The Role of Endocytosis in Neuronal Migration A

THE ROLE OF ENDOCYTOSIS IN NEURONAL MIGRATION

A DISSERTATION SUBMITTED TO THE NEUROSCIENCES PROGRAM AND THE COMMITTEE ON GRADUATE STUDIES OF STANFORD UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Jennifer Cynthia Shieh March 2010

This dissertation is online at: http://purl.stanford.edu/dj352gy7333

Includes supplemental files: 1. Movie of SVZa neurons expressing GFP and K44A-dynamin or mCherry and WT-dynamin, see Figure 2.8 (183-T1-1-20x_15fps-crop.avi) 2. Movie of cell shown in Figure 2.11, treated with MiTMAB (MiTMAB-Movie1.avi) 3. Movie of cell shown in Figure 2.11, treated with MiTMAB (MiTMAB-Movie2.avi) 4. Movie of cells treated with MDC, see Figure 2.18 (MDC-Movie1_230-T4-2.avi)

ii I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Susan McConnell, Primary Adviser

I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Thomas Clandinin

I certify that I have read this dissertation and that, in my opinion, it is fully adequate in scope and quality as a dissertation for the degree of Doctor of Philosophy.

Kang Shen

Approved for the Stanford University Committee on Graduate Studies. Patricia J. Gumport, Vice Provost Graduate Education

This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file in University Archives.

iii ABSTRACT Disruptions in neuronal migration have been implicated in a variety of human mental disorders, including epilepsy, autism, and schizophrenia. Despite the critical role of migration during nervous system development, the basic physical and cytoskeletal mechanisms of coordinated neuronal movement have not yet been fully characterized. A migrating neuron moves with morphologically distinct steps: a single leading process extends ahead of a stationary cell soma, followed by the formation of a cytoplasmic dilation ahead of the nucleus, subsequent movement of the nucleus into the dilation, and retraction of the cell rear. The temporal and spatial regulation of adhesion is important for the proper progression of these steps. Because endocytosis has been implicated in adhesion disassembly, I examined the role of endocytosis during neuronal migration. Disrupting endocytosis either in vitro or in vivo leads to altered neuronal migration. Introducing dominant negative clathrin or dynamin into the developing cortex delays radial migration in vivo. To investigate cellular mechanisms for this effect in a simpler system, I examined anterior subventricular zone (SVZa) neurons migrating from explants in a three-dimensional matrix in vitro. This explant system provides subcellular resolution while preserving the essential features of the neuronal migration cycle. Through immunocytochemistry and transmission electron microscopy (TEM), we saw that components of the clathrin endocytic machinery are localized to the dilation region of a migrating neuron at points of matrix attachment. Adhesion molecules are present at the tip of an extended leading process as well as in the dilation ahead of the nucleus but are largely absent from the rear of the cell. Endocytic components and adhesion molecules primarily colocalize in the dilation. We hypothesized that endocytosis weakens adhesions in the dilation to allow the cell rear to move forward during migration. In support of this hypothesis, exposing explants to pharmacological inhibitors of either clathrin or dynamin prevents migration out of explants, and neurons that have migrated out have altered morphology and adhesion molecule distribution. Neurons exposed to a dynamin inhibitor tend to have “tails” of membrane at the rear, and these tails contain adhesion

iv molecules. The presence of adhesion molecules at the rear of migrating neurons exposed to a dynamin inhibitor supports the idea that endocytosis plays a role in regulating adhesion disassembly. Endocytosis likely plays a critical role in general neuronal migration regardless of the specific neuronal subtype, migration mode, or substrate.

v ACKNOWLEDGMENTS

The path to a PhD is long and isolated but mine has been illuminated by countless people who have all held a torch to light that path and support my journey. There is no way that I can name everyone who has contributed, so I won’t try and will just hope that I can somehow express my gratitude more personally. Of course, I have to name a few people who have had the biggest impact on my development as an official, card- carrying scientist.

My advisor Sue McConnell – for giving me the freedom to develop into an independent “cowgirl” scientist as well as being the amazing teacher and communicator and photographer that I aspire to be.

My committee members James Nelson, Tom Clandinin, and Kang Shen – for being the smartest, most approachable, and fun people (let alone incredible scientists) I have ever known, and for treating me like a peer.

My fellow McConnell lab labbies – for being the intelligent, fun, fiery compatriates that made me want to join the lab in the first place and model myself after them. Chris Kasnowski – for being the font of knowledge that she is. Sandra Wilson – who I try to emulate in my scientific rigor. Laura Schaevitz – for moral support and showing me that you can be smart and ambitious and still have weekends to yourself. Shalu Srinivasan – whose general disposition and persistence cannot be beat. Dino Leone – for sharing a ridiculous need for more data storage, among other things. Pushkar Joshi – for encouraging ridiculous dreams of escaping lab life. Bruce Schaar – my advisor, without whom this dissertation would be completely different and I may never have become a cell biologist.

My Neurostuds – for being the most amazing people, the reason why I wanted to come to Stanford, and the most redeeming feature of graduate school (knowing there are

vi others suffering with you). I couldn’t possibly have survived without the Nerdpatrol crew – especially Leslie Meltzer and Jocelyn Krey. Rachel Kalmar – for the love of design and dance and everything awesome. Saul Villeda – for the enthusiasm and tequila. Matt Carter – for being crazy and suggesting we author a textbook at exactly the time when we should be writing our dissertations.

My non-neuro Studs – Leila Takayama and Emmalynne Hu Roy – for being the most amazing randomly-assigned roommates that could not possibly have been better chosen for me.

My family – for their crazy but wonderful ways. Especially my mom – for her eternal support, encouragement, love, and great genes.

My Vishal – for not letting me quit, for constantly challenging me to THINK and check my brain, for making sure I actually had fun and enjoyed grad school, for showing me why I should be confident, and for including me in his wonderful family.

vii TABLE OF CONTENTS

Abstract …………………………………………………………………………… iv Acknowledgments ……………………………………………………………….... vi Table of Contents ...………………………………………………………………… viii List of Figures ……………………………………………………………………… xii Chapter 1: Introduction……………………………………………………………… 1 Development of the Cerebral Cortex Modes of Neuronal Migration The Neuronal Migration Cycle Coordinating the Cytoskeleton for Neuronal Migration Leading Process Choice and Extension Differences between Axonal Polarity and Migration Polarity Dilation Formation and Nucleokinesis Rear Retraction Adhesion Dynamics in Cell Migration Adhesion Formation in Cell Migration Adhesion in Neuron Migration Biochemical and Biomechanical Mechanisms of Adhesion Disassembly Endocytosis and Adhesion in Cell Migration Clathrin-dependent and Clathrin-independent Forms of Endocytosis Endocytosis and Adhesion Endocytosis in Migrating Neurons Contributions of this Dissertation References Figures

viii Chapter 2: Endocytosis is critical for neuronal migration……………………………49 Preface Summary Introduction Results Components of clathrin-mediated endocytosis are enriched in the dilation of migrating neurons Clathrin coated vesicles are positioned to regulate adhesion Adhesion proteins are concentrated in distinct subcellular domains Inhibiting dynamin function disrupts migration in vitro Acutely inhibiting dynamin function disturbs cell soma translocation Inhibiting dynamin function alters cell morphology and the distribution of adhesions Inhibiting clathrin function disrupts migration in vitro Early endosome dynamics may be affected by clathrin inhibition Inhibiting clathrin function delays cortical migration in vivo Inhibiting dynamin function stalls cortical migration in vivo Discussion Spatial regulation of adhesion and de-adhesion Adhesion in vivo The role of clathrin-mediated endocytosis in neuronal migration A model for neuronal migration Broader implications for three-dimensional adhesion systems Experimental Procedures Acknowledgments References Figures

ix Chapter 3: Preliminary Studies on Neuronal Migration…………………………….155 Preface Part 1: Adhesion Force Analysis in Migrating Neurons…………………….156 Introduction Results Adhesion force analysis in migrating neurons Discussion Coordinating strength and adhesion molecules Issues with DQA Future directions Experimental Procedures Part 2: The Kinesin-1 Motor Domain Accumulates at the Leading Process Tip in Migrating Neurons………………………………………………………161 Summary Introduction Directed neuronal migration requires a single leading process Consolidating branches into a single leading process Results Kinesin-1 motor domain localizes to the tip of the leading process in migrating neurons Kinesin-1 motor domain tracks with the tip of the leading process during extension and retraction events Discussion Establishing polarity in vivo Role of kinesin-1 in regulating adhesion disassembly Future directions Experimental Procedures References Figures

x Chapter 4: Conclusions and Future Directions……………………………………175 Implications of this Dissertation for General Cell Migration Implications of this Dissertation for Different Forms of Neuronal Migration Coordinating the Cytoskeleton Throughout Neuronal Development Coordinating Migration with Differentiation Coordinating Migration with Axon Extension Importance and Formation of the Dilation Future Directions References

xi LIST OF FIGURES

FIGURE 1.1 The developing cerebral cortex is organized both horizontally and vertically………………………………………………….41

FIGURE 1.2 Neurons migrate using multiple modes……………………....43

FIGURE 1.3 A model for cytoskeletal coordination during cycles of saltatory neuronal migration……………………………………………45

FIGURE 1.4 Clathrin-mediated endocytosis may be used to internalize adhesion receptors…………………………………………….47

FIGURE 2.1 Components of CME are present in the dilation of migrating neurons………………………………………………………..95

FIGURE 2.2 Clathrin localization to the dilation is specific………………..97

FIGURE 2.3 The dilation is a site of active endocytosis…………………...99

FIGURE 2.4 Components of CME colocalize with adhesions……………101

FIGURE 2.5 Clathrin adaptors colocalize with integrin β1……………….103

FIGURE 2.6 Integrin β1 mediates migration in SVZa explants cultured in a Matrigel/collagen I matrix…………………………………..105

FIGURE 2.7 Adhesion molecules enriched in the tip of the leading process differ from those enriched in the dilation……………………107

xii FIGURE 2.8 Dominant negative dynamin impairs SVZa neuron migration…………………………………………………….109

FIGURE 2.9 MiTMAB blocks CME but not bulk fluid phase uptake, and increases surface integrin β1 levels………………………….111

FIGURE 2.10 The dynamin inhibitor dynasore affects bulk fluid-phase uptake at high concentrations……………………………………….113

FIGURE 2.11 Inhibiting dynamin impairs SVZa neuron migration……….115

FIGURE 2.12 The microtubule and actin cytoskeleton is intact in neurons treated with MiTMAB………………………………………117

FIGURE 2.13 Inhibiting dynamin alters the morphology of and distribution of adhesion proteins in migrating neurons……………………..119

FIGURE 2.14 Individual cells show varied adhesion distributions………...121

FIGURE 2.15 Excess rear membrane and adhesion staining are apparent in MiTMAB-treated neurons…………………………………..123

FIGURE 2.16 Individual line scan data for cells aligned by nuclei………...125

FIGURE 2.17 Effect of MiTMAB on adhesion at rear……………………..127

FIGURE 2.18 Inhibiting clathrin impairs SVZa neuron migration…………129

FIGURE 2.19 MDC blocks CME, but not bulk fluid phase uptake………...131

xiii

FIGURE 2.20 YFP-2xFYVE shows early endosomes are enriched in the dilation of migrating neurons and move forward during migration…………………………………………………….133

FIGURE 2.21 Clathrin knockdown may lead to subtle migration defects in vivo. …………………………………………………………135

FIGURE 2.22 Clathrin heavy chain expression may be reduced in brains expressing CHC-1 siRNA but not control or CHC-2 siRNA ……………………………………………………………….137

FIGURE 2.23 Dominant negative clathrin expression leads to delayed cortical migration. ………………………………………………….139

FIGURE 2.24 GFP+ neurons express dominant negative constructs at E17 ……………………………………………………………….141

FIGURE 2.25 Dominant negative dynamin I expression leads to stalled cortical migration……………………………………………143

FIGURE 2.26 GFP+ neurons express dominant negative constructs at E17 ……………………………………………………………….145

FIGURE 2.27 Radial glia are intact in dominant negative-expressing cortex ……………………………………………………………….147

FIGURE 2.28 α3 integrin expression is highest in the IZ…………………..149

xiv FIGURE 2.29 Dominant negative dynamin-expressing neurons extend axons but are present in the white matter at P1…………………….151

FIGURE 2.30 Model of Neuronal Migration……………………………….153

FIGURE 3.1 DQA shows changes in relative forces generated by migrating neurons………………………………………………………169

FIGURE 3.2 Kif5C560-YFP selectively localizes to the tip of migrating neurons………………………………………………………171

FIGURE 3.3 Kif5C560-YFP remains in the tip of migrating neurons as the leading process extends and retracts………………………...173

xv CHAPTER 1: INTRODUCTION

Summary The nervous system is a precisely and beautifully organized structure that controls everything from the most basic stimulus response, such as dilating the pupil, to the most complicated thought processes, such as reading and understanding this dissertation. The complexity of the mammalian brain becomes even more awesome in light of its humble beginnings as a simple sheet of neuroepithelium. The laminated pattern of the cerebral cortex arises from the coordinated birth and development of neuronal cohorts with the same fate. This dynamic process requires early morphogen patterning to specify general areas for the simple sheet of cells to become, and then within those areas, molecular and genetic cues are enacted that tell individual cells how they should act, where they should go, what they should do, and with whom they need to communicate. This complicated dance of development requires the coordination of millions of individual cells. But, within each of these cells lies yet another intricate layer of machinery that ensures each cell can respond appropriately to those external molecular cues. I have been examining this delicate internal machinery, attempting to understand the essential physical mechanisms that allow newborn neurons to move properly. In this chapter, I describe what is currently known about the cellular mechanisms of neuronal migration and basic cellular mechanisms regulating adhesion in migration that have yet to be translated to a neuronal context.

Development of the Cerebral Cortex An incredibly diverse collection of cells populates the nervous system. A prime example of nervous system diversity and complexity is the cerebral cortex – the brain structure that mediates our highest cognitive and perceptual abilities. The cerebral cortex develops in a series of dynamic events that culminate in the formation of the precisely wired neuronal circuits that underlie complex behaviors. For the human brain to perform its full repertoire of behaviors requires the proper progression and coordination of these dynamic developmental events.

The great variety of cell types in the cerebral cortex is fundamental in generating complex connections and behaviors. Numerous features define neuronal identity, including: molecular constituents (genes and proteins, including neurotransmitters, that are expressed), morphology, connectivity, and location. Though these distinct features are highly interrelated, I focus here on the importance that positional information confers on cellular identity. The mature mammalian cortex is divided into functional regions defined by their afferent and efferent connections to mediate specific abilities, such as motor cortex, sensory cortex, visual cortex, and so on. But, how does an apparently homogeneous neuroepithelial sheet become parceled into the unique functional areas of the mature cerebral cortex? This seemingly “blank” neuroepithelial sheet is actually a “protomap” with horizontal arealization defined by morphogenetic gradients set up by early signaling centers of factors such as FGFs, Wnts, and BMPs (Figure 1.1A, Rakic et al., 2009). A neuron’s function is dictated not only by its presence in a specific nervous system structure or region, but also its position within the highly organized nuclei and laminae of that structure. In addition to the horizontal/areal organization, cortex across these regions is organized vertically, from the ventricular to the pial surface (Figure 1.1B). Proliferating neuroepithelial cells line the fluid-filled ventricle and undergo what is known as interkinetic nuclear migration (INM). During INM, nuclei oscillate in phase with the cell cycle such that they proceed through M phase at the apical (ventricular) surface and undergo S phase at the basal surface of the ventricular zone (VZ). These progenitors can divide to give rise to more progenitors that will continue to divide and populate the cortex, or they can begin to differentiate and give rise to neurons. Newborn neurons will then migrate radially outward toward the pial surface to generate the mature laminated cortex. The six distinct layers of the mature neocortex are generated in an “inside-out” fashion linked to neuronal birthdate; deeper layers are born earlier with later-born neurons migrating past the deep layers to a more superficial position (McConnell, 1995). The developing cortex forms distinct laminar zones that maturing neurons pass through as they transition between the different phases of development: proliferation,

2 initial neuron specification (differentiation), migration, and final maturation (differentiation) (Bystron et al., 2008). Progenitors at the apical surface form the VZ, while just above, the subventricular zone (SVZ) develops around E13-14 in mice, acting as a secondary site of proliferation. Sitting basal to the SVZ is the developing intermediate zone (IZ), which eventually becomes filled with axons creating the white matter. These zones are spatial snapshots of cortical development timing, as cohorts of neurons born on the same day proceed through the stages and zones together. There is great cell type variety throughout both horizontal and vertical organizations of the cortex. Early protomaps establish pockets of progenitors for specialized cell types; excitatory projection neurons tend to be born in the VZ of the developing cortex itself, while inhibitory interneurons are born in the VZ of the developing basal ganglia, known as the ganglionic eminence (Marin and Rubenstein, 2001). Coordinating long-range migrations with these specialized proliferative regions diversifies the cell type composition and complexity found in the mature cerebral cortex by allowing different cell types to intermingle. Interneurons migrating tangentially from the ganglionic eminence coordinate their birth and arrival to be properly integrated with projection neurons with the same birthdates (Anderson et al., 2002; Marin and Rubenstein, 2001; Valcanis and Tan, 2003). The specialized proliferative zones where neurons are born may be far from their ultimate residence, so they frequently must traverse incredible distances before arriving at their final destination. Arriving at this correct final position is necessary to establish the proper neural networks vital to accomplishing complex cognitive tasks. However, these long journeys leave many opportunities for the disruption of brain development. Indeed, migration appears to be a sensitive process; improper neuronal migration has been implicated in a number of human syndromes from mental retardation and epilepsy to schizophrenia and dyslexia (Fatemi and Folsom, 2009; Gershon and Rieder, 1992; McManus and Golden, 2005; Shastry, 2007). Thus, migration of neurons to their appropriate location is critical for the development of a functional mammalian brain. Though there are a number of critical steps that must be

3 properly coordinated for the cerebral cortex to develop properly, I have focused on neuronal migration.

Modes of Neuronal Migration Neurons of the cerebral cortex use a variety of migrating modalities to reach their final position (Figure 1.2). These different modes of migration are largely classified by substrate (e.g. gliophilic or neurophilic) or direction of migration (e.g. radial movements along the vertical plane or tangential movements in the horizontal plane). Neurophilic migration can be further subdivided into axonophilic migration, such as that of interneurons migrating tangentially along TAG-1+ fibers (Denaxa et al., 2001; McManus et al., 2004), or chain migration, seen in the neural progenitors of the anterior subventricular zone (SVZa) that migrate to the olfactory bulb (Wichterle et al., 1997). There is also now growing evidence for vasophilic migration along blood vessels in both the normal adult brain as well as after stroke (Saghatelyan, 2009). Migration substrate partially overlaps with descriptions of migration classified by direction – generally radial or tangential. Radial migration includes somal translocation, movement of the cell soma along its own leading process, executing a pull-up type movement (Figure 1.2B). Somal translocation in the cerebral cortex appears to be more prevalent at early stages of development when the developing cortex is much thinner (Nadarajah et al., 2001). At later stages, radially migrating neurons primarily exhibit glial-guided locomotion, using the radial glial fiber’s pial process as a substrate along which to climb (Figure 1.2B). Locomoting neurons move in an inchworm-like fashion with their leading process tightly wrapped around the radial glial fiber (Rakic, 1972). Tangential migration describes non-radially oriented migration that is typically radial glia-independent. This includes both the interneurons leaving the ganglionic eminence to integrate into the cortex, as well as the chain migration of SVZa neurons into the olfactory bulb. While distinct neuronal subtypes are often described simplistically as using a single mode of migration, individual neurons have been observed transitioning through multiple distinct modes, indicating that neurons are able to utilize a variety of

4 modes to arrive at their final position (Nadarajah et al., 2002; Nadarajah et al., 2001; Nadarajah and Parnavelas, 2002; Tabata and Nakajima, 2003). Distinct modes appear to correspond to the distinct laminar zones of the developing cortex. After a newly born neuron exits the VZ or SVZ, it will often change its morphology from bipolar to multipolar in the IZ and then back to bipolar to continue migrating radially along a glial fiber guide toward the pial surface (Figure 1.2B, Tabata et al., 2009; Tabata and Nakajima, 2003). While in a multipolar stage of migration, neurons can migrate tangentially, perpendicular to radial glial fiber guides, or even migrate back down toward the ventricle (Nadarajah et al., 2002; O'Rourke et al., 1997; O'Rourke et al., 1992). Tangentially migrating interneurons also exhibit these changes in different modes as they stream in through the SVZ/IZ or marginal zone (MZ) near the pial surface and then must reorient to incorporate themselves into their proper layer. Extensive migration occurs throughout the nervous system, with many different types of neurons utilizing modes and mechanisms to migrate in ways similar to cortical neurons (Hatten, 1999; Marin and Rubenstein, 2003). Cerebellar granule neurons have been studied for decades as a model system of glial-guided migration (Edmondson and Hatten, 1987). Serotonergic neurons feature somal translocation movements similar to those seen in early cortical neurons (Hawthorne et al., 2010). Gonadotropin-releasing (GnRH) neurons migrate tangentially along TAG-1+ vomeronasal axon fibers (Cariboni et al., 2007; Yoshida et al., 1995). Most of these diverse types of neurons display similar abilities to migrate in different modes despite the radically different substrates and extracellular environments they encounter during migration. Regardless of the mode and specific neuronal subtype, there are certain common features that characterize the basic steps of neuronal migration.

The Neuronal Migration Cycle In all motile cells, migration can be described as a cyclical process that involves a reiterative sequence of distinct yet integrated steps: polarization and protrusion, attachment at the cell front, forward movement of the cell body, and detachment with retraction at the cell rear (Lauffenburger and Horwitz, 1996; Ridley

5 et al., 2003; Vicente-Manzanares et al., 2005; Webb et al., 2002). Migrating neurons, however, differ fundamentally from the cells whose migration has traditionally been examined (e.g. neutrophils, fibroblasts, keratinocytes, Dichtyostelium, et al). Most model cells migrating in two dimensions in vitro elaborate broad lamellae at their leading edges; leading edge movement is closely coupled to that of the nucleus, and the cell rear forms a contractile tail. Migrating neurons, by contrast, extend a long leading process that actively explores the environment, and nucleokinesis (the movement of the nucleus and cell soma) does not smoothly follow leading process extension, but rather jumps in discrete events, leading to a saltatory “two-stroke” migration cycle (Edmondson and Hatten, 1987; O'Rourke et al., 1992; Schaar and McConnell, 2005). The stereotypical “two-stroke” neuronal migration cycle is characterized by a leading process that first extends and explores, followed by a distinct cell soma translocation event. After the leading process extends but before the cell soma moves forward, a cytoplasmic dilation swells in the leading process proximal to the nucleus (Bellion et al., 2005; Schaar and McConnell, 2005). This dilation is characteristic of multiple neuronal subtypes migrating on a variety of substrates, from projection neurons or cerebellar granule neurons migrating along radial glial fibers to tangentially migrating interneurons in vivo to SVZa neuroblasts migrating in extracellular matrix (ECM) (Ang et al., 2003; Gasser and Hatten, 1990; Nadarajah et al., 2001; Solecki et al., 2009; Wichterle et al., 1997). After the formation of this transient structure, the nucleus moves forward into the dilation and the rear membrane is retracted. This cycle is repeated as the neuron propels itself forward.

Coordinating the Cytoskeleton for Neuronal Migration Major cytoskeletal remodeling is required to enable the dynamic cellular behaviors neurons exhibit as they progress through the steps of the neuronal migration cycle. Microtubules and actin are essential for movements of leading process extension as well as translocation of the nucleus and cell soma. Schaar and McConnell (2005) describe a model for the intracellular events that coordinate the saltatory steps

6 of neuronal migration (Figure 1.3). In this model, adhesive contacts with the migration substrate are formed in the leading process during extension, potentially strengthening during pauses in extension. After the leading process grows past a pause location, a cytoplasmic dilation forms at that same location. Prior to nucleokinesis, the centrosome, the mammalian microtubule organizing center, moves into the dilation. Finally, the nucleus translocates into the dilation, squeezed by contractions at the cell rear mediated by myosin II. These contractions may also break off leftover adhesions to release the soma for forward movement. A flurry of work in the last decade has greatly advanced our understanding of the cell biological basis of neuronal migration. Much of the work examining the cellular and molecular mechanisms that govern neuronal migration has focused on the microtubule and actin cytoskeleton, and the coordination of leading process movement with nuclear translocation. In this section, I summarize research that has elucidated the cellular and molecular mechanisms that coordinate each step in the neuronal migration cycle.

Leading Process Choice and Extension The first step in migration is polarization, including protrusion or extension of the cell membrane in the direction of migration. Neurons migrating radially in cortex transition between multipolar and bipolar stages and may migrate in a number of different directions when multipolar. Interneurons migrating tangentially into cortex utilize a branching mode of migration to choose direction (Martini et al., 2009; Ward et al., 2005). Thus, polarization in migrating neurons can be interpreted as consolidating these multiple neurites or branches and choosing a single leading process for the cell body to follow. Mutants with defects in branching have illuminated a number of molecules involved in choosing a single leading process to create a directed, polarized migrating neuron. Doublecortin (Dcx) was cloned as an X-linked causative gene leading to human doublecortex syndrome or type 1 lissencephaly. RNAi-mediated knockdown of Dcx leads to excessive branching, with radially migrating cortical neurons stalling in a

7 multipolar state (Bai et al., 2003). Similarly, interneurons from Dcx knockout animals display excessive branching during migration and an inability to stabilize a single leading process (Kappeler et al., 2006). Doublecortin like kinase (DCLK) plays an overlapping role with Dcx in vivo, regulating both neuronal migration and axon tract formation (Deuel et al., 2006; Koizumi et al., 2006b). Excessive and unstable process formation leading to slowed or stalled migration is also characteristic of mice mutant for Cdk5 or the Cdk5 activator p35 (Gupta et al., 2003; Ohshima et al., 2007). Conversely, neurons lacking the F-BAR domain protein SrGAP2 appear to branch less, leading to a more rapid migration up to the cortex, further highlighting the importance of leading process stabilization for cortical migration (Guerrier et al., 2009). Disruption of a number of molecules leads to problems transitioning out of the IZ between the multipolar to bipolar state. However, mutations in filamin A (Flna), an actin crosslinking protein, lead to impaired migration out of the VZ causing periventricular heterotopias in humans (Fox et al., 1998; Sarkisian et al., 2008). This may be due to an impaired ability to establish proper bipolar morphology and initiate migration. Flna mutants display more complex branching with active extension and retraction of neurites in the SVZ/IZ region (Nagano et al., 2004). Consistent with Flna controlling proper migration morphology, increased Flna expression due to knockdown of FILIP, an Flna interacting protein that normally degrades Flna, promotes a bipolar morphology in the SVZ/IZ. Unlike in the SrGAP2 mutants, this change in morphology does not appear to alter migration rates, as cells still move as slowly as multipolar cells in the same region. Proper regulation of Flna levels appears to be important for maintaining proper migrating morphology.

