression depending on the promoter, the expression cassette so formed can be subcloned level of isothiopropylgalactoside added to the transformed into a plasmid or other vector (e.g., an expression vector). cells. Promoters can also provide for tissue specific or devel 0187. In some embodiments, a cDNA clone encoding a opmental regulation. An isolated promoter sequence that is a feruloyl-CoA:monolignol transferase protein is employed strong promoter for heterologous DNAS is advantageous that has been isolated from Angelica sinensis root tissue or because it provides for a sufficient level of gene expression for from Hibiscus cannabinus (Kenaf) stem sections. In other easy detection and selection of transformed cells and pro embodiments, cDNA clones from other species that encode a vides for a high level of gene expression when desired. feruloyl-CoA:monolignol transferase protein are isolated 0184 Expression cassettes generally include, but are not from selected plant tissues, or a nucleic acid encoding a limited to, a plant promoter such as the CaMV 35S promoter mutant or modified feruloyl-CoA:monolignol transferase (Odell et al., Nature. 313:810-812 (1985)), or others such as protein is prepared by available methods or as described CaMV 19S (Lawton et al., Plant Molecular Biology: 9:315 herein. For example, the nucleic acid encoding a mutant or 324 (1987)), nos (Ebert et al., Proc. Natl. Acad. Sci. USA. modified feruloyl-CoA:monolignol transferase protein can 84:5745-5749 (1987)), Adh1 (Walker et al., Proc. Natl. Acad. be any nucleic acid with a coding region that hybridizes, for Sci. USA. 84:6624-6628 (1987)), sucrose synthase (Yang et example, to SEQ ID NO: 1 or SEQ ID NO:8 and that has al., Proc. Natl. Acad. Sci. USA. 87:4144-4148 (1990)), C-tu feruloyl-CoA:monolignol transferase activity. bulin, ubiquitin, actin (Wang et al., Mol. Cell. Biol. 12:3399 0188 Using restriction endonucleases, the PMT inhibi (1992)), cab (Sullivan et al., Mol. Gen. Genet. 215:431 tory/mutating nucleic acid and/or the entire coding sequence (1989)), PEPCase (Hudspeth et al., Plant Molecular Biology. for the feruloyl-CoA:monolignol transferase can be sub 12:579-589 (1989)) or those associated with the R gene com cloned downstream of the promoter in a 5' to 3' sense orien plex (Chandler et al., The Plant Cell. 1:1175-1183 (1989)). Further suitable promoters include the poplar xylem-specific tation. secondary cell wall specific cellulose synthase 8 promoter, 0189 Targeting Sequences: cauliflower mosaic virus promoter, the Z10 promoter from a 0190. Additionally, expression cassettes can be con gene encoding a 10 kD Zein protein, a Z27 promoter from a structed and employed to target the PMT inhibitory nucleic gene encoding a 27 kD Zein protein, inducible promoters, acids and/or feruloyl-CoA:monolignol transferase nucleic such as the light inducible promoter derived from the pearbcS acids to an intracellular compartment within plant cells or to gene (Coruzzi et al., EMBO.J. 3:1671 (1971)) and the actin direct an encoded protein to the extracellular environment. promoter from rice (McElroy et al., The Plant Cell. 2:163-171 This can generally be achieved by joining a DNA sequence (1990)). Seed specific promoters, such as the phaseolin pro encoding a transit or signal peptide sequence to the coding moter from beans, may also be used (Sengupta-Gopalan, sequence of the PMT inhibitory nucleic acid and/or feruloyl Proc. Natl. Acad. Sci. USA. 83:3320-3324 (1985). Other pro CoA:monolignol transferase nucleic acid. The resultant tran moters useful in the practice of the invention are known to sit, or signal, peptide will transport the protein to a particular those of skill in the art. intracellular, or extracellular destination, respectively, and 0185. Alternatively, novel tissue specific promoter can then be posttranslational removed. Transit peptides act by sequences may be employed in the practice of the present facilitating the transport of proteins through intracellular invention. cDNA clones from a particular tissue are isolated membranes, e.g., vacuole, Vesicle, plastid and mitochondrial and those clones which are expressed specifically in that membranes, whereas signal peptides direct proteins through tissue are identified, for example, using Northern blotting. the extracellular membrane. By facilitating transport of the Preferably, the gene isolated is not present in a high copy protein into compartments inside or outside the cell, these number, but is relatively abundant in specific tissues. The promoter and control elements of corresponding genomic sequences can increase the accumulation of a particular gene clones can then be localized using techniques well known to product in a particular location. For example, see U.S. Pat. those of skill in the art. No. 5,258,300. 0186 A PMT inhibitory/mutating nucleic acid and/or a 0191 In general, PMT mutating nucleic acids are directed feruloyl-CoA:monolignol transferase nucleic acid can be to the nucleus of a plant cell. combined with the promoter by standard methods to yield an (0192 3' Sequences: expression cassette, for example, as described in Sambrooket 0193 When the expression cassette is to be introduced al. (MOLECULAR CLONING: A LABORATORY MANUAL. Second Edi into a plant cell, the expression cassette can also optionally tion (Cold Spring Harbor, N.Y.: Cold Spring Harbor Press include 3' nontranslated plant regulatory DNA sequences that (1989); MoLECULAR CLONING: A LABORATORY MANUAL. Third act as a signal to terminate transcription and allow for the Edition (Cold Spring Harbor, N.Y.: Cold Spring Harbor Press polyadenylation of the resultant mRNA. The 3' nontranslated US 2016/0046955 A1 Feb. 18, 2016 26 regulatory DNA sequence preferably includes from about The Plant Cell. 2:785-793 (1990)) is well characterized in 300 to 1,000 nucleotide base pairs and contains plant tran terms of molecular biology, expression, and protein structure Scriptional and translational termination sequences. For and therefore can readily be employed. However, any one of example, 3' elements that can be used include those derived a variety of extensins and/or glycine-rich wall proteins from the nopaline synthase gene of Agrobacterium tumefa (Keller et al., EMBO.J. 8:1309-1314 (1989)) could be modi ciens (Bevan et al., Nucleic Acid Research. 11:369-385 fied by the addition of an antigenic site to create a screenable (1983)), or the terminator sequences for the T7 transcript marker. from the octopine synthase gene of Agrobacterium tumefa 0199 Elements of the present disclosure are exemplified ciens, and/or the 3' end of the protease inhibitor I or II genes in detail through the use of particular marker genes. However from potato or tomato. Other 3' elements known to those of in light of this disclosure, numerous other possible selectable skill in the art can also be employed. These 3' nontranslated and/or screenable marker genes will be apparent to those of regulatory sequences can be obtained as described in An skill in the art in addition to the one set forth herein below. (Methods in Enzymology. 153:292 (1987)). Many such 3 Therefore, it will be understood that the following discussion nontranslated regulatory sequences are already present in is exemplary rather than exhaustive. In light of the techniques plasmids available from commercial sources such as Clon disclosed herein and the general recombinant techniques that tech, Palo Alto, Calif. The 3' nontranslated regulatory are known in the art, the present invention readily allows the sequences can be operably linked to the 3' terminus of the introduction of any gene, including marker genes, into a PMT inhibitory nucleic acids and/or feruloyl-CoA:monoli recipient cell to generate a transformed plant cell, e.g., a gnol transferase nucleic acids by standard methods. monocot cell or dicot cell. 0194 Selectable and Screenable Marker Sequences: 0200 Possible selectable markers for use include, but are 0.195. In order to improve identification of transformants, not limited to, a neogene (Potrykus et al., Mol. Gen. Genet. a selectable or screenable marker gene can be employed with 199:183-188 (1985)) which codes for kanamycin resistance the PMT inhibitory/mutating nucleic acids and/or the feru and can be selected for using kanamycin, G418, and the like; loyl-CoA:monolignol transferase nucleic acids. For example, a bar gene which codes forbialaphos resistance; a gene which a mutating nucleic acid can include the coding region of a encodes an altered EPSP synthase protein (Hinchee et al., marker gene as its non-PMT segment. “Marker genes' are Bio/Technology. 6:915-922 (1988)) thus conferring glypho genes that impart a distinct phenotype to cells expressing the sate resistance; a nitrilase gene Such as bXn from Klebsiella marker gene and thus allow Such transformed cells to be Ozaenae which confers resistance to bromoxynil (Stalker et distinguished from cells that do not have the marker. Such al., Science. 242:419–423 (1988)); a mutant acetolactate syn genes may encode either a selectable or screenable marker, thase gene (ALS) which confers resistance to imidazolinone, depending on whether the marker confers a trait which one sulfonylurea or other ALS-inhibiting chemicals (European can select for by chemical means, i.e., through the use of a Patent Application 154.204 (1985)); a methotrexate-resistant selective agent (e.g., a herbicide, antibiotic, or the like), or DHFR gene (Thillet et al., J. Biol. Chem. 263:12500-12508 whether it is simply a trait that one can identify through (1988)); a dalapon dehalogenase gene that confers resistance observation or testing, i.e., by screening (e.g., the R-locus to the herbicide dalapon; or a mutated anthranilate synthase trait). Of course, many examples of suitable marker genes are gene that confers resistance to 5-methyl tryptophan. Where a known to the art and can be employed in the practice of the mutant EPSP synthase gene is employed, additional benefit invention. may be realized through the incorporation of a suitable chlo 0196. Included within the terms selectable or screenable roplast transit peptide, CTP (European Patent Application 0 marker genes are also genes which encode a “secretable 218571 (1987)). marker whose secretion can be detected as a means of iden 0201 An illustrative embodiment of a selectable marker tifying or selecting for transformed cells. Examples include gene capable of being used in Systems to select transformants markers which encode a secretable antigen that can be iden is the gene that encode the enzyme phosphinothricin acetyl tified by antibody interaction, or secretable enzymes that can transferase, such as the bar gene from Streptomyces hygro be detected by their catalytic activity. Secretable proteins fall scopicus or the pat gene from Streptomyces viridochromoge into a number of classes, including Small, diffusible proteins nes (U.S. Pat. No. 5,550.318). The enzyme phosphinothricin detectable, e.g., by ELISA; and proteins that are inserted or acetyl transferase (PAT) inactivates the active ingredient in trapped in the cell wall (e.g., proteins that include a leader the herbicide bialaphos, phosphinothricin (PPT). PPT inhib sequence such as that found in the expression unit of extensin its glutamine synthetase, (Murakami et al., Mol. Gen. Genet. or tobacco PR-S). 205:42-50 (1986): Twell et al., Plant Physiol. 91: 1270-1274 0.197 With regard to selectable secretable markers, the use (1989)) causing rapid accumulation of ammonia and cell of a gene that encodes a polypeptide that becomes seques death. The Success in using this selective system in conjunc tered in the cell wall, where the polypeptide includes a unique tion with monocots was Surprising because of the major dif epitope may be advantageous. Such a secreted antigenmarker ficulties that have been reported in transformation of cereals can employ an epitope sequence that would provide low (Potrykus, Trends Biotech. 7:269-273 (1989)). background in plant tissue, a promoter-leader sequence that 0202 Screenable markers that may be employed include, imparts efficient expression and targeting across the plasma but are not limited to, a B-glucuronidase or uidA gene (GUS) membrane, and can produce protein that is bound in the cell that encodes an enzyme for which various chromogenic Sub wall and yet is accessible to antibodies. A normally secreted strates are known; an R-locus gene, which encodes a product wall protein modified to include a unique epitope would that regulates the production of anthocyanin pigments (red satisfy Such requirements. color) in plant tissues (Dellaporta et al., In: Chromosome 0198 Examples of proteins suitable for modification in Structure and Function: Impact of New Concepts, 18' Sta this manner include extensin or hydroxyproline rich glyco dler Genetics Symposium, J. P. Gustafson and R. Appels, eds. protein (HPRG). For example, the maize HPRG (Stiefelet al., (New York: Plenum Press) pp. 263-282 (1988)); a B-lacta US 2016/0046955 A1 Feb. 18, 2016 27 mase gene (Sutcliffe, Proc. Natl. Acad. Sci. USA. 75:3737 population screening for bioluminescence, Such as on tissue 3741 (1978)), which encodes an enzyme for which various culture plates, or even for whole plant screening. chromogenic Substrates are known (e.g., PADAC, a chro 0206. Other Optional Sequences: mogenic cephalosporin); a xyl gene (Zukowsky et al., Proc. 0207. An expression cassette of the invention can also Natl. Acad. Sci. USA. 80: 1101 (1983)) which encodes a cat further comprise plasmid DNA. Plasmid vectors include echol dioxygenase that can convert chromogenic catechols; additional DNA sequences that provide for easy selection, an O-amylase gene (Ikuta et al., Bio/technology 8:241-242 amplification, and transformation of the expression cassette (1990)); a tyrosinase gene (Katz et al., J. Gen. Microbiol. in prokaryotic and eukaryotic cells, e.g. pUC-derived vectors 129:2703-2714 (1983)) which encodes an enzyme capable of such as puC8, puC9, puC18, puC19, puC23, puC119, and oxidizing tyrosine to DOPA and dopaquinone which in turn pUC120, pSK-derived vectors, pGEM-derived vectors, pSP condenses to form the easily detectable compound melanin; a derived vectors, or plBS-derived vectors. The additional DNA B-galactosidase gene, which encodes an enzyme for which sequences include origins of replication to provide for there are chromogenic Substrates; a luciferase (lux) gene (Ow autonomous replication of the vector, additional selectable et al., Science. 234:856-859. 1986), which allows for biolu marker genes, preferably encoding antibiotic or herbicide minescence detection; or an aequorin gene (Prasher et al., resistance, unique multiple cloning sites providing for mul Biochem. Biophys. Res. Comm. 126:1259-1268 (1985)), tiple sites to insert DNA sequences or genes encoded in the which may be employed in calcium-sensitive biolumines expression cassette and sequences that enhance transforma cence detection, or agreen or yellow fluorescent protein gene tion of prokaryotic and eukaryotic cells. (Niedz et al., Plant Cell Reports. 14:403 (1995). 0208 Another vector that is useful for expression in both 0203 For example, genes from the maize R gene complex plant and prokaryotic cells is the binary Tiplasmid (as dis can be used as screenable markers. The R gene complex in closed in Schilperoort et al., U.S. Pat. No. 4,940,838) as maize encodes a protein that acts to regulate the production of exemplified by vector pGA582. This binary Tiplasmid vector anthocyanin pigments in most seed and plant tissue. Maize has been previously characterized by An (Methods in Enzy strains can have one, or as many as four, Ralleles that com mology. 153:292 (1987)). This binary Ti vector can be repli bine to regulate pigmentation in a developmental and tissue cated in prokaryotic bacteria Such as E. coli and Agrobacte specific manner. A gene from the R gene complex does not rium. The Agrobacterium plasmid vectors can be used to harm the transformed cells. Thus, an R gene introduced into transfer the expression cassette to dicot plant cells, and under Such cells will cause the expression of a red pigment and, if certain conditions to monocot cells, such as rice cells. The stably incorporated, can be visually scored as a red sector. If binary Tivectors preferably include thenopaline TDNA right a maize line carries dominant alleles for genes encoding the and left borders to provide for efficient plant cell transforma enzymatic intermediates in the anthocyanin biosynthetic tion, a selectable marker gene, unique multiple cloning sites pathway (C2, A1, A2, BZ1 and BZ2), but carries a recessive in the T border regions, the co/E1 replication of origin and a allele at the R locus, transformation of any cell from that line wide host range replicon. The binary Ti vectors carrying an with R will result in red pigment formation. Exemplary lines expression cassette of the invention can be used to transform include Wisconsin 22 that contains the rg-Stadler allele and both prokaryotic and eukaryotic cells, but is preferably used TR112, a K55 derivative that is r-g, b. Pl. Alternatively any to transform dicot plant cells. genotype of maize can be utilized if the C1 and Ralleles are 0209. In Vitro Screening of Expression Cassettes: introduced together. 0210. Once the expression cassette is constructed and sub cloned into a suitable plasmid, it can be screened for the 0204 The R gene regulatory regions may be employed in ability to express the encoded feruloyl-CoA:monolignol chimeric constructs in order to provide mechanisms for con transferases and/or to substantially reduce or inhibit the trolling the expression of chimeric genes. More diversity of expression or translation of a mRNA coding the p-couma phenotypic expression is known at the R locus than at any royl-CoA:monolignol transferase by standard methods. For other locus (Coe et al., in Corn and Corn Improvement, eds. example, for hybrid selection or arrested translation of p-cou Sprague, G. F. & Dudley, J. W. (Am. Soc. Agron. Madison, maroyl-CoA:monolignol transferase mRNA, a preselected Wis.), pp. 81-258 (1988)). It is contemplated that regulatory inhibitory nucleic acid sequence can be subcloned into a regions obtained from regions 5' to the structural R gene can selected expression cassette or vector (e.g., a SP6/T7 contain be useful in directing the expression of genes, e.g., insect ing plasmid, which is supplied by ProMega Corp.). For trans resistance, drought resistance, herbicide tolerance or other formation of plants cells, Suitable vectors include plasmids protein coding regions. In some embodiments, any of the such as described herein. Typically, hybrid arrest translation various R gene family members may be successfully is an in vitro assay that measures the inhibition of translation employed (e.g., P. S. Lc, etc.). However, one that can be used of an mRNA encoding the p-coumaroyl-CoA:monolignol is Sn (particularly Sn:bol3). Sn is a dominant member of the transferase. This screening method can also be used to select R gene complex and is functionally similar to the Rand Bloci and identify more effective PMT inhibitory nucleic acid. A in that Sn controls the tissue specific deposition of anthocya nonsense nucleic acid can be expressed from an expression nin pigments in certain seedling and plant cells, therefore, its cassette that is introduced into plants or plants cells as a phenotype is similar to R. control. The phenotypes of the control and test cells or plants 0205. A further screenable marker contemplated for use in can also be assessed. the present invention is firefly luciferase, encoded by the lux 0211 DNA Delivery of the DNA Molecules into Host gene. The presence of the luxgene in transformed cells may Cells: be detected using, for example, X-ray film, Scintillation 0212. The present invention generally includes steps counting, fluorescent spectrophotometry, low-light video directed to introducing a PMT inhibitory/mutating nucleic cameras, photon counting cameras or multiwell luminometry. acid and/or feruloyl-CoA:monolignol transferase nucleic It is also envisioned that this system may be developed for acids into a recipient cell to create a transformed cell. The US 2016/0046955 A1 Feb. 18, 2016 28 frequency of occurrence of cells taking up exogenous (for WO95/06128. Furthermore, methods for transformation of eign) DNA may below. Moreover, it is most likely that not all monocotyledonous plants utilizing Agrobacterium tumefa recipient cells receiving DNA segments or sequences will ciens have been described by Hiei et al. (European Patent 0 result in a transformed cell wherein the DNA is stably inte 604 662, 1994) and Saito et al. (European Patent 0 672 752, grated into the plant genome and/or expressed. Some may 1995). show only initial and transient gene expression. However, 0216 Methods such as microprojectile bombardment or certain cells from virtually any dicot or monocot species may electroporation are carried out with “naked DNA where the be stably transformed, and these cells regenerated into trans expression cassette may be simply carried on any E. coli genic plants, through the application of the techniques dis derived plasmid cloning vector. In the case of viral vectors, it closed herein. is desirable that the system retain replication functions, but 0213 Another aspect of the invention is a plant species lack functions for disease induction. with lignin containing monolignol ferulates (e.g., coniferyl 0217. The choice of plant tissue source for transformation ferulate), wherein the plant has an endogenous PMT knock will depend on the nature of the host plant and the transfor out and/or has an introduced PMT inhibitory nucleic acid mation protocol. Useful tissue sources include callus, Suspen and/or an introduced feruloyl-CoA:monolignol transferase sion culture cells, protoplasts, leaf segments, stem segments, nucleic acid. The plant can be a monocotyledon or a dicoty tassels, pollen, embryos, hypocotyls, tuber segments, mer ledon. Another aspect of the invention includes plant cells istematic regions, and the like. The tissue source is selected (e.g., embryonic cells or other cell lines) that can regenerate and transformed so that it retains the ability to regenerate fertile transgenic plants and/or seeds. The cells can be derived whole, fertile plants following transformation, i.e., contains from either monocotyledons or dicotyledons. Suitable totipotent cells. Type I or Type II embryonic maize callus and examples of plant species include wheat, rice, Arabidopsis, immature embryos are preferred Zea mays tissue sources. tobacco, maize, soybean, and the like. In some embodiments, Selection of tissue sources for transformation of monocots is the plant or cell is a monocotyledon plant or cell. For example, described in detail in U.S. application Ser. No. 08/112.245 the plant or cell can be a grass (e.g., maize) plant or cell. The and PCT publication WO95/06128. cell(s) may be in a suspension cell culture or may be in an 0218. The transformation is carried out under conditions intact plant part, Such as an immature embryo, or in a special directed to the plant tissue of choice. The plant cells or tissue ized plant tissue. Such as callus, Such as Type I or Type II are exposed to the DNA or RNA carrying the PMT mutating callus. or inhibitory nucleic acid(s), and/or the feruloyl-CoA:mono 0214 Transformation of the cells of the plant tissue source lignol transferase nucleic acids for an effective period of time. can be conducted by any one of a number of methods known This may range from a less than one second pulse of electric to those of skill in the art. Examples are: Transformation by ity for electroporation to a 2-3 day co-cultivation in the pres direct DNA transfer into plant cells by electroporation (U.S. ence of plasmid-bearing Agrobacterium cells. Buffers and Pat. No. 5,384,253 and U.S. Pat. No. 5,472,869, Dekeyser et media used will also vary with the plant tissue source and al., The Plant Cell. 2:591-602 (1990)); direct DNA transfer to transformation protocol. Many transformation protocols plant cells by PEG precipitation (Hayashimoto et al., Plant employ a feeder layer of suspended culture cells (tobacco or Physiol. 93:857-863 (1990)); direct DNA transfer to plant Black Mexican Sweet corn, for example) on the surface of cells by microprojectile bombardment (McCabe et al., Bio/ solid media plates, separated by a sterile filter paper disk from Technology. 6:923-926 (1988); Gordon-Kamm et al., The the plant cells or tissues being transformed. Plant Cell. 2:603-618 (1990); U.S. Pat. No. 5,489,520; U.S. 0219 Electroporation: Pat. No. 5,538,877; and U.S. Pat. No. 5,538,880) and DNA 0220. Where one wishes to introduce DNA by means of transfer to plant cells via infection with Agrobacterium. electroporation, it is contemplated that the method of Methods such as microprojectile bombardment or electropo Krzyzek et al. (U.S. Pat. No. 5,384.253) may be advanta ration can be carried out with “naked DNA where the expres geous. In this method, certain cell wall-degrading enzymes, sion cassette may be simply carried on any E. coli-derived Such as pectin-degrading enzymes, are employed to render plasmid cloning vector. In the case of viral vectors, it is the target recipient cells more Susceptible to transformation desirable that the system retain replication functions, but lack by electroporation than untreated cells. Alternatively, recipi functions for disease induction. ent cells can be made more Susceptible to transformation, by 0215 One method for dicot transformation, for example, mechanical wounding. involves infection of plant cells with Agrobacterium tumefa 0221) To effect transformation by electroporation, one ciens using the leaf-disk protocol (Horsch et al., Science may employ either friable tissues such as a Suspension cell 227: 1229-1231 (1985). Monocots such as grasses can be cultures, or embryogenic callus, or alternatively, one may transformed via microprojectile bombardment of embryo transform immature embryos or other organized tissues genic callus tissue or immature embryos, or by electropora directly. The cell walls of the preselected cells or organs can tion following partial enzymatic degradation of the cell wall be partially degraded by exposing them to pectin-degrading with a pectinase-containing enzyme (U.S. Pat. No. 5,384. enzymes (pectinases or pectolyases) or mechanically wound 253; and U.S. Pat. No. 5,472,869). For example, embryogenic ing them in a controlled manner. Such cells would then be cell lines derived from immature Zea mays embryos can be receptive to DNA uptake by electroporation, which may be transformed by accelerated particle treatment as described by carried out at this stage, and transformed cells then identified Gordon-Kamm et al. (The Plant Cell. 2:603-618 (1990)) or by a suitable selection or screening protocol dependent on the U.S. Pat. No. 5,489,520; U.S. Pat. No. 5,538,877 and U.S. nature of the newly incorporated DNA. Pat. No. 5,538,880, cited above. Excised immature embryos 0222 Microprojectile Bombardment: can also be used as the target for transformation prior to tissue 0223) A further advantageous method for delivering trans culture induction, selection and regeneration as described in forming DNA segments to plant cells is microprojectile bom U.S. application Ser. No. 08/112,245 and PCT publication bardment. In this method, microparticles may be coated with US 2016/0046955 A1 Feb. 18, 2016 29

