Molecular Cloning and Characterization Analysis of Pyruvate Phosphate Dikinase Gene from Dunaliella Parva

Total Page:16

File Type:pdf, Size:1020Kb

Molecular Cloning and Characterization Analysis of Pyruvate Phosphate Dikinase Gene from Dunaliella Parva Advanced Materials Research Vols 347-353 (2012) pp 2438-2442 Online: 2011-10-07 © (2012) Trans Tech Publications, Switzerland doi:10.4028/www.scientific.net/AMR.347-353.2438 Molecular Cloning and Characterization Analysis of pyruvate phosphate dikinase Gene from Dunaliella parva Changhua Shang 1,a , Shunni Zhu 1,b , Zhenhong Yuan 1,c and Zhongming Wang 1,d* 1 Key Laboratory of Renewable Energy and Natural Gas Hydrate, Chinese Academy of Sciences, Guangzhou Institute of Energy Conversion, Chinese Academy of Sciences, Guangzhou, 510640, China No.2, Nengyuan Rd, Wushan, Tianhe District, Guanzhou. aemail: [email protected], bemail: [email protected], cemail: [email protected], demail: [email protected] *Corresponding author: Zhongming Wang Keywords: Dunaliella parva; pyruvate phosphate dikinase; molecular cloning; sequence analysis Abstract. Pyruvate phosphate dikinase (PPDK) catalyzes the reversible conversion of AMP, phosphoenolpyruvate (PEP) and pyrophosphate (PPi) to ATP, pyruvate and inorganic phosphate (Pi). It is a key enzyme in gluconeogensis and photosynthesis that is responsible for reversing the reaction performed by pyruvate kinase in Embden-Meyerhof-Parnas glycolysis. A cDNA clone for the Dunaliella parva PPDK was isolated by sequencing. Then the 3'-RACE and 5'-cDNA amplification were conducted based on the obtained sequence. The molecular characterization of the PPDK gene was described.The Dunaliella parva PPDK gene cDNA sequence was 3249 bp, which contained 2595 bp coding region and 654 bp 3'-untranslated regions. The deduced amino acid sequence of Dunaliella parva PPDK showed significant homology to the known PPDK from Volvox carteri and Chlamydomonas reinhardtii . This study provided foundation for further research on the function analysis and overexpression of PPDK genes. To our knowledge this is the first reported. Introduction Oil-rich microalgae have been proven to be a promising alternative source of lipids producing biodiesel [1-4]. Nevertheless, significant challenges remain in the cost of microalgal biodiesel production. One problem was that the lipid content of microalgae was unsatisfactory for the requirement of commercial production. One of the solution was increasing lipid content in cells. Lipid overproduction using microalgae by genetic engineering approaches was a burgeoning trend. Our research focused on the enhancement of lipid production in green alga using genetic engineering approaches. Because there was correlation between the photosynthesis and lipid accumulation, therefore we planed to enhance the lipid production of green alga through the enhancement of the photosynthesis. Pyruvate phosphate dikinase (PPDK ; EC 2.7.9.1 ) catalyzes the reversible conversion of AMP, phosphoenolpyruvate (PEP) and pyrophosphate (PPi) to ATP, pyruvate and inorganic phosphate (Pi) [5]. It is a key enzyme in gluconeogensis and photosynthesis [5]. This enzyme is part of the C 4 -dicarboxylic acid cycle, for the fixation of atmospheric CO 2 in mesophyll cells and subsequent transport (as malate) to bundle sheath cells for photosynthesis [6-8]. The result of Wang et al. indicated that the two enzymes known to limit C 4 photosynthesis, increase of PPDK, not Rubisco content, corresponds to the recovery and maintenance of photosynthetic capacity [9]. The studies of Hatch and Furbank et al. suggested that PPDK was a rate-limiting enzyme in the C 4 cycle, the PPDK activity is regulated in a light-dependent manner so the total pathway can function optimally in CO 2 assimilation [10-12]. All rights reserved. No part of contents of this paper may be reproduced or transmitted in any form or by any means without the written permission of Trans Tech Publications, www.ttp.net. (ID: 152.14.136.77, NCSU North Carolina State