Introduction and Expression of PEP Synthase in Synechocystis Sp. PCC 6803

Introduction and Expression of PEP Synthase in Synechocystis sp. PCC 6803

Paweł Piątek

Degree project in applied biotechnology, Master of Science (2 years), 2013 Examensarbete i tillämpad bioteknik 45 hp till masterexamen, 2013

Biology Education Centre and the Department of Photochemistry and Molecular Science, Ångstrom, Uppsala University, Uppsala University

Academic Supervisor: Prof. Peter Lindblad Laboratory Supervisors: Dr. Anja Nenninger and Elias Englund

Contents

Abstract 2 Introduction 3 Establishing synthetic pathways in cyanobacteria 3 Synthetic Pathway Design 5 The MOG pathway 6 Phosphoenolpyruvate Synthase 8 Pyruvate Phosphate Dikinase 8 Experimental Aims 10 Materials and Methods 10 Results 13 Construction of the pEERM[PEPS] plasmid 13 PEPS light regulation 13 Correct PEPS recombination 14 Examining overexpression of PEPS 15 Discussion 16 Plasmid Selection 16 Antibiotic Resistance Cassette 17 Light regulation of PEPS 17 RNA Extraction & cDNA Synthesis 18 Overexpression of PEPS and further experimentation 19 Conclusion 19 Appendix 20 Section 1: Colorimetric Determination of PEPS activity 20 Introduction and Theory 20 Materials and Methods 21 Results and Discussion 21 Section 2: Materials 23 Section 3: Primers 24 Acknowledgments 25 References 26 Websites/Databases 26 Literature 26

Abstract

In recent years photosynthetic cyanobacteria have become the focus in high-value compound production through genetically engineered means. Through manipulation of both native and exogenous DNA, it has been shown that it is possible to construct synthetic pathways within cyanobacteria. However some of these constructed pathways are faced with natural bottle-necks found in the organism’s metabolic pathways. Therefore to produce useful compounds, the demands for the organism to fix carbon from the atmosphere greatly increase. This demand is restricted by the enzyme Rubisco, a native carbon-fixing enzyme found within cyanobacteria and plants alike which has been regarded as inefficient. The aim of this thesis is to highlight an alternate synthetic carbon-fixation pathway one could introduce into the cyanobacterium, Synechocystis sp. PCC 6803. This would be shown through the overexpression of phosphoenolpyruvate synthase (PEPS), the first enzyme of the malonyl-CoA-oxaloacetate-glyoxylate pathway. The initial step involved amplifying the native gene coding for PEPS and cloning it into a plasmid which was introduced into Synechocystis sp. PCC 6803. RNA was extracted and used in preparation for semi-quantitative reverse-transcriptase PCR, which detected whether PEPS is expressed alongside its native counterpart. Reverse-transcriptase PCR was similarly used to detect if wild type PEPS is light regulated. Results showed that there is PEPS overexpression in the desired locus alongside the native PEPS, as well as confirmation that wild type PEPS expression is influenced by light. Future experiments may include assays that detect the level of activity of the overexpressed enzyme in comparison to its wild-type equivalent.

Introduction Establishing synthetic pathways in cyanobacteria Metabolically engineered cyanobacteria have become an attractive organism which to produce high- value compounds, chiefly in regards to alternative biofuel production. Through genetically manipulating Synechocystis sp. PCC 6803, it has been shown that its oxygenic photosynthetic properties can provide a practical solution to this challenge, (Rosgaard et al., 2012). Over the course of the last decade, there have been significant strides in this direction with encouraging results illustrating cyanobacteria as excellent candidates for metabolic engineering, Synechocystis sp. PCC 6803 in particular, (Lindberg et al., 2010; Robertson et al., 2011; Skjanes et al., 2013).

By capturing light energy and fixing CO2, Synechocystis sp. PCC 6803 (referred to as PCC 6803 thereon after), is able to produce organic compounds through its native pathways. This activity has been of primary interest to many researchers, with examples of such products including; plastic precursors, pharmaceuticals and biofuels, (Lindberg et al., 2010; Ducat et al., 2011; Skjanes et al., 2013; Wang et al., 2013). Some of these compounds can be naturally derived from PCC 6803, although inefficiently, and not on an industrially viable scale. Despite this, there is a wealth of knowledge pointing to the potential of introducing numerous enzymes derived from foreign organisms into PCC 6803 and redesigning entire pathways into producing desirable products, fig. 1, (Rosgaard et al., 2012).

Fig. 1; Metabolic pathways in cyanobacteria; Metabolic pathways that have been engineered (orange) to produce products (blue). Several enzymes have been omitted from the Isobutanol and 1-butanol pathway. Abbreviations; 3PGA, 3-phosphoglyceric acid; GAP, glyceraldehyde-3-phosphate; 2PG, 2-phosphoglycerate;

PEP, phosphoenolpyruvate; DXP, 1-deoxyxylulose-5-phosphate; HMBPP, 1-hydroxy-2-methyl-2-butenyl-4- pyrophosphate; DMAPP, dimethylallyl-pyrophosphate. Enzyme abbreviations; IspS, isoprene synthase; LdhA, lactate dehydrogenase; Pdc, pyruvate decarboxylase; KivD, oxoacid decarboxylase; 1-butanol pathway enzymes can be found in Rosegaard et. al 2012’s study. Fig. 1, partially adapted from Rosgaard et al., 2012 and Ducat et al., 2011.

The first step before introducing any enzymatic pathway is identifying natural bottlenecks in PCC 6803, and inquiring whether it is possible to alleviate or circumvent such obstacles. Carbon is the key element found in all organic compounds and therefore increasing its presence within the organism is vitally important in increasing the amount of desired product. PCC 6803 pumps carbon into the - cytosol in the form of HCO3 and CO2. Equilibrium inside the cytosol is reached with both compounds - present, to which HCO3 can rapidly convert into CO2. The enzyme, Carbonic Anhydrase (CA) found in - PCC 6803’s carboxysome micro-compartments, favours the conversion of HCO3 into CO2.

Consequently, CO2 concentrates within the carboxysome and becomes fixed via Ribulose-1,5- bisphosphate carboxylase oxygenase (Rubisco) into Ribulose 1,5-bisphosphate (RuBP). This catalytic reaction ultimately results in 3-phosphoglyceric acid (3PGA) molecules being formed and released back into the cytosol fig. 2, (Badger et al., 2002; Espie and Kimber, 2011).

- Fig. 2; Basic model of carbon concentration in cyanobacteria; Carbon in the form of CO2 and HCO3 is pumped - into the cytosol at the expense of ATP and NADH. This carbon accumulates in the form of HCO3 which passes - through the semi-permeable shell of the carboxysome. Carbonic anhydrase (CA) converts HCO3 into CO2

which cannot pass back through the shell. The CO2 is fixed by Rubisco and forms 3-phosphoglyceric acid (3PGA) that leaves the carboxysome to which some is converted into Ribulose 1,5-bisphosphate (RuBP) by the Calvin-Benson-Basham cycle. Fig. 2 partially adapted from Espie and Kimber, 2011 and Badger et al., 2002.

This may describe an efficient carbon fixation system, exactly functioning as anticipated, but there are serious drawbacks with Rubisco with respect to metabolic efficiency. The carbon concentrating mechanism (CCM) was developed through evolutionary pressure to counteract the inefficient nature of Rubisco by increasing CO2 a 1000 times around the enzyme’s active site, (Badger and Price, 2003). A particular study pointed out two major flaws with Rubisco; specificity and catalytic turnover, (Marcus et al., 2011).

With regards to specificity, Rubisco is able to fix both O2 and CO2, as it is a reminder of an earlier era when O2 was rapidly increasing in the atmosphere and CO2 decreasing. This atmospheric shift resulted in CO2 becoming more scarce and thus a CCM system needed to be established, (Badger and Price, 2003). As there is a far higher abundance of O2 in the atmosphere than CO2, there is direct competition in terms of fixation with Rubisco. O2 fixation results in 2-phosphoglycolate formation that requires recycling back into the photorespiration system, resulting in lost energy and between 30-50% of potential carbon dioxide being fixed, (Raines, 2006; Bauwe et al., 2010).

Catalytic rates within Rubisco have been described as slow which results from the kinetic relationship between CO2 and its intermediate transition product (3-keto-2-carboxyarabinitol 1,5- bisphosphate). In an attempt to highlight this relationship, a study has shown the nature of the transition product between CO2 and RuBP becoming tightly bound to the active site of the enzyme. This results in a slow cleavage into two units of RuBP and hinders efficient catalytic throughput, (Tcherkez et al., 2006). Moreover, it has been discussed in this study that Rubisco optimization may not be possible, as it has reached its full activity potential and any further modification would be marginal, if not negligible. Manipulating Rubisco into increased efficiency may be goals to aim for, but at this point, the complexity of the enzyme’s subunits prevent any progress to develop a novel Rubisco counterpart, (Raines, 2006).