DNA and delivered into cells by a propelling force. Exem ated with bombardment, and also the nature of the transform plary particles include those comprised of tungsten, gold, ing DNA, such as linearized DNA or intact supercoiled plas platinum, and the like. mid DNA. 0224. It is contemplated that in some instances DNA pre 0228. One may wish to adjust various bombardment cipitation onto metal particles would not be necessary for parameters in Small scale studies to fully optimize the condi DNA delivery to a recipient cell using microprojectile bom tions and/or to adjust physical parameters such as gap dis bardment. In an illustrative embodiment, non-embryogenic tance, flight distance, tissue distance, and helium pressure. Black Mexican Sweet (BMS) cells were bombarded with One may also minimize the trauma reduction factors (TRFs) intact cells of the bacteria E. coli or Agrobacterium tumefa by modifying conditions which influence the physiological ciens containing plasmids with either the B-glucoronidase or state of the recipient cells and which may therefore influence bar gene engineered for expression in maize. Bacteria were transformation and integration efficiencies. For example, the inactivated by ethanol dehydration prior to bombardment. A osmotic state, tissue hydration and the Subculture stage or cell low level of transient expression of the B-glucoronidase gene cycle of the recipient cells may be adjusted for optimum was observed 24–48 hours following DNA delivery. In addi transformation. Execution of such routine adjustments will be tion, stable transformants containing the bar gene were recov known to those of skill in the art. ered following bombardment with either E. coli or Agrobac 0229. An Example of Production and Characterization of terium tumefaciens cells. It is contemplated that particles may Stable Transgenic Maize: contain DNA rather than be coated with DNA. Hence it is 0230. After effecting delivery of the PMT mutating proposed that particles may increase the level of DNA deliv nucleic acids, PMT inhibitory nucleic acid(s) and/or the feru ery but are not, in and of themselves, necessary to introduce loyl-CoA:monolignol transferase nucleic acid(s) to recipient DNA into plant cells. cells by any of the methods discussed above, the transformed 0225. An advantage of microprojectile bombardment, in cells can be identified for further culturing and plant regen addition to it being an effective means of reproducibly stably eration. As mentioned above, in order to improve the ability to transforming monocots, is that the isolation of protoplasts identify transformants, one may desire to employ a selectable (Christou et al., PNAS. 84:3962-3966 (1987)), the formation or screenable marker gene as, or in addition to, the PMT of partially degraded cells, or the Susceptibility to Agrobac mutating/inhibitory nucleic acid(s) and/or the feruloyl-CoA: terium infection is not required. An illustrative embodiment monolignol transferase nucleic acids. In this case, one would of a method for delivering DNA into maize cells by accelera then generally assay the potentially transformed cell popula tion is a Biolistics Particle Delivery System, which can be tion by exposing the cells to a selective agent or agents, or one used to propel particles coated with DNA or cells through a would screen the cells for the desired marker gene trait. screen, such as a stainless steel or Nytex screen, onto a filter 0231. Selection: Surface covered with maize cells cultured in Suspension (Gor 0232 An exemplary embodiment of methods for identi don-Kamm et al., The Plant Cell. 2:603-618 (1990)). The fying transformed cells involves exposing the bombarded screen disperses the particles so that they are not delivered to cultures to a selective agent, such as a metabolic inhibitor, an the recipient cells in large aggregates. It is believed that a antibiotic, herbicide or the like. Cells which have been trans screen intervening between the projectile apparatus and the formed and have stably integrated a marker gene conferring cells to be bombarded reduces the size of projectile aggregate resistance to the selective agent used, will grow and divide in and may contribute to a higher frequency of transformation, culture. Sensitive cells will not be amenable to further cultur by reducing damage inflicted on the recipient cells by an 1ng. aggregated projectile. 0233. To use the bar-bialaphos or the EPSPS-glyphosate 0226 For bombardment, cells in suspension are prefer selective system, bombarded tissue is cultured for about 0-28 ably concentrated on filters or solid culture medium. Alterna days on nonselective medium and Subsequently transferred to tively, immature embryos or other target cells may be medium containing from about 1-3 mg/l bialaphos or about arranged on solid culture medium. The cells to be bombarded 1-3 mM glyphosate, as appropriate. While ranges of about 1-3 are positioned at an appropriate distance below the macro mg/l bialaphos or about 1-3 mM glyphosate can be employed, projectile stopping plate. If desired, one or more screens are it is proposed that ranges of at least about 0.1-50 mg/l biala also positioned between the acceleration device and the cells phos or at least about 0.1-50 mM glyphosate will find utility to be bombarded. Through the use of techniques set forth in the practice of the invention. Tissue can be placed on any here-in one may obtain up to 1000 or more foci of cells porous, inert, Solid or semi-solid Support for bombardment, transiently expressing a marker gene. The number of cells in including but not limited to filters and solid culture medium. a focus which express the exogenous gene product 48 hours Bialaphos and glyphosate are provided as examples of agents post-bombardment often range from about 1 to 10 and aver suitable for selection of transformants, but the technique of age about 1 to 3. this invention is not limited to them. 0227. In bombardment transformation, one may optimize 0234. An example of a screenable marker trait is the red the prebombardment culturing conditions and the bombard pigment produced under the control of the R-locus in maize. ment parameters to yield the maximum numbers of stable This pigment may be detected by culturing cells on a solid transformants. Both the physical and biological parameters Support containing nutrient media capable of Supporting for bombardment can influence transformation frequency. growth at this stage and selecting cells from colonies (visible Physical factors are those that involve manipulating the DNA/ aggregates of cells) that are pigmented. These cells may be microprojectile precipitate or those that affect the path and cultured further, either in suspension or on solid media. The velocity of either the macro- or microprojectiles. Biological R-locus is useful for selection of transformants from bom factors include all steps involved in manipulation of cells barded immature embryos. In a similar fashion, the introduc before and immediately after bombardment, the osmotic tion of the C1 and B genes will result in pigmented cells adjustment of target cells to help alleviate the trauma associ and/or tissues. US 2016/0046955 A1 Feb. 18, 2016 30

0235. The enzyme luciferase is also useful as a screenable Some cases, pollen from plants of these inbred lines is used to marker. In the presence of the substrate luciferin, cells pollinate regenerated plants. The trait is genetically charac expressing luciferase emit light which can be detected on terized by evaluating the segregation of the trait in first and photographic or X-ray film, in a luminometer (or liquid Scin later generation progeny. The heritability and expression in tillation counter), by devices that enhance night vision, or by plants of traits selected in tissue culture are of particular a highly light sensitive video camera, Such as a photon count importance if the traits are to be commercially useful. ing camera. All of these assays are nondestructive and trans 0241 Regenerated plants can be repeatedly crossed to formed cells may be cultured further following identification. inbred plants in order to introgress the feruloyl-CoA:mono The photon counting camera is especially valuable as it lignol transferase nucleic acids and/or the mutant (e.g. knock allows one to identify specific cells or groups of cells which out) endogenous PMT gene into the genome of inbred plants. are expressing luciferase and manipulate those in real time. In Some embodiments, regenerated plants can also be crossed 0236. It is further contemplated that combinations of with inbred plants to introgress the PMT knockout or PMT screenable and selectable markers may be useful for identi inhibitory nucleic acid(s) into the genome of the plants. This fication of transformed cells. For example, selection with a process is referred to as backcross conversion. When a suffi growth inhibiting compound. Such as bialaphos or glyphosate cient number of crosses to the recurrent inbred parent have at concentrations below those that cause 100% inhibition been completed in order to produce a product of the backcross followed by Screening of growing tissue for expression of a conversion process that is substantially isogenic with the screenable marker gene Such as luciferase would allow one to recurrent inbred parent except for the presence of the intro recover transformants from cell or tissue types that are not duced PMT knockout or PMT inhibitory nucleic acid(s) and/ amenable to selection alone. In an illustrative embodiment or feruloyl-CoA:monolignol transferase nucleic acids, the embryogenic Type II callus of Zea mays L. can be selected plant is self-pollinated at least once in order to produce a with sub-lethal levels of bialaphos. Slowly growing tissue homozygous backcross converted inbred containing the PMT was Subsequently screened for expression of the luciferase knockout or PMT inhibitory nucleic acid(s) and/or feruloyl gene and transformants can be identified. CoA:monolignol transferase nucleic acids. Progeny of these 0237 Regeneration and Seed Production: plants are true breeding. 0238 Cells that survive the exposure to the selective 0242 Alternatively, seed from transformed monocot agent, or cells that have been scored positive in a screening plants regenerated from transformed tissue cultures is grown assay, are cultured in media that Supports regeneration of in the field and self-pollinated to generate true breeding plants. One example of a growth regulator that can be used for plants. Such purposes is dicamba or 2,4-D. However, other growth 0243 Seed from the fertile transgenic plants can then be regulators may be employed, including NAA, NAA+2,4-D or evaluated for the presence and/or expression of the feruloyl perhaps even picloram. Media improvement in these and like CoA:monolignol transferase nucleic acids (or the feruloyl ways can facilitate the growth of cells at specific developmen CoA:monolignol transferase enzyme). Seed from the fertile tal stages. Tissue can be maintained on a basic media with transgenic plants can then be evaluated for the presence and/ growth regulators until Sufficient tissue is available to begin or expression of the PMT knockout mutation or the PMT plant regeneration efforts, or following repeated rounds of inhibitory nucleic acid(s). Transgenic plant and/or seed tissue manual selection, until the morphology of the tissue is Suit can be analyzed for the PMT knockout mutation or the PMT able for regeneration, at least two weeks, then transferred to inhibitory nucleic acid(s) and/or feruloyl-CoA:monolignol media conducive to maturation of embryoids. Cultures are transferase expression using standard methods such as SDS typically transferred every two weeks on this medium. Shoot polyacrylamide gel electrophoresis, liquid chromatography development signals the time to transfer to medium lacking (e.g., HPLC) or other means of detecting a product of feru growth regulators. loyl-CoA:monolignol transferase activity (e.g., coniferyl 0239. The transformed cells, identified by selection or ferulate). screening and cultured in an appropriate medium that Sup 0244. Once a transgenic seed containing the PMT knock ports regeneration, can then be allowed to mature into plants. out mutation or the PMT inhibitory nucleic acid(s) and/or Developing plantlets are transferred to Soilless plant growth feruloyl-CoA:monolignol transferase nucleic acid(s), and mix, and hardened, e.g., in an environmentally controlled having an increase in monolignol ferulates in the lignin of the chamber at about 85% relative humidity, about 600 ppm CO, plant is identified, the seed can be used to develop true breed and at about 25-250 microeinsteins/sec moflight. Plants can ing plants. The true breeding plants are used to develop a line be matured either in a growth chamber or greenhouse. Plants of plants with an increase in the percent of monolignol feru are regenerated from about 6 weeks to 10 months after a lates in the lignin of the plant while still maintaining other transformant is identified, depending on the initial tissue. desirable functional agronomic traits. Adding the trait of During regeneration, cells are grown on Solid media in tissue increased monolignol ferulate production in the lignin of the culture vessels. Illustrative embodiments of such vessels are plant can be accomplished by back-crossing with this trait petri dishes and Plant ConTM. Regenerating plants can be and with plants that do not exhibit this trait and studying the grown at about 19°C. to 28°C. After the regenerating plants pattern of inheritance in segregating generations. Those have reached the stage of shoot and root development, they plants expressing the target trait in a dominant fashion are may be transferred to a greenhouse for further growth and preferably selected. Back-crossing is carried out by crossing testing. the original fertile transgenic plants with a plant from an 0240 Mature plants are then obtained from cell lines that inbred line exhibiting desirable functional agronomic char are known to express the trait. In some embodiments, the acteristics while not necessarily expressing the trait of an regenerated plants are self pollinated. In addition, pollen increased percent of monolignol ferulates in the lignin of the obtained from the regenerated plants can be crossed to seed plant. The resulting progeny are then crossed back to the grown plants of agronomically important inbred lines. In parent that expresses the increased monolignol ferulate trait. US 2016/0046955 A1 Feb. 18, 2016