University, Raleigh, USA-09/04/15,07:32:04) Advanced Materials Research Vols. 347-353 2439 The PPDK gene have been cloned from various species, including Giardia lamblia , Entamoeba histolytica , Trypanosoma cruzi [13-15]. In view of a possible quantitative correlation between PPDK expression levels, photosynthesis, and lipid accumulation, it is of interest to study the PPDK-catalyzed committed step at the molecular level. As a first step to better understanding of the role of PPDK in photosynthesis and lipid accumulation in Dunaliella parva , we report for the first time the cloning and characterization of a new PPDK gene from this commercially important microalgae. Materials and Methods Cell culture conditions. Dunaliella parva FACHB-815, was obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology, Chinese Academy of Sciences, and maintained on Dunaliella medium at 25˚C under light illumination of 2000lux. Total RNA extraction and 1st strand cDNA synthesis. Total RNA was isolated from Dunaliella parva , using a RNAiso Plus reagent (Takara Co. Ltd., China). RNA concentration was determined spectrophotometrically. RNAs were reversely transcribed with PrimeScript Reverse Transcriptase, and an 3′ RACE Adaptor primer was used according to protocol of 3′-Full RACE Core Set Ver.2.0 (Takara Co . Ltd., China). 1 µ g total RNA was used for the reverse transcription reaction. Cloning of a PPDK cDNA fragment from Dunaliella parva. A cDNA clone for the Dunaliella parva PPDK was isolated by sequencing. This clone showed extensive homology with a number of known PPDK genes , providing strong evidence that the obtained sequence encoded part of the Dunaliella parva PPDK cDNA. Cloning of PPDK 3'-cDNA by rapid amplification of cDNA ends (RACE). Total RNA was used to synthesize the first-strand cDNA using a 3'-Full RACE Core Set Ver 2.0 Kit (Takara Co. Ltd., China ). 3'-RACE was conducted with PPDK (w) and PPDK (n) (Table 1) as gene specific outer and inner primers. The first cloning of the 5'-cDNA sequence. Based on highly conserved amino acid regions of known PPDK , a degenerate primers, PPDK (s1) (Table 1) encoding MPGMMDT was synthesized. According to the obtained cDNA clone sequence, a specific primer PPDK(a1t) was synthesized. PPDK (s1) and PPDK(a1t) were used for amplification of partial 5'-cDNA sequence of PPDK . The second cloning of the 5'-cDNA sequence. Based on the obtained partial 5'-cDNA sequence, a specific primer PPDK(a2t) was synthesized. Based on highly conserved amino acid regions of known PPDK, a degenerate primers, PPDK (s2) (Table 1) encoding LLGGKGA was synthesized. PPDK (s2) and PPDK(a2t) were used for amplification of partial 5'-cDNA sequence of PPDK. Table 1 Primers used in this study Primers Primer sequences (5′→3′ ) PPDK(w) CACTCCCGCTTGGACTCACTG PPDK(n) ATCCCTCTGGTCGGCATTGTG PPDK(s1) ATGCCHGGCATGATGGACAC PPDK(a1t) CCATCCATCGCCCTGAAGAG PPDK(s2) CTSCTSGGCGGCAAGGGCGC PPDK(a2t) GTGCTGCCTTGACCCTCT 2440 Renewable and Sustainable Energy Results and Discussion A cDNA clone for the Dunaliella parva PPDK was isolated by sequencing. A Blastx search revealed that the cloned sequence (613 bp) was homologous to a number of known PPDK genes, providing strong evidence that the obtained sequence encoded part of the Dunaliella parva PPDK cDNA. The 3' end cDNA of Dunaliella parva PPDK was amplified by 3'-RACE using PPDK(w) and PPDK(n) based on the 613 bp cDNA fragment. The 3' end cDNA of PPDK is 1173 bp, which contained a 519 bp coding region, 654 bp of 3'-untranslated regions, and a poly A tail 15 bp. The 5' end cDNA of PPDK was amplified by PPDK(s1) and PPDK(a1t) first, then amplified by PPDK(s2) and PPDK(a2t). The length of two amplification were 1544 bp and 433 bp respectively. The total cDNA sequence was assembled from the obtained sequence, which include 2595 bp coding region and 654 bp 3'- untranslated regions (Fig. 1). NCBI-CD search revealed that there are three mainly domains predicted in the Dunaliella parva PPDK protein (Fig. 2). PPDK_N superfamily was a PEP/pyruvate binding domain, PEP-utilizers