Therefore taking these considerations into account, one can start to think of ways of entirely avoiding Rubisco as a primary CO2 fixing enzyme. From literature and databases (see References; Websites/Databases) it has been established that there are such enzymes in existence and that lack the Rubisco’s drawbacks (Alber and Fuchs, 2002; Hugler et al., 2002). Moreover, one can manipulate said enzymes into a synthetic pathway which can directly produce the same labile and malleable high-energy product that Rubisco originally produces.

Synthetic Pathway Design Instead of reliance upon Rubisco and other natural carbon fixation pathways (CPF), one could develop synthetic pathways with existing enzymes. One such study sought out to create the theoretical data to which an entirely synthetic CPF can be modelled and designed. This pointed to using portions of the C4 carbon fixation cycle in order to form the basis of a synthetic pathway, with phosphoenolpyruvate carboxylase (PEPC) being the primary carbon-fixing enzyme, (Bar-Even et al., 2010).

The study scrutinized 5,000 enzymes found in the Kyoto Encyclopaedia of Genes and Genomes (KEGG), (Kanehisa and Goto, 2000), and used constraints-based methods to explore the different combination these enzymes can be arranged in. Using four evaluation criteria points such as; superior kinetics, thermodynamics, energy efficiency and topological compatibility, the study revealed several synthetic CPF’s that were theoretically three times faster at fixing carbon than the classic Calvin-Benson driven cycle. However with this knowledge, these cycles had neither context to prokaryotes or eukaryotes; they point to the possibility in existing in either domain. Therefore in relation to this thesis, prokaryotic enzyme counterparts were needed to be identified that could be introduced into a synthetic cycle in PCC 6803, which will be discussed later.

The conclusion of the study was to introduce two versions of the “malonyl-CoA-oxaloacetate- glyoxylate” (MOG) pathway which was the shortest, thermodynamically and energetically efficient synthetic CPF possible, fig. 3. It hosts PEPC as the main carboxylating enzyme and a means of releasing the cycles’ product, glyoxylate. The paper’s appendix discusses methods upon which to modify this pathway further still by replacing enzymes with similar counterparts. The MOG pathway was designed in two separate versions; alanine (not shown) and lactate options. The lactate, fig. 3, was declared the only possible cycle that can be constructed as the alanine version contains Alanine 2,3-aminomutase that has not been thoroughly studied and characterized.

Fig. 3; The Malonyl-CoA-oxaloacetate- glyoxylate pathway. The pathway is comprised of 11 enzymes, first three found in PCC 6803, and the rest in other prokaryotes. The study focused primarily on alternative carbon fixation pathways, and the MOG pathway, as mentioned, can be implemented into photoautotrophs. However in the case

of a previous project, the goal would be to implement it, or a near-identical pathway into PCC 6803 with the goal of increasing carbon in-vivo, (Bar-Even et al., 2010).

The end product of the MOG cycle is glyoxylate, a compound found to be naturally produced in bacteria, fungi and plants through the glyoxylate cycle, which is an intermediate variant of the tricarboxylic cycle, (Kondrashov et al., 2006). Glyoxylate has been observed to be easily converted into GA3P in PCC 6803 via tartronic semialdehyde and other intermediates. This glycerate/glycogenesis metabolism is co-related with the bacterial-like glycine decarboxylase cycle (Kebeish et al., 2007; Eisenhut et al., 2008; Bar-Even et al., 2010).

The MOG pathway A research training project related to this thesis, dealt with the search and collection of each of the 11 enzymes found in the selected MOG pathway from prokaryotic sources. The first three enzymes of this cycle are present in PCC 6803; PEPS, PEPC and Malate dehydrogenase (MDH), and the rest are found in three other organisms.

Using the Joint Genome Institute (JGI), NCBI BLAST, BRENDA and KEGG databases (see References; Websites/Databases for full list), it was possible to search for the origins of each enzyme. The first

6 series of searches establish the origin of each MOG enzyme, e.g.: whether found in eukaryotes or prokaryotes. A second series grouped selected candidate organisms from 3060 bacterial genomes based on commercial availability and documentation in literature. The third and final series evaluated which candidates are best suited for the MOG pathway based on their native metabolic pathways.

From 3060 genomes searched, ten suited organisms were chosen. This was done by establishing a consensus sequence from each candidate’s enzyme coding sequence. Next, using BLAST it was determined which of the ten organisms is best recognised through the conserved regions of the consensus sequence. From these investigations, three organisms were selected which included, Methylobacterium extorquens, Chloroflexus aurantiacus and Clostridium propionicum.

These bacteria were found to be the most suited in possessing all 11 enzymes of the MOG pathway, (Brunelle and Abeles, 1993; Alber and Fuchs, 2002; Hugler et al., 2002; Smejkalova et al., 2010). However the different environmental characteristics of these bacteria must be noted, for example C. aurantiacus is a thermophile whereas the rest are not. This may be a disadvantage as there may be incongruity between some of these enzymes. However this species shares many similarities with PCC 6803 in terms of environmental habitat, phototrophic metabolism and above all, contains four of the eleven enzymes in the MOG pathway, (Alber and Fuchs, 2002).

Interestingly, one is able to still modify the MOG pathway from the original design. The study details alternate enzymes that can be used instead which perform similar functions, (Bar-Even et al., 2010). This may be necessary as methylmalonyl-CoA carboxytransferase was not found in any of the four MOG organisms. Instead as an alternative, acetyl-CoA carboxylase can be used as a replacement. This enzyme is present both in PCC 6803 and C. aurantiacus, (Kaneko et al., 1996) and offers - increased HCO3 fixation at the expense of ATP, fig. 4.

- HCO3 Fig. 4; Modified version of the MOG pathway. The 6th enzyme of the cycle,

methylmalonyl-CoA carboxytransferase can be switched to acetyl-CoA carboxylase which has the advantage of being able to - fix more HCO3 and form Malonyl-CoA. Enzyme legend; 1, PEP Synthase; 2, PEP carboxylase 3, Malate dehydrogenase; 4, Modified MOG Malyl-CoA Synthetase ; 5, Malyl-CoA Lyase; Pathway 6, Acetyl-CoA Carboxylase; 7, Malonyl-CoA Reductase; 8, 3-hydroxypropionyl-CoA

synthase; 9, Enoyl-CoA Hydratase; 10, Lactoyl-CoA Dehydratase; 11, Lactate Dehydrogenase;

Glyoxylate

- HCO3

These findings establish that the MOG pathway is possible to construct using exclusively prokaryotic sources, some of which include PCC 6803’s own enzymes. The question was now to introduce each of these native PCC 6803 enzymes and examine if they are expressed and determine what the physiological response is. This thesis observes the introduction and overexpression of the first enzyme of this cycle; phosphoenolpyruvate synthase (PEPS).

Phosphoenolpyruvate Synthase PEPS (E.C.: 2.7.9.2), also known as phosphate water dikinase, is involved in pyruvate metabolism, gluconeogenesis and carbon fixation. It converts pyruvate with the addition of ATP and water into phosphoenolpyruvate, which is an important substrate that is carboxylated into oxaloacetate by PEPC (E.C.: 4.1.1.31), (Berman and Cohn, 1970). Although not as widely published as PEPC, PEPS remained a focus for researchers as it was discovered that it enables organisms to grow on C3 sources such as pyruvate, lactate and alanine. The reaction follows the equation, (Cooper and Kornberg, 1967);

(Eqn. 1)

(PEP synthase)

With ΔG°′ of = -12kJmol-1 (Thauer et al., 1977).

As of 2007, only one structure of PEPS has been solved, belonging to Neisseria Meningitidis but the article is yet to be published. Despite this, there is relevant literature pointing to E. coli’s PEPS gene which bares much conserved genetic similarity in relation to other bacteria and archea, (PCC 6803, Nostoc Punctiforme, N. Meningitidis, T. tenax), fig. 6. This may enable to draw parallels between these species and deduce that they perform the same function. E. coli has revealed its bacterial PEPS consisting of a homodimer – whereby low temperatures and phosphorylation of either subunit give the enzyme its stability, (Narindrasorasak and Bridger, 1977). Equation 1, consists of a 2-step reaction; a phosphoenzyme-intermediate forms through histidine residue interaction with the β- phosphoryl group of ATP. This intermediate proceeds to interact with pyruvate, transferring the additional phosphate unit and forming PEP, fig. 7, (Cooper and Kornberg, 1967; Narindrasorasak and Bridger, 1977; Tjaden et al., 2006).