Differences between Axonal Polarity and Migration Polarity Polarity establishment in neurons has frequently been examined in the context of axonogenesis. Many of the key polarity-influencing factors that are involved in establishing the polarity of differentiating neurons or other types of migrating cells, such as the Par3/Par6/aPKC complex, are also involved in establishing polarity for

8 directed neuronal migration, suggesting that we can learn about cellular and molecular mechanisms from the much more established study of polarity specification during differentiation. There are a number of similarities between choosing a single leading process and choosing a neurite to become an axon from multiple equivalent neurites. In addition to the similar morphological appearance and dependence on the microtubule and actin cytoskeleton, both axon and migration guidance use similar cues. Axons and migratory leading processes alter their direction of growth in response to Netrins, Semaphorins, and Slits (Brose and Tessier-Lavigne, 2000; Chen et al., 2008; Manitt and Kennedy, 2002; Tessier-Lavigne and Goodman, 1996). This could indicate converging mechanisms for translating extracellular guidance cues into cytoskeletal changes. However, the morphological changes elicited by a guidance cue differ between growing axons and migrating leading processes. While axon growth cones tend to turn to follow or move away from a cue, migrating neurons instead extend a new neurite towards or away from the cue, then choose to follow the new neurite, branching rather than turning to respond and migrate in a directed manner (Martini et al., 2009; Ward et al., 2005). The similar appearance of growth cones in migratory leading processes to that of axonal growth cones has led to the general notion that guidance and growth of a migratory leading process resembles that of growing axons. Thus, the cytoskeletal dynamics that occur in axonal growth cones could potentially be directly applied to the growth cones of migrating neuronal leading processes. A study of the leading process in migrating cerebellar granule neurons suggests a more complex situation. Cerebellar granule neurons switch between a tangential mode of migration and a radial mode of migration. While migrating tangentially, the leading process will become the parallel fiber axon left in the molecular layer. In this case, the growth cone is very much like an axon growth cone. However, when the granule neuron extends a new leading process to start migrating radially down a Bergmann glial fiber, the leading process growth cone becomes thinner and resembles a dendrite rather than an axon (Kawaji et al., 2004). Because radially migrating cortical neurons also extend their leading

9 process in the direction where the dendrite will eventually grow, and they appear to leave behind an axonal process, it is possible that the leading process growth cone of a cortical neuron may also be more similar to a dendrite in its cytoskeletal structure. Many of the molecules that play a role in establishing axonal polarity were discovered or validated through in vitro studies of unpolarized hippocampal neurons that become polarized in culture. However, neurons in vivo must coordinate the processes of axonogenesis with directed migration in an environment that is polarized to start. Polarity in migrating cells is likely to be a precursor for establishing axon/dendrite polarity, especially in cell types that leave a trailing axon behind during migration, such as radially migrating cortical neurons (Barnes et al., 2007; Kwiatkowski et al., 2007). Molecular evidence that axon formation and migratory leading process extension are distinct events comes from the ability to dissociate disruptions in cortical axonogenesis and radial migration in mice mutant for Cdk5, the polarity protein LKB1, or all three mammalian Ena/VASP proteins (Barnes et al., 2007; Kwiatkowski et al., 2007; Ohshima et al., 2007). As discussed above, Cdk5 knockout mice have impaired radial migration, possibly due to an inability to properly regulate the multipolar-to-bipolar transition out of the IZ. Despite the improper laminar positioning of the neurons, axons are still formed, though they may be mistargeted. In the opposite situation, neurons may be able to migrate properly but still not form an axon. LKB1, the mammalian homolog of C. elegans polarity protein Par4, is required for axon formation in cortical neurons without altering proper laminar positioning in knockout animals. However, acute knockdown of LKB1 using RNA interference does lead to impaired migration due to a disruption in nucleus-centrosome coupling (Asada et al., 2007). Ena (Mena), vasodilator-stimulated phosphoprotein (VASP), and Ena-VASP-like protein (EVL) together facilitate actin polymerization by inhibiting actin-capping proteins. While Ena/VASP triple mutants are able to properly form migratory leading and trailing processes, they do not properly form axons. Thus, the formation of a migratory leading process can be separated from the formation of an axon, suggesting different regulatory pathways though they may share common molecular cues.

Dilation Formation and Nucleokinesis A critical difference between axon elongation and migration is the coordination of leading process extension and movement of the cell body. Thus, cytoskeletal mechanisms controlling nucleokinesis have been the focus of a great deal of research (Higginbotham and Gleeson, 2007; Tsai and Gleeson, 2005). While actin- interacting proteins were highlighted in migratory leading process dynamics, the microtubule cytoskeleton is the focus during nucleokinesis. A cytoplasmic dilation forms at the end of the leading process proximal to the nucleus just before nucleokinesis. The centrosome and Golgi apparatus enter the dilation ahead of the nucleus (Bellion et al., 2005; Schaar and McConnell, 2005). As a microtubule organizing center, the centrosome plays an essential role in linking the leading process and the cell soma. Proteins found at the centrosome are required for nucleokinesis, with coupling between the centrosome and the nucleus being an essential component. Lis1/PAFAH1B1, a protein first identified through genetic analysis of human type 1 lissencephaly patients, is found at the centrosome and plays an important role in coupling nuclear movement with the centrosome (Reiner et al., 1993; Sapir et al., 1997). Lis1 acts in a complex with the minus-end directed microtubule motor dynein, dynactin, and Ndel1 (Nudel) to maintain the integrity of the microtubule fork structure that couples the nucleus to the centrosome (Sasaki et al., 2005; Shu et al., 2004). Dynein at the centrosome may act by pulling forward on the nucleus in its microtubule cage. Par6α and myosin II have also been found in the centrosome region of migrating cerebellar granule neurons (Solecki et al., 2004; Solecki et al., 2009). Though leading process extension and nucleokinesis are distinct steps during neuronal migration, the stabilization of a single leading process to follow is tightly associated with movement of the nucleus into that process. This is highlighted by the molecules involved in both events. In addition to its role in stabilizing microtubules to consolidate a single leading process, Dcx also appears to be used in the actual coupling between leading process and nucleokinesis. Dcx coordinates leading process

11 choice with centrosome positioning, and then Dcx/ Lis1 together coordinate with dynein to link the centrosome to the nucleus (Koizumi et al., 2006a; Tanaka et al., 2004). Cdk5 plays multiple roles during neuronal migration, as it has numerous substrates involved in different aspects of the neuronal migration cycle (Ayala et al., 2007). In addition to its potential role in consolidating a single leading process, which could be linked to its phosphoregulation of Dcx, Cdk5 phosphorylates FAK (focal adhesion kinase) at Ser732 to stabilize connections at the microtubule fork that couple the nucleus to the centrosome (Xie et al., 2003). Despite the importance of microtubules in all aspects of neuronal migration, suprisingly little work has investigated the potential role of kinesin family plus-end directed microtubule motors. One recent study failed to see an effect of inhibiting kinesin using the pharmacological inhibitor AMP-PNP on the migration velocity of somally translocating serotonergic neurons (Hawthorne et al., 2010). However, kinesin-1 does interacts with mNUDC to mediate transport of the Lis1/dynein/dynactin complex critical for nucleokinesis (Yamada et al., 2010). Kinesin motors also interact with the nuclear envelope proteins SUN1/2 and Syne2, which are required for the link between the nucleus and centrosome to allow nucleokinesis (Zhang et al., 2009). The actin motor non-muscle myosin II plays a number of roles in general cell migration, including neuronal migration (Vicente-Manzanares et al., 2007). Myosin IIB mutants display abnormal cerebellar granule neuron and tangential migration (Ma et al., 2004; Tullio et al., 2001). Possibly in coordination with nuclear-centrosome coupling to aid nucleokinesis, myosin II at the rear of migrating neurons may serve to both push the nucleus forward and aid in detachment of the rear membrane from the extracellular environment for trailing process retraction. Migrating tangential and SVZa neurons in culture require myosin II at the rear to aid in somal translocation (Bellion et al., 2005; Schaar and McConnell, 2005), while migrating cerebellar granule neurons appear to utilize myosin II in the dilation, to aid in centrosome movement or coordinating movement of the nucleus from the front (Solecki et al., 2009). This may point to certain features unique to specific modes of migration.

Rear Retraction After nucleokinesis, the cell soma membrane formerly surrounding the nucleus is retracted. The resolution of the cell soma rear after nucleokinesis has generally been neglected in studies of neuronal migration. This may be due to the difficulty in studying rear retraction in migrating neurons that leave behind trailing processes or elaborate axons during migration. However, the focus of my thesis research points to the importance of proper adhesion regulation for rear detachment, including in migrating neurons. Even in neurons that leave a trailing process behind, full somal translocation requires that the cytoplasm and membrane surrounding the nucleus that constitutes the cell soma should not be left behind as a large empty bag that used to hold the nucleus. Membrane remodeling must occur along with nucleokinesis. My thesis research points to the role of endocytosis in that membrane remodeling process as a function of removing the attachments that normally anchor the cell soma in place during leading process elongation.

Adhesion Dynamics in Cell Migration Adhesion is tightly integrated with cytoskeletal dynamics, as adhesive contacts with the migratory substrate are directly and indirectly connected to the actin cytoskeleton. These contacts transmit force information from the outside in to generate changes in cytoskeletal structure. These changes can be used to create pulling forces, using the adhesive contacts as traction, or perhaps to attract specific molecular components that will indicate a direction in which to polarize and migrate. Proper adhesion strength must be dynamically regulated along the length of a motile cell as it moves. Efficient cell migration requires that cells repeatedly form and dissolve contacts between themselves and their substrate, whether it is other cells or extracellular matrix. Adhesion formation regulation is a key factor in the ability of a cell to properly migrate.

Adhesion Formation in Cell Migration Actin polymerization both drives protrusion and is tightly linked to the formation of adhesions at leading edge lamellipodia in individual fibroblast-like cells migrating in two dimensions (2D) (DeMali et al., 2002; Vicente-Manzanares et al., 2009). Many studies have focused on the formation of the large macromolecular adhesion complexes surrounding integrin receptors, which connect ECM molecules like fibronectin or laminin to the actin cytoskeleton. Integrin heterodimers on the membrane surface bind to different substrates depending on their constituent α and β subunits. Actively-bound integrin receptors participate in “outside-in” signaling, initiating signaling cascades within the cell. These signaling cascades then attract other molecules to create large focal adhesion complexes around sites of integrin clustering (Partridge and Marcantonio, 2006). There is a wide variety of adhesive structures with varying sizes, molecular compositions, and contributions to force transduction (Turner, 2000; Zamir et al., 1999). These distinct types of adhesive structures are found at different points during migration and in different regions of the cell. Traditionally, adhesion complexes have been categorized based on their morphology, mode of formation, and molecular composition. Differences among the structures have been correlated to their maturity, which is also related to their strength and signaling functions. Substrate structure and content affects the structure and molecular composition of cell-matrix adhesions (Katz et al., 2000; Sastry and Burridge, 2000; Webb et al., 2003; Webb et al., 2002; Zamir and Geiger, 2001). For example, fibroblast cell morphology and adhesion is very different in a 3D substrate compared with a 2D substrate. Even within cells, there are differences in focal adhesions depending on their relative location in a migrating cell (Ballestrem et al., 2001). Smaller nascent focal complexes at the dynamic leading edge of migrating cells may provide more traction forces (Beningo et al., 2001). As these focal complexes mature, they may grow into larger, more organized focal adhesions that typically appear farther back in a cell. These larger adhesion structures may not have as strong of a connection to the substrate or the cytoskeleton, creating a gradient of adhesive strength. Having weaker adhesion forces at the cell rear permits forces

14 generated by cytoskeletal motors to move the cell toward areas of greater adhesion strength. Thus, asymmetrical adhesion forces are needed for directed migration. If adhesions were equally strong all over, cells might not be able to move in a specific direction, but rather just spread out. Local remodeling of adhesion within subcellular specializations is also important. Indeed, much of what is known about adhesion dynamics is based on work focused on the spatial regulation of adhesions within the lamellipodia rather than whole cell adhesion dynamics. Adhesion regulation at both the subcellular and whole cell level is particularly relevant for neurons, which migrate using two independent parts (the leading process growth cone and the cell soma) that must each regulate and coordinate adhesion.

Adhesion in Neuron Migration Despite the continued clarification of cytoskeletal dynamics during neuronal migration, one process that has largely been ignored is the role and coordination of adhesion. The model for cytoskeletal coordination in migrating neurons proposed by Schaar and McConnell (2005) included predictions about adhesion regulation. As in other migrating cells, a gradient of adhesion strength should be established, such that there is greater attachment in the direction of migration with weaker attachment at the rear of the cell. They proposed that traction-generating adhesions are present in the growth cones during dilation formation and nucleokinesis so that the leading process can serve as an anchor for cell body movement. During extension and exploration, adhesions in the leading process growth cone should be rapidly turned over so the growth cone can explore without getting stalled in its substrate. This may be occurring while multiple processes are present, with all the processes extending and exploring in a dynamic way. When a single leading process is chosen and the cell needs to move its soma forward, then the leading process should strengthen adhesion to provide traction forces necessary to serve as an anchor toward which the cell body will move. The dilation region may act as an intermediate anchor point for the nucleus. As with polarization, we can take lessons from the more developed field of axon growth and guidance to examine what is known about adhesion at the axonal

15 growth cone and see whether these lessons apply to the migratory leading process. The morphology and molecular composition of adhesive structures in fibroblast-like cells is distinct from those observed in axon growth cones. Adhesion molecules found in large focal adhesion complexes in fibroblast-like cells migrating in 2D do not form the same large complexes in axon growth cones; rather, they appear as small scattered puncta (Renaudin et al., 1999). While integrin-based adhesions are the focus in model cells migrating in ECM, neurons likely use distinct adhesion receptors during different modes of migration on various substrates. In neurons, integrin receptors have been implicated in multiple modes of migration, including migration along radial glia, neurophilic chain migration and tangential migration. However, there is still controversy about the exact role and which integrin subunits are required for radial glial-guided neuron migration (Belvindrah et al., 2007a; Belvindrah et al., 2007b; Georges-Labouesse et al., 1998; Marchetti et al., 2010; Schmid et al., 2004). Cell-cell adhesion molecules are important for neuron-radial glia interactions during radial migration, as well as neuron-neuron interactions used in chain migration. For glial-guided migration, receptors as varied as astrotactin, connexins, and CHL1 (Close Homolog of L1) have been proposed to mediate attachment of neurons to radial glial guides (Demyanenko et al., 2004; Edmondson et al., 1988; Elias et al., 2007). Neurons migrating along axons utilize TAG-1, while PSA-NCAM is present on chain migrating neurons (Rousselot et al., 1995). Though specific adhesion receptors may vary depending on the substrate, the fundamental mechanisms regulating their presence on the surface and their activity mediating attachment may still be the same. Different molecular components of adhesion complexes may ultimately converge on the same cytoskeletal signaling pathways

Biochemical and Biomechanical Mechanisms of Adhesion Disassembly

Adhesion disassembly is as important as assembly, because the cycle of attachment at the leading edge and detachment at the rear must be properly regulated for forward movement to occur (Webb et al., 2002). Stronger adhesions at the leading edge of the cell exert tractional forces, while weaker adhesions at the rear of the cell

16 allow the release of the cell body from the substrate. Altering the balance of adhesion affects migratory speed and indeed can determine whether a cell moves at all (Gupton and Waterman-Storer, 2006). Overly weak adhesions fail to provide sufficient traction for forward movement; conversely, overly strong adhesions cause cells to stick to substrates, unable to detach. However, much less focus has been placed on de- adhesion and detachment of the cell rear. Accumulating evidence suggests that adhesion disassembly is not simply a reversal of assembly.

Cells can utilize several mechanisms to detach from substrates at the cell rear. Adhesion complexes can disassemble through biochemical mechanisms such as dissolving or down-regulating the associations among proteins recruited to adhesion complexes (Broussard et al., 2008). For example, calpain can proteolyze talin binding domains that link integrin receptors to the actin cytoskeleton, thus promoting adhesion disassembly (Franco et al., 2004). Recent evidence implicates the recruitment of FAK to nascent adhesion sites in order to abrogate molecular interactions that stabilize integrin-ECM ligation, leading to the maturation and weakening of adhesion complexes (Shan et al., 2009). De-adhesion can also occur through biomechanical mechanisms. In migrating fibroblasts, for example, strong myosin-based contractions break off pieces of membrane, leaving a trail of membranes like “footprints” on the substrate (Palecek et al., 1996; Rid et al., 2005). Alternatively, biomechanical forces arising from the endocytic internalization of adhesion molecules can physically disrupt contacts between an ECM substrate and cell membrane.

Endocytosis and Adhesion in Cell Migration

The membrane is a dynamic cellular organ. Cells utilize regulated methods of membrane internalization for a plethora of functions, including the uptake of growth factors, guidance cues, and neurotransmitter-bound receptors. Endocytosis is an attractive candidate mechanism for adhesion disassembly because endocytic trafficking pathways can be used to recycle adhesion components to aid in the formation of new adhesions elsewhere in the cell. This would also be a convenient

17 method to add new membrane to the front while removing membrane from the rear, another critical process in cell migration. Mark Bretscher proposed decades ago that recycling adhesion receptors from the rear to the front of migrating cells could drive cell migration (Bretscher, 1976, 1996a, b, 2008). While support for the importance of integrin receptor trafficking for cell migration has accumulated over the years, more evidence points to the spatial restriction of integrin recycling at the leading edge rather than whole cell integrin recycling as playing the critical role in migration (Caswell and Norman, 2008; Caswell et al., 2009; Ulrich and Heisenberg, 2009). However, integrin trafficking is involved in the coordination of a variety of important whole cell events, including the polarized activation of Rho GTPase signaling, growth factor signaling, and ECM remodeling, all of which influence cell migration. Endocytosis and recycling of adhesion receptors do appear to be integral in creating a gradient of adhesive strength in migrating cells, as well as triggering adhesion disassembly at the cell rear through mechanisms other than the internalization of adhesion receptors. For example, endosomes targeted toward the rear of migrating osteosarcoma cells activate the Rho- ROCK contractile signaling pathway, which is required for cell rear de-adhesion (Sturge et al., 2006). Future work will likely elucidate precise spatiotemporal regulation of adhesion receptor trafficking dependent on different contexts.

Clathrin-dependent and Clathrin-independent Forms of Endocytosis

Clathrin-mediated endocytosis (CME) is one of the most well-studied forms of membrane internalization (Figure 1.4). Cargo-specific adaptor proteins that bind target molecules at the membrane surface, such as AP2, Dab2 and Numb, recruit clathrin. Classic clathrin triskelia composed of three clathrin heavy chains tightly associated with three clathrin light chains assemble into a lattice that begins to deform the plasma membrane into a coated pit. Dynamin then aids in pinching off the budding coated vesicle, which is internalized and uncoated. Dynamin plays an important role in CME as a master regulator of endocytic vesicle formation (Mettlen et al., 2009). Though first identified as a microtubule-binding motor protein (Shpetner and Vallee, 1989), it has since been suggested that this initial discovery in vitro is not related to dynamin's

18 in vivo function. Dynamin may play a dual role in endocytic vesicle formation: an early regulatory role that aids in the formation of a CCV, and a later mechanochemical role to catalyze membrane fission and the pinching off of the coated vesicle from the membrane.

Though the classic CME pathway has been the predominantly studied form of regulated internalization into cells, there are numerous clathrin-independent forms of endocytosis as well (Conner and Schmid, 2003; Doherty and McMahon, 2009; Mettlen et al., 2009). Caveolae-mediated endocytosis is one of the better-characterized forms of clathrin-independent endocytosis. Caveolae are flask-shaped invaginations of the membrane enriched in caveolin-1. These invaginations also appear to be pinched off from the membrane surface into independent vesicles through dynamin-mediated mechanisms (Doherty and McMahon, 2009).

Endocytosis and Adhesion

Despite the continuing controversy over exactly how membrane trafficking and adhesion regulation are coordinated, it is clear that there is an important role for endocytosis regulating adhesion and directed migration. Clathrin-dependent and clathrin-independent endocytosis are both involved in regulating adhesion disassembly. Caveolae-based internalization of integrins is necessary for proper downstream integrin signaling (Echarri and Del Pozo, 2006; Shi and Sottile, 2008; Wary et al., 1998). A growing number of studies have shown that CME is also involved in adhesion disassembly. Disrupting CME can lead to the persistence of attachments that limit cell motility. In fibroblasts or a fibrosarcoma cell line, preventing either dynamin- or clathrin-dependent endocytosis leads to persistent, large focal adhesions that prevent normal migration (Chao and Kunz, 2009; Ezratty et al., 2009; Ezratty et al., 2005). Integrin trafficking specifically has been shown to be important for cell migration, with integrins being internalized through non-traditional adaptors Numb and Dab2 (Nishimura and Kaibuchi, 2007; Teckchandani et al., 2009).

Different types of cells may use different forms of endocytosis, but it is also possible that individual cells use different forms at distinct subcellular regions to control spatial and temporal dynamics. It may be possible that the exact mechanism used depends on the cell type, context, or perhaps even localized subcellular regions. Different forms of endocytosis can be restricted in polarized regions of a cell (Sandvig et al., 2008). For example, MDCK cells with distinct apical and basal polarity have caveolae present only on their basal surface (Verkade et al., 2000; Vogel et al., 1998). Caveolae also appear to be polarized in migrating immortalized neurons, though caveolin-1 was present either in the leading process or the rear depending on the type of migration investigated (Lentini et al., 2008). During transmigration through a filter, caveolae were present in the leading process, but polarized cells in a 2D wound- healing assay showed the presence of caveolin-1 at the cell rear, opposite immunolocalized Golgi apparatus. These studies highlight the incredible flexibility of cellular processes to adapt to different contexts.

Redundancy and flexibility in internalization routes is further highlighted by the lack of phenotypes in mice mutant for various molecules thought to be critical in different forms of endocytosis. Endocytosis is important and critically involved in a number of different processes but both caveolin and dynamin 1 mutants appear grossly normal (Ferguson et al., 2007; Le Lay and Kurzchalia, 2005). Their phenotypes are noticeable only when directly challenged. Lack of serious phenotypes in these mutant mice supports the idea that different types of endocytosis can compensate for each other. Additional evidence that different forms of endocytosis can compensate for each other comes from studies using HeLa cells expressing a temperature-sensitive mutant of dynamin; though endocytosis is inhibited after a shift to the non-permissive temperature, it is restored after only 30-60 min by a clathrin- and dynamin- independent mechanism (Damke 1995). It is unclear what these alternative endocytic pathways are or what leads to their upregulation. Thus, teasing apart the exact role of different forms of endocytosis in the normal regulation of cellular processes can be complicated by the flexibility of cells to adapt to disruption.

Endocytosis in Migrating Neurons In neurons, growth cone motility and axon elongation require endocytosis of L1 adhesion molecules for de-adhesion (Kamiguchi, 2003). A neuronal specific L1 isoform can potentiate migration in HEK293 or B35 cells through an interaction with β1 integrins (Panicker et al, 2006; Thelen et al., 2002). However, this potentiation also requires clathrin and dynamin function, providing another link between adhesion and endocytosis specifically in neurons. Both histological and functional evidence points to an important but poorly understood role for endocytosis in adhesion regulation in migrating neurons. Electron micrographs show that clathrin coated vesicles (CCVs) are situated near adhesive contact points in neurons migrating in different modes. Cerebellar granule neurons migrating along radial glia have CCVs near sites of contact between the two cells (Gregory et al., 1988; Yuasa et al., 1996), and neurons migrating in chains toward the olfactory bulb exhibit CCVs near adherens junctions (Doetsch et al., 1997). Several genes that are critical for cortical neuron migration are associated with proteins implicated in endocytosis or adhesion. As mentioned earlier in the chapter, RNAi- mediated knock-down of the microtubule-associated protein Doublecortin (Dcx) disrupts radial migration in the cortex (Bai et al., 2003). While Dcx is involved in regulating the microtubule cytoskeleton in migrating neurons, it also interacts with the µ1 subunit of the AP-1 clathrin adaptor complex, suggesting a potential role in endocytosis (Friocourt et al., 2001). Knock-down of the dyslexia-associated protein KIAA0319 disrupts radial migration as well. KIAA0319 has domains suggesting a role in adhesion, and recently its protein product was shown to interact with the clathrin adaptor AP-2 and follow a clathrin-mediated endocytosis pathway (Levecque et al., 2009; Paracchini et al., 2006). Disruptions in Disabled-1 (Dab1), a protein related to the clathrin adaptor Disabled-2 (Dab2), in Scrambler mutant mice lead to improper cortical migration due to an inability of cortical neurons to detach from their radial glial guide (Sanada et al., 2004). Dab1 acts via the Reelin pathway to regulate radial migration, potentially by binding to clathrin adaptors such as AP-2 and affecting the internalization and recycling of the Reelin receptors VLDLR and APOE-R2

(Homayouni et al., 1999). Recent studies suggest that Dab2 is involved in integrin internalization and trafficking in migrating HeLa cells (Teckchandani et al., 2009). A recent study shows that dynamin plays a role in somal translocation of serotonergic neurons (Hawthorne et al., 2010). Inhibiting dynamin with the small molecule inhibitor dynasore slows migration velocity dramatically. This is consistent with my own work, which further examines dynamin and clathrin function in migrating neurons. In migrating cerebellar granule neurons, CME appears to play a role in BDNF internalization and establishing polarity. Zhou et al. (2007) show that granule neurons in slice culture do not orient or migrate properly when dynamin is disrupted. Similarly, they do not appropriately respond to a BDNF gradient if CME is blocked in vitro. Establishing polarity rather than regulating adhesion could be considered an alternate role for endocytosis in migrating neurons. However, it could also be complementary to the hypothesis that endocytosis is involved in regulating adhesion, because polarity is tightly linked to the coordination of the cytoskeleton, including adhesion. Internalization of growth factors and guidance cues could trigger the appropriate trafficking of adhesion molecules such that they are moved toward the guidance cue and removed from other locations to permit retraction of extraneous processes or movement of the cell soma. Indeed, cell adhesion molecules L1 and integrin β1 activate a common intracellular signaling pathway involving c-Src, PI3K, Rac1, PAK1, MEK, ERK1/2, which converges with growth factor signaling pathways (Schmid and Maness, 2008). The complex process of neuronal migration requires the coordination of guidance cue internalization, polarization, and cytoskeletal remodeling, including adhesion regulation, all of which may be linked through endocytic trafficking.

Contributions of this Dissertation

The work described in this dissertation evolved from the accumulating circumstantial evidence for endocytosis playing a critical role in neuronal migration and a need to more fully understand and describe basic cellular mechanisms that

22 contribute to normal migration. Though we can learn a great deal from what is already known about the control of adhesion in model migratory cells, the unique morphology and mode by which neurons migrate suggests that it is important to directly examine these processes in migrating neurons. In this dissertation, I provide evidence that endocytosis is critical for the proper regulation of neuronal migration. Examining the effects of blocking the function of proteins necessary for proper clathrin-mediated endocytosis reveals that radial migration in vivo requires endocytosis. Complementary in vitro studies suggest that endocytosis during migration is involved in properly regulating adhesion. Adding to the evidence that endocytosis regulates large focal adhesion complexes in cells migrating in 2D, I show that endocytosis also affects smaller adhesion points for 3D migration.

References Anderson, S.A., Kaznowski, C.E., Horn, C., Rubenstein, J.L., and McConnell, S.K. (2002). Distinct origins of neocortical projection neurons and interneurons in vivo. Cereb Cortex 12, 702-709.

Ang, E.S., Jr., Haydar, T.F., Gluncic, V., and Rakic, P. (2003). Four-dimensional migratory coordinates of GABAergic interneurons in the developing mouse cortex. J Neurosci 23, 5805-5815.

Asada, N., Sanada, K., and Fukada, Y. (2007). LKB1 regulates neuronal migration and neuronal differentiation in the developing neocortex through centrosomal positioning. J Neurosci 27, 11769-11775.

Ayala, R., Shu, T., and Tsai, L.H. (2007). Trekking across the brain: the journey of neuronal migration. Cell 128, 29-43.

Bai, J., Ramos, R.L., Ackman, J.B., Thomas, A.M., Lee, R.V., and LoTurco, J.J. (2003). RNAi reveals doublecortin is required for radial migration in rat neocortex. Nat Neurosci 6, 1277-1283.