The progeny from this cross will also segregate so that some RNA for analysis can be obtained from those tissues. PCR of the progeny carry the trait and some do not. This back techniques may also be used for detection and quantification crossing is repeated until an inbred line with the desirable of RNA produced from the PMT knockout mutant gene or the functional agronomic traits, and with expression of the trait introduced PMT inhibitory nucleic acid(s) and/or the intro involving an increase in monolignol ferulates (e.g., coniferyl duced feruloyl-CoA:monolignol transferase nucleic acids. ferulate) within the lignin of the plant. Such expression of the PCR also be used to reverse transcribe RNA into DNA, using increased percentage of monolignol ferulates in plant lignin enzymes such as reverse transcriptase, and then this DNA can can be expressed in a dominant fashion. be amplified through the use of conventional PCR techniques. 0245 Subsequent to back-crossing, the new transgenic Further information about the nature of the RNA product may plants can be evaluated for an increase in the weight percent be obtained by Northern blotting. This technique will dem of monolignol ferulates incorporated into the lignin of the onstrate the presence of an RNA species and give information plant. This can be done, for example, by NMR analysis of about the integrity of that RNA. The presence or absence of an whole plant cell walls (Kim, H., and Ralph, J. Solution-state RNA species can also be determined using dot or slot blot 2D NMR of ball-milled plant cell wall gels in DMSO-d/ Northern hybridizations. These techniques are modifications pyridine-ds. (2010) Org. Biomol. Chem. 8(3), 576-591;Yelle, of Northern blotting and also demonstrate the presence or D. J., Ralph, J., and Frihart, C. R. Characterization of non absence of an RNA species. derivatized plant cell walls using high-resolution solution (0250 While Southern blotting and PCR may be used to state NMR spectroscopy. (2008) Magn. Reson. Chem. 46(6), detect the PMT knockout mutation or the PMT inhibitory 508-517; Kim, H., Ralph, J., and Akiyama, T. Solution-state nucleic acid(s) and/or the feruloyl-CoA:monolignol trans 2D NMR of Ball-milled Plant Cell Wall Gels in DMSO-d ferase nucleic acid in question, they do not provide informa (2008) BioEnergy Research 1(1), 56-66: Lu, F., and Ralph, J. tion as to whether the preselected DNA segment is being Non-degradative dissolution and acetylation of ball-milled expressed. Expression may be evaluated by specifically iden plant cell walls; high-resolution solution-state NMR. (2003) tifying the protein products of the introduced feruloyl-CoA: Plant J. 35(4), 535-544). The new transgenic plants can also monolignol transferase nucleic acids, by assessing the level be evaluated for a battery of functional agronomic character of p-coumaroyl-CoA:monolignol transferase mRNA and/or istics such as lodging, kernel hardness, yield, resistance to enzyme expressed, or evaluating the phenotypic changes disease, resistance to insect pests, drought resistance, and/or brought about by their expression. herbicide resistance. 0251 Assays for the production and identification of spe 0246 Plants that may be improved by these methods cific proteins may make use of physical-chemical, structural, include but are not limited to grass species, oil and/or starch functional, or other properties of the proteins. Unique physi plants (canola, potatoes, lupins, Sunflower and cottonseed), cal-chemical or structural properties allow the proteins to be forage plants (alfalfa, clover and fescue), grains (maize, separated and identified by electrophoretic procedures. Such wheat, barley, oats, rice, Sorghum, millet and rye), grasses as native or denaturing gel electrophoresis or isoelectric (Switchgrass, prairie grass, wheat grass, Sudangrass, SOr focusing, or by chromatographic techniques such as ion ghum, Straw-producing plants), Softwood, hardwood and exchange, liquid chromatography or gel exclusion chroma other woody plants (e.g., those used for paper production tography. The unique structures of individual proteins offer Such as poplar species, pine species, and eucalyptus). In some opportunities for use of specific antibodies to detect their embodiments the plant is a gymnosperm. Examples of plants presence informats such as an ELISA assay. Combinations of useful for pulp and paper production include most pine spe approaches may be employed with even greater specificity cies such as loblolly pine, Jack pine, Southern pine, Radiata such as Western blotting in which antibodies are used to pine, spruce, Douglas fir and others. Hardwoods that can be locate individual gene products that have been separated by modified as described herein include aspen, poplar, eucalyp electrophoretic techniques. Additional techniques may be tus, and others. Plants useful for making biofuels and ethanol employed to absolutely confirm the identity of the feruloyl include corn, grasses (e.g., miscanthus, Switchgrass, and the CoA:monolignol transferase Such as evaluation by amino like), as well as trees Such as poplar, aspen, willow, and the acid sequencing following purification. The Examples of this like. Plants useful for generating dairy forage include application also provide assay procedures for detecting and legumes such as alfalfa, as well as forage grasses Such as quantifying the PMT inhibitory nucleic acid, the mutant bromegrass, and bluestem. p-coumaroyl-CoA:monolignol transferase and/or feruloyl 0247 Determination of Stably Transformed Plant Tissues: CoA:monolignol transferase activity. 0248. To confirm the presence of the PMT knockout muta 0252. The expression of a gene product can also be deter tion or the PMT inhibitory nucleic acid(s) and/or the feruloyl mined by evaluating the phenotypic results of its expression. CoA:monolignol transferase nucleic acids in the regenerating These assays also may take many forms including but not plants, or seeds or progeny derived from the regenerated limited to analyzing changes in the chemical composition, plant, a variety of assays may be performed. Such assays morphology, or physiological properties of the plant. Chemi include, for example, molecular biological assays available to cal composition may be altered by expression of preselected those of skill in the art, such as Southern and Northern blot DNA segments encoding storage proteins which change ting and PCR; biochemical assays, such as detecting the amino acid composition and may be detected by amino acid presence of a protein product, e.g., by immunological means analysis. (ELISAs and Western blots) or by enzymatic function; plant part assays, Such as leaf, seed or root assays; and also, by Kits analyzing the phenotype of the whole regenerated plant. 0253) Any of the nucleic acids or polypeptides described 0249. Whereas DNA analysis techniques may be con herein may be comprised in a kit. In some embodiments, the ducted using DNA isolated from any part of a plant, RNA may kits can include a container that includes a nucleic acid, or a only be expressed in particular cells or tissue types and so mixture of nucleic acids. Such a nucleic acid or mixture of US 2016/0046955 A1 Feb. 18, 2016 32 nucleic acids can be used, for example, to transform plant acids and/or PMT inhibitory nucleic acids are typically pro cells and/or generate transgenic plants. In some embodi vided in a separate container from the FMT encoding nucleic ments, the nucleic acid(s) can encode a feruloyl-CoA:mono acids. lignol transferase. In another example, the kits can include a 0261 The kits of the present invention will also typically container that includes an PMT mutating nucleic acid for include a means for containing the vials in close confinement introducing one or more mutations into an endogenous PMT for commercial sale. Such as, e.g., injection and/or blow gene. In another example, the kits can include a container that molded plastic containers into which the desired vials are includes an inhibitory nucleic acid, or a mixture of inhibitory retained. nucleic acids. Such inhibitory nucleic acids can be used, for 0262. Such kits may also include components that pre example, to inhibit the expression of p-coumaroyl-CoA: serve or maintain the nucleic acids or that protect against their monolignol transferases. degradation. Such components may be RNAse-free or protect 0254 The kits can also include more than one container. against RNAses, such as RNase inhibitors. Such kits gener For example, the kits can include two or more containers, ally will comprise, in Suitable means, distinct containers for where one container includes a feruloyl-CoA:monolignol each individual reagent or solution. transferase nucleic acid, and another container includes an 0263. A kit will also include instructions for employing inhibitory nucleic acid that inhibits the expression of p-cou the kit components as well the use of any other reagent not maroyl-CoA:monolignol transferases. included in the kit. Instructions may include variations that 0255. In some embodiments, reagents for generating or can be implemented. assembling an inhibitory nucleic acid (e.g., siRNA) cocktail or candidate siRNA molecules can be included in a kit. The DEFINITIONS kit may further include individual siRNAs that can be mixed 0264. As used herein, “isolated” means a nucleic acid or to create a siRNA cocktail or individual DNA constructs that polypeptide has been removed from its natural or native cell. can be mixed and transfected or transduced into cells wherein Thus, the nucleic acid or polypeptide can be physically iso they express a cocktail of siRNAs. The kit may also include lated from the cell or the nucleic acid or polypeptide can be multiple DNA templates encoding siRNAs to multiple sites present or maintained in another cell where it is not naturally on one or more genes that when transcribed create an siRNA present or synthesized. cocktail. The kit may also comprise reagents for creating or 0265. As used herein, a “native nucleic acid or polypep synthesizing the dsRNA and a polypeptide with RNAse III tide means a DNA, RNA or amino acid sequence or segment activity that can be used in combination to create siRNA that has not been manipulated in vitro, i.e., has not been cocktails. isolated, purified, and/or amplified. 0256 The kits can also include one or more buffers, such 0266. As used herein, “recessive gene disruption” refers to as a nuclease buffer, transcription buffer, or a hybridization mutating an endogenous target p-coumarate monolignol buffer, compounds for preparing the DNA template or the transferase (PMT) gene sequence to eliminate either expres dsRNA, and components for isolating the resultant template, sion or function. Methods for mutating a target sequence are dsRNA, or siRNA. known in the art, and include, without limitation, the genera 0257 The components of the kits may be packaged either tion of mutations via chemical or radiation damage followed in aqueous media or in lyophilized form. The containers can by isolation of the mutant. In addition, available molecular be vials, test tubes, flasks, bottles, Syringes or other container biology approaches for decreasing the expression of a func means, into which a component may be placed, and prefer tional phenotype may be used, and include without limitation, ably, Suitably aliquoted. various knockout or knockdown methods. These methods 0258 Where there is more than one component in the kit, capitalize upon knowledge of sequence either in the gene of the kit also will generally contain a second, third or other interest or in the DNA sequence flanking the gene. Such additional container into which the additional components sequences are then examined to find Suitable sequences that may be separately placed. However, various combinations of can be targeted to accomplish either excision of the target components may also be included in one container. The kits gene or fragments of the gene. Thus, an endogenous p-cou of the present invention also will typically include a means for marate monolignol transferase (PMT) expression in tissue of containing the nucleic acids, and any other reagent containers any of the disclosed transgenic plants is inhibited by a reces in close confinement for commercial sale. Such containers sive gene disruption selected from a mutant p-coumarate may include injection or blow-molded plastic packages into monolignol transferase (PMT) gene that eliminates endog which the desired vials are retained. enous p-coumarate monolignol transferase (PMT) expres 0259 When the components of the kit are provided in one Sion, an endogenous p-coumarate monolignol transferase and/or more liquid solutions, the liquid Solution is an aqueous (PMT) knockout mutant, and an endogenous p-coumarate Solution, with a sterile aqueous solution being particularly monolignol transferase (PMT) knockdown mutant. preferred. However, the components of the kit may be pro 0267 As used herein, “dominant gene silencing refers to vided as dried powder(s). When reagents and/or components inducing or destroying/inhibiting the mRNA transcript of the are provided as a dry powder, the powder can be reconstituted gene, a means which provides the benefit of being done in a by the addition of a suitable solvent. It is envisioned that the spatial or temporal manner by the selection of specific pro Solvent may also be provided in another container means. moters. Of the dominant gene silencing approaches, dsRNA 0260. In some embodiments, nucleic acids are provided in triggered RNAi is one of the most powerful and the most dried form or suspended in an appropriate buffer or solvent. It efficient at gene silencing, and allows one to enhance or is contemplated that 0.1,1,5, 10, 20,30,40, 50,60, 70,80,90, capitalize upon a natural regulatory mechanism which 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, destroys intact mRNA by providing an antisense oligonucle 400, 500, 600, 700, 800, 900, 1000 mg or nucleic acid can be otide that is specific for an endogenous p-coumarate monoli provided in kits of the invention. The PMT mutating nucleic gnol transferase (PMT) gene (For review, see, Behlke, 2006, US 2016/0046955 A1 Feb. 18, 2016

Molecular Therapy 13(4): 644-670; see also, Tang and Galili, strand cDNA, 10 uL 10x Advantage 2 PCR Buffer (Advan 2004, Trends Biotechnology 22:463-469; Rajewsky and tage 2 Polymerase Mix, Clontech), 20 nM dNTP mix (Invit Socci, 2004, Developmental Biology 267:529-535; Hamilton rogen), 20 pM 5' PCR Primer (Creater SMART cDNA et al., 2002, EMBO.J. 21:4671-4679J). In one embodiment, a Library Construction Kit, Clontech), 20 pM Modified CDS construct comprising a Suitable RNAi sequence under the III/3' PCR Primer (IDT, see sequence above), 2 uL 50x control of a promoter is introduced into the plant in order to Advantage 2 Polymerase Mix (Clontech), and deionized silence p-coumarate monolignol transferase (PMT) protein water to a final volume of 100 uL. This reaction was placed in expression. Accordingly, in certain embodiments, the endog athermal cycler, preheated to 95°C., and cycled 24 times (95° enous p-coumarate monolignol transferase (PMT) expres C. for 1.25 minutes and 68°C. for 6 minutes). A 5uILaliquot sion of any of the disclosed transgenic plants is inhibited by of each double stranded cDNA reaction was analyzed by gel an RNAi antisense oligonucleotide that is specific for an electrophoresis. The cDNA was subjected to Proteinase K endogenous p-coumarate monolignol transferase (PMT) digestion by adding 40 ug of Proteinase K with incubation at gene. 45° C. for 20 minutes. A solution of 50% phenol and 50% 0268. The following non-limiting Examples illustrate how chloroform was used to extract proteins from each cDNA aspects of the invention have been developed and can be made sample followed by two chloroform extraction. The double and used. stranded cDNA was pooled from all reactions and precipi tated by adding/10 volume of 3 M sodium acetate pH 4.8, 20 Example 1 ugglycogen, and 2.5 volumes ethanol at room temperature. After centrifugation at 15000xg, the cDNA pellet was washed Materials and Methods with 80% ethanol, dried and dissolved in 79 uL deionized 0269. This Example illustrates some methods that can be water. The double stranded cDNA was digested with Sfil to employed to make and use the invention. remove concatenated primers and size fractionated using Angelica sinensis Tissue Collection and Total RNA Extrac Chroma Spin--TE-1000 Columns (Clontech) to remove short tion fragments. Fractions were analyzed by agarose gel electro 0270. One- and two-year-old field grown Angelica sinen phoresis and the fractions with sizes above 500 base pairs sis plants (Mountain Gardens Herbs), were transplanted into were pooled. cDNA was submitted to the Genomics Core at Readi-Earth and grown for two months in a greenhouse to Michigan State University for Roche 454 sequencing using recover. The single root of a two-year plant was harvested, cut the 454 GSFLX Titanium Sequencer. into Small pieces, and ground in liquid nitrogen to a fine powder. Total RNA was extracted by adding 100 mg of pow Amplification and Cloning of Feruloyl-CoA:Monolignol dered Angelica sinensis root tissue to 1 ml Trizol buffer (Invit Transferase (FMT) rogen) and incubating for 15 minutes while Vortexing at room 0273 cDNA was synthesized from the Angelica sinensis temperature. One-fifth volume of chloroform was added and root total RNA, using Superscript III Reverse Transcriptase incubated for an additional 15 minutes. After centrifugation at (Invitrogen). After DNase digestion, 5 lug of total RNA was 15000xg for 35 minutes at 4°C., the aqueous phase was added to 0.5ug Oligo d(T)s, 10 nM dNTP mix (Invitro extracted with /s Volume of chloroform. Total RNA was gen) and DEPC water to a volume of 13 uL. The reaction precipitated from the aqueous phase by adding/S Volume of mixture was incubated at 65° C. for 5 minutes. After cooling a solution containing 1 M sodium chloride and 0.8 M sodium the sample on ice for 2 minutes, 4 ul of 5x First-strand citrate and /s Volume of isopropyl alcohol. The RNA was Buffer, 100 nM DTT, 40 units RNase OUT and 200 units collected by centrifugation at 12,000xg and the pellet was Superscript III Reverse Transcriptase (Invitrogen) were washed in 70% ethanol, dried and dissolved in RNase-free added and incubated at 50° C. for 60 minutes. The reaction water. Residual DNA was removed by DNase digestion using was inactivated by heating to 70° C. for 15 minutes and stored the RNase-free DNase Kit (Qiagen), following manufactur on ice. The FMT coding sequence was amplified using er's guidelines. RNA quality was assessed using an Agilent 5'-AAAAAA GCA GGC TTC ATG ACG ATCATG GAG 2100 Bioanalyzer. GTT CAA GTT-3' (SEQ ID NO:4) and 5'-GTA CAA GAA Library Quality cINA Synthesis and 454 Sequencing AGC TGG GTT CTA GGAAGC GAA AGC AGA GAT-3' 0271 AcDNA library was constructed from Angelica sin (SEQID NO:5) oligonucleotides (Integrated DNA Technolo ensis root RNA using the Creator SMART cDNA Library gies) as forward and reverse gene specific primers with partial Construction Kit (Clontech). First-strand cDNA was synthe Gateway attB1 and attB2 attachment sites. Using the Plati sized by combining 1 g of RNA with 10 pM SMART IV num Pfx DNA Polymerase kit (Invitrogen), 2 LL 10x Pfx Oligo, 10 pM of modified CDS III/3' cDNA synthesis primer Amplification Buffer, 7.5 nM dNTP mix. 25 nM magnesium 5'-TAG AGG CCG AGG CGG CCG ACA TGT TTT GTT sulfate, 10 mM of each primer, 2.5 units of Plantinum Pfx TTTTTTTCTTTTTTTTTT VN-3' (SEQ ID NO:3) with DNA Polymerase and deionized water to a final volume of 20 PAGE purification (Integrated DNA Technologies), and uL was added to 200 ng cDNA. The sample was denatured at deionized water to a final volume of 5 uL and incubated at 72° 94° C. for 4 minutes, followed by 25 cycles of 94° C. for 30 C. for 2 minutes. Samples were cooled on ice for 2 minutes seconds, 55° C. for 30 seconds, and 68° C. for 1 minute 45 and a solution of 2 ul, 5x First Strand Buffer, 20 nM dithio seconds. After a cooling the sample to 4°C., a second PCR threitol (Creator SMART cDNA Library Construction Kit, reaction was completed, as described above, using 5'-GGGG Clontech), 10 nM dNTP mix and 200 units SuperScript II ACA AGT TTG TAC AAA AAA GCA GGCT-3' (SEQ ID Reverse Transcriptase (Invitrogen) was added to each reac NO:6) and 5'-GGG AC CAC TTT GTA CAA GAA AGC tion tube. Samples were incubated at 42°C. for 1 hour, and TGG GT-3' (SEQ ID NO:7) oligonucleotides (Integrated then placed on ice to terminate first strand cDNA synthesis. DNA Technologies) as forward and reverse primers and 2.5 (0272 Double stranded cDNA was amplified from first uL of the first PCR reaction to add full length Gateway attB1 strand cDNA synthesis reactions by combining 2 uI of first and attB2 attachment sites to the coding sequence. After US 2016/0046955 A1 Feb. 18, 2016 34 amplification, the reaction was analyzed by electrophoresis Purification of E. coli Expressed Feruloyl-CoA:Monolignol on a 0.8% agarose gel and the PCR product was purified using Transferase (FMT) the QIAquick Gel Extraction Kit (Qiagen), following manu 0277 HIS-tagged FMT was purified using an AKTA puri facturer's guidelines. fier (GE Healthcare) operated with UNICORN 5.11 work 0274 The amplified FMT coding sequence was cloned station version (GE Healthcare) and a protocol modified from into the Gateway entry vectorp)ONR221 (Invitrogen) using the manufacturer's guidelines. Four 5 ml HiTrap desalting the BP Clonase II Enzyme Mix (Invitrogen). After purifica columns (GE Healthcare) were equilibrated with binding tion, 150 ng of PCR product was added to 150 ng of buffer. A 5 ml aliquot of the soluble protein was injected onto pDONR221 entry vector, to a final volume of 4 LL with TE the desalting column and eluted with binding buffer at a flow buffer, and 1 uLBPClonase II Enzyme Mix. The reaction was rate of 1 ml/minute. Fractions with the highest protein con incubated overnight at room temperature, inactivated by add centrations, as indicated by higher UV absorbance, were col ing 1 lug Proteinase Kand incubating at 37°C. for 10 minutes. lected in 1 ml fractions. These fractions were applied to a 1 ml After cooling on ice, 2.5 LL of the reaction was used to HisTrap HP column (GE Healthcare), conditioned and transform One Shot Top 10 Chemically Competent E. coli charged with 0.1 M NiSO, according to manufacturers Cells (Invitrogen) according to manufacturer's guidelines. guidelines, at a flow rate of 0.1 ml/minute. The column was The transformants were grown at 37°C. overnight on LBagar washed with 5 ml of buffer A (20 mM Tris-hydrochloride pH plates containing and 50 ug/ml Kanamycin. Single colonies 8, 0.5 M sodium chloride, 1 mM 2-mercaptoethanol, and 20 were picked and grown in LB media containing 50 lug/ml mMimidazole) then bound protein was eluted at 1 ml/minute Kanamycin overnight at 37° C. Plasmid DNA was purified with a 20 ml linear gradient from buffer A to buffer B (20 mM from these cultures using the QIAprep Spin Miniprep Kit Tris-hydrochloride pH 8, 0.5 M sodium chloride, 1 mM (Qiagen), according to manufacturer's guidelines. Samples 2-mercaptoethanol, and 500 mM imidazole). Fractions con were Submitted for high throughput sequencing, using the taining protein were collected and analyzed by SDS-PAGE. M13 forward and M13 reverse primers (Invitrogen) at the Fractions with the highest concentration of FMT were com Michigan State University Genomics Core, and compared to bined and desalted using an Amicon Ultracel 10K membrane the 454 sequencing data to Verify coding sequence using filter (Millipore). DNASTAR Lasergene 8 software. 0275 Sequences in entry vectors were inserted into Feruloyl-CoA:Monolignol Transferase (FMT) Enzymatic pDEST17 vector using 150ng of plasmid DNA from the entry Assay clone, 150 ng of pDEST17 vector and 1 uL LR Clonase II (0278. The feruloyl-CoA, p-coumaroyl-CoA, and caf Enzyme Mix. The reaction was incubated overnight at room feoyl-CoA substrates used in the FMT assay were enzymati temperature. Transformation of competent cells was com cally synthesized using the tobacco 4-coumarate-CoA-ligase pleted as described above. Transformants were selected on (4CL) with a c-terminal HIS tag in pCRT7/CT TOPO, pro LBagar plates containing 100 g/ml Ampicillin. Clones were vided by Eran Pichersky. Following a method modified from screened by PCR using Gotaq Hot Start Green Master Mix Beuerle and Pichersky (Anal. Biochem. 302(2): 305-12 (Promega) by adding 10 uL of the 2x master mix to 10 mM of (2001)) 3.3 mg offerulic acid, coumaric acid or caffeic acid, each gene specific primer, deionized water to final Volume of 2 mg coenzyme A, and 6.9 mg ATP were added to 50 mM 20 uL. This PCR reaction was denatured at 94° C. for 3 Tris-hydrochloride pH 8 and 2.5 mM magnesium chloride in minutes then cycled 25 times through 94° C. for 30 seconds, a final volume of 10 ml. The reaction was started by adding 55° C. for 30 seconds, 72°C. for 1 minute 45 seconds, with a 0.25 mg 4CL, protein purified as described by the method of final elongation step at 72°C. for 5 minutes before cooling to Beurerle and Pichershy. After a five-hour incubation at room 4° C. Each reaction was analyzed by gel electrophoresis. temperature, additional 6.9 mg ATP 2 mg coenzyme A, and Clones were then transformed into One Shot BL21 Chemi 0.25 mg purified 4CL were added and the reaction was incu cally Competent E. coli Cells (Invitrogen), according to bated overnight. The CoA esters were purified on an SPE manufacturer's guidelines, for expression. cartridge as described in Beuerle and Pichersky (2001). Expression of Feruloyl-CoA:Monolignol Transferase (FMT) (0279. The FMT activity assay contained 100 mM MOPS in E. coli pH 6.8, 1 mM dithiothreitol (DTT), 1 mM feruloyl-CoA, 1 (0276 Cultures of BL21 E. coli containing FMT nucleic mM coniferyl alcohol, 3.9 g of purified FMT protein and acids in the expression vector were grown at 37°C. overnight deionized water to a volume of 50 uL. After a 30-minute in 5 ml LB media containing 100 ug/ml amplicillin. The cul incubation, 1 uL of 10M hydrochloric acid was added to stop tures were then added to 1 L of LB media containing 100 the reaction. Because the product synthesized in the reaction, ug/ml amplicillin and grown to an OD600 of 0.4 to 0.5. Protein coniferyl ferulate (CAFA), is insoluble, 50 uL of methanol expression in the cells was induced by adding 1 mM of was added to solubilize the CAFA. Prior to UPLC, protein isopropyl B-D-1-thiogalactopyranoside (IPTG) and the cells and insoluble material were removed by filtering through an were incubated for 6 hours at 22°C. Cells were harvested by Amicon Ultracel 10K membrane filter (Millipore). The flow centrifugation at 4°C. and pellets were stored at -80°C. The through was analyzed using an Acquity Ultra Performance pellets were suspended in 10 ml of binding buffer, a solution LC with an Acquity UPLC BEH C18 1.7 um 2.1 x 100 mm containing 20 mM Tris-hydrochloride pH 8, 0.5 M sodium column and the Acquity Console and Empower 2 Software, chloride, 1 mM 2-mercaptoethanol and cells were lysed using all from Waters Corporation. The solvents used in this method a French press. The extract was then centrifuged at 50,000xg were solvent A, 0.1% trifluoroacetic acid, and solvent B, for 30 minutes at 4° C. to separate soluble and insoluble 100% acetonitrile. Samples were analyzed using the follow protein fractions. The soluble protein fraction in the superna ing gradient conditions, 13% B, for 5 minutes, 1 minute linear tant was collected and the insoluble protein fraction was gradient to 42% B, held for 4 minutes, 1 minute linear gradi suspended in 10 ml of suspension buffer. Both fractions were ent to 100% B, held for 1 minutes and 3 minutes at 13% B analyzed for expression on an SDS-PAGE gel. with a flow rate of 0.3 ml/minute. This method was then used US 2016/0046955 A1 Feb. 18, 2016