Pyruvate Phosphate Dikinase The original MOG pathway calls for the use of pyruvate phosphate dikinase (PPDK) (E.C.:2.9.7.1) as the first enzyme within the cycle. PCC 6803 is the organism of choice for the first 3 enzymes, but PPDK remains a putative gene that has not been fully characterized; there are no known sequences or structures in regards to PCC 6803. Therefore PEPS was the next best candidate as it performs an identical reaction to PPDK with the exception of an additional orthophosphate unit in the forward reaction, (Evans and Wood, 1968). PPDK has been shown to be a key enzyme in C4 photosynthesis, by allowing PEP to be carboxylated by PEPC, which also points to it being light dependent, (Hatch and Slack, 1968; Pocalyko et al., 1990).

Fig. 6; Protein residue alignment of PEPS between Synechocystis PCC 6803 (syn:slr0301), Nostoc Punctiforme (npu:Npun_F0017) , E. coli 9 (eco:b1702), N. Meningitidis (nme:NMB0618 ) and T. tenax (ttn:TTX_0910). Underlined in red are conserved regions which point to the similarity in structure of PEPS. The alignment was performed with ClustalX2.

Experimental Aims The aim of this thesis is to amplify PEPS from PCC 6803 and re-introduce it into the genome, downstream of the light inducible psbA2 promoter region. By having multiple copies of the gene, both in the native site and psbA2 site overexpression is expected. To measure this, semi-quantitative RT-PCR is used to detect mRNA from both wild type and engineered copies of the strain. In addition to these experiments, wild-type PEPS will be examined whether light plays a role in its expression. Materials and Methods

(Full materials and equipment used can be found in the Appendix, Section 2, Table 1)

Isolation of DNA: Genomic DNA of PCC 6803 was extracted via an adapted protocol (Tamagnini et al., 1997). Cells were spun down and washed twice with 5 M NaCl, removing polysaccharides. The cells were resuspended with 200 µL 50 mM Tris-HCl (pH 8.0) with 10 mM EDTA. 0.5 g of 0.5 mm diameter glass-beads, along with 25 µL of 10 % sodium dodecyl sulphate (SDS) and 500 µL of phenol:chloroform:isoamyl alcohol in a 25:24:1 ratio. The cells were vortexed vigoursly and centrifuged at 21,000 rcf for 15 min. The upper aqueous phase was extracted to equal volumes of chloroform. The DNA was precipitated using a 1/10 volume of 3 M sodium acetate (pH 5.2) and 2.5x volumes of 100 % ethanol, which then was spun down and washed with 70 % ethanol. The pellets had ethanol removed and were left to dry. The DNA was dissolved in water.

Isolation of RNA: RNA was extracted via an adapted protocol (Pinto et al., 2009). A volume of 50 mL samples of 48 h cultures were centrifuged at 4,500 rcf for 12 min. The supernatant was poured off and the remaining supernatant mixture was resuspended with the pellet and placed into 2 mL Eppendorf tubes and once again centrifuged at 12,000 rcf for 10 min. The centrifuged samples’ supernatant was then fully removed. For the experimental work, the twice-centrifuged pellet would be flash frozen in liquid nitrogen and stored at -80 °C for future use.

Approx. 2 g of 0.5 mm acid-washed glass beads were placed into screw-cap tubes. The pellet was resuspended with 1 mL TRIzol and placed into the tubes. The tubes were shaken at 6800 RPM for 30 sec in a homogenizer (bead beater) and cooled on ice for 2 min. This step was repeated twice. The tubes were removed from the ice and inverted for approx. 2 min and centrifuged at 12,000 rcf for 10 min to discard cell debris. The dark brown supernatant was pipetted into fresh tubes.

A volume of 0.1 mL of bromo-chloropropane was added and shaken vigorously by hand until the solution turned into an emulsion. At approx. 5 min phase-separation began and the tubes weres centrifuged at 12,000 rcf for 10 min. The upper phase was removed into new tubes and equal volumes of 100 % propanol were pipetted into each tube, then inverted several times and incubated at room temperature for 10 min. The samples were then centrifuged once more at 12,000 rcf for 15 min.

The supernatant was removed completely without disturbing the pellet and 1 mL of 75 % EtOH was added. The loose pellet in solution was inverted for approx. 3 min and centrifuged at 16,000 rcf for 4 min. This EtOH wash step was repeated twice. The supernatant was removed for the final time and left to air dry for 2 min. The RNA pellet was eluted in 50 µL Ambion RNA storage solution, aliquoted and stored at -80 °C for later use.

Agarose gel electrophoresis: Sodium Borate (SB) and Tris-acetate-EDTA (TAE) buffers were used in the preparation of gel electrophoresis.

SB buffers were used for high voltage (200 V) gels which enabled fast turnover times (approx. 10-15 min) for genetic products under 1 kb. A 1x working SB buffer was diluted from a 40x stock solution, this was used both as a running buffer and 1 % gels. TAE buffers were used for regular voltage (70 V) gels for products larger than 1 kb. A 1x working TAE buffer was formed from 50x stock solution, and was used as a running buffer and 1 % gel.

All gels used thiazole orange dye for visualizing DNA bands under UV light; 8 µl thiazole orange per 100 mL into either TAE or SB gel was used. PCR product sizes were compared with GeneRuler 1 kb and 100 b DNA ladders (Thermo Scientific).

PCR, Gel and Plasmid Purifications: All of these procedures used Gene JET Purification kit, Gene JET Gel Extraction kit and Gene JET Plasmid Miniprep. All protocols were followed as the manufacture recommended, but samples were eluted in 30 µl sterile water and not elution buffer. All DNA/RNA concentrations determined using Nanodrop 2000.

Light and dark experimentation: The wild type PCC 6803 strains were divided into two conical flasks, each containing 50 mL of BG11 and were grown for 3 d to a suitable O.D., of approx. 0.8. Using two 500 mL autoclaved bubble flasks, 400 mL of BG11 was poured into each and inoculated with the previously grown PCC 6803 cultures in conical flasks. The amount of culture placed into each flask was adjusted so that an initial bubble-flask O.D. of 0.1 could be achieved. The flasks remained bubbling under a light strength of 27 μEm-2sec-1 for 36 h until an O.D. of 0.7 was reached.

The bubble-flasks were then wrapped in dark plastic and foil, preventing any light from entering the culture. The flasks would be left to continue to grow for a total of 24 h, with 2 sets of samples taken at 3 different time points starting at 0 h (light sample), 3 h and 24 h.

Samples were pipetted into 2 x 50 mL Falcon tubes from each bubble-flask. Each tube was covered to prevent light from entering. The samples were centrifuged at 4,500 rcf for 12 min with the majority of the supernatant removed. The remaining supernatant and pellet was resuspended and placed into a 2 mL Eppendorf tube and centrifuged again at 12,000 rcf for 12 min. The supernatant was discarded and the pellet was flash frozen in liquid nitrogen and stored at -80 °C. The entire procedure was done in total darkness except for the light samples, where treatment in darkness was not necessary.

DNase treatment and RT-PCR: To ensure that the extracted RNA remained free from contamination, a DNase kit was used. The manufacturer’s recommended protocols were followed, with 4 µg of RNA used instead of 4 µg with appropriate adjustments.

The reverse transcriptase kit was used as per manufacturers recommended protocol with the use of random hexameric primers. The incubation steps were as follows; 25 °C for 5 min, 42 °C for 60 min, and 85 °C for 5 min all done in a PCR machine. The synthesized cDNA was aliquoted into 2.2 µL amounts and stored at -80 °C.

Sequencing: Constructed pEERM plasmids containing the inserted PEPS genes were sequenced though Macrogen by diluting the concentration of the plasmid to 100 ng/µL in 10µL. A similar

approach was taken when sequencing PCR products derived from engineered PCC 6803 genomic DNA but using a 50 ng/µL concentration in a 10 µL volume. Both forward and reverse primers were designed (see: Appendix, section 3, Table 3) to fully sequence these oligonucleotide. Results were uploaded to the Macrogen website.

PCR: In the appendix, section 3, table 3 shows all of the primers used for PCR, RT-PCR and screening, all of these primers were ordered from ThermoFisher Scientific. Gene isolation and amplification used PFU II Ultra DNA polymerase and Phusion HS II High-Fidelity DNA Polymerase that followed the manufacturer’s recommended guidelines for 20 µL and 50 µL reactions. 100 ng/µL concentrations of template genomic DNA was used for amplification.