Ballestrem, C., Hinz, B., Imhof, B.A., and Wehrle-Haller, B. (2001). Marching at the front and dragging behind: differential alphaVbeta3-integrin turnover regulates focal adhesion behavior. J Cell Biol 155, 1319-1332.

Barnes, A.P., Lilley, B.N., Pan, Y.A., Plummer, L.J., Powell, A.W., Raines, A.N., Sanes, J.R., and Polleux, F. (2007). LKB1 and SAD kinases define a pathway required for the polarization of cortical neurons. Cell 129, 549-563.

Bellion, A., Baudoin, J.P., Alvarez, C., Bornens, M., and Metin, C. (2005). Nucleokinesis in tangentially migrating neurons comprises two alternating phases: forward migration of the Golgi/centrosome associated with centrosome splitting and myosin contraction at the rear. J Neurosci 25, 5691-5699.

Belvindrah, R., Graus-Porta, D., Goebbels, S., Nave, K.A., and Muller, U. (2007a). Beta1 integrins in radial glia but not in migrating neurons are essential for the formation of cell layers in the cerebral cortex. J Neurosci 27, 13854-13865.

Belvindrah, R., Hankel, S., Walker, J., Patton, B.L., and Muller, U. (2007b). Beta1 integrins control the formation of cell chains in the adult rostral migratory stream. J Neurosci 27, 2704-2717.

Beningo, K.A., Dembo, M., Kaverina, I., Small, J.V., and Wang, Y.L. (2001). Nascent focal adhesions are responsible for the generation of strong propulsive forces in migrating fibroblasts. J Cell Biol 153, 881-888.

Bretscher, M.S. (1976). Directed lipid flow in cell membranes. Nature 260, 21-23.

Bretscher, M.S. (1996a). Getting membrane flow and the cytoskeleton to cooperate in moving cells. Cell 87, 601-606.

Bretscher, M.S. (1996b). Moving membrane up to the front of migrating cells. Cell 85, 465-467.

Bretscher, M.S. (2008). On the shape of migrating cells--a 'front-to-back' model. Journal of cell science 121, 2625-2628.

Brose, K., and Tessier-Lavigne, M. (2000). Slit proteins: key regulators of axon guidance, axonal branching, and cell migration. Curr Opin Neurobiol 10, 95-102.

Broussard, J.A., Webb, D.J., and Kaverina, I. (2008). Asymmetric focal adhesion disassembly in motile cells. Curr Opin Cell Biol 20, 85-90.

Bystron, I., Blakemore, C., and Rakic, P. (2008). Development of the human cerebral cortex: Boulder Committee revisited. Nat Rev Neurosci 9, 110-122.

Cariboni, A., Maggi, R., and Parnavelas, J.G. (2007). From nose to fertility: the long migratory journey of gonadotropin-releasing hormone neurons. Trends Neurosci 30, 638-644.

Caswell, P., and Norman, J. (2008). Endocytic transport of integrins during cell migration and invasion. Trends Cell Biol 18, 257-263.

Caswell, P.T., Vadrevu, S., and Norman, J.C. (2009). Integrins: masters and slaves of endocytic transport. Nature reviews 10, 843-853.

Chao, W.T., and Kunz, J. (2009). Focal adhesion disassembly requires clathrin- dependent endocytosis of integrins. FEBS Lett 583, 1337-1343.

Chen, G., Sima, J., Jin, M., Wang, K.Y., Xue, X.J., Zheng, W., Ding, Y.Q., and Yuan, X.B. (2008). Semaphorin-3A guides radial migration of cortical neurons during development. Nat Neurosci 11, 36-44.

Conner, S.D., and Schmid, S.L. (2003). Regulated portals of entry into the cell. Nature 422, 37-44.

DeMali, K.A., Barlow, C.A., and Burridge, K. (2002). Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J Cell Biol 159, 881-891.

Demyanenko, G.P., Schachner, M., Anton, E., Schmid, R., Feng, G., Sanes, J., and Maness, P.F. (2004). Close homolog of L1 modulates area-specific neuronal positioning and dendrite orientation in the cerebral cortex. Neuron 44, 423-437.

Denaxa, M., Chan, C.H., Schachner, M., Parnavelas, J.G., and Karagogeos, D. (2001). The adhesion molecule TAG-1 mediates the migration of cortical interneurons from the ganglionic eminence along the corticofugal fiber system. Development 128, 4635- 4644.

Deuel, T.A., Liu, J.S., Corbo, J.C., Yoo, S.Y., Rorke-Adams, L.B., and Walsh, C.A. (2006). Genetic interactions between doublecortin and doublecortin-like kinase in neuronal migration and axon outgrowth. Neuron 49, 41-53.

Doetsch, F., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1997). Cellular composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J Neurosci 17, 5046-5061.

Doherty, G.J., and McMahon, H.T. (2009). Mechanisms of endocytosis. Annu Rev Biochem 78, 857-902.

Echarri, A., and Del Pozo, M.A. (2006). Caveolae Internalization Regulates Integrin- Dependent Signaling Pathways. Cell Cycle 5.

Edmondson, J.C., and Hatten, M.E. (1987). Glial-guided granule neuron migration in vitro: a high resolution time-lapse video microscopic study. J. Neurosci. 7, 1928- 1934.

Edmondson, J.C., Liem, R.K.H., Kuster, J.E., and Hatten, M.E. (1988). Astrotactin: A novel neuronal cell surface antigen that mediates neuron-astroglial interactions in cerebellar microcultures. J. Cell Biol. 106, 505-517.

Elias, L.A., Wang, D.D., and Kriegstein, A.R. (2007). Gap junction adhesion is necessary for radial migration in the neocortex. Nature 448, 901-907.

Ezratty, E.J., Bertaux, C., Marcantonio, E.E., and Gundersen, G.G. (2009). Clathrin mediates integrin endocytosis for focal adhesion disassembly in migrating cells. J Cell Biol 187, 733-747.

Ezratty, E.J., Partridge, M.A., and Gundersen, G.G. (2005). Microtubule-induced focal adhesion disassembly is mediated by dynamin and focal adhesion kinase. Nat Cell Biol 7, 581-590.

Fatemi, S.H., and Folsom, T.D. (2009). The neurodevelopmental hypothesis of schizophrenia, revisited. Schizophr Bull 35, 528-548.

Ferguson, S.M., Brasnjo, G., Hayashi, M., Wolfel, M., Collesi, C., Giovedi, S., Raimondi, A., Gong, L.W., Ariel, P., Paradise, S., et al. (2007). A selective activity- dependent requirement for dynamin 1 in synaptic vesicle endocytosis. Science 316, 570-574.

Fox, J.W., Lamperti, E.D., Eksioglu, Y.Z., Hong, S.E., Feng, Y., Graham, D.A., Scheffer, I.E., Dobyns, W.B., Hirsch, B.A., Radtke, R.A., et al. (1998). Mutations in filamin 1 prevent migration of cerebral cortical neurons in human periventricular heterotopia. Neuron 21, 1315-1325.

Franco, S.J., Rodgers, M.A., Perrin, B.J., Han, J., Bennin, D.A., Critchley, D.R., and Huttenlocher, A. (2004). Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol 6, 977-983.

Friocourt, G., Chafey, P., Billuart, P., Koulakoff, A., Vinet, M.C., Schaar, B.T., McConnell, S.K., Francis, F., and Chelly, J. (2001). Doublecortin interacts with mu subunits of clathrin adaptor complexes in the developing nervous system. Molecular and cellular neurosciences 18, 307-319.

Gasser, U.E., and Hatten, M.E. (1990). CNS neurons migrate on astroglial fibers from heterotypic brain regions in vitro. Proc. Natl. Acad. Sci. USA 87, 4543-4547.

Georges-Labouesse, E., Mark, M., Messaddeq, N., and Gansmuller, A. (1998). Essential role of alpha 6 integrins in cortical and retinal lamination. Curr Biol 8, 983- 986.

Gershon, E.S., and Rieder, R.O. (1992). Major disorders of mind and brain. Sci. Am. 267, 127-133.

Gregory, W.A., Edmondson, J.C., Hatten, M.E., and Mason, C.A. (1988). Cytology and neuron-glial apposition of migrating cerebellar granule cells in vitro. J Neurosci 8, 1728-1738.

Guerrier, S., Coutinho-Budd, J., Sassa, T., Gresset, A., Jordan, N.V., Chen, K., Jin, W.L., Frost, A., and Polleux, F. (2009). The F-BAR domain of srGAP2 induces membrane protrusions required for neuronal migration and morphogenesis. Cell 138, 990-1004.

Gupta, A., Sanada, K., Miyamoto, D.T., Rovelstad, S., Nadarajah, B., Pearlman, A.L., Brunstrom, J., and Tsai, L.H. (2003). Layering defect in p35 deficiency is linked to improper neuronal-glial interaction in radial migration. Nat Neurosci 6, 1284-1291.

Gupton, S.L., and Waterman-Storer, C.M. (2006). Spatiotemporal feedback between actomyosin and focal-adhesion systems optimizes rapid cell migration. Cell 125, 1361-1374.

Hatten, M.E. (1999). Central nervous system neuronal migration. Annu Rev Neurosci 22, 511-539.

Hawthorne, A.L., Wylie, C.J., Landmesser, L.T., Deneris, E.S., and Silver, J. (2010). Serotonergic neurons migrate radially through the neuroepithelium by dynamin- mediated somal translocation. J Neurosci 30, 420-430.

Higginbotham, H.R., and Gleeson, J.G. (2007). The centrosome in neuronal development. Trends Neurosci 30, 276-283.

Homayouni, R., Rice, D.S., Sheldon, M., and Curran, T. (1999). Disabled-1 binds to the cytoplasmic domain of amyloid precursor-like protein 1. J Neurosci 19, 7507- 7515.

Kappeler, C., Saillour, Y., Baudoin, J.P., Tuy, F.P., Alvarez, C., Houbron, C., Gaspar, P., Hamard, G., Chelly, J., Metin, C., and Francis, F. (2006). Branching and nucleokinesis defects in migrating interneurons derived from doublecortin knockout mice. Hum Mol Genet 15, 1387-1400.

Katz, B.Z., Zamir, E., Bershadsky, A., Kam, Z., Yamada, K.M., and Geiger, B. (2000). Physical state of the extracellular matrix regulates the structure and molecular composition of cell-matrix adhesions. Molecular biology of the cell 11, 1047-1060.

Kawaji, K., Umeshima, H., Eiraku, M., Hirano, T., and Kengaku, M. (2004). Dual phases of migration of cerebellar granule cells guided by axonal and dendritic leading processes. Molecular and cellular neurosciences 25, 228-240.

Koizumi, H., Higginbotham, H., Poon, T., Tanaka, T., Brinkman, B.C., and Gleeson, J.G. (2006a). Doublecortin maintains bipolar shape and nuclear translocation during migration in the adult forebrain. Nat Neurosci 9, 779-786.

Koizumi, H., Tanaka, T., and Gleeson, J.G. (2006b). Doublecortin-like kinase functions with doublecortin to mediate fiber tract decussation and neuronal migration. Neuron 49, 55-66.

Kwiatkowski, A.V., Rubinson, D.A., Dent, E.W., Edward van Veen, J., Leslie, J.D., Zhang, J., Mebane, L.M., Philippar, U., Pinheiro, E.M., Burds, A.A., et al. (2007). Ena/VASP Is Required for neuritogenesis in the developing cortex. Neuron 56, 441- 455.

Lauffenburger, D.A., and Horwitz, A.F. (1996). Cell migration: a physically integrated molecular process. Cell 84, 359-369.

Le Lay, S., and Kurzchalia, T.V. (2005). Getting rid of caveolins: phenotypes of caveolin-deficient animals. Biochim Biophys Acta 1746, 322-333.

Lentini, D., Guzzi, F., Pimpinelli, F., Zaninetti, R., Cassetti, A., Coco, S., Maggi, R., and Parenti, M. (2008). Polarization of caveolins and caveolae during migration of immortalized neurons. J Neurochem 104, 514-523.

Levecque, C., Velayos-Baeza, A., Holloway, Z.G., and Monaco, A.P. (2009). The dyslexia-associated protein KIAA0319 interacts with adaptor protein 2 and follows the classical clathrin-mediated endocytosis pathway. Am J Physiol Cell Physiol 297, C160-168.

Ma, X., Kawamoto, S., Hara, Y., and Adelstein, R.S. (2004). A point mutation in the motor domain of nonmuscle myosin II-B impairs migration of distinct groups of neurons. Molecular biology of the cell 15, 2568-2579.

Manitt, C., and Kennedy, T.E. (2002). Where the rubber meets the road: netrin expression and function in developing and adult nervous systems. Prog Brain Res 137, 425-442.

Marchetti, G., Escuin, S., van der Flier, A., De Arcangelis, A., Hynes, R.O., and Georges-Labouesse, E. (2010). Integrin alpha5beta1 is necessary for regulation of radial migration of cortical neurons during mouse brain development. Eur J Neurosci.

Marin, O., and Rubenstein, J.L. (2001). A long, remarkable journey: tangential migration in the telencephalon. Nat Rev Neurosci 2, 780-790.

Marin, O., and Rubenstein, J.L. (2003). Cell migration in the forebrain. Annu Rev Neurosci 26, 441-483.

Martini, F.J., Valiente, M., Lopez Bendito, G., Szabo, G., Moya, F., Valdeolmillos, M., and Marin, O. (2009). Biased selection of leading process branches mediates chemotaxis during tangential neuronal migration. Development 136, 41-50.

McConnell, S.K. (1995). Constructing the cerebral cortex: neurogenesis and fate determination. Neuron 15, 761-768.

McManus, M.F., and Golden, J.A. (2005). Neuronal migration in developmental disorders. Journal of child neurology 20, 280-286.

McManus, M.F., Nasrallah, I.M., Gopal, P.P., Baek, W.S., and Golden, J.A. (2004). Axon mediated interneuron migration. J Neuropathol Exp Neurol 63, 932-941.

Mettlen, M., Pucadyil, T., Ramachandran, R., and Schmid, S.L. (2009). Dissecting dynamin's role in clathrin-mediated endocytosis. Biochem Soc Trans 37, 1022-1026.

Nadarajah, B., Alifragis, P., Wong, R.O., and Parnavelas, J.G. (2002). Ventricle- directed migration in the developing cerebral cortex. Nat Neurosci 5, 218-224.

Nadarajah, B., Brunstrom, J.E., Grutzendler, J., Wong, R.O., and Pearlman, A.L. (2001). Two modes of radial migration in early development of the cerebral cortex. Nat Neurosci 4, 143-150.

Nadarajah, B., and Parnavelas, J.G. (2002). Modes of neuronal migration in the developing cerebral cortex. Nat Rev Neurosci 3, 423-432.

Nagano, T., Morikubo, S., and Sato, M. (2004). Filamin A and FILIP (Filamin A- Interacting Protein) regulate cell polarity and motility in neocortical subventricular and intermediate zones during radial migration. J Neurosci 24, 9648-9657.

Nishimura, T., and Kaibuchi, K. (2007). Numb controls integrin endocytosis for directional cell migration with aPKC and PAR-3. Developmental cell 13, 15-28.

O'Rourke, N.A., Chenn, A., and McConnell, S.K. (1997). Postmitotic neurons migrate tangentially in the cortical ventricular zone. Development 124, 997-1005.

O'Rourke, N.A., Dailey, M.E., Smith, S.J., and McConnell, S.K. (1992). Diverse migratory pathways in the developing cerebral cortex. Science 258, 299-302.

Ohshima, T., Hirasawa, M., Tabata, H., Mutoh, T., Adachi, T., Suzuki, H., Saruta, K., Iwasato, T., Itohara, S., Hashimoto, M., et al. (2007). Cdk5 is required for multipolar- to-bipolar transition during radial neuronal migration and proper dendrite development of pyramidal neurons in the cerebral cortex. Development 134, 2273-2282.

Palecek, S.P., Schmidt, C.E., Lauffenburger, D.A., and Horwitz, A.F. (1996). Integrin dynamics on the tail region of migrating fibroblasts. Journal of cell science 109 ( Pt 5), 941-952.

Paracchini, S., Thomas, A., Castro, S., Lai, C., Paramasivam, M., Wang, Y., Keating, B.J., Taylor, J.M., Hacking, D.F., Scerri, T., et al. (2006). The chromosome 6p22 haplotype associated with dyslexia reduces the expression of KIAA0319, a novel gene involved in neuronal migration. Hum Mol Genet 15, 1659-1666.

Partridge, M.A., and Marcantonio, E.E. (2006). Initiation of attachment and generation of mature focal adhesions by integrin-containing filopodia in cell spreading. Molecular biology of the cell 17, 4237-4248.

Rakic, P. (1972). Mode of cell migration to the superficial layers of fetal monkey neocortex. J Comp Neurol 145, 61-83.

Rakic, P., Ayoub, A.E., Breunig, J.J., and Dominguez, M.H. (2009). Decision by division: making cortical maps. Trends Neurosci 32, 291-301.

Reiner, O., Carrozzo, R., Shen, Y., Wehnert, M., Faustinella, F., Dobyns, W.B., Caskey, C.T., and Ledbetter, D.H. (1993). Isolation of a Miller-Dieker lissencephaly gene containing G protein beta-subunit-like repeats. Nature 364, 717-721.

Renaudin, A., Lehmann, M., Girault, J., and McKerracher, L. (1999). Organization of point contacts in neuronal growth cones. J Neurosci Res 55, 458-471.

Rid, R., Schiefermeier, N., Grigoriev, I., Small, J.V., and Kaverina, I. (2005). The last but not the least: the origin and significance of trailing adhesions in fibroblastic cells. Cell Motil Cytoskeleton 61, 161-171.

Ridley, A.J., Schwartz, M.A., Burridge, K., Firtel, R.A., Ginsberg, M.H., Borisy, G., Parsons, J.T., and Horwitz, A.R. (2003). Cell migration: integrating signals from front to back. Science 302, 1704-1709.

Rousselot, P., Lois, C., and Alvarez-Buylla, A. (1995). Embryonic (PSA) N-CAM reveals chains of migrating neuroblasts between the lateral ventricle and the olfactory bulb of adult mice. J Comp Neurol 351, 51-61.

Saghatelyan, A. (2009). Role of blood vessels in the neuronal migration. Semin Cell Dev Biol 20, 744-750.

Sanada, K., Gupta, A., and Tsai, L.H. (2004). Disabled-1-regulated adhesion of migrating neurons to radial glial fiber contributes to neuronal positioning during early corticogenesis. Neuron 42, 197-211.

Sandvig, K., Torgersen, M.L., Raa, H.A., and van Deurs, B. (2008). Clathrin- independent endocytosis: from nonexisting to an extreme degree of complexity. Histochem Cell Biol 129, 267-276.

Sapir, T., Elbaum, M., and Reiner, O. (1997). Reduction of microtubule catastrophe events by LIS1, platelet-activating factor acetylhydrolase subunit. EMBO J 16, 6977- 6984.

Sarkisian, M.R., Bartley, C.M., and Rakic, P. (2008). Trouble making the first move: interpreting arrested neuronal migration in the cerebral cortex. Trends Neurosci 31, 54-61.

Sasaki, S., Mori, D., Toyo-oka, K., Chen, A., Garrett-Beal, L., Muramatsu, M., Miyagawa, S., Hiraiwa, N., Yoshiki, A., Wynshaw-Boris, A., and Hirotsune, S. (2005). Complete loss of Ndel1 results in neuronal migration defects and early embryonic lethality. Mol Cell Biol 25, 7812-7827.

Sastry, S.K., and Burridge, K. (2000). Focal adhesions: a nexus for intracellular signaling and cytoskeletal dynamics. Experimental cell research 261, 25-36.

Schaar, B.T., and McConnell, S.K. (2005). Cytoskeletal coordination during neuronal migration. Proceedings of the National Academy of Sciences of the United States of America 102, 13652-13657.

Schmid, R.S., and Maness, P.F. (2008). L1 and NCAM adhesion molecules as signaling coreceptors in neuronal migration and process outgrowth. Curr Opin Neurobiol 18, 245-250.

Schmid, R.S., Shelton, S., Stanco, A., Yokota, Y., Kreidberg, J.A., and Anton, E.S. (2004). alpha3beta1 integrin modulates neuronal migration and placement during early stages of cerebral cortical development. Development 131, 6023-6031.

Shan, Y., Yu, L., Li, Y., Pan, Y., Zhang, Q., Wang, F., Chen, J., and Zhu, X. (2009). Nudel and FAK as antagonizing strength modulators of nascent adhesions through paxillin. PLoS Biol 7, e1000116.

Shastry, B.S. (2007). Developmental dyslexia: an update. J Hum Genet 52, 104-109.

Shi, F., and Sottile, J. (2008). Caveolin-1-dependent beta1 integrin endocytosis is a critical regulator of fibronectin turnover. Journal of cell science 121, 2360-2371.

Shpetner, H.S., and Vallee, R.B. (1989). Identification of dynamin, a novel mechanochemical enzyme that mediates interactions between microtubules. Cell 59, 421-432.

Shu, T., Ayala, R., Nguyen, M.D., Xie, Z., Gleeson, J.G., and Tsai, L.H. (2004). Ndel1 operates in a common pathway with LIS1 and cytoplasmic dynein to regulate cortical neuronal positioning. Neuron 44, 263-277.

Solecki, D.J., Model, L., Gaetz, J., Kapoor, T.M., and Hatten, M.E. (2004). Par6alpha signaling controls glial-guided neuronal migration. Nat Neurosci 7, 1195-1203.

Solecki, D.J., Trivedi, N., Govek, E.E., Kerekes, R.A., Gleason, S.S., and Hatten, M.E. (2009). Myosin II motors and F-actin dynamics drive the coordinated movement of the centrosome and soma during CNS glial-guided neuronal migration. Neuron 63, 63-80.

Sturge, J., Wienke, D., and Isacke, C.M. (2006). Endosomes generate localized Rho- ROCK-MLC2-based contractile signals via Endo180 to promote adhesion disassembly. J Cell Biol.

Tabata, H., Kanatani, S., and Nakajima, K. (2009). Differences of migratory behavior between direct progeny of apical progenitors and basal progenitors in the developing cerebral cortex. Cereb Cortex 19, 2092-2105.

Tabata, H., and Nakajima, K. (2003). Multipolar migration: the third mode of radial neuronal migration in the developing cerebral cortex. J Neurosci 23, 9996-10001.

Tanaka, T., Serneo, F.F., Higgins, C., Gambello, M.J., Wynshaw-Boris, A., and Gleeson, J.G. (2004). Lis1 and doublecortin function with dynein to mediate coupling of the nucleus to the centrosome in neuronal migration. J Cell Biol 165, 709-721.

Teckchandani, A., Toida, N., Goodchild, J., Henderson, C., Watts, J., Wollscheid, B., and Cooper, J.A. (2009). Quantitative proteomics identifies a Dab2/integrin module regulating cell migration. J Cell Biol 186, 99-111.

Tessier-Lavigne, M., and Goodman, C.S. (1996). The molecular biology of axon guidance. Science 274, 1123-1133.

Tsai, L.H., and Gleeson, J.G. (2005). Nucleokinesis in neuronal migration. Neuron 46, 383-388.

Tullio, A.N., Bridgman, P.C., Tresser, N.J., Chan, C.C., Conti, M.A., Adelstein, R.S., and Hara, Y. (2001). Structural abnormalities develop in the brain after ablation of the gene encoding nonmuscle myosin II-B heavy chain. J Comp Neurol 433, 62-74.

Turner, C.E. (2000). Paxillin and focal adhesion signalling. Nat Cell Biol 2, E231-236.

Ulrich, F., and Heisenberg, C.P. (2009). Trafficking and cell migration. Traffic (Copenhagen, Denmark) 10, 811-818.

Valcanis, H., and Tan, S.S. (2003). Layer specification of transplanted interneurons in developing mouse neocortex. J Neurosci 23, 5113-5122.

Verkade, P., Harder, T., Lafont, F., and Simons, K. (2000). Induction of caveolae in the apical plasma membrane of Madin-Darby canine kidney cells. J Cell Biol 148, 727-739.

Vicente-Manzanares, M., Choi, C.K., and Horwitz, A.R. (2009). Integrins in cell migration--the actin connection. Journal of cell science 122, 199-206.

Vicente-Manzanares, M., Webb, D.J., and Horwitz, A.R. (2005). Cell migration at a glance. Journal of cell science 118, 4917-4919.

Vicente-Manzanares, M., Zareno, J., Whitmore, L., Choi, C.K., and Horwitz, A.F. (2007). Regulation of protrusion, adhesion dynamics, and polarity by myosins IIA and IIB in migrating cells. J Cell Biol 176, 573-580.

Vogel, U., Sandvig, K., and van Deurs, B. (1998). Expression of caveolin-1 and polarized formation of invaginated caveolae in Caco-2 and MDCK II cells. Journal of cell science 111 ( Pt 6), 825-832.

Ward, M.E., Jiang, H., and Rao, Y. (2005). Regulated formation and selection of neuronal processes underlie directional guidance of neuronal migration. Molecular and cellular neurosciences 30, 378-387.

Wary, K.K., Mariotti, A., Zurzolo, C., and Giancotti, F.G. (1998). A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell 94, 625-634.

Webb, D.J., Brown, C.M., and Horwitz, A.F. (2003). Illuminating adhesion complexes in migrating cells: moving toward a bright future. Curr Opin Cell Biol 15, 614-620.

Webb, D.J., Parsons, J.T., and Horwitz, A.F. (2002). Adhesion assembly, disassembly and turnover in migrating cells -- over and over and over again. Nat Cell Biol 4, E97- 100.

Wichterle, H., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1997). Direct evidence for homotypic, glia-independent neuronal migration. Neuron 18, 779-791.

Xie, Z., Sanada, K., Samuels, B.A., Shih, H., and Tsai, L.H. (2003). Serine 732 phosphorylation of FAK by Cdk5 is important for microtubule organization, nuclear movement, and neuronal migration. Cell 114, 469-482.

Yamada, M., Toba, S., Takitoh, T., Yoshida, Y., Mori, D., Nakamura, T., Iwane, A.H., Yanagida, T., Imai, H., Yu-Lee, L.Y., et al. (2010). mNUDC is required for plus-end- directed transport of cytoplasmic dynein and dynactins by kinesin-1. EMBO J 29, 517- 531.

Yoshida, K., Tobet, S.A., Crandall, J.E., Jimenez, T.P., and Schwarting, G.A. (1995). The migration of luteinizing hormone-releasing hormone neurons in the developing rat is associated with a transient, caudal projection of the vomeronasal nerve. J Neurosci 15, 7769-7777.

Yuasa, S., Kawamura, K., Kuwano, R., and Ono, K. (1996). Neuron-glia interrelations during migration of Purkinje cells in the mouse embryonic cerebellum. Int J Dev Neurosci 14, 429-438.

Zamir, E., and Geiger, B. (2001). Molecular complexity and dynamics of cell-matrix adhesions. Journal of cell science 114, 3583-3590.

Zamir, E., Katz, B.Z., Aota, S., Yamada, K.M., Geiger, B., and Kam, Z. (1999). Molecular diversity of cell-matrix adhesions. Journal of cell science 112 ( Pt 11), 1655-1669.

Zhang, X., Lei, K., Yuan, X., Wu, X., Zhuang, Y., Xu, T., Xu, R., and Han, M. (2009). SUN1/2 and Syne/Nesprin-1/2 complexes connect centrosome to the nucleus during neurogenesis and neuronal migration in mice. Neuron 64, 173-187.