to analyze a 10 LIL injection of each assay reaction; standards 6.58 (1H, dt, J=15.9, 1.7 Hz, C.), 6.97 (2H, m, A5/6), 7.15 (s, for each of the substrates along with chemically synthesized 1H, A2): 13C NMR 820.5 (OAc), 56.2 (OMe), 63.1 (Y), 110.9 CAFA were used to determine retention times for each com (A2), 119.5 (A6), 123.6 (A5), 129.3 (a), 131.4 (B), 137.2 pound. (A1), 140.2 (A4), 152.3 (A3), 169.0 (OAc). Size Exclusion Chromatography of FMT 4-Acetoxyconiferylferulate 0280 A 100LL sample of protein purified by immobilized 0284 Coupling of 4-acetoxyferuloyloyl chloride with metalion affinity chromatography (IMAC) was loaded onto a 4-acetoxyconiferyl alcohol was efficiently carried out using Superdex 75 10/300 GL gel filtration column (GE Health 4-(dimethylamino)-pyridine (DMAP). Thus, 4-acetoxyco care), equilibrated with 100 mM MOPS pH 6.8. The protein niferyl alcohol and 4-acetoxyferuloyl chloride were dis was eluted with the same buffer at a constant flow rate of 0.1 solved in dry CHCl (120 mL) to which DMAP (0.25 equiv) ml/minute and collected in 0.5 ml fractions. Aliquots of the and Et-N (0.85 equiv) were added. The mixture was stirred protein sample prior to gel filtration, and each of the fractions for 2 h, when TLC CHC1/EtOAc (5:1) showed the starting near the elution peak were analyzed for protein content by material was converted into a faster moving compound. The SDS-PAGE gel electrophoresis. Protein containing fractions solution was diluted with CHCl and washed successively were analyzed to determine the amount of FMT activity, as with aqueous 3% HCl and saturated NHC1. Drying over described above. MgSO4, evaporation, and purification by flash chromatogra phy CHC1/EtOAc (19:1) gave the diacetate of coniferyl NMR ferulate (94%) as a pale yellow oil. 0281. To confirm the identification based on the chromato 0285 Coniferyl ferulate. gram peak comparisons, the reaction product, which was 0286 The above diacetate (0.195 mmol) was dissolved in insoluble before addition of methanol, was centrifuged to pyrrolidine (1 mL). Once dissolution was complete, the pyr pellet the coniferyl ferulate, which was dissolved in perdeu rolidine solution was diluted with 50 mL of ethyl acetate and teroacetone and analyzed by NMR. The proton NMR spec washed with 1 MHSO (3x20 mL) and saturated NHCl trum, FIG. 3A, unambiguously confirmed the authenticity of (2x20 mL). After drying over MgSO and evaporation, the the coniferyl ferulate product, particularly when compared resulting syrup was submitted to Solid phase extraction with the spectrum from the independently synthesized CHC1/EtOAc (19:1) to afford coniferyl ferulate (93%) as a coniferyl ferulate (described below). For absolute confirma white solid. NMR spectra are the same as those for the FMT tion, ''C NMR data was also obtained via a 2D 'H-'C enzyme generated product, as shown in FIG. 3. correlation (HSQC) spectrum (for the protonated carbons, FIG. 3B) and a 2D 'H-C long-range correlation (HMBC) Example 2 spectrum (not shown, but data for all carbons is given on FIG. 3B). Identification and Cloning of a Synthesis of Authentic Coniferyl Ferulate feruloyl-CoA:monolignol transferase 0282. The synthesis was similar to that described for the 0287. Mature A. Sinensis plants were purchased from related compound, coniferyl p-coumarate (Lu, F., and Ralph, Mountains, Gardens and Herbs (North Carolina) and RNA J. Facile synthesis of 4-hydroxycinnamyl p-coumarates. was extracted from the roots of these plants. This RNA was (1998).J.Agr. Food Chem. 46(8), 2911-2913). Thus, as shown used to synthesize double-stranded cDNA. The cDNA was in FIG.9, 4-acetoxyferuloyl chloride was prepared from feru sequenced using a Roche GSFLX Titanium Sequencer and lic acid by acetylation followed by chlorination using SOCl. 736,017 sequences were obtained. The sequences were according to a previous method (Helm, R. F., Ralph, J., and assembled into 62425 contigs using CAP3 (Huang, X. A Hatfield, R. D. Synthesis of feruloylated and p-coumaroy contig assembly program based on sensitive detection of frag lated methylglycosides. (1992) Carbohydr. Res. 229(1), 183 ment overlaps. (1992) Genomics 14: 18-25). The consensus 194). sequence for each contig was searched against all proteins 0283 4-Acetoxyconiferaldaldehyde was prepared in from Arabidopsis and the NCBI non-redundant protein data 94-96% yield by acetylation of coniferaldehyde with acetic bases using the BLASTX software program (Altschul S. Gish anhydride/pyridine and then reduced with borane/tert-buty W. Miller W. Myers E, Lipman D. Basic local alignment lamine complex to give the corresponding alcohol, as follows. search tool. (1990) J Mol Biol 215(3), 403-410). The The 4-acetoxyconiferaldehyde was dissolved in methylene sequences were sorted by abundance and filtered to show only chloride to which borane/tert-butylamine complex (1.5 sequences annotated as being within a “transferase family.” equiv) was added. The mixture was stirred at room tempera which is the annotation in the TAIR9 database assigned to ture for 2 h, when TLC showed that the starting material had members of the BAHD class of acyltransferases. disappeared completely. The solvent was evaporated at 40°C. 0288. Two very abundant BAHD acyltransferases were under reduced pressure. The residue was hydrolyzed with 0.5 identified as well as a number of such enzymes with lower MHSO in ethanol/water (1:1) for 1.5 h. Most of the ethanol EST counts. These two sequences were cloned by PCR from was removed by evaporation, and the product was extracted an A. Sinensis cDNA pool using oligonucleotides designed to with ethyl acetate. The ethylacetate solution was washed with amplify their coding regions. The coding region of the A. saturated NHCl and dried over MgSO. Evaporation of the Sinensis sequences was transferred to the expression vector ethyl acetate gave the product, 4-acetoxyconiferyl alcohol as pDEST17 using Gateway technology. This vector adds an a pale yellow oil (96% yield); H NMR (acetone-d) & 2.31 amino-terminal 6xHIS-tag to the protein, which allows for (3H, s, OAc), 3.83 (3H, s, OAc), 3.90 (1H, t, J)5.5 Hz, Y-OH), affinity purification by immobilized metal affinity chroma 4.22 (2H, dt,J) 5.5, 1.7 Hz, Y), 6.38 (1H, dt, J) 15.9, 5.2 Hz, B), tography (IMAC). E. coli clones containing the recombinant US 2016/0046955 A1 Feb. 18, 2016 36 protein where grown and induced to produce recombinant acetic acid (NAA), 6-benzylaminopurine (BA), and thiadia protein. The enzyme was purified from the E. coli protein Zuron (TDZ) and solidified with 3% (w/v) agar and 1.1% extract using IMAC. (w/v) phytagel (WPM 0.1/0.1/0.1). After three days the discs 0289 Purified recombinant enzyme was assayed for FMT were transferred to WPM 0.1/0.1/0.1 supplemented with car activity using a reaction mixture containing 2 mM coniferyl benicillin disodium (500mg L') and cefotaxime sodium salt alcohol, 0.5 feruloyl-CoA, 100mMHEPES pH 7.4 and 1 mM (250mg L'). Following three additional days, the discs were DTT. The second most abundant BAHD acyltransferase gene transferred to WPM 0.1/0.1/0.1 containing carbenicillin, when incubated with Coniferyl alcohol and feruloyl-CoA cefotaxime and hygromycin (25 mg L'). After five weeks, produced a compound with the retention time of authentic shoots and callus material were transferred to WPM with agar coniferyl ferulate (CAFA) (FIG. 2). The product produced and phytagel, 0.01 uM BA, carbenicillin, cefotaxime and was mostly insoluble in water. The addition of methanol to hygromycin. Once individual shoots were visible, plantlets 50% after stopping the enzyme with acid was required to were transferred to solidified WPM with 0.01 uM NAA and analyze the product by UPLC. The insolubility of the product carbenicillin, cefotaxime and hygromycin to induce rooting. made partial purification easy as the product was separated After two consecutive five-week periods on this media, shoot from the substrates by centrifugation. tips were isolated to solidified antibiotic-free WPM with 0.01 0290 This partial purified product was analyzed by NMR. uM NAA. The identity of the product as CAFA was confirmed by 0294 Plants were confirmed as transgenic by PCR screen 'H-NMR (FIG.3). The enzyme was tested with p-coumaryl ing of genomic DNA employing gene specific oligonucle alcohol (FIG. 4) and sinapyl alcohol (FIG. 5) in addition to otides. All shoot cultures, including transgenic and non-trans coniferyl alcohol (FIG. 2). The enzyme is active with all three formed wild-type lines, were maintained on solid WPM with monolignols, i.e., p-coumaryl alcohol, coniferyl alcohol and 0.01 uM NAA in GA-7 vessels at 22° C. under a 16-hour Sinapyl alcohol. The enzyme was tested with p-coumaroyl photoperiod with an average photon flux of 50 umol ms' CoA (FIG. 6) and caffeoyl-CoA (FIG. 7) as well as feruloyl until out-planting to the greenhouse. Plants were then trans CoA (FIG. 2). The enzyme has a strong preference for feru ferred to soil and grown under supplemental lights (a 300 W loyl-CoA as can be seen by comparison of FIGS. 2, 6 and 7. m) on flood tables and watered with fertigated water daily in In FIGS. 6 and 7, very little product is produced from p-cou a greenhouse. maroyl-CoA and caffeoyl-CoA substrates. However, sub 0295) Purification of YFP-FMT was via GFPtrap A stantial product is formed when feruloyl-CoA is used instead (Chromotek) following the manufactures guidelines. Briefly, (FIG. 2). leaves from transgenic 1-year poplar trees were ground to a 0291. The IMAC purified FMT had a few lower molecular powder in liquid nitrogen and 250 mg powder of each ground weight proteins as shown in FIG. 8. These lower molecular leaf sample was separately suspended in 300 ul 100 mM proteins are likely proteolytic fragments of FMT as deter sodium phosphate pH 6. An aliquot of 5ul was added to the mined by analysis of tryptic digests of these bands by mass FMT enzyme assay described in the foregoing Examples. spectrometry. To ensure that the major band was responsible After 45 minutes of incubation, the reaction was stopped with for the activity, FMT was further purified using size-exclu 100 mM hydrochloric acid, and the products were solubilized sion chromatography. The FMT activity elutes coincident with the addition of methanol to a concentration of 50%. The with the major protein band (FIG. 8). protein and insoluble materials were removed by filtration through an Amicon Ultracel 10K membrane filter (Milli Example 3 pore). Control reactions were also completed using a protein extract from wild type hybrid poplar, as well as the standard Analysis of Transgenic Poplar Containing the FMT no enzyme control. These samples were analyzed by western Sequence blot and the UPLC method described in the Examples above. Formation of coniferyl ferulate was also detected by compari 0292. This Example illustrates the expression and enzy son of the UPLC traces of leaf extracts with authentic matic activity observed in poplar trees that were genetically coniferyl ferulate. modified to express the Angelica sinensis feruloyl-CoA: monolignol transferase nucleic acids described herein. Results Methods 0296. As shown in FIG. 10, FMT activity was identified in extracts from transgenic poplar lines containing the Angelica 0293 Hybrid poplar (Populus albaxgrandidentata) was Sinensis FMT by observing a product peak at the same reten transformed using Agrobacterium tumefaciens EHA105 tion time as the authentic standard (FIG. 10B). No such peak employing a common leaf disk inoculation. Two constructs was observed for wild type popular leaf extracts or in the no were created to drive the expression of FMT in poplar: 1) enzyme control. Similarly, FMT protein expression was 35S:YFP-FMT (cauliflower mosaic virus ubiquitous 35S detected by western blot analysis only in leaves from poplar promoter with an N-terminal tagged Yellow Fluorescent Pro trees that had been genetically modified to express the tein), and 2) CesA8:YFP-FMT (poplar xylem-specific sec Angelica sinensis FMT (FIG. 10A). ondary cell wall specific cellulose synthase 8 promoter with an N-terminal tagged Yellow Fluorescent Protein). The binary Example 4 plasmids were inserted into EHA105 using the freeze-thaw technique, and incubated overnight in liquid Woody Plant Transgenic Arabidopsis with the Angelica sinensis Media (WPM) supplemented with 100 uMacetosyringone. FMT Leaf disks were cut and co-cultured with EHA105 for one hour at room temperature, blotted dry and plated abaxailly 0297. This Example illustrates that other plant species can onto WPM supplemented with 0.1 uM each C.-naphthalene readily be transformed with the Angelica sinensis feruloyl US 2016/0046955 A1 Feb. 18, 2016 37

CoA:monolignol transferase nucleic acids described herein was incubated for an additional 15 minutes. After centrifuga to express an enzymatically active FMT. tion at 15000xg for 35 minutes at 4°C., the aqueous phase was extracted with /s Volume of chloroform. Total RNA was Methods: precipitated from the aqueous phase by adding /S Volume of 0298 Arabidopsis were transformed by standard proce a solution containing 1 M sodium chloride and 0.8 M sodium dures with the Angelica sinensis feruloyl-CoA:monolignol citrate and /s Volumes of isopropyl alcohol. The RNA was transferase nucleic acids described herein. As a control some collected by centrifugation at 12,000xg and the pellet was samples of Arabidopsis were transformed with an empty washed in 70% ethanol, dried and dissolved in RNase-free vector that did not contain the Angelica sinensis FMT. FMT water. Residual DNA was removed by DNase digestion using expression was detected by Reverse Transcriptase PCR of the RNase-free DNase Kit (Qiagen), following manufactur protein isolated from the transgenic Arabidopsis leaves. er's guidelines. RNA quality was assessed using an Agilent Enzymatic activity by the expressed FMT was detected using 2100 Bioanalyzer. Total RNA from Hibiscus cannabinus was the assay described in Example 1. submitted to the Genomics Core at Michigan State University for Roche 454 sequencing using the 454 GSFLX Titanium Results Sequencer. 0299. As illustrated in FIG. 11, the transgenic Arabidopsis Candidate Selection plants express an enzymatically active Angelica sinensis feru loyl-CoA:monolignol transferase. FIG. 11A shows the prod 0304 Ferulate monolignol transferase (FMT) candidates ucts of Reverse Transcriptase PCR amplification of tran were chosen from the Kenaf CLC 454 sequencing database Scripts from Arabidopsis leaves transformed with empty by searching for “transferase family proteins’ that have no vector or with a vector expressing the FMT transcript. As close homologs in Arabidopsis thaliana. The two candidates shown, FMT transcripts were detected only when reverse with the largest number of EST sequences were amplified and transcriptase was added (+ RT) to the PCR reaction mixture, cloned. and not when reverse transcriptase was absent (-RT) from the Cloning of Hibiscus cannabinus FMT PCR reaction mixture. A PCR product of the expected size for 0305 cDNA was synthesized from the Hibiscus cannabi the FMT enzyme (1326 base pairs) was visible only in the nus stem sections total RNA, using Superscript III Reverse reaction containing total RNA from Arabidopsis transformed Transcriptase (Invitrogen). After DNase digestion, 5 Jug of with the Angelica sinensis FMT when the reverse tran total RNA was added to 0.5ug Oligo d(T)s, 10 nM dNTP scriptase is present. mix (Invitrogen) and DEPC water to a volume of 13 uL. The 0300 FIG. 11B shows representative UPLC traces illus reaction mixture was incubated at 65° C. for 5 minutes. After trating FMT activity in ground stems from Arabidopsis trans cooling the sample on ice for 2 minutes, 4 LL of 5x First formed with the FMT from Angelica sinensis (see, bottom strand Buffer, 100 nM DTT, 40 units RNase OUT and 200 panel). The absorbance for each of the substrates, coniferyl units Superscript III Reverse Transcriptase (Invitrogen) were alcohol (1) and feruloyl-CoA (2) and for the product, added and incubated at 50° C. for 60 minutes. The reaction coniferyl ferulate (3), was detected at 280 nm (solid line) and was inactivated by heating to 70° C. for 15 minutes and stored at 340 nm (dotted line). The top panel of FIG. 11B shows the on ice. The Hibiscus cannabinus FMT coding sequence was results of control reactions of stems transformed with empty amplified using 5'-AAAAAAGCAGGCTTCATGGCAAC vector (top panel). Coniferyl ferulate (3) is detected only CCACAGCACTATCAT-3' (SEQ ID NO:10 and 5'-GTA when protein from the transformed Arabidopsis-FMT stems CAAGAAAGCTGGGTTCTAGATCACTA was added. GAGCATCGCCGG-3 (SEQ ID NO:11) oligonucleotides 0301 These data indicate that plants can readily be trans (Integrated DNA Technologies) as forward and reverse gene formed with the Angelica sinensis nucleic acids described specific primers with partial Gateway attB1 and attB2 attach herein and Such transformed plants can readily express an ment sites. Using the Platinum Pfx DNA Polymerase kit enzymatically active feruloyl-CoA:monolignol transferase (Invitrogen), 2 LL 10x Pfx Amplification Buffer, 7.5 nM that incorporates monolignol ferulates such as coniferyl feru dNTP mix. 25 nM magnesium sulfate, 10 mM of each primer, late into plant tissues. 2.5 units of Plantinum Pfx DNA Polymerase and deionized water to a final volume of 20 uL was added to 200 ng cDNA. Example 5 The sample was denatured at 94° C. for 4 minutes, followed by 25 cycles of 94° C. for 30 seconds, 52° C. for 30 seconds, Isolation of Hibiscus cannabinus (Kenaf) FMT and 68°C. for 2 minutes. After a cooling the sample to 4°C., a second PCR reaction was completed, as described above 0302) This Example illustrates isolation of the Hibiscus with a 55° C. annealing temperature, using 5'-GGGG ACA cannabinus (Kenaf) feruloyl-CoA:monolignol transferase AGTTTG TACAAAAAA GCAGGCT-3' (SEQID NO:12) nucleic acids and expression of an enzymatically active FMT. and 5'-GGGACCACTTT GTA CAAGAAAGCTGG GT-3' (SEQ ID NO:13) oligonucleotides (Integrated DNA Tech Materials and Methods nologies) as forward and reverse primers and 2.5 L of the 0303 Hibiscus cannabinus (Kenaf) stem sections were first PCR reaction to add full length Gateway attB1 and attB2 collected and stored in RNAlater (Qiagen) until processing. attachment sites to the coding sequence. After amplification, The tissue was then removed from the RNAlater solution and the reaction was analyzed by electrophoresis on a 0.8% aga ground to a powder in liquid nitrogen. Total RNA was rose gel and the PCR product was purified using the extracted by adding 100 mg of powdered Hibiscus cannabi QIAquick Gel Extraction Kit (Qiagen), following manufac nus stem sections to 1 ml Trizol buffer (Invitrogen) and incu turer's guidelines. bating for 15 minutes while Vortexing at room temperature. 0306 The amplified FMT coding sequence was cloned One-fifth volume of chloroform was added and the mixture into the Gateway entry vectorp)ONR221 (Invitrogen) using US 2016/0046955 A1 Feb. 18, 2016