Colony PCR and RT-PCR was performed using DreamTaq DNA polymerase which followed the manufacturer’s recommended guidelines for 20 µL and 50 µL reactions. The method used for E. coli colony PCR involved selecting transformed E. coli colonies and resuspending them individually in 10 µL of sterile water. 1 µL of the resuspended culture/water mixture was pipetted and used as a template. For PCC 6803 colonies, a similar method was used. Volumes of 100 µL to 500 µL of liquid culture were centrifuged, decanted and 1 µL volumes were resuspended in 10 µL of water to which 1 µL was used as a template.

Organisms and growth conditions: In the appendix, section 2, table 2, shows the bacterial strains used. E. coli DH5α was grown using standard Lysogeny broth (LB) medium with 1 % NaCl that was either used in standard 1 % agar plates or in liquid form. 20 mg/mL of chloramphenicol was added to LB plates as selection antibiotic. PCC 6803 was cultivated in BG-11 media that was supplemented with NaNO3 (Rippka et al., 1979) and grown under high light (15 μE) at 30 °C. BG-11 plates were made with 1 % agar and contained 20 mg/mL of chloramphenicol for engineered PCC 6803.

Cloning: The resultant amplified PEPS gene was gel purified (see: gel purifications) and washed to ensure a contaminant-free product. Concentrations were measured using Nanodrop 2000. The pEERM plasmid and extracted PEPS were digested using FastDigest restriction enzymes, XbaI and PstI in 5x FastDigest Green buffer with 1 µL of enzymes used per 0.2 µg of PCR product and 1 µg plasmid. The digestion took place at 37 °C for 6 min. Shrimp Alkaline Phosphatase (SAP) was added to de-phosphorylate the plasmid and prevent re-ligation; this procedure was incubated at 37 °C for 1 h.

The ligation step involved using 50 ng of the digested pEERM plasmid with 5x fold molar excess of digested PEPS insert. Using 1x Quick Ligation Buffer with 1 µL Quick T4 DNA Ligase, the reaction mixture was incubated for 5 min at room temperature.

Transformation was done by using 1 µL of this mixture, then adding it to E. coli DH5α competent cells. After thawing, the cells were left on ice for approx. 30 min. During this step 500 µL of LB medium was pre-warmed at 37 °C. The cells were heat shocked by being placed in a 42 °C water bath for 2 min, then cooled on ice for 5 min. Cells were pipetted into the 500 µL warm LB medium and incubated at 37 °C, at 250 RPM in a shaker for 1 h. After incubation, 55 µL of the cell culture was spread on a LB agar plate labelled “10 %” and the rest of the culture (495 µL) was spun down at 12,000 rcf for 2 min and spread on a LB agar plate labelled “90 %”. All LB plates used chloramphenicol as the selection antibiotic. Negative controls consisted of the unligated pEERM and PEPS components, with the absence of ligation enzyme.

Results Construction of the pEERM[PEPS] plasmid Genes were amplified from WT PCC 6803 genomic DNA with the use of primers listed in the appendix, under section 3, table 3. The resultant PCR product was digested with XbaI and PstI enzymes, dephosphorylated and inserted into the pEERM plasmid. This plasmid was cloned using DH5α E. Coli with a fully successful transformation. To ensure correct transformation, a restriction digest and colony PCR were performed. The plasmid was sequenced and sequencing results demonstrated a correct copy of the plasmid was present

The pEERM[PEPS] plasmid was extracted, purified and then transformed into PCC 6803. The transformants were left to grow on semi-permeable Millipore membranes in 1 % agar BG11 plates containing 20 µg/mL of CM. During this period, the membranes were transferred as necessary onto fresh BG11 agar to prevent drying out. After approximately 30 d, green colonies were observed. These colonies remained growing until a suitable biomass was achieved and then were restreaked onto new Millipore membranes. When colonies grew to, approx. 0.5 mm – 1 mm in diameter, a colony PCR was performed to checking if PEPS was recombined correctly into the chromosome. A set of unique primers annealing only to the engineered region were used, (see Table 3, Appendix Section 3; Primers).

PEPS light regulation In order to determine if PEPS is light regulated, WT PCC 6803 was grown to determine several key factors in regards to the nature of PEPS expression. By using reverse-transcriptase PCR, criteria such as the cycle threshold value and primer annealing temperatures needed to be determined. To perform this task, RNA needed to be extracted, DNase treated and reverse-transcribed into cDNA. The RNA concentration was measured using NanoDrop and physical quality used 1 % SB gel electrophoresis, fig. 7. RNA was used as a PCR template to detect DNA contamination. However in literature it has been revealed that DNase treatment may reduce the quality of RNA, which may result poor cDNA synthesis, this subject is elaborated in the discussion.

A B 16s Universal Bp 150 th 0400 th 27 300 17 200

Fig. 7; RNA and cDNA analysis; Determination of RNA quality C (A), using 1% SB gel showing three bands; with top bands Fluorescence representing 23s and 16s ribosomal mRNA and bottom representing short mRNAs and fragments. Threshold experiments (B) determining the threshold cycle (Ct) needed for product formation to appear. 17 required for 16s

ribosomal product, 27 for PEPS (using Universal primers). Copies No. of Threshold determination test example (C) that examines the number of cycles for florescence to exceed the background No. of Cycles level. 13

1 µg of RNA template was used as per manufacturers recommended protocol. After the synthesis, a quick PCR program was selected to check for the presence of cDNA, when positive, the cDNA was used in a cycle threshold value test, fig. 7 (C). Sequences encoding PEPS, and ribosomal 16S and 23S house-keeping genes were used as reference genes that determined threshold values. Primers specific to the ribosomal sequences were used. Samples for 16S and 23S were taken between the 14th and 20th cycles and the PEPS gene samples were taken at 24th to 28th cycle in the PCR program, fig. 7 (B).

Using this data, the light experiment was used on WT PCC 6803 to determine whether or not PEPS is directly or indirectly light regulated. Samples in duplicate were collected at 0 h, 3 h and 24 h to which RNA was extracted from. Using the known threshold cycle value, a PCR was performed to semi-quantitatively observe the relative amounts of PEPS mRNA transcribed in relation to the light conditions, fig. 8.

16S

500 0h 3h 24h + 400 300 Fig. 8; Light repression of PEPS. Samples were taken 200

at 3 different time points, 0 h, 3 h and 24 h. 16s 100 ribosomal primers were used as a control and Universal primers detected the relative levels of PEPS expression in relation to the length of darkness PCC 6803 was placed in. The positive control (+), used genomic DNA.

PEPS

24h 0h 3h + 500 400 300 200

The results show the down-regulation of PEPS when PCC 6803 is placed in darkness. Similar findings have been discovered in higher plants (Hatch and Slack, 1968) but have not yet been published in regards to prokaryotes.

Correct PEPS recombination During PEPS light regulation work, pEERM[PEPS] colonies were continually restreaked and plated onto fresh BG11 agar plates with 20 µg/mL CM selection antibiotic. Approx. after 3 months of genetic segregation, colony PCR experiments were performed to examine whether colonies contained overexpressed PEPS genes in the correct locus, downstream of the psbA2 promoter. The following gel image, fig. 9, shows that it is in the correct region but however remnants of the photosystem II D1 protein (psbA2) gene still persist. This result suggests that although PEPS is in the correct region, it also has not fully segregated from the psbA2 gene, of which there are multiple copies remaining. In order to fully segregate the engineered strain, selection pressure needs be increased to favour the inserted PEPS gene containing the CM resistance cassette over the psbA2 gene.

Bp PEPS 1000 750

Fig. 9; Determining level of segregation in 500

pEERM[PEPS] strains. Overexpressed PEPS is present 250 in the engineered strains, but the psbA2 gene is also present suggesting engineered strains are not fully segregated. Therefore increasing selection pressure by adding higher antibiotic concentrations will cause Bp psbA2 1000 PCC to favour the inserted PEPS. 750

500

Examining overexpression of PEPS Full segregation of engineered PCC 6803 strains could take several months to accomplish, which is beyond the scope of this thesis. In consequence, another RT-PCR was performed on the engineered PCC 6803 strains to determine if PEPS is overexpressed. RNA was once more extracted from 3 biological replicants, each containing extra copies of PEPS. RNA from a WT sample was extracted and served as the control.

Sets of 4 different primers were used in this RT-PCR , (see: Appendix, section 3, table 3,). Fig. 10 (A) shows the results of the WT and ENG primers. Fig 10 (B) shows the result of the universal primer, U. The gel images show that the extra copy of PEPS successfully recombined into the desired locus and also is expressed alongside the native copy. Universal primers, fig. 10 (B), illustrate the multiple copies of PEPS both in WT and engineered strains, hence the stronger signal seen on the gel.