Figure 1.1 The developing cerebral cortex is organized both horizontally and vertically. (A) Morphogenetic patterning centers establish cortical areas in the horizontal plane of the developing cortex. (B) The developing cortex contains vertical laminar zones from the ventricular to the pial surface. Radial glial progenitors undergo interkinetic nuclear migrations in the ventricular zone (VZ), where they can give birth to more progenitors that will continue to divide in the VZ, intermediate progenitors that establish the subventricular zone (SVZ), or newly post-mitotic neurons that will migrate out of the VZ. Neurons undergo multipolar migration in the intermediate zone (IZ), the future white matter, before continuing toward the pial surface to establish the mature six-layered cortical plate (CP).

41 Pia A B

Cortical Plate

42 Intermediate Zone

FGF8 Subventricular Wnts and BMPs Zone EGFs

Ventricular Zone

Ventricle Figure 1.2 Neurons migrate using multiple modes. (A) Neuronal migration in the cortex can be grossly categorized as radial or tangential. Radially migrating neurons in the cortex move from ventricular surface to pial surface. Tangential migration can describe the movements of interneurons from the ganglionic eminence (LGE = lateral ganglionic eminence, MGE = medial ganglionic eminence) migrating perpendicular to radial glia, as well as neurons migrating anteriorly to the olfactory bulb. (B) Radial migration can be further characterized as multipolar migration (1), glial-guided locomotion (2), or somal translocation (3).

43 A B radial

tangential

1 44 LGE

MGE

to olfactory bulb Figure 1.3 A model for cytoskeletal coordination during cycles of saltatory neuronal migration. The leading process forms adhesive contacts (blue) with its substrate as it extends. After leading process extension, a cytoplasmic dilation forms just ahead of the cell nucleus (black). Before nucleokinesis, the centrosome (red dot) moves into the forming dilation. Microtubules (red lines) within the cell soma form longitudinal arrays, along which the nucleus translocates. Myosin II (yellow) contractions appear to generate a pushing force on the nucleus and may also serve to break adhesions at the cell rear. The nucleus ends up in the former dilation where it pauses as the leading process extends again, starting the next cycle of migration. Reprinted from Schaar and McConnell (2005), PNAS 102 (38), Copyright (2005) National Academy of Sciences, U.S.A.

46 Figure 1.4 Clathrin-mediated endocytosis may be used to internalize adhesion receptors. (1) Cargo-specific adaptor molecules, such as AP-2 or Dab2, bind to target molecules on the membrane surface, and attract clathrin. (2) The membrane begins to invaginate as the clathrin coat forms on the intracellular surface, creating a clathrin coated pit (CCP). (3) A clathrin coated vesicle (CCV) with membrane-bound receptors is pinched off with the aid of dynamin. (4) The internalized CCV will quickly become uncoated. The internalized endosome can then continue on through the endosomal pathway so the internalized receptors are either recycled back to the membrane surface or degraded.

47 1

ββ ββ 2 ββ β

β β

β β β

β β 3 ββ

β β

β ββ Adaptor ECM substrate Clathrin Adhesion Dynamin ββ Receptor

48 CHAPTER 2: ENDOCYTOSIS IS CRITICAL FOR NEURONAL MIGRATION

Preface

Work described in this chapter was performed in collaboration with a former post-doc in the lab, Bruce Schaar. He collected the electron micrographs and contributed experimental advice. Shalu Srinivasan performed the in utero electroporation surgeries and Chris Kaznowski assisted with sectioning. JCS collected all non-EM data and analyzed all data. Figures and text were created by JCS and SKM. Parts of this chapter have been submitted as a manuscript to Neuron for consideration as: Shieh JC, Schaar BT, and McConnell SK (2009) Endocytosis regulates cell soma translocation and the distribution of adhesion proteins in migrating neurons.

Summary

Newborn neurons migrate from their birthplace to their final location to form a properly functioning nervous system. During these movements, young neurons must attach and subsequently detach from their substrate to facilitate migration, but little is known about the mechanisms cells use to release their attachments. We show that adhesion molecules are largely absent from the rears of migratory telencephalic neurons, and that the machinery for clathrin-mediated endocytosis is positioned to regulate the distribution of adhesion proteins in a subcellular region just proximal to the neuronal cell body. Inhibiting endocytosis impedes the movement of migrating neurons both in vitro and in vivo. Inhibiting endocytosis in vitro shifts the distribution of adhesion proteins to the rear of the cell. These results suggest that endocytosis plays a critical role in regulating substrate detachment and thus enables cell body translocation in migrating neurons.

49 Introduction

Neuronal migration is critical for proper nervous system development. Disruptions in neuronal migration have been implicated in neurological disorders such as epilepsy, mental retardation, schizophrenia, and dyslexia (Fatemi and Folsom, 2009; Gershon and Rieder, 1992; McManus and Golden, 2005; Shastry, 2007). Many of these disruptions are linked to dysregulation of the actin or microtubule cytoskeleton, which impairs the directed motility of migrating neurons and prevents them from reaching their final destination in the nervous system. Neurons migrate in a stereotypical saltatory, two-stroke cycle: first, a leading process extends and explores, and then the cell soma follows in a distinct translocation event (Edmondson and Hatten, 1987; O'Rourke et al., 1992; Schaar and McConnell, 2005). After the leading process extends but before the cell soma moves forward, a cytoplasmic dilation swells in the leading process proximal to the nucleus (Schaar and McConnell, 2005). This dilation is characteristic of neurons migrating on a variety of substrates, from radial glial fibers to extracellular matrix (ECM) (Gasser and Hatten, 1990; Nadarajah et al., 2001; Solecki et al., 2009; Wichterle et al., 1997). After the formation of this transient structure, the nucleus moves forward into the dilation, at least partially due to myosin contractions at the cell rear (Bellion et al., 2005; Schaar and McConnell, 2005). This cycle is repeated as the neuron propels itself forward.

Neuron migration can also be viewed in light of classic models of cell migration in which movement is comprised of distinct yet integrated steps: polarization and protrusion, attachment at the cell front, forward movement of the cell body, and detachment with retraction at the cell rear (Lauffenburger and Horwitz, 1996; Ridley et al., 2003; Vicente-Manzanares et al., 2005; Webb et al., 2002). Great progress has been made in elucidating the mechanisms that control these steps in individual fibroblast-like cells migrating in two dimensions (2D). These studies have illuminated the critical role played by Rho GTPases and actin regulation in many steps, particularly polarization, protrusion, and translocation (Fukata et al., 2003; Kaverina et al., 2002; Ridley et al., 2003; Wen et al., 2004). Actin polymerization both drives protrusion and is tightly linked to the formation of adhesions at leading edge

50 lamellipodia (DeMali et al., 2002; Vicente-Manzanares et al., 2009). Many studies have focused on the formation of the large macromolecular adhesion complexes surrounding integrin receptors, which connect ECM molecules like fibronectin or laminin to the actin cytoskeleton. Though the formation and assembly of these adhesion complexes has been intensively studied (Webb et al., 2002), much less is known about how these adhesion complexes disassemble.

Adhesion disassembly is as important as their assembly, because the cycle of attachment at the leading edge and detachment at the rear must be properly regulated for forward movement to occur (Webb et al., 2002). Stronger adhesions at the leading edge of the cell exert tractional forces, while weaker adhesions at the rear of the cell allow the release of the cell body from the substrate. Altering the balance of adhesion affects migratory speed and indeed can determine whether a cell moves at all (Gupton and Waterman-Storer, 2006). Overly weak adhesions fail to provide sufficient traction for forward movement; conversely, overly strong adhesions cause cells to stick to substrates, unable to detach.

Cells can utilize several mechanisms to detach from substrates at the cell rear. Adhesions can be disassembled through biochemical mechanisms that regulate the associations among proteins recruited to adhesion complexes (Broussard et al., 2008). For example, calpain can proteolyze talin binding domains that link integrin receptors to the actin cytoskeleton, thus promoting adhesion disassembly (Franco et al., 2004). De-adhesion can also occur through biomechanical mechanisms. In migrating fibroblasts, for example, strong myosin-based contractions break off pieces of membrane, leaving a trail of membranes like “footprints” on the substrate (Palecek et al., 1996; Rid et al., 2005). Alternatively, biomechanical forces arising from the endocytic internalization of adhesion molecules can physically disrupt contacts between an ECM substrate and cell membrane. Growing evidence suggests that clathrin-mediated endocytosis is involved in adhesion disassembly. Disrupting endocytosis can lead to the persistence of attachments that limit cell motility. In fibroblasts or a fibrosarcoma cell line, preventing either dynamin- or clathrin- dependent endocytosis leads to persistent, large focal adhesions that prevent normal

51 migration (Chao and Kunz, 2009; Ezratty et al., 2009; Ezratty et al., 2005). In neurons, growth cone motility and axon elongation require endocytosis of L1 adhesion molecules for de-adhesion (Kamiguchi, 2003). A neuron-specific L1 isoform can potentiate migration in non-neuronal cells through an interaction with β1 integrins (Panicker et al, 2006; Thelen et al., 2002). However, this potentiation also requires clathrin and dynamin function, providing another link between adhesion and endocytosis.

Both histological and functional evidence points to an important but poorly understood role for endocytosis in adhesion regulation in migrating neurons. Electron micrographs show that clathrin coated vesicles (CCVs) are situated near adhesive contact points in neurons migrating in different modes. Cerebellar granule neurons migrating along radial glia have CCVs near sites of contact between the two cells (Gregory et al., 1988; Yuasa et al., 1996), and neurons migrating in chains toward the olfactory bulb exhibit CCVs near adherens junctions (Doetsch et al., 1997). Several genes that are critical for cortical neuron migration are associated with proteins implicated in endocytosis or adhesion. RNAi-mediated knock-down of the microtubule-associated protein Doublecortin (DCX) disrupts radial migration in the cortex (Bai et al., 2003). While DCX is involved in regulating the microtubule cytoskeleton in migrating neurons, it also interacts with the µ1 subunit of the AP-1 clathrin adaptor complex, suggesting a potential role in endocytosis (Friocourt et al., 2001). Knock-down of the dyslexia-associated protein KIAA0319 disrupts radial migration as well. KIAA0319 has domains suggesting a role in adhesion, and recently its protein product was shown to interact with the clathrin adaptor AP-2 and follow a clathrin-mediated endocytosis pathway (Levecque et al., 2009; Paracchini et al., 2006). Disruptions in Disabled-1 (Dab1), a protein related to the clathrin adaptor Disabled-2 (Dab2), in Scrambler mutant mice lead to improper cortical migration due to an inability of cortical neurons to detach from their radial glial guide (Sanada et al., 2004). Dab1 acts via the Reelin pathway to regulate radial migration, potentially by binding to clathrin adaptors such as AP-2 and affecting the internalization and recycling of the Reelin receptors VLDLR and APOE-R2 (Homayouni et al., 1999).

52 Recent studies suggest that Dab2 is involved in integrin internalization and trafficking in migrating HeLa cells (Teckchandani et al., 2009).

Here, we study the role of endocytosis in regulating the subcellular distribution of adhesion proteins in migrating neurons, and ascertain whether the disruption of endocytosis leads to defects in neuronal migration. Examination of the ultrastructure of neurons migrating in vitro reveals that CCVs are present in the cytoplasmic dilation at points of contact with an extracellular matrix substrate. Adhesion proteins are largely absent from the rear of migratory neurons, and colocalize significantly with clathrin within the dilation, suggesting that adhesive contacts might be weakened in the proximal domain of the leading process prior to cell soma translocation. Pharmacological inhibition of dynamin in neurons migrating in a three-dimensional (3D) matrix substrate produce significant disruptions in migration and lead to changes in the subcellular distribution of adhesion molecules. Finally, we find that the expression of dominant negative clathrin or dynamin delays the migration of cortical neurons in vivo. These results suggest an important role for endocytosis in neuronal migration, and that endocytosis may regulate the spatiotemporal dynamics of adhesions.

Results

Components of clathrin-mediated endocytosis are enriched in the dilation of migrating neurons

In initial studies to characterize cytoskeletal events that occur during neuronal migration, we performed correlative electron microscopy on neurons migrating through a 3D environment (Schaar and McConnell, 2005). Neurons migrating out from anterior subventricular zone (SVZa) explants cultured in Matrigel were followed by time-lapse microscopy until they initiated nucleokinesis. This point in the migration cycle is marked by the formation of a transient cytoplasmic dilation within the leading process of the neuron, just proximal to the cell body. At this point, the neurons were rapidly fixed and processed for transmission electron microscopy

53 (TEM). In TEM images of neurons in the process of nucleokinesis, we observed CCVs and clathrin-coated pits in the dilation and perinuclear region (Figure 2.1D). These clathrin-coated structures (CCSs) were never observed at the tip of the leading process or at the rear of the cell. However, CCSs were rare (6 CCSs in sections through 5 migrating neurons). Thus, we were prompted to further examine the localization of clathrin machinery using immunocytochemistry.

Immunostaining for components of clathrin-mediated endocytosis, including clathrin heavy chain, clathrin light chain, or the adaptors AP-2 and Dab2 demonstrated the presence of these components throughout the leading process (Figure 2.1A). Line scan analysis of fluorescence intensity along the length of neurons identified as migratory by the presence of a dilation or elongated nucleus showed enrichment of these components within the dilation (Figure 2.1B,C). Because the centrosome and Golgi localize to the dilation region (Bellion et al., 2005; Tsai et al., 2005), we asked whether the enrichment of clathrin in the dilation was solely due to Golgi-associated clathrin, which is not involved in surface membrane internalization. Golgi-associated clathrin was revealed by co-staining for GM130, a marker of the Golgi apparatus (Figure 2.2A). Even after Golgi-associated clathrin was subtracted from the clathrin immunoreactivity, there was a substantial accumulation of clathrin within the dilation. Also, the CCSs visible by EM were at or near the membrane surface, some in stereotypical shapes indicating an active pinching off process (Figure 2.4A, B). This suggests that the enrichment of clathrin in the dilation is involved in surface membrane internalization.

Another indication that clathrin is actively involved in membrane internalization is the presence of the cargo-specific adaptor proteins AP-2, Dab2, and Numb, which are also present in the dilation (Figures 2.1A,B and 2.5). These adaptor proteins interact with specific surface molecules and regulate the recruitment of clathrin to these locations on the membrane surface to mediate cargo-specific internalization (Traub, 2009). Transferrin-bound transferrin receptors are an example of cargo internalized through CME. After exposing cells to Alexa 594-conjugated transferrin, we examined the distribution of internalized Alexa-594 conjugated

54 transferrin as indicators for sites of active endocytosis. This method has previously been used to demonstrate the presence of endocytic hot-spots on dendrites (Blanpied et al., 2002). After a 2 minute exposure, transferrin puncta were primarily present in the dilation, with 61.4 ± 5.0% (p <0.001, n = 21 cells) of transferrin puncta present there (Figure 2.3A). Transferrin colocalized with eGFP-tagged clathrin light chain after 2 minutes (Figure 2.3B). After 10 minutes, transferrin colocalized with early endosomes labeled by YFP-2xFYVE, demonstrating the transition of internalized transferrin through the endocytic recycling pathway (Figure 2.3C).

Not all endocytic-associated proteins were enriched in the dilation. Caveolin-1, a molecule involved in caveolae-mediated but not clathrin-mediated endocytosis, was enriched in the tip of the leading process rather than in the dilation (Figure 2.2B). These data are consistent with EMs of radially migrating cerebellar granule neurons that revealed CCVs in the perinuclear region of the cell, whereas uncoated vesicles were observed near the tip of the leading process (Gregory et al., 1988). This could indicate specialized domains for different forms of endocytosis in migrating neurons.

Clathrin coated vesicles are positioned to regulate adhesion

Further inspection of the EM images revealed CCSs at points of ECM contact (Figure 2.4A,B). The striking apposition of CCSs with adhesive contacts suggests that clathrin-mediated endocytosis (CME) could be involved in regulating the adhesive relationship between the cell membrane and its substrate. Consistent with this hypothesis, clathrin and dynamin are required for focal adhesion disassembly in model cells migrating in 2D (Chao and Kunz, 2009; Ezratty et al., 2009; Ezratty et al., 2005). Testing this idea in migrating neurons required that we first identify the relevant adhesion receptors utilized by SVZa neurons migrating in Matrigel.

Heterodimeric integrin receptors are the major receptors used by cells responding to ECM molecules. Integrin β1 dimerizes with a number of different integrin α subunits to mediate binding to different ECM substrates, such as fibronectin, laminin, or collagen. Integrin β1 is also a relevant adhesion receptor in SVZa neurons migrating in vivo (Belvindrah et al., 2007b). Because the ECM

55 substrate used in our system is composed primarily of laminin and collagen types I and IV, integrin β1 receptors were likely candidates to mediate adhesion by SVZa neurons in vitro. Indeed, culturing explants in the presence of an integrin β1 function- blocking antibody prevented neurons from migrating out of explants, compared to an isotype control antibody (Figure 2.6). Thus, integrin β1 is required for migration in the SVZa explant system.

To examine whether components of CME are in the proper subcellular location to regulate adhesion, we immunostained migrating neurons using antibodies that recognize clathrin light chain (CLC) and an active conformation of integrin β1. To quantify the extent of colocalization in different subcellular domains, individual neurons that contained dilations (and were thus likely in the process of migration) were divided into 5 regions: tip of the leading process, distal leading process, dilation, soma, and rear. Each region was examined for colocalization of adhesion and endosome proteins using the JACoP plugin in ImageJ. Consistent with our EM observations that CCSs in the dilation of migrating neurons were present at points of matrix contact, the highest incidence of colocalization between clathrin and active integrin β1 was observed in the dilation. Pearson’s coefficient, a measure of colocalization, was significantly higher in the dilation than in any other subcellular domain (Figure 2.4D, n = 10, p < 0.01, Student’s t-test). The tendency for greater overlap in dilations is consistent with the possibility that endocytosis weakens adhesive contacts in the dilation prior to nucleokinesis. Consistent with a role for CME in internalizing adhesion proteins, we also saw greater colocalization between the clathrin adaptor AP-2 and integrin β1 in the dilation region than any other region (Figure 2.5B, n = 12, p < 0.02). Interestingly, colocalization between Dab2 and integrin β1 in the tip and in the dilation did not differ significantly, but both showed greater colocalization at these sites than in any other subcellular region (Figure 2.5D, n = 9, p < 0.04). The presence of significant colocalization between Dab2 and integrin β1 at the tip may reflect distinct roles for Dab2 and AP-2 in these different subcellular domains. For example, recent studies in HeLa cells reveal that Dab2 maintains an intracellular pool of integrin β1 that can be recycled to create new adhesive contacts at

56 the leading edge of migrating cells (Teckchandani et al., 2009). Numb is another clathrin adaptor shown to be involved in integrin trafficking in other cell types (Nishimura and Kaibuchi, 2007). We observed greater colocalization between Numb and active integrin β1 in the dilation than in the soma or rear of the cell (Figure 2.5F, n = 6, p < 0.02)

Adhesion proteins are concentrated in distinct subcellular domains

The selective presence of CCSs and colocalization of adhesion molecules with clathrin in the dilation of migrating neurons raises the possibility that the strength or types of adhesive contacts between neurons and their substrate may be distinct in different subcellular domains. In neurons migrating in a 3D ECM substrate, molecules involved in integrin-based adhesion complexes appeared diffuse with small puncta (Figures 2.7A-C and 2.13C,E,G, insets). This suggests neurons do not form the large focal adhesion complexes seen in many types of cells migrating in 2D. Focal adhesion proteins are distributed primarily in the leading processes of migrating neurons and resemble the 3D-matrix adhesions described in fibroblasts cultured in 3D environments (Cukierman et al., 2001).

Certain adhesion molecules showed distinct subcellular enrichment patterns. For example, integrin-linked kinase (ILK) was selectively enriched in the dilation (Figure 2.7A), whereas focal adhesion kinase (FAK) proteins modified by phosphorylation of Y577 and Y861 were selectively enriched in the tips of leading processes (Figure 2.7B,C). FAK phosphorylated at Y407, Y576, and Y397 did not show consistent intensity peaks in specific subcellular regions (not shown). FAK Y577 and Y861 are both sites of Netrin-induced Src phosphorylation, which lead to FAK activation (Liu et al., 2004; Ren et al., 2004). Thus, adhesion proteins enriched in the tip of the leading process may reflect specific activities involved in leading process guidance and growth. Differences in adhesion protein composition in subcellular domains may reflect differences in the type, age, or function of the adhesions in these different regions.

57 Strikingly, despite differences in the particular proteins enriched either at the tip or in the dilation, all adhesion proteins examined were generally absent or present only at low levels in the rears of migrating neurons (Figures 2.4C; 2.5; 2.13C,E,G; 2.14A-C), consistent with the notion that adhesive contacts must be released at the rear to facilitate cell soma translocation. The presence of adhesions in the leading process but not at the rear of the cell implicates a process involved in removing adhesions to maintain this distribution.

Inhibiting dynamin function disrupts migration in vitro

The association between CCSs and adhesions in the dilation, as well as the absence of adhesions at the rear of migrating neurons, suggest that endocytosis may be involved in removing or weakening adhesions prior to somal translocation. Because the dilation becomes the cell rear in the next cycle of migration, neurons may maintain the polarized distribution of adhesions in the leading process but not at the rear by removing adhesion proteins in the dilation prior to nucleokinesis. This hypothesis predicts that blocking endocytosis might: 1) prevent neurons from migrating or cause them to migrate more slowly; and 2) alter the subcellular distribution of adhesion molecules, such that adhesions accumulate at the cell rear.

To examine whether inhibiting endocytosis affects the migration of SVZa neurons, we examined the effect of expressing dominant negative dynamin (K44A- dyn) on migration out of explants (van der Bliek et al., 1993). The K44A substitution disrupts the GTPase activity of dynamin and has been used frequently to block endocytosis (Damke et al., 1994; Kruchten and McNiven, 2006; Le Roy and Wrana, 2005). Significantly fewer cells migrated out of explants expressing K44A-dyn (36.7 ± 8.8% of WT-dyn, p < 0.01, n = 3 independent experiments) (Figure 2.8A). Cells that do migrate out of the explant exhibit altered dynamics. The average velocity of K44A- dyn cells observed was 3.3 ± 1.0 µm/hr (n = 26 cells), which was significantly (p < 0.05, Student’s t-test) slower than average WT-dyn cell velocity (8.3 ± 2.2 µm/hr, n = 21 cells). This difference in average velocity is mostly due to the greater percentage of neurons expressing K44A-dyn that do not migrate, though more also have slower rates than those expressing WT-dyn (Figure 2.7D). However, there was great individual

58 variability in the behavior of K44A-dyn expressing neurons. It is difficult to examine or properly interpret the migration dynamics of the K44A-dyn neurons because most cells will not migrate out of the explant to be examined. Also, because this is a long- term block of endocytosis, cells may begin to upregulate compensatory mechanisms of endocytosis or otherwise behave differently than normal. Thus, to further dissect the role of endocytosis on migration dynamics with finer temporal resolution, we cultured explants in the presence of myristyl trimethyl ammonium bromide (MiTMAB), a small molecule inhibitor of dynamin (Quan et al., 2007), which regulates vesicle fission during endocytosis (Ungewickell and Hinrichsen, 2007).

To verify that MiTMAB disrupts clathrin-mediated endocytosis, we assayed transferrin internalization in neurons exposed to varying amounts of MiTMAB. Alexa 594-conjugated human transferrin was added for 15 minutes to explants cultured in the presence of 1% DMSO (vehicle control) or 10, 30, 50, or 100 µM MiTMAB; explants were exposed to MiTMAB for a total of 30 minutes. Transferrin internalization at 10 and 30 µM MiTMAB did not differ significantly from vehicle-treated explants, expressed as a percentage of transferrin internalized by cells exposed to vehicle, but 50 µM MiTMAB reduced transferrin internalization to 72.3 ± 9.9 % (p < 0.01, Student’s t-test) of internalization in vehicle-treated cells (Figure 2.9A). 100 µM MiTMAB reduced transferrin internalization to 43.5 ± 8.3% (p < 0.001), but also affected bulk fluid-phase endocytosis, which was assessed by measuring the internalization of Texas Red-dextran (Figure 2.9B). In contrast to its effects on transferrin internalization, MiTMAB treatment at 50 µM did not affect dextran internalization (Figure 2.9B), suggesting that low concentrations of MiTMAB disrupt clathrin-mediated but not bulk endocytosis. MiTMAB treatment at 30 µM significantly increased the presence of surface levels of integrin β1 (Figure 2.9C). We also tested the effects of the dynamin inhibitor dynasore (Macia et al., 2006). Likely due to the complex environment of the Matrigel/collagen matrix, dynasore was required at high concentrations (200 or 400 µM) before transferrin internalization was significantly affected (p < 0.01, n = 4 independent experiments) (Figure 2.10A). However, dextran internalization was also significantly affected at those

59 concentrations (p < 0.05, n = 4 independent experiments). Thus, experiments using dynasore were discontinued, but it is possible that dynasore, like MiTMAB may affect surface integrin β1 levels at a lower concentration than transferrin internalization. This may be examined in future studies, though the significant block of dextran internalization at 10 µM suggests caution should be used in interpreting those effects.

When applied to SVZa neurons migrating in a 3D matrix for at least 4 hours, MiTMAB decreased the distance neurons were able to migrate from the edge of explants (Figure 2.11A,B). The sensitivity of migrating neurons to MiTMAB treatment exceeded that shown by the transferrin internalization assay. The distance over which neurons migrated in vitro was significantly altered by treatment with only 10 µM MiTMAB (Figure 2.11B), whereas a significant block of transferrin internalization was not seen until 50 µM MiTMAB (Figure 2.11A). However, effects on the surface integrin levels do begin to appear at 10 µM, with a significant increase at 30 µM (Figure 2.9C). Thus, transferrin internalization does not appear to appropriately represent the kinetics of endocytosis for adhesions. Indeed, different receptors internalized through CME take different pathways (Traub, 2009), thus it is difficult to identify a generic CME pathway. There is also evidence that the integrin endocytosis pathway differs from that utilized by transferrin receptors, since integrin internalization requires adaptor proteins distinct from those used for transferrin receptor endocytosis (Nishimura and Kaibuchi, 2007). The effect of MiTMAB on the migration of SVZa neurons is unlikely to be due to a general disruption in bulk endocytosis, since MiTMAB did not affect dextran internalization at lower concentrations (Figure 2.9B). It is also unlikely to be due to a general disruption in cytoskeletal structure, as actin and microtubules appeared normal in MiTMAB-treated neurons (Figure 2.12).

Acutely inhibiting dynamin function disturbs cell soma translocation

Using pharmacological inhibitors on neurons migrating in vitro affords the opportunity to disrupt endocytosis using a more refined temporal control than is possible with genetic methods. While observing SVZa neurons migrating from explants using differential interference contrast (DIC) time-lapse microscopy, we

60 replaced the regular imaging medium with MiTMAB-containing medium. Neurons were imaged for 30 minutes during MiTMAB treatment before the medium was replaced with regular imaging medium (washout). In the presence of MiTMAB, neurons typically either paused and failed to move forward, or they made a single somal translocation near the beginning of MiTMAB treatment (Figure 2.11C). The average velocity of cell movement was greatly reduced during MiTMAB treatment (7.6 ± 1.7 µm/hr, n = 19, p < 0.01, Student’s t-test) compared to the migration rate prior to drug addition (14.5 ± 1.9 µm/hr) (Figure 2.11D). In addition, we found that the time between cell soma translocations was significantly increased during treatment (Figure 2.11D). Leading process dynamics appeared generally unaffected, as growth cones continued to make exploratory movements in the presence of MiTMAB.