the BP Clonase II Enzyme Mix (Invitrogen). After purifica - Continued tion, 150 ng of PCR product was added to 150 ng of pDONR221 entry vector, to a final volume of 4 LL with 881 GCATACGACG CACCGTGAAA CCACGGTTGC CCGAAGGATA Tris-EDTA (TE) buffer, and 1 uLBP Clonase II Enzyme Mix. 921 CTACGGGAAT GCTTTCACCT CGGCAAATAC GGCCATGACC The reaction was incubated overnight at room temperature, inactivated by adding 1 ug Proteinase Kand incubating at 37° 961. GGGAAGGAAC TCGACCAAGG ACCGCTCTCG AAAGCTGTGA C. for 10 minutes. After cooling on ice, 2.5 LL of the reaction was used to transform One Shot Top 10 Chemically Compe OO1 AACAAATCAA. GGAGAGCAAA. AAGCTTGCTT CGGAGAATGA tent E. coli Cells (Invitrogen) according to manufacturers O41 CTATATCTGG AACTTGATGA, GCATTAACGA GAAGCTGAGA guidelines. The transformants were grown at 37°C. overnight on LB agar plates containing and 50 ug/ml Kanamycin. O81 GAACTGAATT CGAAGTTCGA AGCGGCCGCC GGTTCAACCA Single colonies were picked and grown in LB media contain ing 50 lug/ml Kanamycin overnight at 37° C. Plasmid DNA 121 TGGTCATAAC AGATTGGAGG CGGTTGGGAC TATTGGAAGA was purified from these cultures using the QIAprep Spin 161 TGTGGATTTT GGATGGAAAG GTAGCGTAAA CATGATACCA Miniprep Kit (Qiagen), according to manufacturer's guide lines. Samples were Submitted for high throughput sequenc 2O1 CTGCCGTGGA ACATGTTCGG GTACGTGGAT TTGGTTCTTT ing, using the M13 forward and M13 reverse primers (Invit 241 TATTGCCTCC TTGTAAACTG GACCAATCGA TGAAAGGCGG rogen), along with 5'-CGCACTCGGTTTGTGATGGC-3' (SEQ ID NO:14) and 5'-TTCACAGCTTTCGAGAGCG 281 TGCTAGAGTG TTGGTTTCCT TTCCCACGGC TGCTATTGCC GTC-3' (SEQID NO:15) as two gene specific primers, at the Michigan State University Genomics Core. This sequence 321 AAATTCAAGG AAGAAATGGA TGCTCTCAAA CATGATAACA data was compared to the 454 sequencing data to verify 361. AGGTTGCCGG CGATGCTCTA GTGATCTAG coding sequence using DNASTAR Lasergene 8 Sequence Manager Software. The SEQID NO:8 nucleic acid encodes a Hibiscus cannabi 0307 The following were the Hibiscus cannabinus nus (Kenaf) feruloyl-CoA:monolignol transferase enzyme (Kenaf) nucleotide and protein sequences chosen for expres with the following amino acid sequence (SEQID NO:9). sion. Nucleotide sequence SEQID NO:8: MATHSTIMFS WDRNDVWFVK PFKPTPSOVL, SLSTIDNDPN ATGGCAACCC ACAGCACTAT CATGTTCTCA GTCGATAGAA 4. LEIMCHTVFW YOANADFDWK PKDPASI IOE ALSKLLWYYY 4. ACGATGTCGT GTTTGTCAAA CCCTTCAAAC CTACACCCTC 8 PLAGKMKRET DGKLRIACTA DDSWPFLWAT ADCKLSSLNH 8 ACAGGTTCTA TCTCTCTCCA CCATCGACAA TGATCCCAAC 12 LDGIDWHTGK EFALDFASES DGGYYHPLVM OVTKFICGGF 12 CTTGAGATCA TGTGCCATAC TGTTTTTGTG TATCAAGCCA 16 TIALSLSHSV CDGFGAAOIF OALTELASGR NEPSVKPWWE 16 ATGCCGATTT CGATGTTAAG CCCAAGGATC CAGCTTCCAT 2O ROLLVAKPAE EIPRSIVDKD LSAASPYLPT TDIVHACFYV 2O AATCCAGGAA GCACTCTCCA AGCTCTTGGT TTATTACTAT 24 TEESIKTLKM NLIKESKDES ITSLEWLSAY IWRARFRALK 24 CCCTTAGCGG GGAAGATGAA. GAGGGAGACC GATGGAAAAC 28 LSPDKTTMLG MAWGIRRTWK PRLPEGYYGN AFTSANTAMT 28 TTCGAATCGC TTGCACTGCC GACGATAGCG TGCCCTTCTT 32 GKELDQGPLS KAVKOIKESK KLASENDYIW NLMSINEKLR 32 AGTAGCCACC GCCGATTGCA AGCTCTCGTC GTTGAACCAC 36 ELNSKFEAAA GSTMWITDWR RLGLLEDWDF GWKGSWNMIP 36 TTGGATGGCA. TAGATGTTCA. TACCGGGAAA GAATTCGCCT 4 O LPWNMFGYVD LVLLLPPCKL DOSMKGGARV LVSFPTAAIA 4 O TGGATTTTGC ATCCGAATCC GACGGTGGCT ATTATCACCC 44 KFKEEMDALK HDNKWAGDAL WI 44 TCTGGTCATG CAGGTGACGA AGTTCATATG CGGAGGGTTC 0308 Sequences in entry vectors were inserted into 48 ACCATCGCTT TGAGTTTATC GCACTCGGTT TGTGATGGCT pDEST17 vector using 150 ng of plasmid DNA from the 52 TCGGTGCAGC. TCAGATCTTT CAAGCATTGA CCGAGCTCGC Kenaf FMT entry clone, 150 ng of pDEST17 vector and 1 uL LR Clonase II Enzyme Mix. The reaction was incubated 56 AAGTGGCAGG AACGAGCCCT CCGGTTAAACC CGTGTGGGAG overnight at room temperature. Transformation of competent cells was completed as described above. Transformants were 6 O AGGCAACTAT TAGTGGCGAA ACCGGCCGAG (GAAATCCCTC selected on LB agar plates containing 100 g/ml Ampicillin. 64 GGTCGATTGT CGATAAGGAC TTGTCGGCAG CTTCACCGTA Clones were screened by PCR using Gotaq Hot Start Green Master Mix (Promega) by adding 10 uL of the 2x master mix 68 TCTGCCGACA ACCGACATAG TCCATGCCTG CTTTTATGTA to 10 mM of each gene specific primer with partial Gateway 72 ACCGAGGAGA GTATAAAAAC ACTGAAAATG AATCTGATCA. attB1 and attB2 attachment sites as described above, deion ized water to final volume of 20 uL. This PCR reaction was 76 AAGAAAGCAA AGATGAGAGT ATAACCAGTC TCGAGGTCCT denatured at 94° C. for 3 minutes then cycled 25 times through 94° C. for 30 seconds, 52° C. for 30 seconds, 72° C. 8O TTCAGCCTAT ATATGGAGAG. CAAGGTTTAG AGCATTGAAA for 2 minutes, with a final elongation step at 72° C. for 5 84 TTGAGTCCAG ATAAAACCAC AATGCTCGGC ATGGCCGTAG minutes before cooling to 4°C. Each reaction was analyzed by gel electrophoresis. Clones were then transformed into US 2016/0046955 A1 Feb. 18, 2016 39

One Shot BL21 Chemically Competent E. coli Cells (Invit added to stop the reaction. Because the product synthesized in rogen), according to manufacturer's guidelines, for expres the reaction, coniferyl ferulate (CAFA), is partially insoluble, Sion. 50LL of methanol was added to solubilize the CAFA. Prior to Expression of FMT in E. coli UPLC, protein and insoluble material were removed by fil 0309 Cultures of BL21 E. coli containing the KenafFMT tering through an Amicon Ultracel 10K membrane filter (Mil in the expression vector, were grown at 37°C. overnight in 5 lipore). The flow-through was analyzed using an Acquity ml LB media containing 100 ug/ml amplicillin, then added to Ultra Performance LC with an Acquity UPLC BEHC18 1.7 500 ml of LB media containing 100 ug/ml amplicillin and um 2.1x100 mm column and the Acquity Console and grown to an OD600 of 0.3 to 0.4. The culture was then Empower 2 Software, all from Waters Corporation. The sol induced by adding 1 mM of Isopropyl B-D-1-thiogalactopy vents used in this method were solvent A, 0.1% trifluoroacetic ranoside, IPTG, and incubated overnight at 18°C. Cells were acid, and solvent B, 100% acetonitrile. Samples were ana harvested by centrifugation at 4°C. and pellets were stored at lyzed using the following gradient conditions, 13% B, for 5 -80° C. The pellets were suspended in 10 ml of binding minutes, 1 minute linear gradient to 42% B, held for 4 min buffer, a solution containing 20 mM Tris-hydrochloride pH 8, utes, 1 minute linear gradient to 100% B, held for 1 minute 0.5 M sodium chloride, 1 mM 2-mercaptoethanol and cells and 3 minutes at 13% B with a flow rate of 0.3 ml/minute. This were lysed using a French press. The extract was then centri method was then used to analyze a 10 LIL injection of each fuged at 50,000xg for 30 minutes at 4°C. to separate soluble assay reaction; standards for each of the Substrates along with and insoluble protein fractions. The soluble protein fraction, chemically synthesized CAFA were used to determine reten Supernatant, was collected and the insoluble protein fraction tion times for each compound. was suspended in 10 ml of suspension buffer. Both fractions 0313 FIGS. 12A and 12B illustrate the expression, puri were analyzed for expression on an SDS-PAGE gel. fication and enzyme activity for FMT from Hibiscus cannabi Purification of E. coli Expressed FMT nus. FIG. 12A shows that the Hibiscus cannabinus FMT is 0310 HIS-tagged Kenaf FMT was purified using an expressed in E. coli BL21 cells. The Hibiscus cannabinus AKTA purifier (GE Healthcare) operated with UNICORN FMT was expressed with an N-terminal 6xHis tag in the 5.11—workstation version (GE Healthcare) and a protocol pDEST17 vector (Invitrogen) and the soluble protein (-50 modified from the manufacturer's guidelines. Four 5 ml kDa) was purified over a Ni" columnusing an AKTA purifier HiTrap Desalting columns (GE Healthcare) were equili (GE Healthcare). brated with binding buffer. A 5 ml aliquot of the soluble 0314 Fractions 29 and 30 from the Ni" column that con protein was injected onto the desalting column and eluted tained purified protein were assayed for FMT activity. FIG. with binding buffer at a flow rate of 1 ml/minute. Fractions 12B shows the products of an FMT enzyme assay of fractions with the highest protein concentrations, as indicated by 29 and 30 after UPLC separation. The products of the FMT higher UV absorbance, were collected in 1 ml fractions. enzyme assay were detected by absorbance at 280 nm (solid These fractions were applied to a 1 ml HisTrap HP column line) and 340 nm (dotted line) for the substrates coniferyl (GE Healthcare), conditioned and charged with 0.1 MNiSO alcohol (1) and feruloyl-CoA (2). A control reaction with no according to manufacturer's guidelines, at a flow rate of 0.1 enzyme is shown at the top of FIG. 12B. The products of the ml/minute. The column was washed with 5 ml of buffer A (20 assay containing the Hibiscus cannabinus FMT enzyme are mM Tris-hydrochloride pH 8, 0.5M sodium chloride, 1 mM shown in the bottom panel of FIG. 12B. The production of 2-mercaptoethanol, and 20 mM imidazole) then bound pro coniferyl ferulate (3) is visible only when the Hibiscus can tein was eluted at 1 ml/minute with a 20 ml linear gradient nabinus FMT enzyme was present in the assay (bottom from buffer A to buffer B (20 mM Tris-hydrochloride pH 8, panel). The product and substrate peaks were identified by 0.5 M sodium chloride, 1 mM 2-mercaptoethanol, and 500 comparison to synthetic standards. mM imidazole). Fractions containing protein were collected 0315 FIG. 13 shows an alignment of the Hibiscus can and analyzed by SDS-PAGE. Fractions with the highest con nabinus and Angelica sinensis feruloyl-CoA:monolignol centration of Kenaf FMT were combined and desalted using transferase sequences. As illustrated, the Hibiscus cannabi an Amicon Ultracel 10K membrane filter (Millipore). nus and Angelica sinensis feruloyl-CoA:monolignol trans ferases share only about 23% sequence identity. When similar FMT Enzymatic Assay amino acid Substitutions are considered, the Hibiscus Can nabinus and Angelica sinensis feruloyl-CoA:monolignol 0311. The feruloyl CoA, p-coumaroyl CoA, and caffeoyl transferases share only about 41% sequence similarity. CoA substrates used in the FMT assay were enzymatically synthesized using the tobacco 4-coumarate CoA-ligase Example 6 (4CL) with a c-terminal HIS tag in pCRT7/CT TOPO. Fol lowing a method modified from Beuerle and Pichersky Isolation of p-Coumarate Monolignol Transferase (2001) 3.3 mg offerulic acid, coumaric acid or caffeic acid, 2 from Rice mg coenzyme A, and 6.9 mg ATP were 50 mM Tris-hydro chloride pH 8, 2.5 mM magnesium chloride in a final volume 0316. This Example illustrates isolation of the Oryza of 10 ml. The reaction was started by adding 0.25 mg 4CL sativa (rice) p-coumarate monolignol transferase (PMT) protein, purified as described by the method of Beurerle and nucleic acids and expression of an enzymatically active PMT Pichershy. After a five-hour incubation at room temperature, enzyme. an additional 6.9 mg ATP, 2 mg coenzyme A, and 0.25 mg purified 4CL were added and the reaction was incubated Materials and Methods overnight. The CoA esters were purified on an SPE cartridge as described in Beuerle and Pichersky (2001). 0317 Gene Synthesis— 0312 The FMT activity assay contained 100 mM sodium 0318 A PMT nucleic segment from Oryza sativa was phosphate buffer pH 6, 1 mM dithiothreitol (DTT), 1 mM synthesized and cloned into the entry vector pENTR221 (In feruloyl CoA, 1 mM coniferyl alcohol, 0.5 g of purified vitrogen). The coding region of the Oryza sativa p-couma Kenaf FMT protein and deionized water to a volume of 50 uL. royl-CoA:monolignol transferase has the following nucleic After a 45-minute incubation, 100 mM hydrochloric acid was acid sequence (SEQ ID NO:16). US 2016/0046955 A1 Feb. 18, 2016 40