Fig. 10; Overexpression of PEPS; Four sets of A B

primers were used in detecting different PEPS 500 WT 16S 400 expressions; (A) Bands underlined represent 3 16S 300 500 * 200 different engineered biological replicants. 1 2 400 * 300 200 Bands labelled with (*) represent the WT cDNA control. Bands labelled (1) represent pEERM[PEPS] DNA control (+ive for engineered strains, -ive for WT). (2) ENG U 500 Represents genomic DNA (+ive for WT stains, 500 1 2 400 400 * 300 -ive for engineered). * 300 200 200

The threshold cycle for the engineered and WT primers was discovered to be higher, at 30 cycles, than the universal primers at 27 cycles. This is due to the fact that the universal primer anneals to both copies of the PEPS gene, native and overexpressed, and thus needs less cycles for a product to appear. The WT and ENG primers only anneal to either the native or overexpressed copies of PEPS. The ENG primers share sequence regions with the pEERM[PEPS] plasmid, therefore making it exclusively anneal to strains containing the homologously recombined region within the genome. The WT primer follows the same principle but consists of a region outside of the native PEPS gene that is absent in the engineered, exclusively annealing to native PEPS copies. From fig. 10, it can be shown that in the engineered strain, both WT and extra copies are present, with overexpressed PEPS located within the psbA2 region.

Discussion Plasmid Selection The plasmid pBlueScript was used in the construction of PEPS plasmid. This plasmid consisted of two pieces labelled VecA and VecB, which required dedicated primers for amplification. The strategy was to amplify all 3 parts; PEPS, VecA and VecB, then purify and assemble them via Gibson assembly. However initial PCR amplifications proved that not all components amplified equally and therefore additional PCR reactions were needed to compensate for this. After purification, Gibson Assembly was employed to fully construct this plasmid containing PEPS.

After several attempts, the Gibson Assembly method proved to be ineffective, which could be due to sub-optimal overlap regions created by the designed primers. Further reading suggested using primers with a minimum overlap region of 20 base pairs for better homology between fragments (Merryman and Gibson, 2012). It is imagined that re-designing these primers with more compatible annealing temperatures and improved homology would yield better results. It was suggested to use a much simpler ligation via a BioBrick approach with the newly designed pEERM plasmid.

This plasmid was designed by colleagues Elias Englund and Rui Miao, and served as the basis of all the cloning work for the remainder of this thesis. The pEERM plasmid was derived from purchased MEV 1 plasmid which was optimised by replacing several components reducing its overall size five- fold. Fig. 11 shows the overall features of the plasmid and cut sites. Using the BioBrick approach to construct this plasmid, the region between PstI and SpeI enzymatic cut sites were used to insert the gene of interest. A longer digestion period was suggested (24 h), than specified in the manufacturer’s protocol, as initially E. coli transformations did not yield any positive results. When digested for a longer period, then subsequently ligated and transformed, a transformation took place with over 98% of the colonies containing the plasmid.

CM Cassette

Fig. 11; pEERM[PEPS] construction. Overall size consisted of 6038bp with PEPS 2457 bp. Terminator

Upstream (US) and downstream (DS) regions PstI pEERM[PEPS] were sections of the psbA2 gene region, with 6038bp the US containing a portion of the psbA2 US promoter. Enzyme cut sites; PstI and XbaI RBS were used in digestion and ligation. XbaI

PEPS

Antibiotic Resistance Cassette As shown in the fig. 11, pEERM makes use of the CM resistance cassette as means of selection. For cloning work on E. Coli it is an ideal selection antibiotic, but for work on PCC 6803 it is less than optimal as it was observed that CM does not efficiently select, or remove untransformed PCC 6803 as fast as other conventional antibiotics. In literature, (Ryan et al., 1970) CM was observed to lose potency after a period of roughly 4 weeks, with satellite colonies growing on the edge of the plate. Therefore, there is only a window of time when one can expect single, transformed, resistant colonies. This may be due to temperature degradation, and the fact that the paper did not test different antibiotics on any cyanobacterial strains. Mentioned in the methods section, semi- permeable membranes were used to maintain a constant level of potent antibiotic. For practical reasons the use of CM was necessary as it was included in the first version of pEERM, but in further work colleagues switched the CM cassette to kanamycin as it was deemed more efficient in removing untransformed colonies with a turnover time of 2-3 weeks instead of 4-6 weeks.

Light regulation of PEPS Searching through literature, it was uncertain whether or not PEPS is directly or indirectly light controlled, but what is known is that it is involved in pyruvate metabolism. From sequence analysis on PCC 6803 (Kaneko et al., 1995; Kaneko et al., 1996) it has been shown that PEPS bares homology with E. Coli PEPS which enables one to look at it in greater detail (Tjaden et al., 2006).

Therefore to determine whether PEPS is light regulated, WT strains of PCC 6803 were used in an experiment as described in the methods section. From the results it was shown clearly that there is repression in regards to transcription when PCC 6803 is placed in darkness for varying lengths of time. Light samples, 0 h and 3 h samples show very little difference, but 24 h samples show a clear sign that this gene is down regulated by the absence of light.

From literature, it has been difficult to establish if PEPS has any direct response to light in regards to prokaryotes. However looking at higher plants an article states that PEPS is light activated (Hatch and Slack, 1968). The paper studies PEPS derived from Amaranthus palmeri, and determines that the enzyme is photoactivated, meaning that its activity is down regulated when placed in darkness – and recovers when placed back into light. Moreover a lag period is observed when samples were removed from darkness and placed back into light, suggesting re-activation rather than re-synthesis of the enzyme.

It is proposed that PEPS is not only directly regulated by light, but also by the surrounding enzymes that are light activated. In the MOG pathway the succeeding enzyme, PEPC, uses - phosphoenolpyruvate in conjunction with fixing carbon (HCO3 ) to form oxaloacetate, (Coleman and Colman, 1980). Through several studies, PEPC’s activity can be largely attributed to the level of light - - as well it’s interaction with HCO3 , (Miller and Colman, 1980). It’s notable to point out that HCO3 assimilation occurs during light periods in cyanobacteria, in contrast to some Crassulacean acid metabolism plants which reserve this activity for dark periods (Herrera, 2009; Pisciotta et al., 2010).

- Therefore, decrease in activity of PEPC through the lack of HCO3 assimilation with phosphoenolpyruvate can reduce its overall need and as result affect the activity of PEPS.

The results of this light/dark experiment only included the WT strain to determine if light regulation had any impact on PEPS. It can be assumed that with engineered strains, this regulation is much stronger as it has been mentioned that engineered strains contain overexpressed copies of PEPS downstream of the psbA2 promoter. As discussed, this promoter is relatively strong, even more so than that of the native promoter found in the WT strain, (Mohamed et al., 1993; Agrawal et al., 1999). Therefore it is possible to ascertain that extra copies of PEPS will have a marked increase in expression under light and dark conditions. It has been shown in the results section that overexpression occurs, observable through RT-PCR techniques.

RNA Extraction & cDNA Synthesis In order to accomplish successful RT-PCR analysis, high quality RNA was required. From initial extraction procedures it became apparent that the protocol required some adjustments, as the quality and quantity of RNA extracted was not suitable enough for further RT-PCR work. Different strategies were employed such as doubling the initial amount of sample culture from 10 mL to 20 mL, and using more thorough cell lysis techniques. A methodology papers answered the question of RNA extraction from cyanobacteria, (Pinto et al., 2009). Reviewing procedures within this article highlighted more in-depth steps resulting in a marked increase in the samples yield and quality. Working with the author, Dr. Fernando Lopes Pinto, it was possible to further tailor his protocol to the needs of these experiments.

Fig. 7(A) shows a marked improvement in RNA, both in quality and quantity. As described in the methods section, this improvement can be attributed to multiple centrifugation steps, removing impurities and the bulk of the cell content unrelated to RNA, as well as elution into proprietary storage buffers.

With RNA extraction, several issues were experienced when synthesizing cDNA. In some cases it is possible to use RNA directly into cDNA synthesis, but the risk of DNA contamination is high, therefore DNase treatment is employed. However, DNase enzyme treatment may aid in the removal of DNA contamination, but likewise reduce the over-all RNA fidelity, (Wiame et al., 2000). This is partly due to the temperatures involved in DNase inactivation as well as buffering agents such as Mg2+ which require chelating agents such as EDTA, (Wiame et al., 2000; Gerard et al., 2002). There are numerous ways around these problems, such as minimizing incubation times as well as adding excess dNTPs to chelate free Mg2+.