The changes in migration rate and time between translocations were even more exaggerated during the period immediately after washout of MiTMAB. The average rate of migration during this period was 5.4 ± 1.0 µm/hr, significantly slower than before MiTMAB addition (p < 0.001). On average, neurons remained stationary for 63.6 ± 3.7 minutes before moving forward, more than 3 times as long as before and twice as long as during MiTMAB treatment (p < 0.001). When cells did eventually move their somata forward, the rear membrane often required a longer period of time to resolve; kymographs revealed that cell rears moved to form a sloped line rather than a discrete jump (Figure 2.11C). We were initially surprised that cells did not recover immediately following removal of MiTMAB; however, the sustained effects after washout are likely due to disrupting the removal of adhesions in the dilation during treatment. This is predicted to interfere with cell soma translocation in the next cycle of migration, which would occur after washout. Consistent with this interpretation, cells imaged for several hours after MiTMAB washout did recover and exhibit a normal migration rate (not shown).

Inhibiting dynamin function alters cell morphology and the distribution of adhesions

Time-lapse analysis of migrating neurons acutely treated with MiTMAB are consistent with the hypothesis that dynamin-mediated endocytosis regulates cell soma

61 translocation in migrating neurons. To ascertain whether MiTMAB also disrupts the ability of cells to release from their substrates at the cell rear, we examined the morphologies of MiTMAB-treated SVZa neurons. In normal SVZa neurons, few migrating cells retain a trailing process (Figure 2.13A). However, MiTMAB-treated neurons were much more likely to exhibit trailing processes or tails (Figure 2.13B). Similar bulbs of membrane and cytosol at the cell rear are visible in normally migrating cells (Schaar and McConnell, 2005), but they usually resolve quickly (presumably due to myosin II-mediated contraction during somal translocation) and are not captured as frequently in fixed neurons.

The presence of membrane tails in MiTMAB-treated neurons suggests that the rear portion of membrane may have been impeded in detaching from the substrate. To examine whether there was a concomitant increase in adhesion molecules at the rear of MiTMAB-treated neurons, we examined the distribution of adhesion proteins. While the adhesion proteins are typically present in the leading process and dilation but not the rear of SVZa neurons (Figure 2.13C,E,G), MiTMAB-treated neurons show an accumulation of adhesion proteins at the cell rear, as revealed by line-scan analysis of fluorescence intensities for integrin β1 and FAK immunoreactivity (Figure 2.13D,F,H). The effect remains the same even when using GFP to normalize for the amount of bulk cytoplasm present. When cells are aligned by their nuclei using DAPI staining, it is clear to see the variability in the presence of membrane at the cell rear (Figure 2.15, 2.16). MiTMAB-treated cells show greater variability, as some cells have tails, while others do not; in the control condition, no cells have extended cell rears. Comparing the ten bins representing the cell rear and soma in the situation where cells are not aligned by their nuclei, there was a significant increase in the average normalized fluorescence intensity for all adhesion proteins examined (p < 0.01, Student’s t-test) in MiTMAB treated neurons (Figure 2.17A). When comparing the average normalized fluorescence intensity for all the bins posterior to the aligned maximal value for the nucleus (DAPI value = 1), the significant increase in adhesion for MiTMAB-treated neurons compared to control is still present (Figure 2.17B). We observed this rearward redistribution of adhesion proteins whether or not the neurons

62 displayed a trailing process. The increase in adhesion proteins at the cell rear is consistent with the hypothesis that endocytosis in the dilation removes or weakens adhesions prior to somal translocation. We speculate that increased adhesion at the cell rear may explain the impediments in somal translocation that result from the acute application of MiTMAB to migrating neurons.

Inhibiting clathrin function disrupts migration in vitro

To confirm that the effects we saw inhibiting endocytosis through dynamin perturbation were mediated through clathrin-based endocytosis, we also examined the effect of the pharmacological inhibitor monodansyl cadavarine (MDC)(Davies et al., 1984). MDC prevents fewer cells from migrating out from explants at increasingly higher concentrations (Figure 2.18A). This corresponds to its ability to inhibit transferrin internalization (Figure 2.19A), though interestingly there was not an effect on surface integrin β1 levels (Figure 2.19C) as seen in the MiTMAB-treated neurons. The effect on migration dynamics was a bit different from MiTMAB effects as well; though there was still slowed migration in the presence of the drug, the velocity after washout was not even more slowed, as with MiTMAB treatment (Figure 2.18C). However, the time between translocations was increased, as with MiTMAB treatment. This may point to distinct functions for clathrin-dependent compared to clathrin- independent mechanisms of migration, or this may indicate that neurons are rapidly able to compensate for a block in clathrin-dependent forms of endocytosis by utilizing clathrin-independent but dynamin-dependent endocytosis, such as that mediated by caveolae.

Early endosome dynamics may be affected by clathrin inhibition

A preliminary study was done applying MDC to neurons expressing a marker of early endosomes, YFP-2xFYVE (Gillooly et al., 2000). YFP-2xFYVE+ vesicular structures appeared to be enriched in the dilation (Figure 2.20A), consistent with the hypothesis that the dilation is a hot-spot of endocytosis. These structures colocalize with the early endosome marker EEA1 (Figure 2.20B). In time-lapse imaging experiments, FYVE+ vesicles travel forward in the leading process, maintaining their

63 position as the nucleus moves into the dilation (Figure 2.20C, D). In the presence of the clathrin inhibitor MDC, FYVE+ fluorescence appeared to become more diffuse and weak in the paused cell soma, but after washout, brightened again, present at the cell rear (Figure 2.20D).

Inhibiting clathrin function delays cortical migration in vivo

Although different subtypes of neurons utilize distinct substrates and modes of migration, they follow the same general sequence of steps in the migration cycle, including the formation of a cytoplasmic dilation (Solecki et al., 2009; Tsai et al., 2007). Because clathrin-mediated endocytosis may be important for regulating adhesion at this critical step, we examined whether endocytosis plays a role in the migration of neurons in vivo, using neurons of the developing cerebral cortex for these studies.

RNAi-mediated knockdown of clathrin heavy chain (CHC) was performed by introducing either GFP with non-targeting siRNA (control siRNA) or GFP with siRNA targeted to CHC into developing mouse embryonic cortex at E13.5 using in utero electroporation. Two different target sequences were used, CHC-1 siRNA and CHC-2 siRNA. Neurons expressing CHC-2 siRNA did not display any change in distribution across the cortex (n = 4 brains, 3417 cells; Figure 2.21C, D). However, immunostaining for CHC showed that knockdown was likely not effective (Figure 2.22C). Preliminary evidence with CHC-1 siRNA (n = 2 brains, 6322 cells) suggests that after 4 days, there is a greater percentage of cells present in the lower regions of the cortex, such as the IZ (Figure 2.21B). In brains electroporated with CHC-1 siRNA, immunostaining of CHC may be slightly reduced compared to control (Figure 2.22B). RNAi-mediated knockdown may require days before expression begins to effectively block CHC protein production. Also, it is known that CHC is stable and has a long half life, so protein produrance may interfere with the proper interpretation of siRNA experiments investigating radial migration. Cultured cells required multiple transfections of CHC siRNA spaced over multiple days before effective protein knockdown was observed (Esk et al., 2010; Ezratty et al., 2009). Thus, it would be difficult to determine whether neurons were able to migrate to the top of the cortical

64 plate because CHC was not required or because CHC was not efficiently knocked down. Immunostaining of CHC siRNA-expressing cortex 3 days after electroporation shows that CHC is still present (data not shown). Thus, we also examined the effect of a dominant negative clathrin construct which might be expected to produce a more immediate effect.

Either GFP alone or GFP along with a dominant negative clathrin construct (DN-Hub) were introduced into developing mouse embryos at E13.5 using in utero electroporation. The dominant negative clathrin construct (Liu et al., 1998) encodes the Hub region of clathrin heavy chain, which binds to clathrin light chain to prevent the regulated formation of the clathrin coat. Electroporated embryos were allowed to develop for either 2 days (fixed at E15.5) or 4 days (fixed at E17.5) then processed for immunohistochemistry (Figure 2.23A,B,D,E). To determine the distribution of GFP+ cells, we divided images of cortex into 10 evenly-spaced bins from the ventricular surface to the pial surface using a DAPI-stained image, and counted the number of GFP+ neurons in each bin (Figure 2.23C,F).

After 2 days survival, 28.2 ± 2.9% (n = 7, mean ± SEM) of neurons expressing only GFP had reached the cortical plate (CP, bins 1-3) (Figure 2.23A,C). The distribution of neurons expressing DN-Hub differed significantly (n = 7, p < 0.02, Chi- square test), with only 12.7 ± 4.6% of neurons present in the CP (Figure 2.23B,C). Most were in the intermediate and subventricular zones (IZ/SVZ, 70.9 ± 4.2%, bins 4- 8). After 4 days survival, however, the distribution of DN-Hub expressing cells did not differ significantly from that of GFP-only expressing cells (p > 0.5, Chi-square test). Thus, cell migration appeared to have recovered by 4 days (Figure 2.23D-F). The morphology of DN-Hub expressing neurons appeared normal for their positions; cells in the IZ had a multipolar morphology similar to GFP-only cells in transit through the IZ (Figure 2.23A’,B’), while cells that settled in the CP had similar morphology to GFP-only cells in the CP (Figure 2.23D’,E’).

The delayed migration of neurons transfected with DN-Hub into their final positions within the cortical plate is consistent with a role for endocytosis in regulating the rate of migration. Alternatively, it is plausible that neurons were able to continue

65 migrating because they ceased expression of DN-Hub. A T7 tag contained within the DN-Hub construct was used to assess DN-Hub expression in GFP+ neurons. Many cells transfected with both GFP and DN-Hub showed strong T7 staining at 2 days, when most cells were in the IZ, and at 4 days, when most cells had reached the top of the cortical plate (Figure 2.24A-F). Although anti-T7 immunostaining did not label all GFP+ neurons, the number and pattern of T7+ cells were similar at 2 and 4 days, suggesting that the eventual ability of transfected neurons to complete their migration into the cortical plate was not due to a downregulation of DN-Hub. Delayed migration was also not due to a disruption in radial glia morphology or the structural integrity of the apical surface, since both appeared normal in electroporated brains at E15 and E17 (Figure 2.27A-D and data not shown).

Inhibiting dynamin function stalls cortical migration in vivo

To provide an independent method for probing the role of endocytosis in cortical migration, we introduced a dominant negative dynamin I (K44A-dyn) construct (van der Bliek et al., 1993) into E13.5 mouse cortices using in utero electroporation. Either K44A-dyn or a control wild-type dynamin I construct (WT- dyn) was co-electroporated with GFP. Embryos were allowed to develop for either 2 days (fixed at E15.5) or 4 days (fixed at E17.5) and the position of GFP+ neurons in the cortex was determined by counting the number of GFP+ neurons in 10 evenly- spaced bins across the cortex, as described above.

After 2 days survival, neurons expressing WT-dyn have reached the top of the cortical plate (Figure 2.25A,C), similar to neurons expressing GFP only in the previous experiment (Figure 2.23A). In contrast, the majority of cells expressing K44A-dyn were found in the IZ/SVZ (Figure 2.25B,C). Unlike cells expressing DN- Hub, after 4 days of survival, cells expressing K44A-dyn did not fully recover to match the positions of control WT-dyn cells; the distribution of K44A-dyn cells at E17 differed significantly from that of WT-dyn cells (p < 0.001, Chi-square test) (Figure 2.25E,F). At this stage, more than half (53.0 ± 5.8%, n = 7) of K44A-dyn-expressing neurons were present in the IZ/SVZ, compared to only 18.7 ± 7.5 % (n =3) of WT- dyn-expressing neurons (Figure 2.25D,E). Though the recovery was not complete,

66 there was a shift in the distribution of K44A-dyn cells such that a greater percentage of GFP+ neurons was found in the CP after 4 days. GFP+ cells transfected with K44A- dyn that reached the top of the cortical plate still expressed the DN construct, assayed by continued expression of the HA-tag after 2 or 4 days (Figure 2.26A-L). However, the staining intensity for HA in neurons within the cortical plate was lower than that of cells in the IZ/SVZ (Figure 2.26K, inset). This difference suggests that neurons that were able to migrate to the CP may have downregulated or expressed lower levels of K44A-dyn. Alternatively, cells that reached the CP may have utilized a dynamin- independent form of endocytosis. Both radial glia morphology and the integrity of the ventricular surface appeared normal in electroporated brains (Figure 2.27E-H and data not shown), suggesting that the disruption in migration reflects a requirement for dynamin in migrating neurons. Examining whether adhesion molecules are upregulated in the electroporated cortices was inconclusive. Staining for α3 integrin in E15 WT-dyn and K44A-dyn expressing cortices showed that the IZ region is normally the region with the greatest α3 integrin immunoreactivity (Figure 2.28). Thus, it would be difficult to ascertain whether an additional increase in integrin activity in that region led to the stalling of neurons located there.

The morphology of K44A-dyn-expressing neurons in the IZ/SVZ at E15 (Figure 2.25B’) appeared similar to that of cells expressing WT-dyn (Figure 2.25A’). At E17, although most K44A-dyn-expressing neurons were in the IZ, they no longer displayed the morphology of multipolar migrating neurons; K44A-dyn-expressing cells extended axonal and dendritic-like processes (Figure 2.25E’), suggesting that they had differentiated within the IZ. In similar experiments in which cortical neurons were electroporated and then examined at P1 (Figure 2.29), cells expressing high levels of K44A-dyn, as assessed by HA staining intensity, were still present in the white matter (Figure 2.29B,E). The effect of dynamin disruption appeared to be selective for migration, since differentiation and axon extension appeared to be normal. At P1, K44A-dyn-expressing neurons extended axons that crossed the corpus callosum (Figure 2.29D), similar to cells expressing WT-dyn (Figure 2.29C). HA+

67 cells in the white matter had the morphology of differentiated neurons rather than of neurons still in transit (Figure 2.29B, inset).

Migration was disrupted more dramatically in response to expression of dominant negative dynamin compared to dominant negative clathrin. Multiple endocytic pathways exist for internalizing molecules into a cell (Conner and Schmid, 2003). The difference between the dominant negative clathrin and dominant negative dynamin expression is likely due to the use of clathrin-independent, but perhaps dynamin-dependent, forms of endocytosis to compensate for the block in clathrin formation. In neurons treated with DN-Hub, which blocks the formation of CCVs, it first seemed plausible that neurons moved to a caveolae-based form of internalization. However, the caveolae pathway is also dynamin-dependent (Henley et al., 1998), which would force cells to utilize clathrin-independent, dynamin-independent pathways for endocytosis. Such pathways are known to exist, since HeLa cells can switch to a clathrin- and dynamin-independent form of endocytosis after only 30-45 minutes of overexpressing dominant negative dynamin (Damke et al., 1995). However, little is known about this pathway and it is unclear whether it exists in neurons.

Discussion

Attachment and detachment are critical steps in cell migration. While adhesion assembly and attachment have been studied extensively, far less research has addressed the process of de-adhesion, which enables detachment. Here we find pronounced subcellular differences in the localization of adhesion molecules in migrating neurons: adhesions are present in the leading process but sparse or absent at the cell rear. Electron micrographs revealed that CCVs are seen at points of adhesive contact with a matrix substrate, and immunostaining confirmed that components of clathrin machinery colocalize with adhesion receptors primarily in the dilation of migratory neurons. These observations suggest that clathrin-mediated endocytosis may weaken adhesions in the dilation prior to somal translocation. To test this, we used

68 dominant negative and pharmacological approaches to interfere with endocytosis in migrating neurons, resulting in a disruption of neuronal migration in vivo and in vitro. Inhibiting dynamin function in vitro also caused a redistribution of adhesion molecules to the cell rear, consistent with the notion that CME in the dilation weakens adhesions to facilitate forward translocation during neuronal migration.

Spatial regulation of adhesion and de-adhesion

It has long been appreciated that there are distinct zones of adhesivity in polarized migrating cells. From the front to the rear of a migrating cell, adhesion complexes of varying composition, size, and strength form to create these distinct zones. Nascent adhesions at the leading edge provide strong traction forces (Beningo et al., 2001). Strong, small focal complexes in leading edge lamellipodia can either be turned over or continue to mature and grow into larger focal adhesions. Focal adhesions at the rear of the cell transmit less force from substrate to cytoskeleton (Ji et al., 2008; Schneider et al., 2009). Thus, the spatial regulation of these distinct types of adhesion complexes in 2D, with newer focal complexes at the front and older focal adhesions at the rear, establishes the differential adhesive strengths that are required for forward movement.

Our observations of adhesion molecules in neurons migrating in 3D suggest a similar spatial specificity and regulation. Although adhesion molecules in neurons were distributed in diffuse puncta rather than identifiable focal complexes, as in traditionally studied model cells, they are still likely to exhibit tight spatiotemporal regulation. In support of a spatial segregation of adhesive zones, we noted differences in the presence of certain adhesion molecules at the tip of the leading process compared to the dilation region. These differences in adhesion composition may reflect differences in the dynamics and strength of adhesions in the leading process vs. dilation or cell soma. Adhesions in these two regions likely serve distinct purposes: those at the tip of the leading process are used for traction, while adhesions in the dilation would serve to create an intermediate anchor point toward which the nucleus can move. Because the dilation becomes the cell rear after somal translocation (Schaar and McConnell, 2005), however, adhesions in this region may need to be weakened

69 prior to the next migration cycle. The dilation region is reminiscent of the “culling zone,” present between the nucleus and tail of migrating fibroblasts, where focal adhesions are disassembled (Smilenov et al., 1999). In fibroblasts, the culling zone becomes the location of the cell rear in the next cycle of migration as a cell moves forward, suggesting that disassembly of focal adhesions in that zone may prepare the cell for the next step in migration. The regional specificity of adhesion zones begs the question of how these zones are generated within the cell.

Regulation of adhesion assembly and disassembly likely mediates the creation of asymmetric zones of adhesion within migrating cells. Nascent focal complexes in leading lamellipodia can either undergo turnover or mature into focal adhesions (Broussard et al., 2008). Adhesion turnover can occur through several means. Biochemical alteration of the binding properties of proteins contained within an adhesion complex through phosphorylation/de-phosphorylation or proteolysis can weaken adhesions (Franco et al., 2004; Webb et al., 2002). Acto-myosin contractile forces are also involved in biomechanical breaks in adhesive contacts (Kirfel et al., 2004; Vicente-Manzanares et al., 2007). Accumulating evidence suggests that endocytosis is involved in adhesion disassembly, since disrupting endocytosis can lead to the persistence of attachments that limit cell motility (Chao and Kunz, 2009; Ezratty et al., 2005). Thus it is likely that a combination of biochemical and biomechanical processes regulate adhesion disassembly, with different combinations leading to distinct adhesion zones within a migrating cell.

Here, we provide three lines of evidence that CME is involved in regulating the distribution of adhesion molecules in neurons. First, EM images suggest that clathrin-coated vesicles and pits are located preferentially at points of contact between the membrane of migrating neurons in vitro and the surrounding ECM matrix. Second, immunostaining of adhesion molecules and components of CME reveal that the two colocalize preferentially in the dilation of neurons migrating in vitro. Finally, the presence of adhesion molecules in the leading process but not at the rear of migratory neurons suggests that the relationship between endocytosis and adhesion is one of

70 disassembly. Indeed, our experiments reveal that adhesion components accumulate at the cell rear when dynamin-dependent endocytosis is disrupted in vitro.

Endocytosis is an attractive candidate to spatially regulate adhesion distribution. A long-standing idea has been that integrin adhesion receptors must be trafficked back to the leading edge of a cell to provide both membrane and adhesion receptors out to the front of a cell (Bretscher, 1976, 1996a, b, 2008). Thus, integrins endocytosed at the rear of the cell could both weaken adhesions at the rear and be returned to the leading edge to enable new adhesion formation. Though there is still no direct evidence that integrins are internalized at the rear and then re-inserted at the front of migrating cells, integrin receptors do travel in endosomes and their recycling is important for movement (Caswell and Norman, 2006; Pellinen and Ivaska, 2006). In migrating neutrophils, integrins are present in endocytic vesicles and colocalize with markers of the endocytic recycling compartment (Pierini et al., 2000). Neural crest cells also recycle surface integrins to permit motility (Strachan and Condic, 2004). In fibroblasts, the Eps15-homology domain protein EHD1 regulates β1 integrin endosomal transport, and EHD1 knockout cells show larger, more prominent focal adhesions, resulting from slower focal adhesion disassembly, which impair migration (Jovic et al 2007). Indeed, the clathrin adaptor Dab2 appears to be involved in trafficking integrin receptors to mediate its role in migration (Teckchandani et al., 2009). In neurons, the colocalization of Dab2 and integrin β1 at both the dilation and tip of the leading process (Figure 2.5C) suggest that Dab2 may also involved in this process in neurons.

While our research is consistent with the hypothesis that endocytosis plays a role in regulating adhesion in migrating neurons, it does not rule out other roles for endocytosis. For example, growth factor or guidance cue internalization may occur through clathrin-mediated endocytosis. Polarized trafficking of the growth factor BDNF is important for directed granule cell migration in the cerebellum (Zhou et al., 2007), and axon growth cone dynamics rely on both endo- and exocytosis in regulating turning responses to guidance cues (Kamiguchi, 2003). However, there is evidence that growth cone motility utilizes a clathrin-independent, bulk endocytotic

71 pathway rather than CME (Bonanomi et al., 2008). In vitro, we observed that MiTMAB blocked somal translocation but not leading process dynamics, suggesting that there may be alternative forms of regulating adhesions at the growth cone vs. cell soma.

Adhesion in vivo

Neurons are capable of migrating along a variety of substrates: radial glia, other neurons, and extracellular matrix. The types of adhesion molecules used are likely to differ in these different forms of migration. While integrins are used to connect the cytoskeleton to extracellular matrix substrates, other adhesion molecules (e.g. astrotactin, connexins, or PSA-NCAM: (Doetsch et al., 1997; Edmondson et al., 1988; Elias et al., 2007) are more likely to be used for radial and chain migration, which utilize cell-cell interactions to generate traction forces. However, there is evidence that integrins are also critical for radial migration in the cortex, though the relevant ligands may be expressed by radial glial fibers rather than neurons (Belvindrah et al., 2007a; Dulabon et al., 2000; Schmid et al., 2004). Despite the diversity of molecular players, all cells must regulate adhesion, and EM observations suggest that endocytosis may be used to weaken adhesions in many or most types of migrating neurons. Electron micrographs of cerebellar granule neurons migrating along glia either in vitro or in vivo reveal the presence of CCVs near intercellular adhesive contacts (Gregory et al., 1988; Yuasa et al., 1996), and SVZa neurons undergoing chain migration in vivo also exhibit CCVs near sites of cell-cell contact (Doetsch et al., 1997). Interestingly, Gregory et al. (1988) noted the CCVs are present in the perinuclear region of the cerebellar granule neurons while uncoated vesicles are enriched at the leading process tip, supporting the idea that distinct forms of endocytosis may be used to regulate movement at the cell’s leading edge and rear.

The role of clathrin-mediated endocytosis in neuronal migration

The proper regulation of adhesion is critical for normal migration. Thus, if CME regulates adhesion, migration should be altered if CME is disrupted. Indeed, altering the balance of adhesion strength in either direction – causing weaker or

72 stronger adhesions – disrupts migration in model cells in vitro (Gupton and Waterman-Storer, 2006; Kirfel et al., 2004). Here we show that the disruption of either clathrin or dynamin in vivo slows or stops the migration of young neurons. Time- lapse imaging of SVZa neurons in vitro, in which dynamin was acutely inhibited, showed that migration was slowed due to defects in cell soma translocation. A recent study examining somal translocation in serotonergic neurons corroborates our findings that dynamin impacts movement of the cell soma (Hawthorne et al., 2010). Hawthorne and colleagues demonstrate that application of the dynamin inhibitor dynasore dramatically decreases the velocity of migrating serotonergic neurons. These observations are consistent with increased adhesion at the cell rear, leading to the inability of affected cells to detach from their migratory substrates.

It could be argued that the effects of inhibiting dynamin, whether from expression of the K44A mutation or application of MiTMAB, are not the result of disrupting the role of dynamin in endocytosis but rather reflect a more direct involvement of this protein in cytoskeletal remodeling (Palamidessi et al., 2008). However, we saw no overt alterations in the organization of the actin or microtubule cytoskeleton in MiTMAB-treated neurons, apart from the failure of migrating neurons to resolve their trailing processes at the cell rear. In addition, expressing a dominant negative form of clathrin disrupts the migration of cortical neurons in vivo, suggesting that endocytosis plays an essential role in cell movement. Nevertheless, adhesion regulation is tightly linked to cytoskeletal proteins. Actin is involved in the recruitment of adhesion components to large complexes surrounding integrin receptors. Microtubules target focal adhesions in a way that induces a dynamin- and clathrin-dependent disassembly (Ezratty et al., 2005). Thus, if dynamin is directly affecting cytoskeletal dynamics, the effects we see of inhibiting dynamin in migrating neurons are likely one facet of a coordinated system for regulating adhesion and polarity in directed cell migration.

A model for neuronal migration

Adding our current results to our previous model of neuronal migration (Schaar and McConnell, 2005), we propose the following model for directed migration

73 (Figure 2.30). A neuron receives a guidance cue to migrate toward or away from a particular direction, polarizing the cell so that it forms a single leading process in the proper direction. The leading process extends and dynamically explores the substrate. Eventually, strong anchoring adhesions form in the growth cone to provide traction forces. The formation of a cytoplasmic dilation predicts the future location of the cell nucleus. To ensure that a gradient of adhesive strength is maintained to enable the cell rear to detach from the substrate during somal translocation, endocytosis in the dilation weakens adhesive contacts. We hypothesize that weakening adhesions in this region prepares the cell for nuclear translocation into the dilation, which defines the new cell rear. Somal translocation is driven by myosin II contractions behind the nucleus (Schaar and McConnell, 2005), which coordinate with dynein at the centrosome to move the nucleus into the dilation (Tsai et al., 2007; Vallee et al., 2009). Myosin contractions at the cell rear should be strong enough to break any remaining contacts between the substrate and cell membrane during nuclear movement and thus retract the rear membrane. Our data suggest that endocytic events in the dilation thus enable the nucleus to move into a region in which attachments have already been weakened, thus facilitating the next cycle of somal translocation.

Although this model is primarily based on observations of SVZa neurons in culture, other neurons display similar morphological steps while migrating (Gasser and Hatten, 1990; Nadarajah et al., 2001; O'Rourke et al., 1995). Neurons migrate in diverse areas of the nervous system using multiple modes and substrates, from glial- guided radial migration in the cortex to chain migration into the olfactory bulb. Despite these differences, neuron movements appear to be controlled by similar cytoskeletal mechanisms (Marin et al., 2006). Endocytosis may be one of those fundamental regulated processes involved in neuronal migration. Our studies demonstrate that clathrin and dynamin regulate the migration of cortical neurons in vivo and of SVZa neurons in vitro, which suggests that endocytosis is important for migration regardless of substrate and neuronal subtype.

We note that neurons migrating in vivo may require a distinct mechanism for regulating adhesion at the rear if they leave a trailing process or grow an axon during

74 migration. The presence of trailing processes may lead to slightly different mechanisms of movement regulation; for example, in migrating SVZa neurons and tangentially migrating interneurons, which do not extend an obvious trailing process during migration, myosin II at the rear of the cell aids in somal translocation (Bellion et al., 2005; Schaar and McConnell, 2005). However, cerebellar granule neurons, which extend an axon as they migrate, show myosin II activation ahead of the nucleus in the dilation region (Solecki et al., 2009).