- Continued ATGGGGTTCG CGGTGGTGAG GACGAACCGG GAGTTCGTGC 121 DHPLMIPEDD LLPDAAPGVH PLDLPLMMOW TEFSCGGFVV

41 GGCCGAGCGC GGCGACGCCG CCGTCGTCCG GCGAGCTGCT 161 GLISVHTMAD GLGAGOFINA WGDYARGLDR PRVSPVWARE

81 GGAGCTGTCC ATCATCGACC GCGTGGTGGG GCTCCGCCAC 2O1 AIPSPPKLPP GPPPELKMFO LRHVTADLSL DSINKAKSAY

121. CTGGTGCGGT CGCTGCACAT. CTTCTCCGCC GCCGCCCCGA 241 FAATGHRCST FDWAIAKTWO ARTRALRLPE PTSRVNLCFF

161 GCGGCGGCGA CGCCAAGCCG TCGCCGGCGC GGGTGATCAA 281. ANTRHLMAGA AAWPAPAAGG NGGNGFYGNC FYPWSWWAES

201 GGAGGCGCTG GGGAAGGCGC TGGTGGACTA CTACCCGTTC 3.21 GAWEAADWAG WWGMIREAKA RLPADFARWA WADFREDPYE

241 GCGGGGAGGT TCGTGGACGG CGGCGGCGGG CCGGGGAGCG 361 LSFTYDSLFW SDWTRLGFLE ADYGWGPPSH WIPFAYYPFM

281 CCCGCGTGGA GTGCACCGGC GAGGGCGCCT GGTTCGTGGA 4O1 AVAIIGAPPV PKTGARIMTO CVEDDHLPAF KEEIKAFDK 321. GGCCGCCGCC GGCTGCAGCC TCGACGACGT GAACGGCCTC 0320 An expression vector containing an N-terminal 6xHis tag was made by incorporating OsPMT (SEQ ID 361 GACCACCCGC TCATGATCCC CGAGGACGAC CTCCTCCCCG NO:16) into plEST17 (Invitrogen) using Invitrogen's Gate 4O1 ACGCCGCCCC CGGTGTCCAC CCCCTCGACC TCCCCCTCAT way cloning technology, according to manufacturer's guide lines. 44.1 GATGCAGGTG ACGGAGTTCA GTTGCGGAGG GTTCGTGGTG 0321 Expression of OsPMT in E. coli, and Purification— 481. GGCCTGATCT CGGTGCACAC GATGGCGGAC GGGCTAGGGG 0322 Cultures of BL21 cells (Invitrogen) containing the 521 CCGGGCAGTT CATCAACGCG. GTGGGCGACT ACGCCCGCGG OsPMT expression vector were grown to an ODoo between 0.4 and 0.5, cooled to 18°C., and expression was induced by 561 GCTGGACAGG CCGAGGGTGA, GCCCGGTCTG GGCCCGCGAG adding isopropyl B-D-1-thiogalactopyranoside (IPTG.; Roche). After 18-h (overnight) incubation at 18°C., cells 6O1 GCCATCCCGA GCCCGCCGAA GCTGCCCCCG GGCCCGCCGC were harvested by centrifugation and frozen at -80°C. The 641 CGGAGCTGAA. GATGTTCCAG CTCCGCCACG TCACCGCCGA pellets from a 1 L culture were suspended in 20 ml of binding buffer (20 mM Tris-hydrochloride pH 8, 0.5 M sodium chlo 681 CCTGAGCCTG GACAGCATCA ACAAGGCCAA GTCCGCCTAC ride, 1 mM 2-mercaptoethanol), and cells were lysed using a French pressure cell press. The extract was then centrifuged at 721 TTCGCCGCCA CCGGCCACCG CTGCTCCACC TTCGACGTCG 50,000xg for 30 minat 4°C. to separate soluble and insoluble 76.1 CCATCGCCAA. GACGTGGCAG GCGCGCACCC GCGCGCTCCG protein fractions. Soluble protein was collected and the pellet was suspended in 10 ml of 20 mM pH 8 Tris-hydrochloride. 801 CCTCCCGGAA CCCACCTCCC GCGTCAACCT CTGCTTCTTC Both fractions were analyzed for expression on an SDS 841 GCCAACACCC GCCACCTCAT GGCCGGCGCC GCCGCCTGGC PAGE gel by comparing bands of the expected molecular weight from an uninduced culture to the induced culture. 881 CCGCACCCGC CGCCGGCGGC AATGGCGGCA ATGGGTTCTA 0323. His-tagged OsPMT was purified by IMAC using an 921 CGGCAACTGC TTCTACCCGG, TGTCGGTGGT GGCGGAGAGC AKTA purifier (GE Healthcare) operated with UNICORN 5.11 workstation (GE Healthcare) and a protocol modified 961. GGGGCGGTGG AGGCGGCGGA CGTGGCCGGG GTGGTGGGGA from the manufacturer's guidelines. Four stacked 5 ml 1 OO1 TGATACGGGA. GGCGAAGGCG. AGGCTGCCGG CGGACTTCGC HiTrap desalting columns (GE Healthcare) were equilibrated with binding buffer. A 5 ml aliquot of the soluble protein was 1041 GCGGTGGGCG GTGGCCGACT TCAGGGAGGA TCCGTACGAG injected onto the desalting column and eluted with binding buffer at a flow rate of 1 ml/min. Fractions with the highest 1 OS 1. CTGAGCTTCA CGTACGATTC CCTGTTCGTC. TCCGACTGGA protein concentrations, as indicated by UV absorbance, were 1121 CGCGGCTGGG (GTTCCTGGAG. GCGGACTACG. GGTGGGGGCC collected in 1 ml fractions. These combined fractions were applied to a 1 ml HisTrap HP column (GE Healthcare), 1161 GCCGTCGCAC GTCATACCCT TCGCGTACTA. CCCGTTCATG charged with Ni" and conditioned with binding buffer, at a 1201 GCCGTCGCCA TCATCGGCGC GCCGCCGGTG. CCCAAGACCG flow rate of 0.2 ml/min. The column was washed with 5 ml of buffer A (20 mM Tris-hydrochloride pH 8, 0.5 M sodium 1241 GCGCCCGGAT CATGACGCAG TGCGTCGAGG ACGACCACCT chloride, 1 mM 2-mercaptoethanol, and 20 mM imidazole) then bound protein was eluted at 1 ml/min over a 20 ml linear 1281 GCCGGCGTTC AAGGAGGAGA TCAAGGCCTT CGACAAGTAA gradient from buffer A to buffer B (20 mM Tris-hydrochloride 0319. This Oryza sativa p-coumaroyl-CoA:monolignol pH 8, 0.5M sodium chloride, 1 mM 2-mercaptoethanol, and transferase nucleic acid encodes the following amino acid 500 mM imidazole). Fractions containing protein were col sequence (SEQID NO:17). lected and analyzed by SDS-PAGE: bands of the expected size were extracted from the SDS-PAGE gel and sent to the MSU Proteomics Core for in-gel trypsin digestion followed 1 MGFAWWRTNR EFWRPSAATP PSSGELLELS IIDRWWGLRH by LCMS/MS. Peptides were searched against the Oryza sativa genome database (NCBI), and identified by Mascot. 41 LVRSLHIFSA. AAPSGGDAKP SPARWIKEAL GKALWDYYPF IMAC fractions with the highest concentration of OspMT 81 AGRFWDGGGG PGSARWECTG EGAWFWEAAA GCSLDDWINGL were combined and further purified by size-exclusion chro matography using a Superdex 75 10/300 GL gel filtration column (GE Healthcare) and exchanged into a pH 6 buffer US 2016/0046955 A1 Feb. 18, 2016 containing 100 mM sodium phosphate. Protein samples were Compounds relating to compound 2 include: concentrated to 1 g/ul in 100 mM sodium phosphate pH 6 0337 2 is p-coumaroyl-CoA: containing 100 ng/ul BSA (NEB) and a complete mini 0338 2, is caffeoyl-CoA; and EDTA-free protease inhibitor tablet (Roche) using an Ami 0339 2 is feruloyl-CoA: con Ultracel 10K membrane filter (Millipore). Compounds relating to compound 3 include: 0324 Enzyme Activity Assay— (0340) is p-coumaryl ferulate: 0325 The CoA thioesters, p-coumaroyl-CoA 2a, caf (0341) , is p-coumaryl caffeate; feoyl-CoA 2b, and feruloyl-CoA 2c, for use as substrates in (0342 it is p-coumaryl p-coumarate; the OsPMT enzyme assay, were synthesized using the (0343 is caffeyl p-coumarate; tobacco 4-coumarate CoA-ligase (4CL) with a C-terminal (0344) , is caffeyl caffeate; His tag in the vector pCRT7/CT TOPO via the following (0345) is caffeyl ferulate: reaction. (0346) , is coniferyl p-coumarate; (0347 is coniferyl caffeate; (0348 is coniferyl ferulate: OH S-CoA O (0349 s is sinapyl p-coumarate; 10350 s, is sinapyl caffeate; and 0351) is is sinapyl ferulate. PMT 0352. The CoA thioesters, p-coumaroyl-CoA 2a, caf -- Her feoyl-CoA 2b, and feruloyl-CoA 2c were purified using Sep pak cartridges (Waters) following a method modified from Beuerle & Pichersky (Anal. Biochem. 302:305-312 (2002)). The concentration for each CoA thioester was calculated R R R3 based on its absorbance maximum and extinction coefficient. OH OH Ferulic acid, caffeic acid and p-coumaric acid were purchased 1 2 from Sigma-Aldrich. Purified CoA thioesters were analyzed OH for purity using an Acquity Ultra Performance LC with an Acquity UPLC BEHC18 (1.7 um 2.1x100 mm) column and the Acquity Console and Empower 2 Software (Waters Cor poration). R3 0353 Authentic coniferyl p-coumarate 3Ga and sinapyl p-coumarate 3Sa were synthesized as described by Lu & Ralph (J.Agr. Food Chem. 46: 2911-2913 (1998)). p-Cou maryl p-coumarate 3Ha was made by an analogous route (see, id.). 0354) The OsPMT enzyme activity assay, in 50 mM pH 6 sodium phosphate buffer containing 1 mM dithiothreitol (DTT), 1 mM CoA thioester, 1 mM monolignol, and deion ized water to produce a final volume of 50L, was initiated by adding of 1 lug of purified PMT protein in 1xESA (NEB). After a 30-min. incubation, the reaction was stopped by the addition of 100 mM hydrochloric acid. Reaction products were solubilized by adjusting the solution OH to 50% methanol. An identical assay with no enzyme added was performed for every reaction. Protein was removed by filtering through an Amicon Ultracel 10K membrane filter (Millipore) and the flow-through was analyzed by ultra-per wherein R and R2 are separately hydrogen, hydroxy, or formance liquid chromatography (UPLC). The solvents used alkoxy (e.g., O—CH). in this method were: solvent A, 0.1% trifluoroacetic acid, and The different compounds are identified by number as relating solvent B, 100% acetonitrile. Samples were analyzed using a to compound 1, 2 or 3 with the following symbols for sub method with an initial concentration of 10% B, followed by a stituents: 15 minute linear gradient to 60% B, held for 1 minute, then a 0326 H means that R and R are hydrogen; 1 minute linear gradient to 100% B, held for 1 minute, and a 0327 C means that R is OH and R is hydrogen; 1 minute linear gradient to the initial 10% B, held for 2 0328 G means that R is O CH and R is hydrogen; minutes, with a constant flow rate of 0.3 ml/minute. Eluting 0329 S means that R and Rare O CH: compounds were detected at 280 nm and 340 nm. Enzyme 0330 a means that R is hydrogen; activity was also determined for 0331 b means that R is hydroxy; and the reverse reaction, using authentic Sinapyl p-coumarate 3Sa 0332 C means that R is O CH. or p-coumaryl p-coumarate 3Ha and coenzyme-A as Sub Compounds relating to compound 1 include: strates, with all other assay conditions as mentioned above. Standards for each of the substrates along with chemically 0333 1 is p-coumaryl alcohol; synthesized Standards of each monolignol conjugate 3 were 0334 1, is caffeyl alcohol: used to determine retention times for each compound and 0335. 1 is coniferyl alcohol; and identify HPLC chromatogram peaks. Crude reaction prod 0336 1s is sinapyl alcohol. ucts isolated from the enzymatic reaction of Sinapyl alcohol US 2016/0046955 A1 Feb. 18, 2016 42

1S and p-coumaroyl-CoA 2a, catalyzed by PMT, were iden Results tified by comparison with the synthetic standard peaks in 0359 Identification of a Candidate Gene– proton NMR spectra and matching correlations in 2D COSY 0360. The most likely class of enzymes to catalyze acyla NMR spectra. tion of monolignols with p-coumarate belong to the BAHD 0355 1D Proton & 2D COSY NMR acyltransferases, currently referred to as HXXXD-acyltrans 0356) NMR spectra of synthesized compounds and the ferases, as they catalyze many similar reactions. As crude reaction products from PMT reactions, dissolved in p-coumaroylation is a distinctive feature of grass lignins, the acetone-de, were acquired using standard pulse experiments inventors reasoned that a grass specific HXXXDacyltrans and conditions on a Bruker Biospin (Billerica, Mass.) ferase that is co-expressed with genes involved in monolignol AVANCE 500 (500 MHz) spectrometer fitted with a cryo biosynthesis would be a good candidate for the enzyme genically cooled 5-mm TCI gradient probe with inverse responsible for acylation of monolignols. The RiceXPro geometry (proton coils closest to the sample). Spectral pro database version 1.5 co-expression tool (ricexpro.dna.affrc. cessing used Bruker's Topspin 2.1 software. The central sol go.jp) at the National Institute of Agrobiological Sciences vent peaks were used as internal reference ÖH/ÖC 2.04/29.8. Genome Resource Center (Ibaraki, Japan) was used to iden Standard Bruker implementations were used for one- and tify HXXXD acyltransferases co-expressed with each of the two-dimensional gradient-selected multiple-quantum-fil three 4CL genes in rice (Sato et al., BMC Plant Biology 11:10 tered correlation spectroscopy (COSY), Bruker pulse pro (2011); Sato et al., Nuc. Acids Res. 39: D1141-D1 148 gram cosygpmff with gradients strengths (ratio 16:12:40) (2011)). The 4CL enzyme is required for the synthesis of selected for a double quantum filter spectra. HSQC and lignin monomers, and the most highly correlated gene with HMBC experiments were also used as usual for routine struc 4CL (Os08g.0245200) is Os01g 18744, an HXXXDacyltrans tural assignments of synthesized compounds. The COSY ferase hereafter referred to as OsPMT (or simply as PMT). experiments shown in FIG. 18 used the following parameters: Closely related sequences were obtained from plant species acquired from 10 to 0 ppm in both dimensions, in F2 (1H) having sequenced genomes using the Phytozome 7 locus with 2k data points (acquisition time 205 ms), and in F1 (1H) keyword search feature (Ouyang et al., Nucleic Acids with 256 increments (F1 acquisition time 25.6 ms) of 1 scan Research 35, D883-D887 (2007). These sequences were (for standards) or 4 scans for the crude PMT product, with a aligned using the program MUSCLE and generated a phylo 1 second inter-scan delay. Processing used simple unshifted genetic tree with the program TREEPUZZLE (Edgar, BMC sine-bell apodization in both dimensions and benefited from Bioinformatics 5: 113 (2004); Schmidt et al., Bioinformatics one level of linear prediction (32 coefficients) in F1. 18(3): 502-504 (2002)). Trees were displayed using the pro gram Dendroscope (Huson et al., Bioinformatics 8: 460 0357 Kinetics— (2007)). The tree shown in FIG. 16 indicates that OsPMT is in 0358 Kinetic analyses were performed using an assay a grass specific group (Mitchell et al., Plant Physiol. 144(1): modified from Santoro et al. (Anal. Biochem. 354: 70-77 43-53 (2007)). As OsPMT is a grass-specific HXXXD-acyl (2006)). The standard 100 uL reaction mixture contained 50 tansferase co-expressed with 4CL, this gene was chosen for mM sodium phosphate pH 6, 2 mM 5,5'-dithiobis-(2-ni further study. trobenzoic acid) (DTNB), 0.01-1 mM CoA thioester sub 0361 Expression of OsPMT in E. coli. A synthetic gene strate, and 0.005-1.0 mM monolignol alcohol substrate and having the amino acid sequence for OsPMT but optimized for initiated by adding 100 ng of purified OsPMT protein in expression in Escherichia coli was synthesized and cloned 1xESA (NEB). The CoA thioester substrates included p-cou into the Gateway entry vector pENTR221 (Invitrogen) by maroyl-CoA 2a and caffeoyl-CoA 2b, and the monolignol Blue Heron Bio (Bothell, Wash.). This OspMT construct was Substrates included sinapyl alcohol 1S and p-coumaryl alco used to create a plasmid that expressed a N-terminal His hol 1 H. Enzyme activity was measured as an increase in tagged version of OspMT in E. coli BL21 cells. Protein CoASH, detected with DTNB at A, which is released as a expression was induced by addition of IPTG for 18h at 18°C. result of monolignol conjugate synthesis (id.). The absor (FIG. 17). Soluble protein was purified using immobilized bance was measured every three min. for 40 min on a Spec metal affinity chromatography (IMAC) followed by size tramax Plus microplate reader using Softmax Pro 5.3 (Mo exclusion chromatography (FIG. 17A). lecular Devices). The reactions were stopped by adding OsPMT protein expression and purification was monitored hydrochloric acid to a concentration of 100 mM, and then throughout this process by SDS-PAGE by following a protein solubilized by adding methanol to 50%. Aliquots of 10 uL near the expected molecular weight of 47 kDa (FIG. 17B). from each assay were analyzed via UPLC to verify product The identity of this protein was verified as OspMT by LC production. A standard curve was created for each CoA MS/MS on in-gel trypsin digested peptides. The additional thioester from triplicate assays of five concentrations from 50 bands present in the Superdex 75 fraction were identified as nM to 1 mM of coenzyme-A. Each reaction contained the fragments of OsPMT by LC-MS/MS. same buffer and DTNB concentrations as the kinetic assays, 0362. Determination of OsPMT Kinetic Parameters— along with 0.5 mMofa CoA thioester (p-coumaroyl-CoA2a, 0363 Purified OsPMT produced a compound that eluted caffeoyl-CoA 2b, or feruloyl-CoA 2c). The equation derived with authentic sinapyl p-coumarate 3Sa when incubated with from fitting this standard curve was used to calculate the Sinapyl alcohol 1S and p-coumaroyl-CoA 2a. This activity quantity (moles) of product synthesized in the assay. Kinetic followed the OspMT protein during gel permeation chroma parameters, Vmax and Km, were calculated using a nonlinear tography as shown in FIG. 17A. The identity of the product regression by entering the reaction rate and Substrate concen was shown to be sinapyl p-coumarate 3Saby NMR (FIG. 18). tration into the program R64, version 2.12.0 (Team, R. D.C., Enzyme Substrate specificity was examined for the acyl R. A language and environment for statistical computing, R donors: p-coumaroyl-CoA 2a, caffeoyl-CoA 2b, and feru Foundation for Statistical Computing, Vienna, Austria loyl-CoA 2c, and the acyl acceptors p-coumaryl alcohol 1H, (2010). coniferyl alcohol 1G, and sinapyl alcohol 1 S. Of the tested US 2016/0046955 A1 Feb. 18, 2016 acyl donors p-coumaroyl-CoA2a and caffeoyl-CoA 2b were Therefore, the transferase enzyme OspMT expressed in E. good substrates while feruloyl-CoA 2c was a poor substrate coli was shown to catalyze transesterification reactions (Table 1). between monolignols 1 and p-coumaroyl-CoA2a, producing primarily monolignol p-coumarates where R and R are TABLE I separately hydrogen, hydroxy, or alkoxy (e.g., O—CH), as illustrated below. Kinetic data for OSPMT purified from E. Coli extracts

Saturating Ki SE V: SE Kgai Varying Substrate Substrate M pkat mg' sec OH S-CoA O sinapyl alcohol 1S p-coumaroyl-CoA2a 35 + 5 10800 + 351 0.51 p-coumaroyl-CoA2a sinapyl alcohol 1S 105 + 12 12500 + 417 0.60 p-coumaryl alcohol 1H p-coumaroyl-CoA2a 141 + 14 54200 + 2.08.0 2.58 PMT p-coumaroyl-CoA2a p-coumaryl alcohol 281 + 62 61500 + 5300 2.93 -- -e- 1H p-coumaroyl-CoA2a coniferyl alcohol 1G NA <218O NA Sinapyl alcohol 1S caffeoyl-CoA 2b 152 8100 244 O.39 caffeoyl-CoA 2b sinapyl alcohol 1S 75 + 5 7500 + 150 0.36 p-coumaryl alcohol 1H caffeoyl-CoA 2b 27 6 S910 - 399 O.28 R2 R H caffeoyl-CoA 2b p-coumaryl alcohol 92 + 11 8590+ 309 0.41 OH OH caffeoyl-CoA 2b coniferyl alcohol NA <298O NA 1 2a 1G OH feruloyl-CoA 2c Sinapyl alcohol 1S NA <1230 NA feruloyl-CoA 2c p-coumaryl alcohol NA NA NA 1H feruloyl-CoA 2c coniferyl alcohol 1G NA NA NA H K. and V data calculated from the mean of at least 3 replicates + the standard error, 1 plkat = 1 pMol substrate sec. NA indicates parameters not calculated due to low activity The enzyme had the highest affinity for sinapyl alcohol 1S but the synthetic rate was 6 times higher with p-coumaryl alcohol 1H. Kinetic parameters for caffeyl alcohol 1C were not estab lished due to its limited solubility. Caffeyl alcohol has never been found incorporated into monocot or dicot lignins, and has in fact only recently been identified in a softwood down regulated in CCoAOMT (Wagneret al., Plant J. 67(1):119-29 (2011)). Too little activity was observed with feruloyl-CoA 2c or coniferyl alcohol 1G as the acceptors to obtain the Km for these compounds but an estimate was obtained of the OH maximum velocity. The activity measured with p-coumaroyl CoA 2a or caffeoyl-CoA 2b as the acyl donor and coniferyl alcohol 1G as the receptor was also noticeably less than that of sinapyl alcohol 1S and p-coumaryl alcohol 1 H. OspMT 0365 Although activity is measured using caffeoyl-CoA was able to efficiently synthesize sinapyl p-coumarate 3Sa, 2b as well, kinetic analysis indicates that the PMT enzyme p-coumaryl p-coumarate 3Ha, Sinapyl caffeate 3Sb, and has a higher affinity for p-coumaroyl-CoA 2a. Kinetic data p-coumaryl caffeate 3Hb as measured by HPLC products also indicates that the affinity for sinapyl alcohol 1S is high; from enzyme assay reactions (FIG. 19). Complete kinetic however the reaction rate for p-coumaryl alcohol 1H with properties were determined for these Substrates using a saturating p-coumaroyl-CoA 2a, Suggests that OSPMT will method modified from Santoro et al. (Anal. Biochem. 354: produce more p-coumaryl p-coumarate 3Haif local concen 70-77 (2006). Control reactions with no acyl donor substrate trations of p-coumaryl alcohol are high enough. Thus, were run for each acyl acceptor and showed no OspMT activ OsPMT could be the enzyme responsible for the p-couma ity. These controls were repeated for each acyl donor sub roylation seen in grasses. Because of the high p-coumaroyla strate, containing no acyl acceptor, and also showed no activ tion, seen primarily on Syringyl lignin units S and the low ity. Reactions containing no enzyme produced no OspMT concentrations of p-hydroxyphenyl H units in grass lignins, activity (FIG. 19). the preferred substrates for the OspMT reaction in the plant are likely sinapyl alcohol 1S and p-coumaroyl-CoA 2a. The 0364 The kinetic properties indicate that OspMT has enzyme favors the synthesis ofsinapyl p-coumarate 3Sa over similar affinity for sinapyl alcohol 1S and p-coumarylalcohol coniferyl p-coumarate 3Ga, which is consistent with the ratio 1H, shown by the very similar Km values; however, the reac (-90:10) of these conjugates observed incorporated into grass tion rates vary with the acyl donor. Although the Km for cell walls. The propensity of OsPMT to synthesize p-cou p-coumaroyl-CoA 2a and caffeoyl-CoA 2b are similar, the maryl p-coumarate 3Haraises the possibility that grasses may maximum reaction rate for p-coumaroyl-CoA 2a is at least 5-fold higher. OspMT appears to synthesize primarily p-cou use this compound in the synthesis of monolignols. The path maryl p-coumarate 3Ha and Sinapyl p-coumarate 3Sa. Based way includes the transesterification of p-coumaroyl-CoA 2a on the kinetic data, if p-coumaryl alcohol 1H is the more to a shikimic acid ester, which is the substrate for C3H (FIG. abundant monolignol, p-coumaryl p-coumarate 3Ha will be 15). produced. If sinapyl alcohol 1S concentrations are greater or 0366 Plants such as Brachypodium distachyon have been similar, the enzyme will produce sinapyl p-coumarate 3Sa. tested using PMT gene knockdown constructs. US 2016/0046955 A1 Feb. 18, 2016 44