domain was a "swivelling" beta/beta/alpha domain which is thought to be mobile in all proteins known to contain it. Pyruvate_kinase superfamily was a domain that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Blastx search revealed that the Dunaliella parva PPDK was homologous to a number of known PPDK genes, The highest similarities were recorded with green algae Volvox carteri and Chlamydomonas reinhardtii . Oleaginous algae have been recognized as promising alternative lipid/oil feedstocks for biofuel production. However, algae-based biofuels are limited by feedstock supply. Lipids are more energy dense, which have frequently been applied as fuel feedstocks. The former studies indicated the feasibility of enhancing photosynthesis through overexpression of PPDK gene [5-12]. In this study, we cloned and characterized the gene encoding PPDK of Dunaliella parva . Multiple sequence alignments revealed that the deduced amino acid sequence of the Dunaliella parva PPDK gene shared high homology with that of many algal species and other organisms. This study provided foundation for further research on the function analysis and overexpression of PPDK genes. Our next work should conduct the correlation analysis among the overexpression of PPDK gene, the photosynthesis and lipid accumulation. Conclusions In conclusion, our data show partial PPDK cDNA was cloned from Dunaliella parva , which includes 2595 bp coding region and 654 bp 3'-untranslated regions. The characterization of PPDK shows it should be functional and can be used to enhance photosynthesis of transgenic algae by it's overexpression in cells. Acknowledgements This work was financially supported by the comprehensive strategic cooperation project between Guangdong Province and Chinese Academy of Sciences (No. 2010A090100010 ), National Key Technology R&D Program of the 12th Five-year Plan of China (No. 2011BAD14B03 ) and Foundation of Key Laboratory of Renewable Energy and Natural Gas Hydrate, Chinese Academy of Sciences (No. y107j6). Advanced Materials Research Vols. 347-353 2441 References [1] Y. Chisti, Biotechnol. Adv. 25 (2007) 294 -306 [2] Y. L i, M. Horsman, N. Wu, C.Q. Lan, N. Dubois-Calero, Biotechnol. Prog. 24 (2008) 815-820 [3] B. Wang, Y.
Recommended publications
  • Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity
    Vol. 10, 2551–2560, April 1, 2004 Clinical Cancer Research 2551 Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity Ki-Hyuk Shin,1 Mo K. Kang,1 Erica Dicterow,1 INTRODUCTION Ayako Kameta,1 Marcel A. Baluda,1 and Telomerase, which consists of the catalytic protein subunit, No-Hee Park1,2 human telomerase reverse transcriptase (hTERT), the RNA component of telomerase (hTR), and several associated pro- 1School of Dentistry and 2Jonsson Comprehensive Cancer Center, University of California, Los Angeles, California teins, has been primarily associated with maintaining the integ- rity of cellular DNA telomeres in normal cells (1, 2). Telomer- ase activity is correlated with the expression of hTERT, but not ABSTRACT with that of hTR (3, 4). Purpose: From numerous reports on proteins involved The involvement of DNA repair proteins in telomere main- in DNA repair and telomere maintenance that physically tenance has been well documented (5–8). In eukaryotic cells, associate with human telomerase reverse transcriptase nonhomologous end-joining requires a DNA ligase and the (hTERT), we inferred that hTERT/telomerase might play a DNA-activated protein kinase, which is recruited to the DNA role in DNA repair. We investigated this possibility in nor- ends by the DNA-binding protein Ku. Ku binds to hTERT mal human oral fibroblasts (NHOF) with and without ec- without the need for telomeric DNA or hTR (9), binds the topic expression of hTERT/telomerase. telomere repeat-binding proteins TRF1 (10) and TRF2 (11), and Experimental Design: To study the effect of hTERT/ is thought to regulate the access of telomerase to telomere DNA telomerase on DNA repair, we examined the mutation fre- ends (12, 13).