Broader implications for three-dimensional adhesion systems

Historically, studies of the cell biology of migration have focused on cells migrating on 2D substrates. However, when those same types of cells are examined migrating in 3D substrates that more closely mimic the in vivo environment, the distribution, composition, size, and dynamics of those adhesions are different (Cukierman et al., 2001; Cukierman et al., 2002). The morphology of cells migrating in 3D can differ from the same cell type migrating in 2D (Even-Ram and Yamada, 2005; Friedl and Brocker, 2000), and some cell types resemble migrating neurons in their morphology when they migrate in 3D (Beadle et al., 2008). Indeed, the diffuse adhesions observed in migrating neurons resemble the smaller focal contacts called “3D-matrix adhesions” seen in fibroblasts cultured in 3D environments (Cukierman et al., 2001). This raises the possibility that what we have learned here from migrating neurons may also be applied to more general cell biology. Future work to test the role of endocytosis in adhesion regulation in other types of migrating cells will facilitate an understanding of how the cytoskeleton is coordinated to enable cell migration.

75 Experimental Procedures

Materials: chemicals, plasmids, antibodies

Myristyl trimethyl ammonium bromide (MiTMAB) and monodansyl cadavarine (MDC) were from Sigma Aldrich. Dynasore was a gift from Tomas Kirchhausen. All chemicals for EM were from Electron Microscopy Services (Fort Washington, PA). Plasmids containing HA-tagged wild-type and dominant-negative (K44A) dynamin I were gifts from Sandra Schmid. The plasmid containing T7-tagged dominant-negative Hub was a gift from Frances Brodsky. All constructs were subcloned into a pCDNA3.1 vector with the CA (CMV promoter with chicken β-actin enhancer) promoter and verified with DNA sequencing. For expression of GFP only, GFP under the CA promoter in a pBlueScript vector was used. TdTomato and mCherry were gifts from Roger Tsien. Small interfering RNA against clathrin heavy chain, target sequence 1 (CHC-1) was AAGCAATGAGCTGTTTGAAGA (Esk et al., 2010; Vassilopoulos et al., 2009) and target sequence 2 (CHC-2) was AACAUUGGAUUCAGUACCUUGTT (Ezratty et al., 2009). YFP-2xFYVE construct was originally created by Harald Stenmark and subcloned into a vector under the CA promoter by Marc Fivaz (Gillooly et al., 2000). eGFP-FKBP-clathrin light chain construct was a gift from Timothy Ryan (Moskowitz et al., 2003).

Primary antibodies used were polyclonal integrin β1 (1:500-1:1000; Chemicon), polyclonal integrin β1 against the extracellular domain (M-106, 1:500; Santa Cruz), monoclonal clathrin heavy chain (clone X22, 1:1000; AbCam), polyclonal clathrin light chain, consensus sequence (1:2000; gift from Frances Brodsky), monoclonal alpha-adaptin subunit of AP-2 (clone AP6, 1:1000; AbCam), polyclonal FAK (1:1000-1:2000; Upstate), polyclonal ILK (1:500; Upstate/Chemicon), monoclonal anti- active human integrin β1 (HUTS-21, 1:500; BD), polyclonal FAK PSSA sampler pack (pY397, pY407, pY576, pY577, pY861, 1:500-1:1000; Biosource/Invitrogen), chicken anti-GFP, rabbit anti-HA tag (1:1000; Santa Cruz), rabbit anti-T7 tag (1:100; Novagen), GM130-FITC (1:100, BD),

76 monoclonal anti-α-tubulin (clone DM1A, 1:1000; Sigma), monoclonal anti-Disabled- 2/p96 (clone 52, 1:500; BD Transduction Labs), polyclonal Numb (1:250-1:500; Cell Signaling), polyclonal caveolin-1 (1:500; Cell Signaling), monoclonal nestin (1:100; Pharmingen), rhodamine-phalloidin (1:250; Molecular Probes). Secondary antibodies were used at 1:500 from Jackson Labs (goat anti-mouse IgG conjugated to Cy2/Cy3/Cy5, goat anti-rabbit Cy2/Cy3) or from Molecular Probes (goat anti-mouse IgG or rabbit IgG conjugated to Alexa 488/594/680, goat anti-chicken Alexa 488).

Electron microscopy

EM images were collected as previously described (Schaar and McConnell, 2005). Briefly, an isolated neuron with a prominent dilation in its leading process was identified by time-lapse microscopy. As soon as the nucleus moved and/or the rear of the cell contracted, 250 µl of EM grade 8% glutaraldehyde was added to the imaging dish (1 ml total). Samples were processed for EM, embedded in Epon, and sectioned with a Leica Ultracut S ultramicrotome. The imaged cell was located by taking thick sections that were stained on a glass slide with Giemsa stain for orientation. Thin (85- nm) sections were then taken and post-stained with 1:1 saturated uranyl acetate/acetone for 15 s, then 3 min of 0.3% lead citrate. Samples were rinsed and air- dried. Transmission EM was then performed by using a JEOL 1230 microscope, and images were acquired with a Gatan 967 slow-scan charge-coupled device (CCD) camera.

Functional blocking of β1 integrin in SVZa explants

Explants were cultured as above in the presence of NB alone, or anti-integrin β1 (Ha2/5; BD Biosciences) function-blocking antibody or hamster IgM isotype control antibody (G235-1; BD Biosciences) was added to the culture at a final concentration of 10 or 50 µg/ml. Explants were cultured for 19-24 hours, then fixed, stained with DAPI and images were captured for migration distance analysis. Migration distance analysis was performed by averaging the cell nucleus position measured at the farthest distance from the edge of the explant at 4 points around the explant.

77 Transferrin, dextran, and integrin β1 internalization

To examine transferrin internalization, human transferrin conjugated to Alexa 594 (Invitrogen) was added to the culture medium at 50 µg/ml for 15 minutes at 37ºC. To examine bulk membrane uptake, Texas Red conjugated dextran (Invitrogen) was added to the culture medium at 10 µg/ml for 15 minutes at 37ºC. To examine surface integrin β1 levels, fixed cells were not pemeabilized and then immunostained using an antibody against the extracellular domain of integrin β1. Internalized puncta were counted using ImageJ by first creating a mask of GFP+ cells to create a masked image of the puncta, and then using the ImageJ analyze particles function to count numbers of internalized puncta.

Preparation, transfection, and imaging of SVZa explants

Explants from the SVZa and rostral migratory stream of neonatal Long/Evans rat pups (P0 – P5) were either directly embedded into gel substrate (mixed 1:1 with gel) or added to the top of the gel; or dissociated, nucleofected, and reaggregated in hanging drops before plating, as previously described (Ward and Rao, 2005). Neurons were allowed to migrate out of explants for 6-8 hours (immunostaining) or 19-24 hours (integrin β1 blocking experiments) before being fixed in 2% PFA at room temperature for 20 minutes.

Transfections of dissociated SVZa cells were done using the Amaxa nucleofector with rat nucleofection solution and program G-013. Cells were transfected with 1-2 µg of a cytoplasmic marker construct to show morphology. Cells transfected with dynamin constructs received 2 µg of dynamin construct plus 1 µg of the cytoplasmic marker. Dissociated cells were placed in hanging drops to form reaggregates that were plated the next morning and allowed to migrate for 4-6 hours before imaging or fixation. The migration substrate was a mixture of phenol red-free, growth factor reduced Matrigel (BD) and rat tail collagen I (BD). Explants were cultured in phenol red-free Neurobasal supplemented with B27, pen/strep, glutamine, and glucose. For time-lapse imaging experiments, 1 M HEPES was added to a 30 mM final concentration.

78 SVZa neuron migration for MiTMAB treatment was observed using a Zeiss Axiovert 200M inverted microscope with a heated stage and Orca ER cooled CCD camera (Hamamatsu), or a CoolSnap HQ camera for fluorescence time-lapse. Images were acquired every minute using either OpenLab or Slidebook software. Kymographs were generated from time-lapse movies using an ImageJ plugin written by J. Rietdorf and A. Seitz. Average velocity was calculated by measuring the position of the cell rear at the start and end of each period (pre, during, or washout) and dividing by the length of time in minutes. Time between translocations was measured by measuring the length of time between the start of a new cell rear position. Student’s t-test was used to do pair-wise comparisons between different conditions.

Immunohistochemistry and analysis

Fixed explants or 15 µm thick cryostat sections from electroporated brains were incubated in blocking solution (explants: 15% heat-inactivated goat serum, 50 mg/ml BSA, 0.03% Triton X-100 in PBS; sections: 2% heat-inactivated goat serum, 0.03% Triton X-100, 50 mg/ml BSA in PBS) for 30 minutes – 1 hour at room temperature and then incubated with primary antibodies diluted in blocking solution overnight at 4°C. After washing with PBS, samples were incubated in secondary antibody and DAPI diluted in blocking solution for 1.5 hours at room temperature. Immunofluorescence images were taken either on a Zeiss LSM510 confocal microscope or a Nikon Eclipse 80i epifluorescent microscope.

Line-scan analysis was performed in ImageJ by using the line selection tool to measure the fluorescence intensity from the rear of a cell to the tip of the leading process of confocal Z-stack maximum projections. Fluorescence intensity values were scaled to the maximum intensity value to get relative intensity along the cell length. Groups of values were averaged into bins to create 50 bins for each cell so that cells of different lengths could be compared. For group data, values for each of the 50 bins were averaged. To align cells by their nuclei, binned values were normalized to the maximum intensity values and the bins were shifted so that the first maximum values for DAPI (DAPI = 1) were aligned. This off-set the 50 bins from each other for each of the cells, so the total number of bins was greater than 50, stretching from the cells

79 that had the greatest number of bins at the rear to the cells with the greatest number of bins at the front. Average values were then calculated across cells. To determine the average “rear” fluorescence value, I averaged the values in all bins posterior to the maximum DAPI value to which cells were aligned.

For colocalization analysis, optical sections of confocal image Z-stacks were manually divided into 5 regions based on morphology: tip of the leading process, identified as the growth cone tip to wrist; distal leading process, identified as wrist to dilation start; dilation, identified as the enlarged cytoplasmic region proximal to the soma; soma, from the end of the dilation to the end of the nucleus; and rear, including any region of the cell beyond the nucleus to the end of the cytoplasm. The JACoP plugin was used to calculate Pearson’s coefficient for each region (Bolte and Cordelieres, 2006). Student’s t-test was used to do pair-wise comparisons between each region.

Migration distance analysis from explants was performed by manually counting the number of cell nuclei in equally spaced concentric rings beyond the edge of the explant to examine the distribution of cells that have migrated out of the explant. Student’s t-test was used to do pair-wise comparisons between different conditions.

In utero electroporation

In utero electroporation into mouse embryos at E13.5 (day of plug = E0.5) was performed as previously described (Tabata and Nakajima, 2001). 0.5 µg/µl GFP with 1 µg/µl of the construct of interest was dissolved in PBS containing fast green for injection. Electroporated brains were collected at E15.5 (2 days), E17.5 (4 days), or P1, and fixed in 4% PFA. All animals were treated under protocols approved by Stanford University Institutional Animal Use and Care Committee. Images of anti- GFP and DAPI-stained cortical sections were divided into 10 equally-sized bins from pia surface to ventricle. GFP images were thresholded and the ImageJ Analyze Particles function was used to count GFP+ cells in each bin.

80 Acknowledgments

We thank Shalu Srinivasan for performing electroporation surgeries; Chris Kaznowski for technical assistance; John Perrino and Ibanri Phanwar from Cell Sciences Imaging Facility for EM and array tomography assistance; Frances Brodsky, Christopher Esk, Sandra Schmid, Tomas Kirchhausen, Phil Robinson, Harald Stenmark, Timothy Ryan, and Roger Tsien for reagents and discussion, and Jerry Crabtree, W. James Nelson, and Tim Stearns for use of equipment. Funded by NIH MH51864. JCS was supported by a National Defense Science and Engineering Graduate Fellowship.

81 References

Bai, J., Ramos, R.L., Ackman, J.B., Thomas, A.M., Lee, R.V., and LoTurco, J.J. (2003). RNAi reveals doublecortin is required for radial migration in rat neocortex. Nat Neurosci 6, 1277-1283.

Beadle, C., Assanah, M.C., Monzo, P., Vallee, R., Rosenfeld, S.S., and Canoll, P. (2008). The role of myosin II in glioma invasion of the brain. Molecular biology of the cell 19, 3357-3368.

Belvindrah, R., Hankel, S., Walker, J., Patton, B.L., and Muller, U. (2007b). Beta1 integrins control the formation of cell chains in the adult rostral migratory stream. J Neurosci 27, 2704-2717.

82 Blanpied, T.A., Scott, D.B., and Ehlers, M.D. (2002). Dynamics and regulation of clathrin coats at specialized endocytic zones of dendrites and spines. Neuron 36, 435- 449.

Bolte, S., and Cordelieres, F.P. (2006). A guided tour into subcellular colocalization analysis in light microscopy. J Microsc 224, 213-232.

Bonanomi, D., Fornasiero, E.F., Valdez, G., Halegoua, S., Benfenati, F., Menegon, A., and Valtorta, F. (2008). Identification of a developmentally regulated pathway of membrane retrieval in neuronal growth cones. Journal of cell science 121, 3757-3769.

Bretscher, M.S. (1976). Directed lipid flow in cell membranes. Nature 260, 21-23.

Bretscher, M.S. (1996a). Getting membrane flow and the cytoskeleton to cooperate in moving cells. Cell 87, 601-606.

Bretscher, M.S. (1996b). Moving membrane up to the front of migrating cells. Cell 85, 465-467.

Bretscher, M.S. (2008). On the shape of migrating cells--a 'front-to-back' model. Journal of cell science 121, 2625-2628.

Broussard, J.A., Webb, D.J., and Kaverina, I. (2008). Asymmetric focal adhesion disassembly in motile cells. Curr Opin Cell Biol 20, 85-90.

Caswell, P.T., and Norman, J.C. (2006). Integrin trafficking and the control of cell migration. Traffic (Copenhagen, Denmark) 7, 14-21.

83 Chao, W.T., and Kunz, J. (2009). Focal adhesion disassembly requires clathrin- dependent endocytosis of integrins. FEBS Lett 583, 1337-1343.

Conner, S.D., and Schmid, S.L. (2003). Regulated portals of entry into the cell. Nature 422, 37-44.

Cukierman, E., Pankov, R., Stevens, D.R., and Yamada, K.M. (2001). Taking cell- matrix adhesions to the third dimension. Science 294, 1708-1712.

Cukierman, E., Pankov, R., and Yamada, K.M. (2002). Cell interactions with three- dimensional matrices. Curr Opin Cell Biol 14, 633-639.

Damke, H., Baba, T., van der Bliek, A.M., and Schmid, S.L. (1995). Clathrin- independent pinocytosis is induced in cells overexpressing a temperature-sensitive mutant of dynamin. J Cell Biol 131, 69-80.

Damke, H., Baba, T., Warnock, D.E., and Schmid, S.L. (1994). Induction of mutant dynamin specifically blocks endocytic coated vesicle formation. J Cell Biol 127, 915- 934.

Davies, P.J., Cornwell, M.M., Johnson, J.D., Reggianni, A., Myers, M., and Murtaugh, M.P. (1984). Studies on the effects of dansylcadaverine and related compounds on receptor-mediated endocytosis in cultured cells. Diabetes Care 7 Suppl 1, 35-41.

DeMali, K.A., Barlow, C.A., and Burridge, K. (2002). Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J Cell Biol 159, 881-891.

84 Doetsch, F., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1997). Cellular composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J Neurosci 17, 5046-5061.

Dulabon, L., Olson, E.C., Taglienti, M.G., Eisenhuth, S., McGrath, B., Walsh, C.A., Kreidberg, J.A., and Anton, E.S. (2000). Reelin binds alpha3beta1 integrin and inhibits neuronal migration. Neuron 27, 33-44.

Edmondson, J.C., and Hatten, M.E. (1987). Glial-guided granule neuron migration in vitro: a high resolution time-lapse video microscopic study. J. Neurosci. 7, 1928- 1934.

Elias, L.A., Wang, D.D., and Kriegstein, A.R. (2007). Gap junction adhesion is necessary for radial migration in the neocortex. Nature 448, 901-907.

Esk, C., Chen, C.Y., Johannes, L., and Brodsky, F.M. (2010). The clathrin heavy chain isoform CHC22 functions in a novel endosomal sorting step. J Cell Biol 188, 131-144.

Even-Ram, S., and Yamada, K.M. (2005). Cell migration in 3D matrix. Curr Opin Cell Biol 17, 524-532.

Ezratty, E.J., Bertaux, C., Marcantonio, E.E., and Gundersen, G.G. (2009). Clathrin mediates integrin endocytosis for focal adhesion disassembly in migrating cells. J Cell Biol 187, 733-747.

85 Ezratty, E.J., Partridge, M.A., and Gundersen, G.G. (2005). Microtubule-induced focal adhesion disassembly is mediated by dynamin and focal adhesion kinase. Nat Cell Biol 7, 581-590.

Fatemi, S.H., and Folsom, T.D. (2009). The neurodevelopmental hypothesis of schizophrenia, revisited. Schizophr Bull 35, 528-548.

Friedl, P., and Brocker, E.B. (2000). The biology of cell locomotion within three- dimensional extracellular matrix. Cell Mol Life Sci 57, 41-64.

Fukata, M., Nakagawa, M., and Kaibuchi, K. (2003). Roles of Rho-family GTPases in cell polarisation and directional migration. Curr Opin Cell Biol 15, 590-597.

Gasser, U.E., and Hatten, M.E. (1990). CNS neurons migrate on astroglial fibers from heterotypic brain regions in vitro. Proc. Natl. Acad. Sci. USA 87, 4543-4547.

Gershon, E.S., and Rieder, R.O. (1992). Major disorders of mind and brain. Sci. Am. 267, 127-133.

86 Gillooly, D.J., Morrow, I.C., Lindsay, M., Gould, R., Bryant, N.J., Gaullier, J.M., Parton, R.G., and Stenmark, H. (2000). Localization of phosphatidylinositol 3- phosphate in yeast and mammalian cells. Embo J 19, 4577-4588.

Gregory, W.A., Edmondson, J.C., Hatten, M.E., and Mason, C.A. (1988). Cytology and neuron-glial apposition of migrating cerebellar granule cells in vitro. J Neurosci 8, 1728-1738.

Gupton, S.L., and Waterman-Storer, C.M. (2006). Spatiotemporal feedback between actomyosin and focal-adhesion systems optimizes rapid cell migration. Cell 125, 1361-1374.

Henley, J.R., Krueger, E.W., Oswald, B.J., and McNiven, M.A. (1998). Dynamin- mediated internalization of caveolae. J Cell Biol 141, 85-99.

Homayouni, R., Rice, D.S., Sheldon, M., and Curran, T. (1999). Disabled-1 binds to the cytoplasmic domain of amyloid precursor-like protein 1. J Neurosci 19, 7507- 7515.

Ji, L., Lim, J., and Danuser, G. (2008). Fluctuations of intracellular forces during cell protrusion. Nat Cell Biol 10, 1393-1400.

Kamiguchi, H. (2003). The mechanism of axon growth: what we have learned from the cell adhesion molecule L1. Mol Neurobiol 28, 219-228.

87 Kaverina, I., Krylyshkina, O., and Small, J.V. (2002). Regulation of substrate adhesion dynamics during cell motility. The international journal of biochemistry & cell biology 34, 746-761.

Kirfel, G., Rigort, A., Borm, B., and Herzog, V. (2004). Cell migration: mechanisms of rear detachment and the formation of migration tracks. Eur J Cell Biol 83, 717-724.

Kruchten, A.E., and McNiven, M.A. (2006). Dynamin as a mover and pincher during cell migration and invasion. Journal of cell science 119, 1683-1690.

Lauffenburger, D.A., and Horwitz, A.F. (1996). Cell migration: a physically integrated molecular process. Cell 84, 359-369.

Le Roy, C., and Wrana, J.L. (2005). Signaling and endocytosis: a team effort for cell migration. Developmental cell 9, 167-168.

Liu, G., Beggs, H., Jurgensen, C., Park, H.T., Tang, H., Gorski, J., Jones, K.R., Reichardt, L.F., Wu, J., and Rao, Y. (2004). Netrin requires focal adhesion kinase and Src family kinases for axon outgrowth and attraction. Nat Neurosci 7, 1222-1232.

Liu, S.H., Marks, M.S., and Brodsky, F.M. (1998). A dominant-negative clathrin mutant differentially affects trafficking of molecules with distinct sorting motifs in the class II major histocompatibility complex (MHC) pathway. J Cell Biol 140, 1023- 1037.

88 Macia, E., Ehrlich, M., Massol, R., Boucrot, E., Brunner, C., and Kirchhausen, T. (2006). Dynasore, a cell-permeable inhibitor of dynamin. Developmental cell 10, 839- 850.

Marin, O., Valdeolmillos, M., and Moya, F. (2006). Neurons in motion: same principles for different shapes? Trends Neurosci 29, 655-661.

McManus, M.F., and Golden, J.A. (2005). Neuronal migration in developmental disorders. Journal of child neurology 20, 280-286.

Moskowitz, H.S., Heuser, J., McGraw, T.E., and Ryan, T.A. (2003). Targeted chemical disruption of clathrin function in living cells. Molecular biology of the cell 14, 4437-4447.

Nadarajah, B., Brunstrom, J.E., Grutzendler, J., Wong, R.O., and Pearlman, A.L. (2001). Two modes of radial migration in early development of the cerebral cortex. Nat Neurosci 4, 143-150.

Nishimura, T., and Kaibuchi, K. (2007). Numb controls integrin endocytosis for directional cell migration with aPKC and PAR-3. Developmental cell 13, 15-28.

O'Rourke, N.A., Dailey, M.E., Smith, S.J., and McConnell, S.K. (1992). Diverse migratory pathways in the developing cerebral cortex. Science 258, 299-302.

O'Rourke, N.A., Sullivan, D.P., Kaznowski, C.E., Jacobs, A.A., and McConnell, S.K. (1995). Tangential migration of neurons in the developing cerebral cortex. Development 121, 2165-2176.

89 Palamidessi, A., Frittoli, E., Garre, M., Faretta, M., Mione, M., Testa, I., Diaspro, A., Lanzetti, L., Scita, G., and Di Fiore, P.P. (2008). Endocytic trafficking of Rac is required for the spatial restriction of signaling in cell migration. Cell 134, 135-147.

Palecek, S.P., Schmidt, C.E., Lauffenburger, D.A., and Horwitz, A.F. (1996). Integrin dynamics on the tail region of migrating fibroblasts. Journal of cell science 109 ( Pt 5), 941-952.

Pellinen, T., and Ivaska, J. (2006). Integrin traffic. Journal of cell science 119, 3723- 3731.

Pierini, L.M., Lawson, M.A., Eddy, R.J., Hendey, B., and Maxfield, F.R. (2000). Oriented endocytic recycling of alpha5beta1 in motile neutrophils. Blood 95, 2471- 2480.

Quan, A., McGeachie, A.B., Keating, D.J., van Dam, E.M., Rusak, J., Chau, N., Malladi, C.S., Chen, C., McCluskey, A., Cousin, M.A., and Robinson, P.J. (2007). Myristyl trimethyl ammonium bromide and octadecyl trimethyl ammonium bromide are surface-active small molecule dynamin inhibitors that block endocytosis mediated by dynamin I or dynamin II. Mol Pharmacol 72, 1425-1439.

Ren, X.R., Ming, G.L., Xie, Y., Hong, Y., Sun, D.M., Zhao, Z.Q., Feng, Z., Wang, Q., Shim, S., Chen, Z.F., et al. (2004). Focal adhesion kinase in netrin-1 signaling. Nat Neurosci 7, 1204-1212.

90 Rid, R., Schiefermeier, N., Grigoriev, I., Small, J.V., and Kaverina, I. (2005). The last but not the least: the origin and significance of trailing adhesions in fibroblastic cells. Cell Motil Cytoskeleton 61, 161-171.

Schaar, B.T., and McConnell, S.K. (2005). Cytoskeletal coordination during neuronal migration. Proc Natl Acad Sci U S A 102, 13652-13657.

Schneider, I.C., Hays, C.K., and Waterman, C.M. (2009). Epidermal growth factor- induced contraction regulates paxillin phosphorylation to temporally separate traction generation from de-adhesion. Molecular biology of the cell 20, 3155-3167.

Shastry, B.S. (2007). Developmental dyslexia: an update. J Hum Genet 52, 104-109.

Smilenov, L.B., Mikhailov, A., Pelham, R.J., Marcantonio, E.E., and Gundersen, G.G. (1999). Focal adhesion motility revealed in stationary fibroblasts. Science 286, 1172- 1174.

91 Solecki, D.J., Trivedi, N., Govek, E.E., Kerekes, R.A., Gleason, S.S., and Hatten, M.E. (2009). Myosin II motors and F-actin dynamics drive the coordinated movement of the centrosome and soma during CNS glial-guided neuronal migration. Neuron 63, 63-80.

Strachan, L.R., and Condic, M.L. (2004). Cranial neural crest recycle surface integrins in a substratum-dependent manner to promote rapid motility. J Cell Biol 167, 545-554.

Tabata, H., and Nakajima, K. (2001). Efficient in utero gene transfer system to the developing mouse brain using electroporation: visualization of neuronal migration in the developing cortex. Neuroscience 103, 865-872.

Traub, L.M. (2009). Tickets to ride: selecting cargo for clathrin-regulated internalization. Nature reviews 10, 583-596.

Tsai, J.W., Bremner, K.H., and Vallee, R.B. (2007). Dual subcellular roles for LIS1 and dynein in radial neuronal migration in live brain tissue. Nat Neurosci 10, 970-979.

Tsai, J.W., Chen, Y., Kriegstein, A.R., and Vallee, R.B. (2005). LIS1 RNA interference blocks neural stem cell division, morphogenesis, and motility at multiple stages. J Cell Biol 170, 935-945.

Ungewickell, E.J., and Hinrichsen, L. (2007). Endocytosis: clathrin-mediated membrane budding. Curr Opin Cell Biol 19, 417-425.

92 Vallee, R.B., Seale, G.E., and Tsai, J.W. (2009). Emerging roles for myosin II and cytoplasmic dynein in migrating neurons and growth cones. Trends Cell Biol 19, 347- 355. van der Bliek, A.M., Redelmeier, T.E., Damke, H., Tisdale, E.J., Meyerowitz, E.M., and Schmid, S.L. (1993). Mutations in human dynamin block an intermediate stage in coated vesicle formation. J Cell Biol 122, 553-563.

Vassilopoulos, S., Esk, C., Hoshino, S., Funke, B.H., Chen, C.Y., Plocik, A.M., Wright, W.E., Kucherlapati, R., and Brodsky, F.M. (2009). A role for the CHC22 clathrin heavy-chain isoform in human glucose metabolism. Science 324, 1192-1196.

Vicente-Manzanares, M., Choi, C.K., and Horwitz, A.R. (2009). Integrins in cell migration--the actin connection. Journal of cell science 122, 199-206.

Vicente-Manzanares, M., Webb, D.J., and Horwitz, A.R. (2005). Cell migration at a glance. Journal of cell science 118, 4917-4919.

Ward, M.E., and Rao, Y. (2005). Investigations of neuronal migration in the central nervous system. Methods Mol Biol 294, 137-156.

Webb, D.J., Parsons, J.T., and Horwitz, A.F. (2002). Adhesion assembly, disassembly and turnover in migrating cells -- over and over and over again. Nat Cell Biol 4, E97- 100.

93 Wen, Y., Eng, C.H., Schmoranzer, J., Cabrera-Poch, N., Morris, E.J., Chen, M., Wallar, B.J., Alberts, A.S., and Gundersen, G.G. (2004). EB1 and APC bind to mDia to stabilize microtubules downstream of Rho and promote cell migration. Nat Cell Biol 6, 820-830.