Storage of cDNA became a concern as typically it was suggested to be stored at -20 °C, but from synthesis a day prior, very little cDNA could be used as a template in PCR reactions and the solution was to aliquot amounts of 2.2 µL into PCR tubes and freeze the tubes at -80 °C. This enabled high- quality cDNA to be available, without it losing integrity due to thawing. It was noted that secondary structures in RNA may be a hindrance to successful reverse-transcription, this issue could be solved by increasing reverse transcriptase incubation temperatures by 3 °C.

Overexpression of PEPS and further experimentation After increasing antibiotic segregation pressure over several weeks the engineered PCC 6803 strains were analysed to determine whether extra-copies of PEPS are expressed. The engineered strains exhibited extra copies of PEPS within the genome via colony PCR, but more importantly, were shown to be expressed via RT-PCR. This answers the question of introducing and overexpressing PEPS in PCC 6803. Despite illustrating clear expression, it still not known whether resultant RNA is translated accordingly into its respective protein structure. Therefor the next series of experiments could involve the use of a western blot and enzyme assays.

From early papers, there have been studies done to quantify PEPS activity in E. coli with the use of relatively simple experiments involving spectroscopic absorption, (Cooper and Kornberg, 1967). In principle the experiments followed use of 2,4-dinitrophenylhydrazine (DNPH) regent that binds to free pyruvate which is detected in the 420 – 445 nm range. This allows detecting the presence of pyruvate that has not been metabolised by PEPS into PEP. Crude extract derived from the organism is added with to a mix of buffers, reagents and pyruvate. At different incubation periods, samples are extracted and DNPH is added to which absorption is measured, (Cooper and Kornberg, 1969). This experiment was attempted with PCC 6803, see: Appendix, Section 1; Colorimetric Determination of PEPS activity.

Conclusion

Through gene amplification and transformation, it is possible to introduce a native gene within Synechocystis PCC 6803. Experiments can be then performed that determine if the gene in question is expressed alongside its native counterpart. Phosphoenolpyruvate Synthase is a vital gene in pyruvate metabolism and the first enzyme in the MOG cycle. Through overexpression, no physiological changes were observed that could impede PCC 6803 growth. This quality is of significance as it is not known how increasing the amount of PEPS contributes to the overall pyruvate exchange and demand within the cell.

Introducing native genes back into an organism also bears the risk of incorrect recombination which may be through insufficient size of the upstream and downstream regions within the cloning vector, which may cause integration of the gene itself into an incorrect locus. Despite this risk, it has been shown that overexpressed PEPS is correctly recombined, but not fully segregated. Through increasing antibiotic concentration, the engineered cells have pressure to retain additional PEPS and gradually remove the psbA2 gene from the chromosome.

Further experiments could examine PEPS presence and activity, and whether additional copies of it contribute to a higher consumption of pyruvate. Doing so would answer several questions; firstly it will indicate that the enzyme is present, suggesting correct translation from RNA into protein, and secondly it would demonstrate its activity. A western blot or assay could be done to achieve this. Future progress could also include designing multiple enzyme constructs and examining carbon fixation with carboxylating enzymes such as PEP carboxylase. This would provide a future framework in the construction of the MOG pathway.

Appendix

Section 1: Colorimetric Determination of PEPS activity

Introduction and Theory To detect the activity of an enzyme, several varieties of assays can be performed, in the case of PEPS a protocol involving the spectroscopic analysis of the enzymes activity was used, (Cooper and Kornberg, 1967). However, the original protocol measured the PEPS activity of E. coli results showing clear activity of the enzyme. In the context of PCC 6803 such a protocol has never been applied, therefore the following assay was a preliminary examination into whether PEPS derived from PCC 6803 is able to show activity. Moreover, the aim of these experiments would be to highlight the activity of engineered PCC 6803 PEPS, as overexpressed copies of enzyme would in theory metabolise more substrate. This anticipated result could show that not only is PEPS overexpressed, but also that it’s functional in the organism.

The main principle upon which the protocol follows is the spectroscopic absorption of colour that is formed when 2,4-dinitrophenylhydrazine (DNPH) binds with free pyruvate in solution. As PEPS metabolizes pyruvate to form phosphoenolpyruvate (PEP), the amount of free pyruvate in solution decreases and DNPH can no longer bind and thus cause a colour change.

The experiment follows the Equation (1);

Eqn (1)

(PEP synthase)

As the DNPH reacts with pyruvate, it forms the complex. 2,4-dinitrophenylhydrazone, fig. 12, and a strong yellow colour is observed. As the amount of pyruvate decreases over time in accordance to Equation (1), 2,4-dinitrophenylhydrazone complex formation decreases and less of a colour change occurs. This action can be correlated with PEPS activity.

Pyruvate 2,4-dinitrophenylhydrazine 2,4-dinitrophenylhydrazone

Fig. 12. Pyruvate interaction with DNPH; Presence of pyruvate results in the formation of 2,4-dinitrophenylhydrazone, which is used in the colorimetric determination of the amount of pyruvate present in solution.

Materials and Methods (Full materials and equipment used can be found in the Appendix, Section 2, Table 1).

Crude cell extract preparation: The Cooper and Kornberg, 1967 (Method 1) protocol is suited to be used with crude cell extract. A volume of 100 mL flasks of PCC 6803 culture in BG11 was grown for approx. 2 d until an O.D. of 0.5-0.6 was reached. The culture was spun down at 4,500 rcf for 10 min and then resuspended in 2 mL of phosphate buffered saline (PBS) buffer (ph 7.4). The spin was repeated and the pellet was resuspended in 200 µL of PBS. The samples were frozen at -80 °C for 1 h and quickly thawed at 37 °C to allow for partial cell disruption. Acid-washed glass beads (0.5 mm in diameter) were placed into the samples, to which they were kept on ice for the remainder of the extraction.

A glass bead beater was used in further disrupting the cells, which was done by vigorously vortexing the samples 4 times at 6,000 RPM for 30 seconds in a bead beater. The samples were placed on ice between each vortexing cycle. A volume of 100 µL was added to the samples, to which then they were spun down at 12,000 rcf for 1 min. The resulting supernatant was the crude extract, which was extracted carefully to avoid any glass beads. The supernatant was aliquoted into 100 µL amounts and stored at -80 °C. A test sample was then taken to determine protein concentration using the RC DC protein assay from BioRad. Bovine serum albumin standards were made.

PEPS activity: The protocol found in Coopers and Kornberg 1967 paper was used, with some slight changes. Instead of using Tris-HCl, 0.5 M, pH 8.4, PBS buffer from the crude extract procedure was used, (Cooper and Kornberg, 1967). A pyruvate standard curve was used to determine the optimal amount needed in the experiment.

Both WT and engineered PCC 6803 samples were used in a preliminary determination of PEPS activity. Volumes were prescribed as in the protocol, but with ATP being omitted in the control tubes. The samples were left equilibrate at 30 °C for 0, 10, 20, 30 and 40 min time points. After equilibration, 0.066 mL of each sample was placed into 2 mL Eppendorf with the following reaction volumes; 0.66 mL, H2O; 0.22 mL and 0.01 % DNPH. This mixture was inverted and placed into a 37 °C water bath for 10 min. After this incubation, the reaction is quenched by adding 1.113 mL 10 % NaOH and inverting the tubes several times. 1 mL volumes were then placed into cuvettes and measured at 420 nm in a spectrophotometer. The control sample consisted of a 0 min without ATP.

Results and Discussion The following results are preliminary tests done to determine if the original Cooper and Kornberg, 1967 protocol can be used with PCC 6803. They illustrate the consumption of pyruvate via crude PEPS over a period of 40 min. Time points, 0, 10, 20, 30, 40 min were used to determine the decrease in pyruvate with respect to time. Four sets of samples were used; Engineered PCC 6803 with overexpressed PEPS, WT PCC 6803 and each had a set of control samples, (which contained an absence of ATP).

Pyruvate removal via crude PEPS (A)

Extinction at 420 nm

Time (min)

(B)

Extinction at 420 nm

Time (min)

Fig. 13; Experiments (A) and (B) showing the removal of pyruvate via crude PEPS. Control samples contained

an absence of ATP which allowed for the background activity of pyruvate removal to take place. The control is expected to stay level throughout the experiment at a high absorption level, which suggests little to no

activity from PEPS when not in the presence of ATP. Experimental samples are expected to see a steep decline in the first 10 min, as partially seen in (B), and continue to decline gradually until the 50 min mark is reached.

Fig. 13 shows the resulting pyruvate change in two separate experiments. In each experiment 100 µL of crude enzyme extract were used, which contained roughly 15 mg/mL of protein calculated from a protein standard curve. Fig. 13 (A) shows a slight decrease in pyruvate, but not an appreciable amount as to declare sufficient PEPS activity. Fig. 13 (B) indicates there is an increase of pyruvate concentration at 20 min, which had been also observed in previous experiments involving only WT samples (results not shown).