    [Show full text]
  • Purification and Characterization of the Reverse Transcriptase Expressed In
    Volume 270, number 1,2, 76-80 FEBS 08845 September 1990 Purification and characterization of the RNase H domain of HIV-l reverse transcriptase expressed in recombinant Escherichia coli S. Patricia Becerra’, G. Marius Clore2, Angela M. Gronenbornz, Anders R. Karlstr6m3, Stephen J. Stahl‘+, Samuel H. Wilson’ and Paul T. Wingfield 1Laboratory of Biochemistry, NCI, ZLaboratory of Chemical Physics, NIDDK, 3Laboratory of Biochemistry, NHLB and 4Protein Expression Laboratory, National Institutes of Health, Bethesda, MD 20892, USA Received 2 July 1990 The ribonuclease H (RNase H) domain of human immuno-deficiency virus (HIV-l) reverse transcriptase has been produced with the aim of provid- ing sufficient amounts of protein for biophysical studies. A plasmid vector is described which directs high level expression of the RNase H domain under the control of the I PL promoter. The domain corresponds to residues 427-560 of the 66 kDa reverse transcriptase. The protein was expressed in Escherichia cob’ and was purified using ion-exchange and size exclusion chromatography. The purified protein appears to be in a native-like homogeneous conformational state as determined by iH-NMR spectroscopy and circular dichroism measurements. HIV-protease treatment of the RNase H domain resulted in cleavage between Phe-440 and Tyr-441. HIV-l reverse transcriptase; HIV-l RNase H; HIV protease; Protein expression; Protein purification; Protein conformation 1. INTRODUCTION as a separate 15 kDa protein. The purified protein ap- pears suitable for structural studies by both NMR spec- Ribonuclease H (RNase H) activity resides in the C- troscopy and X-ray analysis, thereby providing an addi- terminal region of retroviral polymerases as shown by tional target in the search for therapeutic agents against deletion experiments [ 11, linker insertion [2] and point the spread of HIV infection.
    [Show full text]
  • Rapidxfire Thermostable Reverse Transcriptase Application Note
    Application note RapiDxFire Thermostable Reverse Transcriptase Introduction RNA target, which improves cDNA yield and A reverse transcriptase (RT) is a DNA subsequent detection sensitivity from difficult polymerase enzyme that synthesises cDNA RNA targets. Thermostability also is an from an RNA template. RTs are widely indicator of general enzyme stability for storage, used to study gene expression in cells or automation applications, and lyophilisation. tissues, in next-generation sequencing Processivity, which refers to the number of (NGS) applications, and in conjunction with nucleotides incorporated into cDNA during quantitative PCR (qPCR) or isothermal a single enzyme binding event, can affect amplification methods to detect and identify cDNA length, RT efficiency, and RT reaction RNAs that are of clinical or functional time. Native RT enzymes also have RNase H significance. endonuclease activity that will cleave the RNA from a DNA-RNA duplex and limit cDNA length. RT enzymes may differ in key characteristics Some RT variants also have been engineered that affect their performance in different to reduce RNase H activity to allow longer applications. Their thermostability allows cDNA products. cDNA synthesis to be performed at higher temperatures (above 50 °C), enabling them Commercially available RTs used in molecular to melt areas of secondary structure in the biology are generally derived from Moloney Application note RapiDxFire Thermostable Reverse Transcriptase murine leukaemia virus (MMLV) or avian Skeletal Muscle Total RNA (Thermo Fisher myeloblastosis virus (AMV), which have optimal Scientific Cat No. AM7982), RNA, MS2 (Roche activity at 37-42 °C. Cloned AMV RT and Cat No. 10165948001), Zika virus ATCC® engineered variants of AMV RT and MMLV VR-1843™ (ATCC Cat No.