Wichterle, H., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1997). Direct evidence for homotypic, glia-independent neuronal migration. Neuron 18, 779-791.

Yuasa, S., Kawamura, K., Kuwano, R., and Ono, K. (1996). Neuron-glia interrelations during migration of Purkinje cells in the mouse embryonic cerebellum. Int J Dev Neurosci 14, 429-438.

Zhou, P., Porcionatto, M., Pilapil, M., Chen, Y., Choi, Y., Tolias, K.F., Bikoff, J.B., Hong, E.J., Greenberg, M.E., and Segal, R.A. (2007). Polarized signaling endosomes coordinate BDNF-induced chemotaxis of cerebellar precursors. Neuron 55, 53-68.

94 Figure 2.1 Components of CME are present in the dilation of migrating neurons. (A) Immunostaining for components of the clathrin endocytic machinery (green): clathrin heavy chain (left), clathrin light chain (middle), and the clathrin adaptor AP-2 (right). (B) Example of the variation in relative fluorescence intensity from a single line scan over the length of a neuron (inset) stained for AP-2 (green) and clathrin light chain (red). Note the coincidence of the peaks. (C) Individual line scans were binned to create 50 averaged regions along the length of the cell so that cells of different lengths could be compared. Averaged line scan data for clathrin heavy chain (n = 5) shows a peak of intensity in the dilation, just ahead of the nucleus (DAPI, blue). (D) TEM of a migrating neurons reveals CCVs (arrows) near and in the dilation. The direction of migration is toward the lower righthand corner.

95 A B 1.2 AP-2 clathrin light chain DAPI 1.0

0.8

0.6

0.4

clathrin clathrin AP-2, 0.2 heavy chain light chain α-adaptin

Fluorescence intensity (a.u.) 0 DAPI 0 10 20 30 40 Distance (µm)

96 C 1.0 clathrin heavy chain DAPI D 0.8

0.6

0.4

0.2

Average fluorescence intensity Average 0 1 µm Rear Distance (bin) Tip Figure 2.2 Clathrin localization to the dilation is specific. (A) Immunostaining for Golgi (GM130) and clathrin light chain. Subtracting the Golgi image from the clathrin image suggests that only a small fraction of clathrin in the dilation is Golgi-associated. (B) Average line scans for caveolin-1 (n = 9) shows peak intensity in the tip of the leading process.

97 A B caveolin-1 0.8 DAPI n = 9

0.6

98 0.4

0.2 Average fluorescence intensity Average

Golgi (GM130) clathrin light chain clathrin minus Golgi 0 DAPI Rear Distance (bin) Tip Figure 2.3 The dilation is a site of active endocytosis. SVZa neurons expressing either GFP, eGFP-FKBP-clathrin light chain, or YFP-2xFYVE were exposed to Alexa 594-conjugated transferrin for 2 minutes or 10 minutes. (A) At 2 min, transferrin is primarily localized to the dilation region, where it colocalizes with (B) clathrin light chain. (C) After 10 min, transferrin shows colocalization with YFP-2xFYVE early endosomes in the dilation.

99 A Localization of transferrin puncta 70 ** 60

% transferrin 20

0 Rear Soma Dilation Distal lp Tip

B 2 min transferrin

eGFP-CLC

DAPI Overlap

C 10 min transferrin

YFP-2xFYVE

Overlap

100 Figure 2.4 Components of CME colocalize with adhesions. (A, B) TEM of migrating neurons reveals clathrin-coated pits and vesicles (arrows) at points of ECM attachment (arrowheads). (C) Immunostaining for clathrin light chain (green arrows) and an activated form of integrin β1 (red arrows) show overlap (yellow arrows) in the dilation. (D) Average Pearson’s coefficients for each subcellular region (n = 10, p < 0.01, mean ± SEM). LP = leading process.

101 A C clathrin light chain

integrin β1, active

DAPI

102 0.7 B D ** 0.6

0.5

0.4

0.3

0.2 Pearson’s Coefficient Pearson’s 0.1

0.2 µm 0 Rear Soma Dilation Distal LP Tip Figure 2.5 Clathrin adaptors colocalize with integrin β1. Immunostaining for integrin β1 (red arrows) and clathrin adaptors (green arrows): (A) AP-2, (C) Dab2, and (E) Numb. Average Pearson’s coefficients for each subcellular region for (B) AP-2 (n = 12), (D) Dab2 (n = 9), (F) Numb (n = 6). **p < 0.01, *p < 0.05, mean ± SEM, Student’s t-test.

103 * ** * ** A B ** *

** * C D *

E F 0.5 * 0.45

Numb 0.4

0.35

0.3 active 0.25 integrin β1 0.2 0.15

0.1 Pearson’s Coefficient Pearson’s DAPI 0.05

overlap 0 Rear Soma Dilation Distal LP Tip

104 Figure 2.6 Integrin β1 mediates migration in SVZa explants cultured in a Matrigel/collagen I matrix. (C) Migration was inhibited by (B) the presence of 10 µg/ml integrin β1-blocking antibody (Ha2/5) in the media compared to (A) an isotype control (IgM). **p < 0.01, *p < 0.05, mean ± SEM, Student’s t-test.

105 A C A B

C 160

140

120

B D 100

40 **

Average migration distance (µm) Average 20

0 IgM Ha2/5

106 Figure 2.7 Adhesion molecules enriched in the tip of the leading process differ from those enriched in the dilation. Line scans of relative fluorescence intensity along the length of a migrating neuron were normalized into 50 equivalent bins so that intensities could be compared across cells with different lengths. Shown are the average intensities, with example images in the insets, for: (A) ILK (n = 9). (B) FAK, phosphorylated at Y577 (n = 9). (C) FAK, phosphorylated at Y861 (n = 18).

107 A 0.9 ILK 0.8 actin 0.7 DAPI 0.6 0.5 0.4 0.3 0.2 0.1 0 B 0.9 0.8 FAK, pY577 0.7 GFP DAPI 0.6 0.5 0.4 0.3 0.2 0.1 0 C 0.8 0.7 FAK, pY861 GFP 0.6 DAPI 0.5 0.4 0.3 0.2 0.1

Ave. fluorescence intensity Ave. fluorescence intensity Ave. fluorescence intensity fluorescence intensity Ave. fluorescence intensity Ave. Ave. 0 Rear Distance (bin) Tip

108 Figure 2.8 Dominant negative dynamin impairs SVZa neuron migration. (A) Fewer cells migrate out of explants expressing K44A-dyn compared to WT-dyn. (B) Example time-lapse series of cells in the same culture expressing either WT-dyn with tdTomato (red arrow) or K44A-dyn with GFP (green arrow). Kymographs showing position (x-axis) over time (y-axis) highlight movement of the cell body. Leading process movement can also be seen in the K44A-dyn/GFP cell. (C) Cells that do migrate out of explants exhibit altered dynamics. K44A-dyn expressing cells have significantly lower velocity. (D) This is likely due to the greater percentage of K44A- dyn cells do not migrate, or have slower rates than those expressing WT-dyn.

109 A Effect of K44A-dyn Expression B On Migration Distance 140

120 100

60 ** 40

% cells migrating out of explants 0 WT-dyn K44A-dyn

C Effect of K44A-dyn Expression On Velocity 12

6 * 4

Average velocity (µm/hr) Average 2

0 WT-dyn K44A-dyn

D Cells migrating at different velocities 50

% cells 20 tdTomato + WT-dyn

10 GFP + K44A-dyn 0 0 µm/hr < 5 µm/hr 5 - 10 > 10 µm/hr µm/hr

110 Figure 2.9 MiTMAB blocks CME but not bulk fluid phase uptake, and increases surface integrin β1 levels. (A) Clathrin-mediated endocytosis, assayed by transferrin internalization, is significantly inhibited in the presence of 50 and 100 µM MiTMAB. (B) Bulk fluid-phase uptake, assayed by dextran internalization, is not affected until 100 µM MiTMAB. (C) Surface integrin β1 levels were increased in the presence of 30 µM MiTMAB. **p < 0.01, *p < 0.05, mean ± SEM, Student’s t-test.

111 Effect of MiTMAB on transferrin internalization A 120

100

80 ** **

40 % transferrin internalized 20

0 DMSO 10 µM 30 µM 50 µM 100 µM [MiTMAB]

Effect of MiTMAB on dextran internalization B 120

100

80 ** 60

40 % dextran internalized 20

0 DMSO 10 µM 30 µM 50 µM 100 µM [MiTMAB]

Effect of MiTMAB on surface integrin β1 levels C 250

* 200

150

100

% surface integrin β 1 50

0 DMSO 5 µM 10 µM 30 µM [MiTMAB]

112 Figure 2.10 The dynamin inhibitor dynasore affects bulk fluid-phase uptake at high concentrations. Although dynasore inhibits transferrin internalization at 200 µM and 400 µM (A), it also affects dextran internalization at those concentrations (B). Thus, studies using dynasore were not included in this work.

113 Effect of dynasore on transferrin internalization A 160

140

120

100

80 ** 60

40 ** % transferrin internalized 20

0 DMSO 10 µM 50 µM 100 µM 200 µM 400 µM [Dynasore]

Effect of dynasore on dextran internalization B 160

140

120

100 **

80 *

40 % dextran internalized 20

0 DMSO 10 µM 50 µM 100 µM 200 µM 400 µM [Dynasore]

114 Figure 2.11 Inhibiting dynamin impairs SVZa neuron migration. (A) Images of explants treated with varying concentrations of MiTMAB. Fewer DAPI-stained nuclei are present outside the explant at increasingly higher concentrations of MiTMAB. (B) Effect of MiTMAB treatment on the percentage of cell nuclei present in evenly-spaced concentric rings surrounding the explant at increasing distances. * P < 0.05; ** P < 0.01, mean ± SEM, Student’s t-test (C) Time-lapse series (images obtained every 10 minutes) of two neurons treated with MiTMAB. The yellow line shows the position of the dilation at the time of MiTMAB addition; this position marks that of the cell rear after washout. (Bottom) Kymographs plotting time vs. position highlight the positions of the cell rears. See Movies S1, S2. (D) Average velocity (µm/hr) of neurons migrating before the addition of MiTMAB is significantly faster than that in the presence of the drug or after washout (n = 19, p < 0.01, mean ± SEM). The amount of time a cell spends in the same position between translocations is significantly longer after washout (n = 16) compared to either before (n = 15, ** p < 0.001) or in the presence of MiTMAB (n = 16, ** p < 0.001).

115 A C

Vehicle 10 µM 30 µM 50 µM Pre-drug

80 B Vehicle (1% DMSO) 70 * 60 30 µM ** 50 µM ** 50 40 30

30 µM MiTMAB 20 10 Percentage of cells (%) 0 116 1 - close 2 3 4 5 - far Migration distance (from edge of explant)

D 18 90 16 80 ** Washout 14 70

12 60

10 ** 50 8 40

6 ** 30 **

4 20 Average velocity (µm/hr) Average

2 10 Time Average time between jumps (min) Average 0 0 Pre During Washout Pre During Washout Position Position Figure 2.12 The microtubule and actin cytoskeleton is intact in neurons treated with MiTMAB. Immunostaining for α-tubulin (green) and F-actin (red, phalloidin) in vehicle (1% DMSO) and MiTMAB-treated neurons reveals that the organization of the microtubule and actin cytoskeleton in MiTMAB-treated cells appears normal.

117 MiTMAB DMSO α-tubulin F-actin(phalloidin)Merge

118 Figure 2.13 Inhibiting dynamin alters the morphology of and distribution of adhesion proteins in migrating neurons. (A,B) Cytoplasmic GFP and DAPI reveal the morphology of neurons treated with (A) 1% DMSO vehicle or (B) MiTMAB. (C- H) Average line scans of fluorescence intensity for integrin β1 (C, control, n = 20; D, MiTMAB, n = 14), active integrin β1 (E, control, n = 9; F, MiTMAB, n = 7), and FAK (G, control, n = 9; H, MiTMAB, n = 5) reveal that adhesion proteins are found at the rear of MiTMAB-treated cells. Average intensity values for 10 bins at the rear are significantly different (p < 0.01) between control and MiTMAB-treated cells for each adhesion protein shown.

119

120

30 µM MiTMAB Control B DFH A CEG GFP DAPIIntegrinβ1(active)Focaladhesionkinase DAPI

Ave. fluorescence intensity Ave. fluorescence intensity 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 0 Rear Distance(bin) Tip Rear Distance(bin) Tip RearDistance(bin) Tip 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 0 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 0 Figure 2.14 Individual cells show varied adhesion distributions. Individual and average line scans of fluorescence intensity along the lengths of migrating neurons in control (A-C) and MiTMAB-treated cells (D-F) for (A, D) integrin β1, (B, E) active integrin β1, and (C, F) FAK. Each colored line is the relative fluorescence intensity for an individual cell normalized into 50 bins. The averaged data for the adhesion molecule and DAPI are represented by thick black and blue lines, respectively.

121

122

30 µM MiTMAB Control

Fluorescence intensity (a.u.) Fluorescence intensity (a.u.) 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 D EF A BC Rear Distance(bin) Tip Rear Distance (bin) Tip RearDistance(bin) Tip Integrin β1 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 β1 (active)Focaladhesionkinase 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 DAPI Average Figure 2.15 Excess rear membrane and adhesion staining are apparent in MiTMAB-treated neurons. Average line scans of cells aligned by their nuclei, as determined by maximum normalized DAPI value (DAPI = 1). (A) Integrin β1 (B) Active integrin β1 (C) FAK.

123 A 1.2 DAPI-control Controlintb1-control integrin β1 DAPI-MiTMAB MiTMABintb1-MiTMAB 1.0 Control DAPI MiTMAB 0.8

0.6

0.4

0.2 Ave. fluorescence intensity Ave.

0 B 1.2 DAPI-control integrin β1 ControlHUTS21-control DAPI-MiTMAB 1.0 (active) MiTMABHUTS21-MiTMAB Control DAPI MiTMAB 0.8

0.6

0.4

0.2 Ave. fluorescence intensity Ave.

C 1.2 DAPI-control ControlFAK-control FAK DAPI-MiTMAB MiTMABFAK-MiTMAB 1.0 Control DAPI MiTMAB 0.8

0.6

0.4

0.2 Ave. fluorescence intensity Ave.

0 Rear Distance (bin) Tip

124 Figure 2.16 Individual line scan data for cells aligned by nuclei.

125

126

30 µM MiTMAB Control

Fluorescence intensity (a.u.) Fluorescence intensity (a.u.) 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 D EF A BC Rear Distance(bin) Tip RearDistance (bin) Tip RearDistance(bin) Tip Integrin β1(active)Focaladhesionkinase 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 0.2 0.4 0.6 0.8 1.0 1.2 0.2 0.4 0.6 0.8 1.0 1.2 0 0 DAPI Average Figure 2.17 Effect of MiTMAB on adhesion at rear. (A) Average fluorescence intensity of adhesion markers for rear 10 bins in unaligned cells. (B) Average fluorescence intensity of adhesion markers for all bins posterior to maximum DAPI value in aligned cells. * p < 0.05, ** p < 0.01

127 A Effect of MiTMAB on rear fluorescence values, unaligned 0.5 Control ** MiTMAB ** 0.4 **

0.3

0.2

0.1 Ave. fluorescence intensity Ave.

0 integrin β1 integrin β1, FAK active

B Effect of MiTMAB on rear fluorescence values, DAPI-aligned

** Control 0.3 MiTMAB **

0.2

* 0.1 Ave. fluorescence intensity Ave.

0 integrin β1 integrin β1, FAK active

128 Figure 2.18 Inhibiting clathrin impairs SVZa neuron migration. (A) Fewer DAPI- stained nuclei are present outside the explant at increasingly higher concentrations of MDC. * p < 0.05; ** p < 0.01, mean ± SEM, Student’s t-test (B) Time-lapse series of two neurons treated with MDC. The yellow line shows the position of the dilation at the time of MiTMAB addition; this position marks that of the cell rear after washout. (Bottom) Kymographs plotting time vs. position highlight the positions of the cell rears. (C) Average velocity (µm/hr) of neurons migrating before the addition of MDC is significantly faster than that in the presence of the drug or after washout (n = 63, p < 0.001, mean ± SEM). The amount of time a cell spends in the same position between translocations is significantly longer after washout (n = 66) compared to either before (n = 48, ** p < 0.001) or in the presence of MDC (n = 40, ** p < 0.001).

129 B 0’ 0’

6’ A 10’ 140 12’ 120 18’ Pre-drug 20’ 100 24’ 80 31’ 31’ * 60 * 36’ 40’ 40 42’ 20 ** 48’ Percentage of cells (%) 50’ 50 µM MDC 130 0 Vehicle 10 µM 50 µM 100 µM 54’ (DMSO) Concentration of MDC 62’ 62’

C 14 60 66’ 70’ 12 72’ 50 **

10 78’ 80’ ** 40

Washout 84’ 8 ** ** 30 90’ 90’ 6

20 4 Average velocity (µm/hr) Average 2 10 Time Average time between jumps (min) Average 0 0 Pre During Washout Pre During Washout Position Position Figure 2.19 MDC blocks CME, but not bulk fluid phase uptake. (A) Clathrin- mediated endocytosis, assayed by transferrin internalization, is significantly inhibited in the presence of 50 and 100 µM MDC. (B) Bulk fluid-phase uptake, assayed by dextran internalization, is not affected at these concentrations. (C) Surface integrin β1 levels were also not affected by MDC treatment. **p < 0.01, *p < 0.05, mean ± SEM, Student’s t-test.

131 Effect of MDC on transferrin internalization A 120

100

80 * 60

40 ** % transferrin internalized 20

0 DMSO 10 µM 25 µM 50 µM 100 µM [MDC] Effect of MDC on dextran internalization B 200 180 160 140 120 100 80 60

% dextran internalized 40 20 0 DMSO 10 µM 25 µM 50 µM 100 µM [MDC] Effect of MDC on surface integrin β1 levels C 180 160

140

120 100 80

60 40 % surface integrin β 1 20

0 DMSO 10 µM 25 µM 50 µM 100 µM [MDC]

132 Figure 2.20 YFP-2xFYVE shows early endosomes are enriched in the dilation of migrating neurons and move forward during migration. (A) YFP-2xFYVE vesicles present in the dilation of a migrating neuron. (B) YFP-2xFYVE colocalizes with EEA1, indicating it marks early endosomes. (C) Time-lapse series of a neuron expressing mCherry (red) to highlight cell morphology and YFP-2xFYVE (green) to show early endosomes. (D) Time-lapse series of a neuron expressing YFP-2xFYVE and treated with 50 µM MDC, with kymographs of cell migration (left) and YFP- 2xFYVE vesicles (right) at the bottom. Brightfield image in magenta and YFP- 2xFYVE in green.

133 A D

mCherry YFP-2xFYVE DAPI

B Pre-drug

mCherry FYVE EEA1 Merge

C 50 µM MDC Washout Time Time

Position

134 Figure 2.21 Clathrin knockdown may lead to subtle migration defects in vivo. 4 days after introducing siRNA to knock down clathrin heavy chain with targeting construct 1 (CHC-1 siRNA), there is a significant change in the distribution of cells compared to control siRNA (p < 0.001, Chi-square test). There is an increase in cells in the lower regions of CHC-1 siRNA brains compared to control siRNA brains. n = 5 brains, 6455 cells for control siRNA. n = 2 brains, 6322 cells for CHC-1 siRNA. n = 4 brains, 3417 cells for CHC-2 siRNA.

135

136

E13 E17 (4 days) A oto CHC-1siRNA Control B C CHC-2 siRNA D

10 Bin 9 8 7 6 5 4 3 2 1 0 510152025303540 % electroporatedcells CHC-2 siRNA CHC-1 siRNA Control siRNA Figure 2.22 Clathrin heavy chain expression may be reduced in brains expressing CHC-1 siRNA but not control or CHC-2 siRNA. Intensity of CHC immunostaining fluorescence in CHC-1 siRNA electroporated brains (B) appears lower than in brains electroporated with control (A) or CHC-2 (C) siRNA constructs.

137 CHC-2 siRNA CHC-1 siRNA Control C B A GFP heavy chain clathrin,

138 Merge DAPI C’ B’ A’ Figure 2.23 Dominant negative clathrin expression leads to delayed cortical migration. (A-C) After 2 days of migration in the developing cerebral cortex, neurons expressing DN-Hub (B) did not reach the top of the cortical plate (CP) as did control cells expressing GFP only (A). DN-Hub-expressing cells in the IZ/SVZ (B’) show similar morphology to GFP-only-expressing cells (A’). (C) The distribution of cells expressing DN-Hub at E15 differs significantly from that of cells expressing GFP (p < 0.01, Chi-square test). (D-F) DN-Hub expressing neurons migrate into the CP by 4 days. DN-Hub-expressing neurons in their final position in the CP (E, E’) look morphologically similar to GFP-only expressing neurons (D, D’). (F) The distributions of cells expressing DN-Hub vs GFP do not differ significantly at E17 (Chi-square test). Scale bars, 10 µm.

139 A’ C 1 A B 2 3

B’ Bin 6

D’ 10 0 5 10 15 20 25 140

F 1 D E 2

E’ Bin 6

0 5 10 15 20 25 30 35 % electroporated cells Figure 2.24 GFP+ neurons express dominant negative constructs at E17. (A-F) Neurons that reach the top of the CP following electroporation with DN-Hub still express the dominant negative protein. (A-C) Some but not all GFP+ cells at E15 in the IZ express the T7 tag. (D-F) GFP+ cells at E17 at the top of the CP are still positive for T7 tag.

141 GFP anti-T7 DAPI

A B C

D E F

GFP anti-HA DAPI

G H I

J K L

142 K44A-dyn WT-dyn K44A-dyn WT-dyn E17 E15 K44A-dyn WT-dyn K44A-dyn WT-dyn Figure 2.25 Dominant negative dynamin I expression leads to stalled cortical migration. (A-C) Neurons expressing K44A-dyn (B) did not reach the CP after 2 days of migration in the developing cerebral cortex, unlike cells expressing WT-dyn (A). The morphology of K44A-dyn-expressing cells in the IZ (B’) appeared similar to WT- dyn-expressing cells (A’). (D-F) K44A-dyn-expressing cells were found in the intermediate zone (IZ) after 4 days. Higher power view of WT-dyn (A’) and K44A- dyn (B’) cells in the IZ at E15, and of WT-dyn cells in the CP (D’) and K44A-dyn cells in the IZ (E’) at E17. (C, F) The distributions of cells expressing K44A-dyn at E15 and E17 differ significantly from those of WT-dyn-expressing cells (p < 0.01, Chi-square test). Scale bars, 10 µm.

143 WT-dyn K44A-dyn A’ C 1 A B 2 3 4 5

B’ Bin 6 7 8

9 D’ 10

144 0 2 4 6 8 10 12 14 16 18 20

F 1 D E 2 3 4 5

E’ Bin 6 7 8 WT-dyn 9 E17-dynIWT (n=3) K44A-dynE17-K44A (n=7) 10 0 5 10 15 20 25 30 35 40 % electroporated cells Figure 2.26 GFP+ neurons express dominant negative constructs at E17. (A-L) Neurons that reach the top of the CP following electroporation with K44A-dyn still express the dominant negative protein, but at lower levels compared to cells that remain within the IZ. (A-F) GFP+ cells at E15 coexpress the dynamin I construct as assayed by immunostaining for the HA tag present in the WT-dyn and K44A-dyn constructs. (G-L) At E17, GFP+ cells in the CP of brains electroporated with K44A- dyn are positive for the HA tag (J,K inset), but GFP+ cells in the IZ express much higher levels of K44A-dyn.

145 GFP anti-T7 DAPI

A B C

D E F

GFP anti-HA DAPI

A B C

D E F

G H I

E17 E15 J K L K44A-dyn WT-dyn K44A-dyn WT-dyn K44A-dyn WT-dyn K44A-dyn WT-dyn

146 Figure 2.27 Radial glia are intact in dominant negative-expressing cortex. Nestin (red, grayscale) staining shows that radial glial morphology in brains expressing (B, D) DN-Hub or (F, H) K44A-dyn at E15 and E17 look similar to radial glia in brains expressing (A, C) GFP only or (E, G) WT-dyn.

147 GFP DN-Hub WT-dyn K44A-dyn A B E F

148 C D G H E17 E15 E17 E15

GFP Nestin DAPI GFP Nestin DAPI Figure 2.28 α3 integrin expression is highest in the IZ. Sections of E15 cortex electroporated with GFP and either WT-dyn (top) or K44A-dyn (bottom).

149 K44A-dyn WT-dyn GFP

α3 integrin 150 DAPI Merge Figure 2.29 Dominant negative dynamin-expressing neurons extend axons but are present in the white matter at P1. Most neurons expressing DN-K44A fail to migrate into the CP by P1. (A, B, E) The greatest percentage of K44A-dyn-expressing cells is present in the white matter and the distribution of K44A-dyn cells differs significantly from that of WT-dyn cells (p < 0.01, Chi-square test). GFP+ cells in the white matter show stronger staining for K44A-dyn, as assessed by immunostaining for the HA tag (red). These cells exhibit the morphology of differentiated neurons (B, inset). (C, D) Both WT-dyn and K44A-dyn expressing neurons extend HA+ axons across the corpus callosum.

151

152 Figure 2.30 Model of Neuronal Migration. Neurons first extend an exploratory leading process that forms transient and dynamic adhesions (perforated blue lines) in the growth cone. The leading process pauses, strengthening adhesions (solid blue lines) to provide traction. A cytoplasmic dilation forms, and in this region endocytosis (gray circles) weakens adhesion. Myosin II (yellow) mediated contractions at the rear squeeze the nucleus forward and disrupt remaining attachments. Nucleokinesis into the former dilation establishes a new cell rear.

153

154 CHAPTER 3: PRELIMINARY STUDIES ON NEURONAL MIGRATION

Preface Projects described in this chapter were performed by Yin Loon Lee (adhesion force analysis) and Elizabeth Kao (kinesin studies) under my supervision.

155 Part I: Adhesion Force Analysis in Migrating Neurons Introduction During migration, cells utilize focal adhesions to exert tractive forces onto substrates. Adhesive contacts at the leading edge of a migrating cell grip the substrate and then, through direct links to structural cytoskeletal components, transmit these forces to the rest of the cell body. In previous studies on migrating neurons, we described the presence of adhesion molecules in the leading process with a lack of adhesion at the rear of the cell. In the preliminary study described here, we begin to analyze how these adhesion molecules may dynamically transmit their mechanical forces with respect to the steps in the neuronal migration cycle. Migrating neurons first extend a long, thin leading process with an exploratory growth cone. Because growth cone movements are rapid, adhesive contacts are most likely transient and relatively weak to permit dynamic exploration. After reaching the decision to move the rest of the cell in a particular direction, however, adhesions in the growth cone region may strengthen to provide traction. The cytoplasmic dilation should also be attached to the substrate with enough strength to be an intermediate anchor point into which the nucleus will move. Membrane at the rear of the cell resolves quickly after nuclear translocation, requiring that cell attachments at the rear be weakened and/or removed. Observing a migrating neuron at this stage of migration, adhesive strength may appear as a relative gradient, with stronger attachments in the leading process than in the cell soma. During the leading process extension and exploration stages of migration, the cell soma may have stronger adhesive attachments, as it stays in place while the leading process moves. Evidence from our lab (Schaar and McConnell, 2005) supports the hypothesis that a neuron during nucleokinesis has stronger attachments in the leading process than in the cell soma, while a neuron during leading process extension has stronger attachments in the cell soma. The cell soma of migrating neurons that had formed a dilation but had not yet initiated nuclear movement jumped forward when microtubules were depolymerized using nocodazole. In contrast, nocodazole treatment of cells without a dilation, likely extending and exploring with its leading process,

156 caused the leading process to retract back to the soma. These observations suggest that adhesive contacts between the leading process and the substrate are relatively strong by the time of dilation formation, and that adhesive forces demonstrate spatially regulated dynamics at different stages of migration. We can infer where points of strong contact with the migrating neuron may be present from the tensive forces exerted on the substrate. Tractive forces exerted by migrating cells trigger an equal and opposite reaction on the substrate, generating measurable mechanical stress. A variety of cell traction assays have been developed to probe the direction and magnitude of these forces, with the goal of correlating traction with cytoskeletal organization and adhesion dynamics during migration (Balaban et al., 2001; Dembo and Wang, 1999; Munevar et al., 2001; Roy et al., 2002). Here, I describe the use of Deformation Quantification and Analysis (DQA) software (Vanni et al., 2003) to analyze time-lapse images of neurons migrating through a 3D Matrigel matrix. Preliminary DQA revealed dynamic changes in the relative forces produced by distinct subcellular regions of the migrating neuron. However, inconsistencies in results obtained from control experiments suggest these results should be interpreted cautiously.