Example 7 Construct 125: RNAi #4 target spanning 156 bp of the pro moter and 5' untranslated region plus 99 bp of the open Knockdown of p-Coumarate Monolignol Transferase reading frame (SEQID NO:28). in Brachypodium distachyon 0367. A putative PMT gene in Brachypodium distachyon -156 CACTCC ACCTAGCTAG CTGAGCTCCG AAGTCCTGAA was identified as the BRADI2G36910 gene (FIG. 20). The -12 O CTAATAACCC AGCCCGTCTA. TATATACACA GAGCATATAT sequence of this gene was scrutinized and four regions were selected as targets for RNAi knockdown (FIG. 21). -80 ATCCATACAC TCATCGCAGC TAGAGCATGC AAGCTTAATT 0368 RNAi constructs were made by polymerase chain - 4 O AGCCTGCAGG CCGTGGATTT GATAGAGAGA GTGCTTTACA (PCR) amplification of selected portions of the putative Brac hypodium distachyon PMT gene coding sequences and clon 1 ATGGAGAAGA AGTTCACGGT GACTAGGACT AGCAAGTCCC ing the amplicons into the pStarling vector (see website at 41 TGGTGCCCCC ATCTTCGTCT TCCCCAACAC CGGCGGCGAC www.pi.csiro.au/rnai/vectors.htm) to make RNAi hairpin loop cassettes. The Brachypodium distachyon target of the 81 AGAGGACGAT GCACCAGTG RNAi constructs had the following sequences. 0369 Construct 61 targeted a 258bp stretch of DNA origi nating from the 3' end of the putative PMT gene Construct 60: RNAi #1 target at the 3' untranslated region Bradi2.g36910. This stretch of DNA did not share sufficient (SEQ ID NO:25). sequence homology with other PMT-like genes to target expression knockdown of those genes. 0370 Those RNAi expression cassettes were moved into 1 GTAAGCAACG ATCCATAATC GTCCATGTAT GAAACCCAAT the pWBvec8 binary vector backbone and introduced into Brachypodium tissue using a modified Agrobacterium-medi 41. TGAGCGTGCA AGCGCTTAAT TACTACACCT TTTTATAATC ated plant transformation protocol developed by Vogel & Hill, 81 AGTAGCTCTT CTATGTCTGG TGTGTGTGCG TGCAATGTAT Plant Cell Rep. 27:471-478 (2008). 0371 Transgenic Brachypodium plants were regenerated 121 GTAATTTGCT TOTTTGATCG AACTGGCGCA ATTAGGCGTT from the transformed tissue, and plant lines with various levels of PMT gene expression knockdown were identified 161 GTGCTTAATT GTATCGTGGG TCCATCGAAT GAACGATGAT using quantitative Reverse Transcriptase-Polymerase Chain Reaction (qrT-PCR). 2O1 GAAGCAATAA ATGACCATGA TTTGTACTGC TTCCAAATGT 0372. Two plant lines (4B and 7A) originating from inde 241 ATACTGGTAG TATATAGTAC CATGTGTCAT, GTGCGTGTGT pendent transformation events were confirmed by PCR and drug marker selection to be harboring PMT RNAi Construct 281 CATCTGGTAA AATTAAGACG G 61. These two plant lines were phenotypically characterized in detail because they were determined by qRT-PCR to have Construct 61: RNAi i2 target at the 3' end of open reading the most substantial knockdown of PMT expression (FIG. 22). frame (SEQID NO: 26). 0373) Lines 4B and 7A T0-generation plants were found to have 80% and 60% PMT gene expression knockdown, respectively (FIG.22A). Line 4B T1-generation plants were 1 TACGAGCTGA CCTTCACCTA CGACTCCCTC TTCGTGTCGG found to have 95% PMT gene expression knockdown. All 41 ACTGGACCAG GCTGGGCTTT CTAGAGGCCG ACTACGGGTG plants were found to grow normally under growth chamber conditions (FIG.22B). 81. GGGGCCCCCG GCCCACGTGG TGCCCTTCTC GTATCACCCC 0374 Senesced cell wall tissue from these plants were analyzed and determined to have substantially reduced levels 121 TTCATGGCTG TTGCCGTCAT CGGCGCACCG CCCAAGCCCA of p-coumarate FIGS. 23-24). As shown in FIG. 23A greater than 60% reduction was observed for line 4B compared to 161 AGCTCGGCTC CCGCGTCATG ACCATGTGTG. TGGAGGAAGA wild type, with no significant changes in cell wall ferulate levels. 2O1 CCACCTCCCG GAGTTCCGGG ACCAGATGAA CGCCTTCGCC 0375. These results indicate that the identified Brachypo 241 TTCACCGCCG GGAAGTGA dium distachyon PMT gene does play a role in decorating lignin with p-coumarate moieties. Therefore, PMT may com Construct 124: RNAi i3 target starting 11 bp downstream of pete with FMT in making ester conjugates that become incor porated into lignin and reduction of PMT activity in an FMT the ATG translation start site (SEQID NO: 27). expressing plant background can facilitate the generation of plants with increased ferulate content which can improve the 1 GTTCACGGTG ACTAGGACTA GCAAGTCCCT GGTGCCCCCA deconstruction properties of grass species during biomass processing to biofuels. 41. TCTTCGTCTT CCCCAACACC GGCGGCGACA GAGGACGATG Example 8 81 CACCAGTGCC GGTGATCAT.G. CGCCTGTCGA CGATCGACCG PMT Sequences from Various Plant Species 121 TGTTCCCGGG CTGCGCCACC TGGTGCTCTC CCTCCACGCC 0376 Related PMT sequences were obtained from plant species having sequenced genomes using the PhytoZome 7 161 TTCGACGGCC ATGGCGTCGT TGCCGGAGAA. GACGACGAAG locus keyword search feature (Ouyang et al., Nucleic Acids 2O1 AGCGAATTAG GTGGCCGGCG AGGGTGGTGA. GGGAGGCGCT Research 35, D883-D887 (2007); see website at www.phy toZome.net/search.php). 241 GGGGAAGGCG CTCGTGGACT ACTACCCGT 0377 Sequences related to the PMT nucleic acids described herein include those in Table 2.

US 2016/0046955 A1 Feb. 18, 2016 48

0382 Norman, A. G. (1969) Constitution and Biosynthe 0398 Hartley, R. D. (1972) p-Coumaric and ferulic acid sis of Lignin. K. Freudenberg and A. C. Neish. Springer components of cell walls of ryegrass and their relations Verlag, New York, 1968. x+132 pp., illus. S7. Molecular with lignin and digestibility J. Sci. Food Agr. 23, 1347 Biology, Biochemistry and Biophysics, vol. 2 Science 165, 1354. 784. 0399 Harris, P. J., and Hartley, R. D. (1980) Phenolic 0383 Lu, F., and Ralph, J. (2008) Novel tetrahydrofuran constituents of the cell walls of monocotyledons, Biochem. structures derived from B-B-coupling reactions involving Syst. Ecol. 8, 153-160. sinapyl acetate in Kenaf lignins Org. Biomol. Chem. 6. 0400 Ralph, J. (2006) What makes a good monolignol 3681-3694. Substitute? in The Science and Lore of the Plant Cell Wall 0384 Lu, F., and Ralph, J. (2002) Preliminary evidence Biosynthesis, Structure and Function (Hayashi, T. ed.), for Sinapyl acetate as a lignin monomer in kenaf Chem. Universal Publishers (BrownWalker Press), Boca Raton, Commun, 90-91 Fla. pp. 285-293. 0385) Lu, F., and Ralph, J. (2005) Novel B-3-structures in 04.01 Ralph, J. (2010) Hydroxycinnamates in lignifica natural lignins incorporating acylated monolignols. in tion Phytochemistry Reviews 9, 65-83-83. Thirteenth International Symposium on Wood, Fiber, and 0402 Martinez, A. T., Rencoret, J., Marques, G., Gutier Pulping Chemistry, APPITA, Australia, Auckland, New rez, A., Ibarra, D., Jimenez-Barbero, J., and del Rio, J. C. Zealand. (2008) Monolignol acylation and lignin structure in some 0386 Ralph, J. (1996) An unusual lignin from Kenaf J. nonwoody plants: A2D NMR study Phytochem. 69,2831 Nat. Prod. 59,341-342. 2843. 0387 del Rio, J. C., Marques, G., Rencoret, J., Martinez, 0403 del Rio, J. C., Rencoret, J., Marques, G., Gutierrez, A. T., and Gutierrez, A. (2007) Occurrence of naturally A., Ibarra, D., Santos, J. I., Jimenez-Barbero, J., Zhang, L. acetylated lignin units J. Agr. Food Chem. 55, 5461-5468. M., and Martinez, A. T. (2008) Highly Acylated (Acety lated and/or p-Coumaroylated) Native Lignins from 0388 Ralph, J., and Lu, F. (1998) The DFRC method for Diverse Herbaceous Plants J. Agr. Food Chem. 56, 9525 lignin analysis. Part 6. A modified method to determine 95.34. acetate regiochemistry on native and isolated lignins.J.Agr. 0404 Lu, F., and Ralph, J. (1999) Detection and determi Food Chem. 46, 4616-4619. nation of p-coumaroylated units in lignins J. Agr. Food 0389. Smith, D.C. C. (1955)p-Hydroxybenzoates groups Chem. 47, 1988-1992. in the lignin of Aspen (Populus tremula) J. Chem. Soc., 04.05 Grabber, J. H., Quideau, S., and Ralph, J. (1996) 2347. p-Coumaroylated Syringyl units in maize lignin; implica 0390 Nakano, J., Ishizu, A., and Migita, N. (1961) Studies tions for B-ether cleavage by thioacidolysis Phytochem. on lignin. XXXII. Ester groups of lignin Tappi 44, 30-32. 43, 1189-1194. 0391) Landucci, L. L., Deka, G. C., and Roy, D. N. (1992) 0406 Hatfield, R. D., Wilson, J. R., and Mertens, D. R. A 13C NMR study of milled wood lignins from hybrid (1999) Composition of cell walls isolated from cell types of Salix Clones Holzforschung 46, 505-511. grain sorghum stems J. Sci. Food Agr. 79,891-899. 0392 Sun, R. C., Fang, J. M., and Tomkinson, J. (1999) (0407 Ralph, J., Bunzel, M., Marita, J. M., Hatfield, R. D., Fractional isolation and structural characterization of Lu, F., Kim, H., Schatz, P. F., Grabber, J. H., and Steinhart, lignins from oil palm trunk and empty fruit bunch fibres J. H. (2004) Peroxidase-dependent cross-linking reactions of Wood Chem. Technol. 19, 335-356. p-hydroxycinnamates in plant cell walls Phytochem. Revs. 0393 Meyermans, H., Morreel, K., Lapierre, C., Pollet, 3, 79-96. B., DeBruyn, A., Busson, R., Herdewijn, P., DeVreese, B., (0408 Hatfield, R. D., Ralph, J., and Grabber, J. H. (2008) Van Beeumen, J., Marita, J. M., Ralph, J., Chen, C., Burg A potential role ofsinapyl p-coumarate as a radical transfer graeve, B., Van Montagu, M., Messens, E., and Boerjan, W. mechanism in grass lignin formation Planta 228,919-928. (2000) Modifications in lignin and accumulation of phe 04.09 Grabber, J. H., Hatfield, R. D., Ralph, J., and Lu, F. nolic glucosides in poplar xylem upon down-regulation of (2008) Coniferyl ferulate incorporation into lignin dra caffeoyl-coenzyme A O-methyltransferase, an enzyme matically enhances the delignification and enzymatic involved in lignin biosynthesis J. Biol. Chem. 275,36899 hydrolysis of maize cell walls. In 30th Symposium on 36909. Fuels and Chemicals, New Orleans. 0394 Li, S., and Lundquist, K. (2001) Analysis of 0410 D'Auria, J. (2006) Acyltransferases in plants: a hydroxyl groups in lignins by 1H NMR spectrometry Nor good time to be BAHD Curr. Opin. Plant Biol. 9, 331-340. dic Pulp Paper Res. J. 16, 63-67. 0411 Hatfield, R. D., Marita, J. M., Frost, K., Grabber, J. 0395 Lu, F., and Ralph, J. (2003) Non-degradative disso H. Lu, F., Kim, H., and Ralph, J. (2009) Grass lignin lution and acetylation of ball-milled plant cell walls; high acylation: p-coumaroyl transferase activity and cell wall resolution solution-state NMR Plant J. 35, 535-544. characteristics of C3 and C4 grasses Planta 229, 1253 0396 Shimada, M., Fukuzuka, T., and Higuchi, T. (1971) 1267. Ester linkages of p-coumaric acid in bamboo and grass 0412 Mitchell, R. A. C., Dupree, P., and Shewry, P. R. lignins Tappi 54, 72-78. (2007) A novel bioinformatics approach identifies candi 0397 Ralph, J., Hatfield, R. D., Quideau, S., Helm, R. F., date genes for the synthesis and feruloylation of arabinoxy Grabber, J. H., and Jung, H.-J. G. (1994) Pathway of lan Plant Physiol. 144, 43-53. p-Coumaric Acid Incorporation into Maize Lignin AS 0413 Bueuerle, T., and Pichersky, E. (2002) Enzymatic Revealed by NMR Journal of the American Chemical Soci synthesis and purification of aromatic Coenzyme-A esters ety 116, 9448-9456. Anal. Biochem. 302,305-312. US 2016/0046955 A1 Feb. 18, 2016 49

0414 Stoeckigt, J., and Zenk, M. H. (1975) Chemical 0429 Vogel J, Hill T. (2008) High-efficiency Agrobacte synthesis and properties of hydroxycinnamoyl coenzyme rium-mediated transformation of Brachypodium dis A derivatives Z. Naturforsch., C: Biosci. 30C, 352-358. tachyon inbred line Bd21-3. Plant Cell Rep. 27:471-478. 0415 Lu, F., and Ralph, J. (1998) Facile synthesis of 4-hy 0430 All patents and publications referenced or men droxycinnamyl p-coumarates J. Agr. Food Chem. 46, tioned herein are indicative of the levels of skill of those 29.11-2913. skilled in the art to which the invention pertains, and each 0416) Santoro, N., Britva, S., Vander Roest, K., Siegel, G., such referenced patent or publication is hereby specifically and Waldrop A. (2006) A high-throughput screening assay incorporated by reference to the same extent as if it had been for the carboxyltransferase subunit of acetyl-CoA car incorporated by reference in its entirety individually or set boxylase Anal. Biochem. 354, 70-77. forth herein in its entirety. Applicants reserve the right to 0417 Team, R. D. C. (2010) R: A language and environ physically incorporate into this specification any and all ment for statistical computing, materials and information from any Such cited patents or 0418 Sato, Y., Antonio, B., Namiki, N., Motoyama, R., publications. Sugimoto, K., Takehisa, H., Minami, H., Kamatsuki, K., 0431. The specific methods and compositions described Kusaba, M., Hirochika, H., and Nagamura, Y. (2011) Field herein are representative of preferred embodiments and are transcriptome revealed critical developmental and physi exemplary and not intended as limitations on the scope of the ological transitions involved in the expression of growth invention. Other objects, aspects, and embodiments will potential in japonica rice BMC Plant Biology 11, 10. occur to those skilled in the art upon consideration of this 0419 Sato, Y., Antonio, B. A., Namiki, N., Takehisa, H., specification, and are encompassed within the spirit of the Minami, H., Kamatsuki, K., Sugimoto, K., Shimizu, Y., invention as defined by the scope of the claims. It will be Hirochika, H., and Nagamura, Y. (2010) RiceXPro: a plat readily apparent to one skilled in the art that varying Substi form for monitoring gene expression in japonica rice tutions and modifications may be made to the invention dis grown under natural field conditions Nucleic Acids closed herein without departing from the scope and spirit of Research. the invention. The invention illustratively described herein 0420 Ouyang, S., Zhu, W., Hamilton, J., Lin, H., Camp Suitably may be practiced in the absence of any element or bell, M., Childs, K., Thibaud-Nissen, F.O., Malek, R. L., elements, or limitation or limitations, which is not specifi Lee, Y., Zheng, L., Orvis, J., Haas, B., Wortman, J., and cally disclosed herein as essential. The methods and pro Buell, C. R. (2007) The TIGR Rice Genome Annotation cesses illustratively described herein suitably may be prac Resource: improvements and new features Nucleic Acids ticed in differing orders of steps, and the methods and Research 35, D883-D887. processes are not necessarily restricted to the orders of steps 0421 Edgar, R. C. (2004) MUSCLE: a multiple sequence indicated herein or in the claims. As used herein and in the alignment method with reduced time and space complex appended claims, the singular forms “a,” “an and “the include plural reference unless the context clearly dictates ity. in BMC Bioinformatics. otherwise. Thus, for example, a reference to “a nucleic acid 0422 Schmidt, H. A., Strimmer, K. Vingron, M., and von or “a polypeptide' includes a plurality of such nucleic acids or Haeseler, A. (2002) TREE-PUZZLE: maximum likelihood polypeptides (for example, a solution of nucleic acids or phylogenetic analysis using quartets and parallel comput polypeptides or a series of nucleic acid or polypeptide prepa ing. In Bioinformatics. rations), and so forth. Under no circumstances may the patent 0423 Huson, D. H., Richter, D.C., Rausch, C., DeZulian, be interpreted to be limited to the specific examples or T., Franz, M., and Rupp, R. (2007) Dendroscope: An inter embodiments or methods specifically disclosed herein. active viewer for large phylogenetic trees. in BMC Bioin Under no circumstances may the patent be interpreted to be formatics. limited by any statement made by any Examiner or any other 0424) Mitchell, R.A., Dupree, P., and Shewry, P. R. (2007) official or employee of the Patent and Trademark Office A novel bioinformatics approach identifies candidate unless such statement is specifically and without qualification genes for the synthesis and feruloylation of arabinoxylan. or reservation expressly adopted in a responsive writing by in Plant Physiol. Applicants. 0425 Wagner, A., Tobimatsu, Y., Phillips, L., Flint, H., 0432. The terms and expressions that have been employed Torr, K.M., Donaldson, L., Te Kiri, L., and Ralph, J. (2011) are used as terms of description and not of limitation, and CCoAOMT suppression modifies lignin composition in there is no intent in the use of Such terms and expressions to Pinus radiata Plant J., in press, accepted Mar. 17, 2011 exclude any equivalent of the features shown and described or 0426 Brkljacic J. Grotewold E. Scholl R, Mockler T, portions thereof, but it is recognized that various modifica Garvin D F, Vain P. Brutnell T. Sibout R, Bevan M, Budak tions are possible within the scope of the invention as H, Caicedo A. L., Gao C, Gu Y, Hazen S P Holt B F 3rd, claimed. Thus, it will be understood that although the present Hong SY. Jordan M. Manzaneda A. J. Mitchell-Olds T. invention has been specifically disclosed by preferred Mochida K, Mur LA, Park C M, Sedbrook J, Watt M, embodiments and optional features, modification and varia Zheng SJ, Vogel J. P. (2011) Brachypodium as a model for tion of the concepts herein disclosed may be resorted to by the grasses: today and the future. Plant Physiol. 157:3-13. those skilled in the art, and that Such modifications and varia 0427 Cigan A M, Unger-Wallace E. Haug-Collet K. tions are considered to be within the scope of this invention as (2005) Transcriptional gene silencing as a tool for uncov defined by the appended claims and statements of the inven ering gene function in maize. Plant J. 43:929-940. tion. 0428 International Brachypodium Initiative (2010) 0433. The following statements are intended to describe Genome sequencing and analysis of the model grass Brac and Summarize features disclosed the foregoing description hypodium distachyon. Nature 463:763-768. given in the specification. US 2016/0046955 A1 Feb. 18, 2016 50