    [Show full text]
  • Telomere and Telomerase in Oncology
    Cell Research (2002); 12(1):1-7 http://www.cell-research.com REVIEW Telomere and telomerase in oncology JIAO MU*, LI XIN WEI International Joint Cancer Institute, Second Military Medical University, Shanghai 200433, China ABSTRACT Shortening of the telomeric DNA at the chromosome ends is presumed to limit the lifespan of human cells and elicit a signal for the onset of cellular senescence. To continually proliferate across the senescent checkpoint, cells must restore and preserve telomere length. This can be achieved by telomerase, which has the reverse transcriptase activity. Telomerase activity is negative in human normal somatic cells but can be detected in most tumor cells. The enzyme is proposed to be an essential factor in cell immortalization and cancer progression. In this review we discuss the structure and function of telomere and telomerase and their roles in cell immortalization and oncogenesis. Simultaneously the experimental studies of telomerase assays for cancer detection and diagnosis are reviewed. Finally, we discuss the potential use of inhibitors of telomerase in anti-cancer therapy. Key words: Telomere, telomerase, cancer, telomerase assay, inhibitor. Telomere and cell replicative senescence base pairs of the end of telomeric DNA with each Telomeres, which are located at the end of round of DNA replication. Hence, the continual chromosome, are crucial to protect chromosome cycles of cell growth and division bring on progress- against degeneration, rearrangment and end to end ing telomere shortening[4]. Now it is clear that te- fusion[1]. Human telomeres are tandemly repeated lomere shortening is responsible for inducing the units of the hexanucleotide TTAGGG. The estimated senescent phenotype that results from repeated cell length of telomeric DNA varies from 2 to 20 kilo division, but the mechanism how a short telomere base pairs, depending on factors such as tissue type induces the senescence is still unknown.
    [Show full text]
  • RNA-Dependent RNA Polymerase Speed and Fidelity Are Not the Only Determinants of the Mechanism Or Efficiency of Recombination
    G C A T T A C G G C A T genes Article RNA-Dependent RNA Polymerase Speed and Fidelity are not the Only Determinants of the Mechanism or Efficiency of Recombination Hyejeong Kim y, Victor D. Ellis III, Andrew Woodman, Yan Zhao, Jamie J. Arnold y and , Craig E. Cameron y * Department of Biochemistry and Molecular Biology, The Pennsylvania State University, 201 Althouse Laboratory, University Park, PA 16802, USA; [email protected] (H.K.); [email protected] (V.D.E.); [email protected] (A.W.); [email protected] (Y.Z.); [email protected] (J.J.A.) * Correspondence: [email protected]; Tel.: +1-919-966-9699 Present address: Department of Microbiology and Immunology, School of Medicine, University of North y Carolina at Chapel Hill, 125 Mason Farm Rd., Chapel Hill, NC 27599-7290, USA. Received: 15 October 2019; Accepted: 21 November 2019; Published: 25 November 2019 Abstract: Using the RNA-dependent RNA polymerase (RdRp) from poliovirus (PV) as our model system, we have shown that Lys-359 in motif-D functions as a general acid in the mechanism of nucleotidyl transfer. A K359H (KH) RdRp derivative is slow and faithful relative to wild-type enzyme. In the context of the KH virus, RdRp-coding sequence evolves, selecting for the following substitutions: I331F (IF, motif-C) and P356S (PS, motif-D). We have evaluated IF-KH, PS-KH, and IF-PS-KH viruses and enzymes. The speed and fidelity of each double mutant are equivalent. Each exhibits a unique recombination phenotype, with IF-KH being competent for copy-choice recombination and PS-KH being competent for forced-copy-choice recombination.