From the results it can be seen there is activity between pyruvate and PEPS, but there are no conclusive results that imitate similar activity seen in literature, (Cooper and Kornberg, 1967). There are numerous possible reasons for this, the original experiments involved crude extracts derived from E. coli, which does not contain any chlorophyll pigment as PCC 6803 crude extract does. This

may influence the absorption slightly, as cyanobacterial chlorophyll a and chlorophyll b absorbs approximately between 420 and 470 nm, (Agusti and Phlips, 1992). Another protocol suggest using higher absorption wavelengths to 515 nm to avoid this problem, and to alleviate interference from the DNPH reagent which it claimed to interfere with readings at 420 nm, (Anthon and Barrett, 2003). The original pyruvate-detection protocol references using 420 nm as the preferred wavelength to which was used in this series of experiments (Schwimmer and Weston, 1961), 515 nm was also used (results not shown), but early results showed poor sensitivity and 420 nm was used instead.

It can be suggested that partial purification steps can be taken to remove chlorophyll pigment from crude extract. A study highlights four levels of extract purity, ranging from crude to highly purified samples, (Cooper and Kornberg, 1967), the second level involves the use of a DEAE-cellulose ion- exchange chromatography column which gives a reasonable level of protein recovery (80 %) and retains a large portion of the original volume. Therefore several parameters need to be adjusted and optimised for this pyruvate detection experiment to be compatible with PCC 6803.

Section 2: Materials

Table 1: Materials used in this thesis

Equipment Manufacturer

Nanodrop 2000 Thermo Scientific Precellys 24 Bead Beater (Homogenizer) Bertin Biorad MJ Mini Gradient PCR machine Biorad

Kits and Polymerases

Ambion RNA Storage Solution Invitrogen DNase I, RNase-free Fermentas DreamTaq DNA Polymerase Thermo Scientific FastDigest Enzymes Thermo Scientific Gene JET Plasmid Miniprep Thermo Scientific PFU Ultra II Fusion HS DNA Polymerase Agilent Technologies Phusion HS II High-Fidelity DNA Polymerase Thermo Scientific RC DC Protein Assay Bio-Rad RevertAid Reverse Transcriptase Thermo Scientific Shrimp Alkaline Phosphatase (SAP) Thermo Scientific T4 DNA Ligase New England Biolabs

Specialist Chemicals

2,4-Dinitrophenylhydrazine Sigma Aldrich ATP disodium salt hydrate Sigma Aldrich Sodium Pyruvate Sigma Aldrich

All common chemicals/buffers/reagents were obtained from leading manufacturers.

Table 2: Bacterial strains and plasmids used in this thesis

Strains Description Escherichia coli DH5α Used in the transformation of the pEERM [PEPS] plasmid. Synechocystis sp. PCC 6803 Transformed organism of overexpressed PEPS gene.

Plasmids Description pEERM A self-replicating, high copy number plasmid containing upstream and downstream regions of Designed in-house by Elias Englund and Riu the psbA2 gene, with chloramphenicol as the Miao selection cassette.

Section 3: Primers Table 3: Primer List:

PEPS amplification Primers Sequence 5’-3’

PPSA_FOR1 CGCTCTAGAATGGTAAGTTCAGTCGTCGAAAAAACC PPSA_REV1 AATTCTGCAGCTAGCCTAGGGCTTTTTCCACC

RT-PCR Primers

RT_FOR1 CCCTGGGGGAAATGATTCAGC RT_REV2 CCCATTTTTTGGCCATAGCG RT_FOR3 TTAGGTTTAGACCGGGATTC RT_REV4 ATAAACACCATTTCCTAGCC RT_REV5 ATTTGATGCCTGGCTGCAGC RT_REV4_B GCAAAATAAACACCATTTCC RT_REV6 ATTAATTGCCGAGCTAAATGA RT_FOR7 TAGTGGAGGTTCTAGAATGG RT_FOR8 ATTAGGGGTAAATAGATATGGCC

Screening Primers

PPSA_FOR1 CGCATGTCATCTATAAGCTTCGTG PPSA_REV1 GCTGAATCATTTCCCCCAGGG

Acknowledgments

Firstly, I would like to thank my supervisor Prof. Peter Lindblad for giving me the opportunity in starting this exciting project from the very beginning. I wish Prof. Peter Lindblad and Claudia Durall de la Fuente the best of luck with the MOG project and anticipate seeing ground breaking results in the future.

I would also like to give a huge thanks to my laboratory supervisors, Dr. Anja Nenninger and Elias Englund for their indispensible help, patience and knowledge during my laboratory work. Dr. Nenninger provided me with world-class tutoring in many essential laboratory techniques that shaped me as a scientist. Elias’s saint-like patience enabled me to thoroughly understand concepts surrounding my work that got my project off the ground, also if he reads this; I owe him a pint.

I would like to thank my laboratory bench partners, Ievgen Dzhygyr and Martin Rippin for giving advice and help when needed. I would like to extend a further thanks to Martin, his assistance and advice in proof-reading this thesis basically never stopped. And without forgetting, I would like to thank Ievgen for providing much needed energy in the form of chocolate biscuits that somehow never ran out – a crucial factor in the success of my laboratory work.

A big thank you to Fernando Lopes Pinto, whose upfront no-nonsense approach to RNA extraction enabled me to appreciate the intricacies of this delicate work and develop my own protocol from the ground up.

I would like to thank rest of the Cyano group for all the help and friendship ; Rui Miao, Claudia Durall de la Fuente, Karin Stensjö, Pia Lindberg, Christoph Howe, Gustaf Sandh, Namita Khanna, Bagmi Pattanaik, Xin Li, Simmie Hu, the 3 musketeers; Daniel Camsund, HsinHo Huang and Helder Miranda.

Last but not least, I would like to thank our technician Sven Johansson, my course co-ordinators, Katariina Kiviniemi Birgersson and Staffan Svärd who made it possible for me to study in Uppsala, and of course, the folks downstairs in the Chemistry department for making my time in Uppsala both enjoyable and memorable; you know who you all are!

References

Websites/Databases

Database URL

Joint Genome Institute (JGI) http://img.jgi.doe.gov/cgi-bin/w/main.cgi NCBI BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi BRENDA http://www.brenda-enzymes.info/ Kyoto Encyclopaedia of Genes and Genomes (KEGG) http://www.genome.jp/kegg/

Literature

Agrawal G K, Asayama, M & Shirai, M 1999. Light-dependent and rhythmic psbA transcripts in homologous/heterologous cyanobacterial cells. Biochem Biophys Res Commun, 255, 47-53. Agusti S & Phlips, E J 1992. Light-Absorption by Cyanobacteria - Implications of the Colonial Growth Form. Limnology and Oceanography, 37, 434-441. Alber B E & Fuchs, G 2002. Propionyl-coenzyme A synthase from Chloroflexus aurantiacus, a key enzyme of the 3-hydroxypropionate cycle for autotrophic CO2 fixation. Journal of Biological Chemistry, 277, 12137- 12143. Anthon G E & Barrett, D M 2003. Modified method for the determination of pyruvic acid with dinitrophenylhydrazine. In the assessment of onion pungency. Journal of the Science of Food and Agriculture, 83, 1210-1213. Badger M R, Hanson, D & Price, G D 2002. Evolution and diversity of CO2 concentrating mechanisms in cyanobacteria. Functional plant biology : FPB., 29, 161-173. Badger M R & Price, G D 2003. CO2 concentrating mechanisms in cyanobacteria: molecular components, their diversity and evolution. Journal of Experimental Botany, 54, 609-22. Bar-Even A, Noor, E, Lewis, N E & Milo, R 2010. Design and analysis of synthetic carbon fixation pathways. Proceedings of the National Academy of Sciences of the United States of America, 107, 8889-8894. Bauwe H, Hagemann, M & Fernie, A R 2010. Photorespiration: players, partners and origin. Trends Plant Sci, 15, 330-6. Berman K M & Cohn, M 1970. Phosphoenolpyruvate Synthetase of Escherichia coli : PURIFICATION, SOME PROPERTIES, AND THE ROLE OF DIVALENT METAL IONS. Journal of Biological Chemistry, 245, 5309- 5318. Brunelle S L & Abeles, R H 1993. The stereochemistry of hydration of acrylyl-CoA catalyzed by lactyl-CoA dehydratase. Bioorganic Chemistry, 21, 118-126. Coleman J & Colman, B 1980. Demonstration of C3-photosynthesis in a bluegreen alga, Coccochloris peniocystis. Planta, 149, 318-320. Cooper R A & Kornberg, H L 1967. The direct synthesis of phosphoenolpyruvate from pyruvate by Escherichia coli. Proc R Soc Lond B Biol Sci, 168, 263-80. Cooper R A & Kornberg, H L 1969. [48] Phosphoenolpyruvate synthetase. In: JOHN, M. L. (ed.) Methods in Enzymology. Academic Press. Ducat D C, Way, J C & Silver, P A 2011. Engineering cyanobacteria to generate high-value products. Trends Biotechnol, 29, 95-103. Eisenhut M, Ruth, W, Haimovich, M, Bauwe, H, Kaplan, A & Hagemann, M 2008. The photorespiratory glycolate metabolism is essential for cyanobacteria and might have been conveyed endosymbiontically to plants. Proceedings of the National Academy of Sciences of the United States of America, 105, 17199-17204. Espie G S & Kimber, M S 2011. Carboxysomes: cyanobacterial RubisCO comes in small packages. Photosynth Res, 109, 7-20. Evans H J & Wood, H G 1968. The mechanism of the pyruvate, phosphate dikinase reaction. Proc Natl Acad Sci U S A, 61, 1448-53.