Statements: acid that binds to an endogenous p-coumaroyl-CoA:mono 0434 1. An isolated nucleic acid encoding at least a por lignol transferase gene in a cell of grass species. tion of a p-coumaroyl-CoA:monolignol transferase, and/or 0445 12. The isolated nucleic acid of statement 11, an isolated nucleic acid complementary to at least a portion wherein the mutating nucleic has two flanking segments of a p-coumaroyl-CoA:monolignol transferase nucleic and a central segment, acid, wherein the isolated nucleic acid can selectively 0446 wherein the central segment has a point mutation, hybridize to a DNA or RNA with a sequence homologous a deletion, a missense mutation, or a nonsense mutation or complementary to a sequence selected from the group relative to a nucleic acid selected from the group con consisting of SEQ ID NO:16, SE ID NO:18, SEQ ID sisting of SEQID NO:16, SEIDNO:18, SEQID NO:19, NO:19, SEQID NO:22, SEQID NO:23, SEQID NO:25, SEQ ID NO:22, SEQID NO:23, SEQID NO:25, SEQ SEQ ID NO:26, SE ID NO:27, SEQ ID NO:28, and a ID NO:26, SEID NO:27, SEQID NO:28; and combination thereof. 0447 wherein the two flanking segments are separately 0435 2. The isolated nucleic acid of statement 1, wherein homologous or complementary to a different region of a the nucleic acid selectively hybridizes to a DNA or RNA nucleic acid selected from the group consisting of SEQ comprising either strand of any of the SEQID NO:16, 18, ID NO:16, SE ID NO:18, SEQ ID NO:19, SEQ ID 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences under NO:22, SEQ ID NO:23, SEQ ID NO:25, SEQ ID physiological conditions within a live plant cell. NO:26, SEQID NO:27, and SEQID NO:28. 0436 3. The isolated nucleic acid of statement 1, wherein 0448 13. A transgenic plant cell comprising the isolated the nucleic acid selectively hybridizes to a DNA or RNA nucleic acid of any of statements 1-12. comprising either strand of any of the SEQID NO:16, 18, 0449) 14. A transgenic plant comprising the plant cell of 19, 22, 23, 25, 26, 27, 28, 47-63 and 64 sequences under statement 12 or the isolated nucleic acid of any of State stringent hybridization conditions. ments 1-13. 0437. 4. The isolated nucleic acid of statement 3, wherein 0450 15. An expression cassette comprising the p-couma the stringent hybridization conditions comprise a wash in royl-CoA:monolignol transferase nucleic acid of any of 0.1XSSC, 0.1% SDS at 65° C. statements 1-14 operably linked to a promoter functional in 0438 5. The isolated nucleic acid of any of statements 1-5, a host cell. wherein the nucleic acid that selectively hybridizes to a 0451 16. The expression cassette of statement 15, further DNA or RNA has at least about 40%, 50%, 60%, 70%, comprising a feruloyl-CoA:monolignol transferase 80%.90% sequence identity with either strandofany of the nucleic acid operably linked to a promoter functional in a SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28,47-63 and 64 host cell. Sequences. 0452 17. The expression cassette of statement 15 or 16, 0439 6. The isolated nucleic acid of any of statements 1-5, which further comprises a selectable marker gene. wherein the nucleic acid encodes a p-coumaroyl-CoA: monolignol transferase that can catalyze the synthesis of 0453 18. The expression cassette of any of statements monolignol p-coumarate(s) from monolignol(s) and 15-17, wherein the expression cassette is within an expres p-coumaroyl-CoA. sion vector. 0440 7. The isolated nucleic acid of statement 6, wherein 0454) 19. The expression cassette of any of statements the monolignol is coniferyl alcohol, p-coumaryl alcohol, 15-18, wherein at least one of the promoters is a promoter sinapyl alcohol or a combination thereof. functional during plant development or growth. 0441 8. The isolated nucleic acid of any of statements 1-7, 0455 20. The expression cassette of any of statements wherein the nucleic acid encodes a polypeptide with at 15-19, wherein at least one of the promoters is a poplar least 50%, 60%, 70%, 80%, or 90% sequence identity to a Xylem-specific secondary cell wall specific cellulose Syn polypeptide from Oryza sativa comprising a SEQ ID thase 8 promoter, cauliflower mosaic virus promoter, Z10 NO:17, 33, 38 or 44 sequence, Brachypodium distachyon promoter from a gene encoding a 10 kD Zein protein, Z27 comprising a SEQ ID NO:24, 32 or 37 sequence: Citrus promoter from a gene encoding a 27 kD Zein protein, pea Sinensis comprising a SEQID NO:29 sequence, Sorghum rbcS gene or actin promoter from rice. bicolor comprising a SEQID NO:30, 35 or 41 sequence, 0456. 21. A plant cell comprising the expression cassette Zea mays comprising a SEQID NO:31, 36 or 42 sequence, of any of statements 15-20. Panicum virgatum comprising a SEQID NO:34, 40 or 46 0457 22. The plant cell of statement 21, wherein the plant sequence, or Setaria italica comprising a SEQID NO:39, cell is a monocot cell, maize cell, grass cell or softwood 43 or 45 sequence. cell. 0442 9. The isolated nucleic acid of any of statements 1-8, 0458 23. The plant cell of statement 21 or 22, wherein the wherein the nucleic acid encodes p-coumaroyl-CoA: plant cell is a cell selected from the species consisting of monolignol transferase that can catalyze the synthesis of Miscanthus giganteus, Panicum virgatum (Switchgrass), monolignol p-coumarate(s) from a monolignol(s) and Zea mays (corn), Oryza sativa (rice), Saccharum sp. (Sugar p-coumaroyl-CoA with at least about 50% of the activity of cane), Triticum sp. (wheat), Avena sativa (oats), Pennis a p-coumaroyl-CoA:monolignol transferase with the SEQ etum glaucum (pearl millet), Setaria italica (foxtail millet), ID NO:17 or SEQID NO:24. Sorghum sp. (e.g., Sorghum bicolor), Bambu.seae species 0443) 10. The isolated nucleic acid of any of statements (bamboo), Sorghastrum nutans (indiangrass), Tripsacum 1-9, where the isolated nucleic acid is an inhibitory nucleic dactyloides (eastern gamagrass), Andropogon gerardii acid adapted to inhibit the expression and/or translation of (big bluestem), Schizachyrium scoparium (little bluestem), a p-coumaroyl-CoA:monolignol transferase mRNA. Bouteloua curtipendula (Sideoats grama), Silphium tere 0444 11. The isolated nucleic acid of any of statements binthinaceum (prairie rosinweed), Pseudoroegneria spi 1-9, where the isolated nucleic acid is mutating nucleic cata (bluebunch wheatgrass), Sorghum bicolor (sorghum), US 2016/0046955 A1 Feb. 18, 2016 51

Bachypodium distachyon (purple false brome), a species identity, at least 80% sequence identity, at least 85% recited in FIG. 20 and a species recited in Table 2. sequence identity, at least 90% sequence identity, at least 0459 24. The plant cell of statement 21, wherein the plant 95% sequence identity, or at least 97% sequence identity cell is a dicot cell or a hardwood cell. with a nucleic acid sequence selected from the group con 0460 25. A plant comprising the expression cassette of sisting of SEQ ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, any of statements 15-20. 47-63 and 64. 0461) 26. The plant of statement 25, wherein the plant is a 0471 33. A method for incorporating monolignol feru monocot Such as a grass species. lates into lignin of a plant that includes: 0462. 27. The plant of statement 25 or 26, wherein the 0472 a) stably transforming one or more plant cells plant is selected from the species consisting of Miscanthus with a mutating nucleic acid adapted to hybridize to an giganteus, Panicum virgatum (Switchgrass), Zea mays endogenous p-coumaroyl-CoA:monolignol transferase (corn), Oryza sativa (rice), Saccharum sp. (Sugar cane), gene within the plant cells and replace at least one nucle Triticum sp. (wheat), Avena sativa (oats), Pennisetum glau otide of the endogenous p-coumaroyl-CoA:monolignol cum (pearl millet), Setaria italica (foxtail millet), Sorghum transferase gene to generate at least one mutant plant cell sp. (e.g., Sorghum bicolor), Bambu.seae species (bamboo), with a p-coumaroyl-CoA:monolignol transferase gene Sorghastrum nutans (indiangrass), Tripsacum dactyloides knockdown or knockout mutation; or (eastern gamagrass), Andropogon gerardii (big bluestem), 0473 b) stably transforming one or plant cells with an Schizachyrium scoparium (little bluestem), Bouteloua cur expression cassette for expression of an inhibitory tipendula (sideoats grama), Silphium terebinthinaceum (prairie rosinweed), Pseudoroegneria spicata (bluebunch nucleic acid adapted to hybridize to an endogenous wheatgrass), Sorghum bicolor (sorghum), Bachypodium p-coumaroyl-CoA:monolignol transferase nucleic tran distachyon (purple false brome), a species recited in FIG. Script to generate at least one transformed plant cell; 20 and a species recited in Table 2. 0474 b) regenerating the mutant plant cell or the trans 0463. 28. The plant of statement 25, wherein the plant is a formed plant cell into at least one transgenic plant. dicot or a hardwood. 0475 34. The method of statement 33, wherein the trans 0464. 29. A method for incorporating monolignol feru genic plant(s) comprises a recombinant feruloyl-CoA: lates into lignin of a plant comprising: monolignol transferase nucleic acid operably linked to a 0465 a) obtaining one or more plant cells having a promoter that expresses the feruloyl-CoA:monolignol knockout or knockdown mutation of the plant cells transferase protein in the transgenic plant. endogenous p-coumaroyl-CoA:monolignol transferase 0476 35. The method of statement 34, wherein the trans gene. genic plant has increased incorporation of monolignol 0466 b) stably transforming the one or more plant cells ferulates into its lignin compared to a control plant, with an expression cassette comprising a feruloyl-CoA: wherein the control plant (a) does not have the knockout or monolignol transferase nucleic acid to generate one or knockdown mutation, (b) does not have the expression more transformed plant cells with the endogenous cassette comprising an inhibitory nucleic acid, but (c) is p-coumaroyl-CoA:monolignol transferase knockout or stably transformed with the recombinant feruloyl-CoA: knockdown mutation; monolignol transferase nucleic acid operably linked to a 0467 c) regenerating one or more of the transformed promoter that expresses the feruloyl-CoA:monolignol plant cells into at least one transgenic plant. transferase protein. 0468. 30. The method of statement 29, wherein the knock 0477 36. The method of any of statements 33-35, wherein out or knockdown mutation increases incorporation of the knockout or knockdown mutation, or the expression monolignol ferulates into the lignin of at least one of the cassette comprising an inhibitory nucleic acid, increases transgenic plants compared to a control plant that (a) does incorporation of monolignol ferulates into the lignin of a not have the knockout or knockdown mutation but (b) is plant by at least by 1%, or by at least 2%, or by at least 3%, stably transformed with the expression cassette comprising or by at least 5% relative to a control plant that (a) does not feruloyl-CoA:monolignol transferase nucleic acid. have the knockout or knockdown mutation (b) does not 0469 31. The method of statement 29 or 30, wherein the have the expression cassette comprising an inhibitory knockout or knockdown mutation increases incorporation nucleic acid, but (c) is stably transformed with the recom of monolignol ferulates into the lignin of a plant by at least binant feruloyl-CoA:monolignol transferase nucleic acid by 1%, or by at least 2%, or by at least 3%, or by at least 5% operably linked to a promoter that expresses the feruloyl relative to a control plant plant that (a) does not have the CoA:monolignol transferase protein. knockout or knockdown mutation but (b) is stably trans 0478 37. The method of any of statements 33-36, wherein formed with the expression cassette comprising feruloyl the endogenous p-coumaroyl-CoA:monolignol transferase CoA:monolignol transferase nucleic acid. gene can hybridize to a nucleic acid selected from the 0470 32. The method of any of statements 29-31, wherein group consisting of SEQID NO:16, 18, 19, 22, 23, 25, 26, the endogenous p-coumaroyl-CoA:monolignol transferase 27, 28, 47-63 and 64; or the endogenous p-coumaroyl gene can hybridize to a nucleic acid selected from the CoA:monolignol transferase gene has at least 40% group consisting of SEQID NO:16, 18, 19, 22, 23, 25, 26, sequence identity, at least 45% sequence identity, at least 27, 28, 47-63 and 64; or the endogenous p-coumaroyl 50% sequence identity, at least 55% sequence identity, at CoA:monolignol transferase gene has at least 40% least 60% sequence identity, at least 65% sequence iden sequence identity, at least 45% sequence identity, at least tity, at least 70% sequence identity, at least 75% sequence 50% sequence identity, at least 55% sequence identity, at identity, at least 80% sequence identity, at least 85% least 60% sequence identity, at least 65% sequence iden sequence identity, at least 90% sequence identity, at least tity, at least 70% sequence identity, at least 75% sequence 95% sequence identity, or at least 97% sequence identity US 2016/0046955 A1 Feb. 18, 2016 52

with a nucleic acid sequence selected from the group con 0492 49. The method of any of statements 29-48, further sisting of SEQ ID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, comprising breeding a fertile transgenic plant to yield a 47-63 and 64. progeny plant. 0479. 38. The method of any of statements 33-37, wherein 0493 50. The method of statement 49, wherein the prog the mutating nucleic acid has two flanking segments and a eny plant comprises lignin with at least 1% monolignol central segment, ferulate, at least 2% monolignol ferulate, at least 3% mono 0480 wherein the central segment has a point mutation, lignol ferulate, at least 4% monolignol ferulate, at least 5% a deletion, a missense mutation, or a nonsense mutation monolignol ferulate, at least 10% monolignol ferulate, at relative to a nucleic acid selected from the group con least 20% monolignol ferulate, or at least 25% monolignol sisting of SEQID NO:16, SEIDNO:18, SEQID NO:19, ferulate. SEQID NO:22, SEQID NO:23, SEQID NO:25, SEQ 0494 51. The method of any of statements 29-50, further ID NO:26, SEID NO:27, SEQID NO:28; and comprising breeding a fertile transgenic plant to yield a 0481 wherein the two flanking segments can hybridize progeny plant that has an increase in the percentage of to different regions of one of the nucleic acids selected monolignol ferulates in the lignin of the progeny plant as a from the group consisting of SEQ ID NO:16, SE ID dominant trait while still maintaining functional agro NO:18, SEQ ID NO:19, SEQ ID NO:22, SEQ ID nomic characteristics relative to the corresponding NO:23, SEQ ID NO:25, SEQ ID NO:26, SEQ ID untransformed plant. NO:27, and SEQID NO:28. 0495 52. The method of any of statements 29-51, further 0482 39. The method of any of statements 33-37, wherein comprising stably transforming the plant cell with at least the inhibitory nucleic acid can selectively hybridize to a one selectable marker gene. nucleic acid with a sequence selected from the group con 0496 53. A fertile transgenic plant comprising a knock sisting SEQID NO:16, 18, 19, 22, 23, 25, 26, 27, 28, and down or knockout mutation in an endogenous p-couma complementary sequences thereof royl-CoA:monolignol transferase gene, and a recombinant 0483 40. The method of any of statements 33-38, wherein feruloyl-CoA:monolignol transferase nucleic acid oper an inhibitory nucleic acid inhibits expression and/or trans ably linked to a promoter that expresses the feruloyl-CoA: lation of an endogenous p-coumaroyl-CoA:monolignol monolignol transferase protein. transferase mRNA expressed in at least one transgenic 0497 54. The fertile transgenic plant of statement 53, plant. wherein the knockdown or knockout mutation and the feru 0484 41. The method of any of statements 29-40, wherein loyl-CoA:monolignol transferase nucleic acid are trans the transgenic plant is fertile. mitted through a complete normal sexual cycle of the trans 0485 42. The method of any of statements 29-41, further genic plant to the next generation. comprising recovering transgenic seeds from the trans 0498 55. A fertile transgenic plant stably transformed by genic plant. the nucleic acid of any of statements 1-11, wherein the 0486 43. The method of any of statements 29-42, wherein nucleic acid is operably linked to a promoter functional in the plant is a monocot. a host cell, wherein the nucleic acid expresses an inhibitory 0487. 44. The method of any of statements 29-33, wherein nucleic acid and the nucleic acid is transmitted through a the plant is a grass, maize or Softwood plant. complete normal sexual cycle of the transgenic plant to the 0488 45. The method of any of statements 29-44, the plant next generation. is selected from the species consisting of Miscanthus 0499 56. The fertile transgenic plant of statement 55, giganteus, Panicum virgatum (Switchgrass), Zea mays further comprising a feruloyl-CoA:monolignol transferase (corn), Oryza sativa (rice), Saccharum sp. (Sugar cane), nucleic acid is transmitted through a complete normal Triticum sp. (wheat), Avena sativa (oats), Pennisetum glau sexual cycle of the transgenic plant to the next generation. cum (pearl millet), Setaria italica (foxtail millet), Sorghum 0500 57. The fertile transgenic plant of any of statements sp. (e.g., Sorghum bicolor), Bambu.seae species (bamboo), 53-56, wherein the plant is a monocot, grass, maize, gym Sorghastrum nutans (indiangrass), Tripsacum dactyloides nosperm or softwood. (eastern gamagrass), Andropogon gerardii (big bluestem), 0501) 58. The fertile transgenic plant of any of statements Schizachyrium scoparium (little bluestem), Bouteloua cur 53-57, the plant is selected from the species consisting of tipendula (sideoats grama), Silphium terebinthinaceum Miscanthus giganteus, Panicum virgatum (Switchgrass), (prairie rosinweed), Pseudoroegneria spicata (bluebunch Zea mays (corn), Oryza sativa (rice), Saccharum sp. (Sugar wheatgrass), Sorghum bicolor (sorghum), Bachypodium cane), Triticum sp. (wheat), Avena sativa (oats), Pennis distachyon (purple false brome), a species recited in FIG. etum glaucum (pearl millet), Setaria italica (foxtail millet), 20 and a species recited in Table 2. Sorghum sp. (e.g., Sorghum bicolor), Bambu.seae species 0489 46. The method of any of statements 29-42, wherein (bamboo), Sorghastrum nutans (indiangrass), Tripsacum the plant is a dicot, or hardwood. dactyloides (eastern gamagrass), Andropogon gerardii 0490 47. The method of any of statements 29-46, wherein (big bluestem), Schizachyrium scoparium (little bluestem), the lignin in the plant comprises at least 1% monolignol Bouteloua curtipendula (Sideoats grama), Silphium tere ferulate, at least 2% monolignol ferulate, at least 3% mono binthinaceum (prairie rosinweed), Pseudoroegneria spi lignol ferulate, at least 4% monolignol ferulate, at least 5% cata (bluebunch wheatgrass), Sorghum bicolor (sorghum), monolignol ferulate, at least 10% monolignol ferulate, at Bachypodium distachyon (purple false brome), a species least 20% monolignol ferulate, or at least 25% monolignol recited in FIG. 20 and a species recited in Table 2. ferulate. 0502. 59. The fertile transgenic plant of any of statements 0491) 48. The method of any of statements 29-47, wherein 53-56, wherein the plant is a dicot. the lignin in the plant comprises about 1-30% monolignol 0503 54. The fertile transgenic plant of any of statements ferulate, or about 2-30% monolignol ferulate. 53-59, wherein the plant comprises lignin with at least 1%