    [Show full text]
  • Localization of Glucokinase Gene Expression in the Rat Brain Ronald M
    Localization of Glucokinase Gene Expression in the Rat Brain Ronald M. Lynch, Linda S. Tompkins, Heddwen L. Brooks, Ambrose A. Dunn-Meynell, and Barry E. Levin The brain contains a subpopulation of glucosensing neu- rons that alter their firing rate in response to elevated glucose concentrations. In pancreatic ␤-cells, gluco- ammalian feeding behavior and general energy kinase (GK), the rate-limiting enzyme in glycolysis, medi- homeostasis appear to be regulated by circu- ates glucose-induced insulin release by regulating intra- lating levels of nutrients (glucose) and pep- cellular ATP production. A similar role for GK is pro- tides (e.g., leptin, insulin). Sensors to detect lev- posed to underlie neuronal glucosensing. Via in situ M els of these factors have been found to reside within specific hybridization, GK mRNA was localized to hypothalamic areas that are thought to contain relatively large popu- nuclei of the hypothalamus (1–8), where central regulation of lations of glucosensing neurons (the arcuate, ventrome- energy homeostasis is believed to be coordinated. For exam- dial, dorsomedial, and paraventricular nuclei and the lat- ple, large changes in blood glucose are correlated with cen- eral area). GK also was found in brain areas without trally mediated responses such as thermogenesis through known glucosensing neurons (the lateral habenula, the activation of the sympathetic nervous system. These changes bed nucleus stria terminalis, the inferior olive, the are monitored by the brain (9–11), and such responses are retrochiasmatic and medial preoptic areas, and the thal- altered in obesity-prone animals (11–13). Moreover, lesions amic posterior paraventricular, interpeduncular, oculo- of the ventromedial hypothalamus (VMH) prevent the hypo- motor, and anterior olfactory nuclei).
    [Show full text]
  • Prevalence of Rota Virus Detection by Reverse Transcriptase
    IOSR Journal of Pharmacy and Biological Sciences (IOSR-JPBS) e-ISSN:2278-3008, p-ISSN:2319-7676. Volume 12, Issue 1 Ver. III (Jan. - Feb.2017), PP 94-99 www.iosrjournals.org Prevalence of Rota Virus Detection by Reverse Transcriptase- Polymerase Chain Reaction in Stool from Children Fewer Than Five Age With Acute Diarrhea in Diyala Province in Iraq Ansam Dawod Salman Lecturer in Diyala University, Collage of science, Department of Biology Abstract: The present study was conducted for the period from 1/6/2016 to 20/1/2017 in Baquba city. The study aimed to detection of rotavirus in stool specimens of children fewer than five age and also explore the effects of certain demographic factors on the detection rates by revers transcriptase- polymerase chain reaction. The study included 49 patients with acute diarrhea, 32 were male and 17 were female. The age range was two months to 5 years. Demographic information on the patients regarding age, sex, residence, type of feeding and source of drinking water were collected from their parents. Stool specimens were collected from each patients and. Detection of rotavirus in stool specimens was done by conventional reverse transcriptase polymerase chain reaction (RT-PCR). The results of present study showed that the overall infection rate by rotavirus among patients with acute diarrhea by RT-PCR tests was 93.88%. The highest infection rate was recorded among those >10-≤15 months of age. None of the results showed significantly difference between female and male, PCR (88% vs 96.87%). Likewise, there was insignificantly difference between urban and rural residence, PCR (95.65% vs 92.30%).
    [Show full text]
  • Semi-Quantitative Detection of RNA-Dependent RNA Polymerase Activity of Human Telomerase Reverse Transcriptase Protein
    Journal of Visualized Experiments www.jove.com Video Article Semi-quantitative Detection of RNA-dependent RNA Polymerase Activity of Human Telomerase Reverse Transcriptase Protein Yoshiko Maida*1, Mami Yasukawa*1, Marco Ghilotti1, Yoshinari Ando1, Kenkichi Masutomi1 1 Division of Cancer Stem Cell, National Cancer Center Research Institute * These authors contributed equally Correspondence to: Kenkichi Masutomi at [email protected] URL: https://www.jove.com/video/57021 DOI: doi:10.3791/57021 Keywords: Genetics, Issue 136, TERT, RNA-dependent RNA polymerase, double-stranded RNA, telomerase, immunoprecipitation, radioisotope Date Published: 6/12/2018 Citation: Maida, Y., Yasukawa, M., Ghilotti, M., Ando, Y., Masutomi, K. Semi-quantitative Detection of RNA-dependent RNA Polymerase Activity of Human Telomerase Reverse Transcriptase Protein. J. Vis. Exp. (136), e57021, doi:10.3791/57021 (2018). Abstract Human telomerase reverse transcriptase (TERT) is the catalytic subunit of telomerase, and it elongates telomere through RNA-dependent DNA polymerase activity. Although TERT is named as a reverse transcriptase, structural and phylogenetic analyses of TERT demonstrate that TERT is a member of right-handed polymerases, and relates to viral RNA-dependent RNA polymerases (RdRPs) as well as viral reverse transcriptase. We firstly identified RdRP activity of human TERT that generates complementary RNA stand to a template non-coding RNA and contributes to RNA silencing in cancer cells. To analyze this non-canonical enzymatic activity, we developed RdRP assay with recombinant TERT in 2009, thereafter established in vitro RdRP assay for endogenous TERT. In this manuscript, we describe the latter method. Briefly, TERT immune complexes are isolated from cells, and incubated with template RNA and rNTPs including radioactive rNTP for RdRP reaction.