Gerard G F, Collins, S & Smith, M D 2002. Excess dNTPs minimize RNA hydrolysis during reverse transcription. Biotechniques, 33, 984, 986, 988 passim. Hatch M D & Slack, C R 1968. A new enzyme for the interconversion of pyruvate and phosphopyruvate and its role in the C4 dicarboxylic acid pathway of photosynthesis. Biochem J, 106, 141-6. Herrera A 2009. Crassulacean acid metabolism and fitness under water deficit stress: if not for carbon gain, what is facultative CAM good for? Annals of Botany, 103, 645-653. Hugler M, Menendez, C, Schagger, H & Fuchs, G 2002. Malonyl-coenzyme A reductase from Chloroflexus aurantiacus, a key enzyme of the 3-hydroxypropionate cycle for autotrophic CO2 fixation. Journal of Bacteriology, 184, 2404-2410. Kanehisa M & Goto, S 2000. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Research, 28, 27- 30. Kaneko T, Sato, S, Kotani, H, Tanaka, A, Asamizu, E, Nakamura, Y, Miyajima, N, Hirosawa, M, Sugiura, M, Sasamoto, S, Kimura, T, Hosouchi, T, Matsuno, A, Muraki, A, Nakazaki, N, Naruo, K, Okumura, S, Shimpo, S, Takeuchi, C, Wada, T, Watanabe, A, Yamada, M, Yasuda, M & Tabata, S 1996. Sequence Analysis of the Genome of the Unicellular Cyanobacterium Synechocystis sp. Strain PCC6803. II. Sequence Determination of the Entire Genome and Assignment of Potential Protein-coding Regions. DNA Research, 3, 109-136. Kaneko T, Tanaka, A, Sato, S, Kotani, H, Sazuka, T, Miyajima, N, Sugiura, M & Tabata, S 1995. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. I. Sequence features in the 1 Mb region from map positions 64% to 92% of the genome. DNA Res, 2, 153-66, 191- 8. Kebeish R, Niessen, M, Thiruveedhi, K, Bari, R, Hirsch, H J, Rosenkranz, R, Stabler, N, Schonfeld, B, Kreuzaler, F & Peterhansel, C 2007. Chloroplastic photorespiratory bypass increases photosynthesis and biomass production in Arabidopsis thaliana. Nature Biotechnology, 25, 593-599. Kondrashov F A, Koonin, E V, Morgunov, I G, Finogenova, T V & Kondrashova, M N 2006. Evolution of glyoxylate cycle enzymes in Metazoa: evidence of multiple horizontal transfer events and pseudogene formation. Biology Direct, 1. Lindberg P, Park, S & Melis, A 2010. Engineering a platform for photosynthetic isoprene production in cyanobacteria, using Synechocystis as the model organism. Metabolic Engineering, 12, 70-79. Marcus Y, Altman-Gueta, H, Wolff, Y & Gurevitz, M 2011. Rubisco mutagenesis provides new insight into limitations on photosynthesis and growth in Synechocystis PCC6803. Journal of Experimental Botany, 62, 4173-4182. Merryman C & Gibson, D G 2012. Methods and applications for assembling large DNA constructs. Metabolic Engineering, 14, 196-204. Miller A G & Colman, B 1980. Active transport and accumulation of bicarbonate by a unicellular cyanobacterium. Journal of Bacteriology, 143, 1253-9. Mohamed A, Eriksson, J, Osiewacz, H D & Jansson, C 1993. Differential expression of the psbA genes in the cyanobacterium Synechocystis 6803. Mol Gen Genet, 238, 161-8. Narindrasorasak S & Bridger, W A 1977. Phosphoenolypyruvate synthetase of Escherichia coli: molecular weight, subunit composition, and identification of phosphohistidine in phosphoenzyme intermediate. Journal of Biological Chemistry, 252, 3121-7. Pinto F L, Thapper, A, Sontheim, W & Lindblad, P 2009. Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria. BMC Mol Biol, 10, 79. Pisciotta J M, Zou, Y & Baskakov, I V 2010. Light-dependent electrogenic activity of cyanobacteria. Plos One, 5, e10821. Pocalyko D J, Carroll, L J, Martin, B M, Babbitt, P C & Dunaway-Mariano, D 1990. Analysis of sequence homologies in plant and bacterial pyruvate phosphate dikinase, enzyme I of the bacterial phosphoenolpyruvate: sugar phosphotransferase system and other PEP-utilizing enzymes. Identification of potential catalytic and regulatory motifs. Biochemistry, 29, 10757-65. Raines C A 2006. Transgenic approaches to manipulate the environmental responses of the C(3) carbon fixation cycle. Plant Cell and Environment, 29, 331-339. Rippka R, Deruelles, J, Waterbury, J B, Herdman, M & Stanier, R Y 1979. Generic Assignments, Strain Histories and Properties of Pure Cultures of Cyanobacteria. Journal of General Microbiology, 111, 1-61. Robertson D E, Jacobson, S A, Morgan, F, Berry, D, Church, G M & Afeyan, N B 2011. A new dawn for industrial photosynthesis. Photosynth Res, 107, 269-77. Rosgaard L, De Porcellinis, A J, Jacobsen, J H, Frigaard, N U & Sakuragi, Y 2012. Bioengineering of carbon fixation, biofuels, and biochemicals in cyanobacteria and plants. J Biotechnol, 162, 134-47.

Ryan K J, Needham, G M, Dunsmoor, C L & Sherris, J C 1970. Stability of antibiotics and chemotherapeutics in agar plates. Appl Microbiol, 20, 447-51. Schwimmer S & Weston, W J 1961. Onion Flavor and Odor - Enzymatic Development of Pyruvic Acid in Onion as a Measure of Pungency. Journal of Agricultural and Food Chemistry, 9, 301-&. Skjanes K, Rebours, C & Lindblad, P 2013. Potential for green microalgae to produce hydrogen, pharmaceuticals and other high value products in a combined process. Crit Rev Biotechnol, 33, 172- 215. Smejkalova H, Erb, T J & Fuchs, G 2010. Methanol Assimilation in Methylobacterium extorquens AM1: Demonstration of All Enzymes and Their Regulation. Plos One, 5, e13001. Tamagnini P, Troshina, O, Oxelfelt, F, Salema, R & Lindblad, P 1997. Hydrogenases in Nostoc sp. Strain PCC 73102, a Strain Lacking a Bidirectional Enzyme. Appl Environ Microbiol, 63, 1801-7. Tcherkez G G B, Farquhar, G D & Andrews, T J 2006. Despite slow catalysis and confused substrate specificity, all ribulose bisphosphate carboxylases may be nearly perfectly optimized. Proceedings of the National Academy of Sciences of the United States of America, 103, 7246-7251. Thauer R K, Jungermann, K & Decker, K 1977. Energy conservation in chemotrophic anaerobic bacteria. Bacteriol Rev, 41, 100-80. Tjaden B, Plagens, A, Dorr, C, Siebers, B & Hensel, R 2006. Phosphoenolpyruvate synthetase and pyruvate, phosphate dikinase of Thermoproteus tenax: key pieces in the puzzle of archaeal carbohydrate metabolism. Mol Microbiol, 60, 287-98. Wang B, Pugh, S, Nielsen, D R, Zhang, W & Meldrum, D R 2013. Engineering cyanobacteria for photosynthetic production of 3-hydroxybutyrate directly from CO2. Metabolic Engineering, 16, 68-77. Wiame I, Remy, S, Swennen, R & Sagi, L 2000. Irreversible heat inactivation of DNase I without RNA degradation. Biotechniques, 29, 252-4, 256.