    [Show full text]
  • Introduction and Expression of PEP Synthase in Synechocystis Sp. PCC 6803
    Introduction and Expression of PEP Synthase in Synechocystis sp. PCC 6803 Paweł Piątek Degree project in applied biotechnology, Master of Science (2 years), 2013 Examensarbete i tillämpad bioteknik 45 hp till masterexamen, 2013 Biology Education Centre and the Department of Photochemistry and Molecular Science, Ångstrom, Uppsala University, Uppsala University Academic Supervisor: Prof. Peter Lindblad Laboratory Supervisors: Dr. Anja Nenninger and Elias Englund Contents Abstract 2 Introduction 3 Establishing synthetic pathways in cyanobacteria 3 Synthetic Pathway Design 5 The MOG pathway 6 Phosphoenolpyruvate Synthase 8 Pyruvate Phosphate Dikinase 8 Experimental Aims 10 Materials and Methods 10 Results 13 Construction of the pEERM[PEPS] plasmid 13 PEPS light regulation 13 Correct PEPS recombination 14 Examining overexpression of PEPS 15 Discussion 16 Plasmid Selection 16 Antibiotic Resistance Cassette 17 Light regulation of PEPS 17 RNA Extraction & cDNA Synthesis 18 Overexpression of PEPS and further experimentation 19 Conclusion 19 Appendix 20 Section 1: Colorimetric Determination of PEPS activity 20 Introduction and Theory 20 Materials and Methods 21 Results and Discussion 21 Section 2: Materials 23 Section 3: Primers 24 Acknowledgments 25 References 26 Websites/Databases 26 Literature 26 Abstract In recent years photosynthetic cyanobacteria have become the focus in high-value compound production through genetically engineered means. Through manipulation of both native and exogenous DNA, it has been shown that it is possible to construct synthetic pathways within cyanobacteria. However some of these constructed pathways are faced with natural bottle-necks found in the organism’s metabolic pathways. Therefore to produce useful compounds, the demands for the organism to fix carbon from the atmosphere greatly increase.
    [Show full text]
  • Reverse Transcriptase and Cdna Synthesis - Kunitada Shimotohno
    GENETICS AND MOLECULAR BIOLOGY - Reverse Transcriptase and cDNA Synthesis - Kunitada Shimotohno REVERSE TRANSCRIPTASE AND cDNA SYNTHESIS Kunitada Shimotohno Kyoto University, Japan Keywords: retrovirus, reverse transcriptase, Rous sarcoma virus, chicken, murine, transposon, mobile genetic element, human immunodeficiency virus, human t-cell leukemia virus, copia, ty-element, cDNA, Actinomycin-D, ribonuclease H, tRNA, primer, template, inhibitor, azidothimidine, LINE, genome, hepatitis B virus, cauliflower mosaic virus, thermus thermophilus, DNA polymerase, polymerase chain reaction, avian myeloblastosis virus, RNase Contents 1. Introduction 2. Discovery of Reverse Transcriptase 3. Characteristic Features of Retroviral Reverse Transcriptases 3.1. Template and Primer Requirements for Reverse Transcriptase 3.2. Substrates for the Enzyme 3.3. Other Factors Required for Reverse Transcription 3.3. Natural Primers for cDNA Synthesis of Retrovirus Genome 3.5. Inhibitors of Reverse Transcriptases 4. Reverse Transcriptase Activity in Other Organisms 4.1. Reverse Transcriptase Activity in Retroposons 4.2. Reverse Transcripatase Activity in Pararetroviruses 4.2.1. Reverse Transcriptase Activity in Hepatitis B Virus (HBV) 4.2.2. Reverse Transcriptase Activity in Cauliflower Mosaic Virus (CaMV) 4.3. Reverse Transcriptase Activity and Telomerase 4.4. Reverse Transcriptase Activity in Thermus Thermophilus DNA Polymerase 5. Conserved Amino Acid Residues in Putative Reverse Transcriptase 6. Structure of Retroviral Reverse Transcriptases 7. cDNA Synthesis
    [Show full text]
  • Annie's Cute Little Helicase
    Growth-regulated expression and G0-specific turnover of the mRNA that encodes AH49, a mammalian protein highly related to the mRNA export protein UAP56 DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Anne M. Pryor, B.S. ***** The Ohio State University 2003 Dissertation Committee: Dr. Lee Johnson, Adviser Approved By Dr. Gustavo Leone Dr. David Bisaro Adviser Dr. Michael Ostrowski Ohio State Biochemistry Program ABSTRACT The expression patterns of many genes are regulated at the post- transcriptional level. Therefore, understanding the mechanisms of post- transcriptional processes such as splicing and nuclear export is extremely important. DExD/H box RNA helicases are involved in remodeling RNA-RNA and RNA-protein complexes in all aspects of mRNA metabolism. One DExD/H box protein, UAP56, is a presumed RNA helicase that has been shown to be essential for the nuclear export of all mRNAs in S. cerevisiae and D. melanogaster. I have identified another DExD/H box protein, AH49, which is 89.9% identical to UAP56. Although S. cerevisiae and D. melanogaster have only a single protein corresponding to this helicase (Sub2p and HEL, respectively), I show that mRNAs corresponding to AH49 and UAP56 are both expressed in human and mouse cells. Also, both proteins interact with the export factor Aly in GST pull down assays. UAP56 mRNA was more abundant than AH49 mRNA in many of the human and mouse tissues tested. However, AH49 mRNA was much more abundant than UAP56 mRNA in testes. UAP56 and AH49 mRNAs were present at similar levels in proliferating mouse 3T3 and human WI38 fibroblasts.
    [Show full text]
  • RT-PCR) with Propidium Monoazide (PMA)
    Vol. 9(9), pp. 311-314, 15 May, 2014 DOI: 10.5897/SRE2014.5908 Article Number: 06AD24744496 ISSN 1992-2248 © 2014 Scientific Research and Essays Copyright©2014 Author(s) retain the copyright of this article http://www.academicjournals.org/SRE Full Length Research Paper Development of a method to detect infectious rotavirus and astrovirus by reverse transcriptase polymerase chain reaction (RT-PCR) with propidium monoazide (PMA) Wei Yumei 1,2, Liu Tingting1, Wang Jingqi1, He Xiaoqing1* and Wang Zijian2 1College of Biological Sciences and Technology, P. O. Box 162, Beijing Forestry University, Beijing 100083, China. 2State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P. O. Box 2871, Beijing 100085, China. Received 3 January, 2013; Accepted 2 March, 2013 Rotavirus and astrovirus are two kinds of water-borne pathogens that can cause severe diarrhea in children, infants and immunocompromised humans. Both can be present in untreated and inadequately treated water. Molecular methods, such as the reverse transcriptase polymerase chain reaction (RT- PCR), have been used to detect two viral genomes in a few hours, but they cannot distinguish between infectious and noninfectious rotavirus and astrovirus. In our study, we developed a propidium monoazide-reverse transcriptase polymerase-chain reaction (PMA-RT-PCR) assay to determine the infectivity of these two RNA viruses. Rotavirus and astrovirus stool samples were detected by RT-PCR in conjunction with PMA, respectively. Stool samples inactivated with heat treatment (95°C) were processed at the meantime as controls. The result showed that infectious virus samples gave positive results, while noninfectious virus samples presented negative results.
    [Show full text]