Results Adhesion Force Analysis in Migrating Neurons Brightfield time-lapse images of SVZa neurons migrating in a 3D Matrigel matrix were analyzed using DQA (Deformation Quantification and Analysis). DQA uses changes in the pattern of the matrix images to compute the strains and stresses created by cells within the matrix. Preliminary analysis of strain fields surrounding migrating neurons reveals that pulling forces emanate from the front of the leading process, but the location and direction of forces change as the neuron moves forward (Figure 3.1). Blue lines indicate matrix stretching whereas red lines indicate matrix compression; the length of each line reflects the amplitude of the deformation and the orientation shows the direction of the deformation. During nucleokinesis (Figure 3.1, 1’-2’), the matrix appears to be stretched (blue) as the soma exerts compression forces (red). The force of the nucleus moving into the dilation (4’) causes compression forces

157 parallel to the soma. Growth cone explorations (12’-22’) can be seen to dynamically stretch and push against the matrix. The matrix is stretched in front of the growth cone prior to soma advancement and in the rear as the soma moves forward. These data suggest that somal translocation occurs in two steps: first, pulling forces at the leading edge, and second, a contractile pushing force from the rear. Fluorescent microspheres mixed into the Matrigel matrix can serve as fiducial markers, such that the displacement of the beads can also reveal matrix deformations. Displacement of the beads alone could be used to estimate traction forces, because displacement is related proportionally to the traction force (Rabinovitz et al., 2001). Pilot tests analyzing fluorescence images of the microspheres using DQA yielded results inconsistent with DQA results from Matrigel images of the same culture. However, rigorous tests to determine the cause of the inconsistencies were not performed.

Discussion Coordinating Strength and Adhesion Molecules There is a complicated interplay between adhesion complex size, composition, and strength. The composition and size of adhesion complexes varies depending on the age or maturity of the complex, as well as its function and relationship with the actin cytoskeleton. It is thought that small nascent adhesions at the leading edge of migrating cells produce the strongest forces and may have high turnover rates, while larger adhesion complexes may be more persistent, mature, and weaker (Beningo et al., 2001). Likely, the strength of the adhesion complex is related to the integrity of the connection between the adhesion molecules and the cytoskeleton (Hu et al., 2007). If the adhesion complex is more tightly bound to the cytoskeleton, forces from the substrate can be transmitted directly into changes on cell shape or movement, depending on the relative adhesion strength in different regions of the cell.

Issues with DQA

As these were very preliminary studies, more parameters must be examined to

158 determine the best method for measuring adhesion forces in our 3D substrate. There are a number of alternative cell traction assays that permit finer force measurement, such as the use of a deformable, elastic substrate (e.g. silicone film) that wrinkles in response to cell adhesion and movement, or micropatterned substrates with arrays of deflectable posts where the direction and magnitude of the deflections at each post can be easily measured as a cell passes over it. Currently, DQA appears to be the best method for examining forces in the three-dimensional substrates that allow migration properties, forces, and adhesions to be more similar to that found in vivo.

Future Directions This preliminary examination of the variation in relative forces produced by a migrating neuron could be combined with information about the localization and expression levels of various adhesion molecules. Combining DQA with retrospective immunocytochemistry for adhesion molecules or dynamic imaging with GFP-tagged adhesion proteins could reveal the relationship between adhesive structures and force generation. DQA could also reveal both subtle and drastic changes in relative forces caused by changes in adhesions due to endocytosis, or cytoskeletal remodeling. The inconsistencies observed in measurements may be due to effects of other cells in the Matrigel culture. Thus, it would be important to observe isolated cells to discount external forces in the matrix and properly attribute the forces created by individual migrating neurons.

Experimental Procedures Neurons migrating out of SVZa explants were imaged every minute in phase- contrast as previously described (Schaar and McConnell, 2005). Time-lapse images were analyzed for in situ strain mapping using DQA software, available on the web at http://dqa.web.cmu.edu/ (Vanni et al., 2003). Consecutive neighboring images were summed to create a mask to remove cells and ignore intracellular organelle movements during DQA processing. Using the fiber structure of the Matrigel matrix substrate to provide pattern information, DQA software tracks deformations as a

159 displacement field. The x-y shift at subregions between images at two time points is tracked, creating displacement vectors that are regularized and interpolated to define the continuous vector field and used to calculate normalized density changes in the matrix. Default DQA settings were used, with a Cerruti-Gauss basis set for the singular value decomposition. Density changes are scaled and mapped to a blue-red color scale (expansion in blue, compaction in red). The displacement field is used to approximate principal strains at points in the matrix. First harmonic strain images were overlaid on the time-lapse images. To independently measure traction forces, we also utilized fiducial markers to measure matrix deformations. Matrigel was mixed with 1.0 µM red fluorescent FluoSpheres microspheres (Molecular Probes) prior to plating SVZa explants. The displacement of fluorescent beads observed in time-lapse images of migration through an area could be used to estimate traction forces, since displacement is related proportionally to the traction force according to Hooke’s law.

160 Part 2: The Kinesin-1 Motor Domain Accumulates at the Leading Process Tip in Migrating Neurons

Summary An early step in the formation of functional neural circuits is the migration of neurons to appropriate positions in the developing brain. Neuronal migration is a saltatory process during which a leading process extends in the direction of movement, followed by the translocation of the cell body into this process. Leading processes often branch as neurons explore the environment through which they are moving; however, these branches must be consolidated into a single leading process for cell body movement to occur efficiently. The neuron’s choice to retain a single branch may be analogous to the process of neuronal polarization during differentiation in which a single neurite is specified as the axon. Previous studies have demonstrated that the constitutively active motor domain of the kinesin heavy chain, Kif5C, can function as the earliest known marker of axonal identity, since it accumulates and persists in the neurite that becomes the axon (Jacobson et al., 2006). Here, we investigate whether Kif5C acts similarly in migrating neurons as they select a single leading process. We transfected a construct containing a truncated Kif5C sequence fused to YFP (Kif5C560-YFP) into migrating neurons to observe Kif5C localization within these cells. In fixed neurons that displayed a migratory morphology, Kif5C560- YFP was enriched at the tip of the leading process. During time-lapse imaging, Kif5C560-YFP was seen to localize to the tip of the leading process as the process extended and retracted. These results suggest that the localization of Kif5C may predict which branch is retained as the leading process, hence predicting the direction of movement in migrating neurons.

Introduction Cells typically migrate in vivo with purpose toward a specific direction. Attractive molecular cues from the destination as well as repulsive cues from the starting point guide cells along the proper routes. These guidance cues orient and

161 polarize cells so they can move in a directed manner toward their goal. In the developing brain, migrating neurons polarize by extending leading processes tipped with dynamic actin-rich growth cones in the direction of migration. This migratory neuron leading process is reminiscent of the more mature neuronal axon. Functionally, the migratory neuron and the differentiating neuron are distinguished by the requirement that the cell soma must move in a coordinated manner with leading process extension, while the soma of a neuron extending an axon remains stationary. However, certain mechanisms important for the initial establishment of polarity may be similar in migrating neurons and neurons extending axons, as they respond to similar guidance cues and require similar molecules to induce and/or maintain polarity. This preliminary study addresses whether a microtubule motor that is able to mark the neurite destined to become the axon may also be used to track and follow the leading process of a migratory neuron. In addition to having a potential role in selecting the unique process, its use as a molecular marker of the leading process could be useful for future studies of directed neuronal migration.

Directed Neuronal Migration Requires a Single Leading Process Neurons have a single nucleus. Therefore, for a neuron to move in a particular direction, there can only be a single leading process for the nucleus to follow. Establishing polarity is important in many different situations during the development of a neuron. One of the most well-known forms of neuronal polarity is the presence of a single axon to send out signals in a distinct region from the input dendrites. Choosing a single leading process during migration may be similar to events underlying axon selection from a group of equivalent neurites. It has been shown that the motor domain of Kif5C, a heavy chain isoform of conventional kinesin-1, accumulates in the future axon in differentiating neurons (Jacobson et al., 2006).

Consolidating Branches into a Single Leading Process While it is still unclear exactly how similar the migratory leading process is to the growing axon, we can use the large body of work on the initial establishment of

162 polarity in axon selection to inform our thinking about establishing polarity in migrating neurons. However, there are also distinct mechanisms involved; one of the biggest differences between axon guidance and leading process guidance appears to be the method by which they change direction in response to guidance cues. Elongating axons will turn toward or away from a guidance cue, steering with the growth cone; migrating neurons appear to branch in response to guidance cues, initiating new growth cones and processes and selecting a branch to follow (Martini et al., 2009; Ward et al., 2005). Migrating neurons then selectively maintain a process to turn toward or away from guidance molecules. This method of creating a polarized migratory neuron through the selective maintenance of a leading process requires that multiple branched processes be consolidated into a single chosen leading process. Extracellular signals likely bias the choice of a leading process. We are interested in what cytoskeletal effectors respond to these signals to induce the change in morphology. In this preliminary study, we examine whether a kinesin-1 motor domain protein that has been shown to selectively localize to the presumptive axonal neurite may be used to mark the leading process of a migrating neuron. We show that the Kif5C head region is present primarily in the tip of the leading process in migrating neurons. In addition to examining what role Kif5C plays in choosing the leading process during changes in direction, the Kif5C560-YFP construct may also be used as a marker to further examine the molecular mechanisms involved in selecting a single leading process during migration.

Results Kinesin-1 Motor Domain Localizes to the Tip of the Leading Process in Migrating Neurons Explants from the anterior subventricular zone (SVZa) of neonatal rats were transfected with Kif5C560-YFP to visualize Kif5C motor domain localization and mCherry to visualize cellular morphology. Neurons were allowed to migrate out of the explants into a 3D Matrigel/collagen matrix for 3 – 5 hours. Neurons with the presence

163 of a cytoplasmic dilation, indicating they were in the process of moving, were examined for Kif5C. In contrast to the high presence of cytoplasmic mCherry in the cell soma, Kif5C560-YFP was strongest at the tip of the leading process (Figure 3.2, n = 5 cells). This was quantified by examining fluorescence intensity along a vector drawn through a migrating neuron expressing both Kif5C560-YFP and mCherry.

Kinesin-1 Motor Domain Tracks with the Tip of the Leading Process During Extension and Retraction Events To examine the dynamics of Kif5C localization, neurons expressing Kif5C560- YFP and mCherry were imaged as they migrated through a 3D Matrigel/collagen matrix (Figure 3.3). Kif5C560-YFP stayed with the tip of the leading process as it extended and the cell soma moved forward, indicating this may be a useful marker for a migratory leading process. In another imaging session, the tip of a leading process was seen to split, with Kif5C560-YFP fluorescence present in both branches. Interestingly, Kif5C560-YFP intensity in one branch increased (45’, yellow arrow) just before retracting and consolidating with the other branch. The presence of Kif5C in both branches would suggest it may not reveal which of multiple branches may become the stabilized leading process. However, this particular example was only branched at the very tip. The situation may be different in the case of a polarity reversal or a larger branch point. More examples need to be examined. Pilot experiments with the repulsive guidance molecule Slit indicates that branching and turning can be induced in neurons migrating out of SVZa explants. Observing changes in Kif5C560-YFP localization in neurons with induced branching will be more informative about the potential for its use as a marker of a single leading process.

Discussion Establishing Polarity In Vivo Polarity has primarily been examined outside the native environment, where dissociated neurons in culture are exposed on all sides to the same cues. However, in vivo newborn neurons are polarized from conception. Cortical progenitors are

164 polarized, with primary cilia in the ventricle, apically-localized adherens junction proteins, and long basal processes with endfeet in the pial surface. Exposed to this environment however, migrating neurons still must choose a particular direction to move as they transition from birth in the ventricular zone, becoming multipolar in the intermediate zone, where they may also begin to extend an axonal process, while finally continuing to migrate up to the cortical plate with a bipolar morphology. The multipolar stage, during which the neuron is most likely also initiating axon elongation, is of particular interest in vivo as it requires a switch in polarity for the neuron. The neuron must reallocate cytoskeletal resources – membrane addition, microtubule polymerization, and various protrusion-force producing proteins. The localization of Kif5C in particular may be interesting to examine as it has now been shown to accumulate at the tips of growth cones in both future axonal neurites (Jacobson et al., 2006) as well as in a migratory leading process (this study), which is in the direction of future dendrites in vivo.

Role of Kinesin-1 in Regulating Adhesion Disassembly While it is still unclear whether Kif5C is necessary and/or sufficient to establish neuronal polarity, its presence at the tip of growth cones may be related to a role in regulating adhesion dynamics. In spreading and migrating fibroblasts, it has been shown that microtubules target focal adhesions and this targeting is required for proper adhesion disassembly (Kaverina et al., 1999). Krylyshkina et al. (2002) demonstrated that this ability to regulate adhesion dynamics through microtubule targeting depends on kinesin-1 but not dynein. A kinesin-1 function-blocking antibody led to persistent, enlarged focal adhesions without disrupting microtubule targeting. This interesting possibility highlights the inseparable interplay between the microtubule cytoskeleton and adhesion regulation during migration.

Future Directions The suggestive localization of the Kif5C motor domain suggests it may be able to predict the direction of migration by indicating which branch in a migrating neuron

165 will become stabilized. To immediately test this idea, time-lapse imaging of neurons expressing Kif5C560-YFP could be exposed to Slit to induce branching. Examining whether Kif5C remains in the branch that eventually becomes the leading process followed by nuclear translocation events would indicate whether kinesin-1 could be involved in choosing and maintaining the migratory leading process. If Kif5C localization does predict the direction of migration, the next step would be to determine whether it is necessary and/or sufficient for determining the direction of migration through function-blocking or overexpression studies. If Kif5C indeed looked like it were involved in selection of the leading process, localized activation at the tips of branched neurons through uncaging or photoactivation studies might be able to be used to determine sufficiency. Further experiments to test how Kif5C behaves in radially migrating neurons in slice culture or in vivo would be particularly informative regarding how neurons may coordinate migration with axon formation.

Experimental Procedures Explants from the anterior subventricular zone (SVZa) of neonatal rats were transfected with Kif5C560-YFP (Jacobson et al, 2006) and mCherry (Roger Tsien, UCSD) expression constructs using Lipofectamine 2000 (Invitrogen). They were then cultured in a 3D Matrigel/collagen mixture, allowed to migrate for 3-5 hrs and then observed using a Zeiss Axiovert S100TV on a heated stage or fixed with 2% PFA and imaged using a Nikon Eclipse. Kif5C560-YFP contains the motor, neck linker, neck coil and stalk domains of kinesin-1 (a.a. 1-560) fused to YFP.

References Balaban, N.Q., Schwarz, U.S., Riveline, D., Goichberg, P., Tzur, G., Sabanay, I.,

Mahalu, D., Safran, S., Bershadsky, A., Addadi, L., and Geiger, B. (2001). Force and focal adhesion assembly: a close relationship studied using elastic micropatterned substrates. Nat Cell Biol 3, 466-472.

166 Beningo, K.A., Dembo, M., Kaverina, I., Small, J.V., and Wang, Y.L. (2001). Nascent focal adhesions are responsible for the generation of strong propulsive forces in migrating fibroblasts. J Cell Biol 153, 881-888.

Dembo, M., and Wang, Y.L. (1999). Stresses at the cell-to-substrate interface during locomotion of fibroblasts. Biophysical journal 76, 2307-2316.

Hu, K., Ji, L., Applegate, K.T., Danuser, G., and Waterman-Storer, C.M. (2007). Differential transmission of actin motion within focal adhesions. Science 315, 111- 115.

Jacobson, C., Schnapp, B., and Banker, G.A. (2006). A change in the selective translocation of the Kinesin-1 motor domain marks the initial specification of the axon. Neuron 49, 797-804.

Kaverina, I., Krylyshkina, O., and Small, J.V. (1999). Microtubule targeting of substrate contacts promotes their relaxation and dissociation. J Cell Biol 146, 1033- 1044.

Krylyshkina, O., Kaverina, I., Kranewitter, W., Steffen, W., Alonso, M.C., Cross, R.A., and Small, J.V. (2002). Modulation of substrate adhesion dynamics via microtubule targeting requires kinesin-1. J Cell Biol 156, 349-359.

Munevar, S., Wang, Y., and Dembo, M. (2001). Traction force microscopy of migrating normal and H-ras transformed 3T3 fibroblasts. Biophysical journal 80, 1744-1757.

167

Rabinovitz, I., Gipson, I.K., and Mercurio, A.M. (2001). Traction forces mediated by alpha6beta4 integrin: implications for basement membrane organization and tumor invasion. Molecular biology of the cell 12, 4030-4043.

Roy, P., Rajfur, Z., Pomorski, P., and Jacobson, K. (2002). Microscope-based techniques to study cell adhesion and migration. Nat Cell Biol 4, E91-96.

Schaar, B.T., and McConnell, S.K. (2005). Cytoskeletal coordination during neuronal migration. Proceedings of the National Academy of Sciences of the United States of America 102, 13652-13657.

Vanni, S., Lagerholm, B.C., Otey, C., Taylor, D.L., and Lanni, F. (2003). Internet- based image analysis quantifies contractile behavior of individual fibroblasts inside model tissue. Biophysical journal 84, 2715-2727.

168 Figure 3.1 DQA shows changes in relative forces generated by migrating neurons. Time-lapse series of a migrating neuron with DQA strains overlaid. Blue lines indicate stretching, while red lines indicate compression.

169 0’ 1’ 2’ 3’ 4’ 5’ 6’ 7’ 8’ 9’ 10’ 11’

170

12’ 13’ 14’ 15’ 16’ 17’ 18’ 19’ 20’ 21’ 22’ 23’ Figure 3.2 Kif5C560-YFP selectively localizes to the tip of migrating neurons. (A) Neurons transfected with mCherry, to show cell morphology, and Kif5C560-YFP showed strongest Kif5C signal at the tips of the leading process. (B) Average normalized fluorescence intensity as measured by line-scans drawn through transfected neurons (n = 5).

171 A

Kif5C560-YFP

mCherry

Merge

0.85 Kif5C560-YFP

0.75 mCherry n = 5 0.65

0.55

0.45

0.35

0.25

0.15 Normalized average fluorescence intensity

172 Figure 3.3 Kif5C560-YFP remains in the tip of migrating neurons as the leading process extends and retracts. Images were taken every minute of neurons transfected with Kif5C560-YFP and mCherry as they migrated in vitro through a 3D Matrigel/collagen matrix. Kif5C560-YFP remains at the tip of the leading process in cells moving forward. (A) Every 2 minutes of a 25 minute imaging session. (B) Kif5C560-YFP fluorescence is most intense in the tip as the leading process extends, but dims as the tip retracts and splits (40’ – 44’, white arrow). Intensity in one branch increases (45’, yellow arrow), then the branch retracts and consolidates with an upper branch before the cell extends a single leading process again.

173 A

0’ 2’ 4’ 6’ 8’ 10’ 12’

14’ 16’ 18’ 20’ 21’ 24’

0’ 5’ 31’ 35’ 40’ 41’ 42’ 43’

44’ 45’ 46’ 47’ 48’ 49’ 50’ 55’

174 CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS

The continued advancement of biotechnologies, tools, and reagents enables our ability to elucidate the intricate and dynamic intracellular functions that control cell behavior. Examining basic cell biology in neurons highlights the profound effects that seemingly small molecular changes can have on cognition and organismal behavior. While the behavior of an entire organism is controlled by the networked interactions of neuronal circuits, alterations in the behaviors of individual neuronal nodes in that circuit can propagate widely. Neuronal cell biology can be considered a nexus where distinct genetic mutations converge to effect similar cell biological changes, leading to the presentation of similar cognitive and system level phenotypes with disparate origins. Thus, there is great need to investigate basic cell biology in a neuronal context to understand how cellular behaviors are influenced by the environment, as well as how cells alter their environment. Outside-in signaling from the environment to the cell and inside-out signaling from the cell back out to the environment coordinates complex cellular events, such as the development of the nervous system. While molecular signaling pathways are conserved among many different cell types, there is so much complexity and variety in biology, that to fully appreciate the fine precision involved in proper regulation, we must examine all these different special cases to extract the underlying principles and see how cellular environments affect these processes. Cell migration is a prime example of a complex process that is accomplished in many unique ways among different cell types, yet shows convergence of numerous processes onto the same molecular pathways.

Implications of this Dissertation for General Cell Migration Certain principles appear to be conserved among different types of cells, despite the wide range of strategies, shapes, and specific functions exhibited. The guiding physical forces that shape the movements of any cell likely have common origins and lead to similar physical strategies. The work of this dissertation was guided by previous research on cell migration and adhesion regulation. However,

175 much of the work studying migration and adhesion has focused on cells cultured on two-dimensional (2D) substrates. While this is useful for the optical access it provides, the situation is quite different in vivo. Indeed, when those same types of cells are examined migrating in three-dimensional (3D) substrates that more closely mimic the in vivo environment, the distribution, composition, size, and dynamics of adhesions change dramatically (Cukierman et al., 2001; Cukierman et al., 2002). The morphology of cells migrating in 3D can differ from the same cell type migrating in 2D (Even-Ram and Yamada, 2005; Friedl and Brocker, 2000). Some cell types even resemble migrating neurons in their morphology when they migrate in 3D (Beadle et al., 2008). This might suggest that the unique morphology observed in migrating neurons is not so unique, but appears so as a consequence of most neuronal migration research being carried out in environments that are more similar to in vivo environments. The diffuse adhesions observed in migrating neurons resemble the smaller focal contacts called “3D-matrix adhesions” seen in fibroblasts cultured in 3D environments (Cukierman et al., 2001). Thus, it is important to examine whether the principles demonstrated for migration in 2D are the same for cells migrating in 3D substrates. In this dissertation, I showed that essential mechanisms used to regulate migration of various cell types in 2D are also important for migrating neurons both in vivo and in a 3D in vitro system. This supports the idea that endocytic regulation of adhesions is a general strategy used by many different cell types in different contexts. Future studies performed in 3D could further support the relevance of studies in 2D systems, which provide greater experimental manipulation and imaging capabilities. Adhesion studies in particular could benefit greatly from modeling processes in 3D in vitro systems because of the dramatic differences in the size and composition of adhesive contacts due to the substrate composition and dimensionality. Adhesion is tightly coupled to the physical forces exerted by the substrate, which also affects cytoskeletal remodeling responses. Examining adhesion in different contexts allows us to separate the effects caused by specific substrate-receptor interactions from general responses to the physical environment. Certainly, the ability to study basic migration

176 strategies in a more in vivo situation- simply by mimicking the 3D nature of tissue – will aid future studies in establishing more relevant conclusions.

Implications of this Dissertation for Different Forms of Neuronal Migration Neurons have the ability to migrate using different substrates in a variety of directions and modalities. Ultimately, migration essentially involves translating external cues, including secreted guidance molecules, structural extracellular matrix components, and the physical forces exerted by the environment, into a signal to the cytoskeleton to change and coordinate forces to move in a particular direction. The wide variety of different cellular morphologies exhibited by different types of migrating cells, and even different types of migrating neurons likely converge on the same underlying cellular and molecular controls (Marin et al., 2006). In the work described here, I show that two distinct forms of neuronal migration require endocytosis. Cortical neurons migrating along radial glial fibers as well as SVZa neurons migrating individually in ECM were halted by disruptions in endocytosis. This suggests that endocytosis is an essential cellular process regardless of the specific neuronal subtype, substrate, and mode of migration. It is possible that endocytosis plays different, or, more likely, multiple roles in regulating migration in cortical and SVZa neurons. This will be of interest to probe in future experiments.

Coordinating The Cytoskeleton Throughout Neuronal Development As an individual neuron develops, it does not simply follow a strict sequential program of events. Proliferation, differentiation, axon extension and guidance, as well as migration occur in overlapping stages as a neuron matures. Neurons must coordinate cytoskeletal elements at each of these stages to properly mature and realize their cellular identity with regard to cell body position as well as axonal connectivity. This regulation may occur through the recycling of molecules that can control multiple aspects of development. Indeed, many molecules that regulate cytoskeletal elements are conserved between cell cycle control, migration, axon elongation, and synapse formation (Frank and Tsai, 2009). Certainly, cell cycle control and interkinetic nuclear

177 migration (INM) are tightly coordinated, as a hallmark feature of INM is the association of nuclear position with a specific stage of the cell cycle. Thus, proliferation and differentiation are also linked to INM. Coupling the centrosome to the nucleus to effect INM involves similar proteins as that used in nucleokinesis during neuronal migration. SUN proteins on the nuclear envelope link the centrosome to the nucleus, while Lis1 and dynein are important for movement of the nucleus back down to the ventricular surface (Tsai et al., 2005; Zhang et al., 2009). Thus, proper nuclear-centrosome coupling is critical for the proper progression of proliferation and differentiation, as well as migration. Recent studies have demonstrated links between molecules involved in both adhesion and nuclear-centrosome coupling during neuron migration. Inhibiting calpain, an enzyme shown to biochemically influence focal adhesion dynamics (Franco et al., 2004), relieves defects in neuronal migration caused by Lis1 haploinsufficiency (Yamada et al., 2009). While this likely reflects independent functions for the multi-tasking enzyme calpain, it is possible that calpain-mediated proteolysis is coordinated for both adhesion and Lis1 action to enable the proper balance of adhesion and nuclear movement required for nucleokinesis during migration. More compelling evidence for a link between adhesion strength regulation and centrosome positioning factors come from a study on the interaction between Ndel1 (Nudel), which interacts with Lis1 in the dynein motor complex (Shu et al., 2004), and FAK (Shan et al., 2009). Shan and colleagues (2009) demonstrate that active FAK disrupts Ndel1 binding with paxillin at nascent focal adhesions at the leading edge of lamellipodia in migrating human epithelial cells, leading to adhesion de-stabilization. This raises interesting possibilities about the coordination of adhesion strength and nuclear-centrosome coupling for nucleokinesis in neuronal migration.

Coordinating Migration with Differentiation The laminar position of a neuron is tightly coordinated with its fate with respect to its axon projection, morphology, and gene expression identity. Developing neurons in the cerebral cortex are exposed to spatiotemporal microenvironments in the

178 form of the unique laminar zones they progress through as they mature to establish the cortical plate. Newly differentiated neurons escaping from the proliferative VZ appear to become more committed to a specific laminar fate over time. Do cell fate- conferring transcription factors directly instruct cells or permit reception to guidance cues that signify where to go? Studies delineating the transcriptional control over neuronal migration have been increasing recently, furthering our understanding of how transcription factors known to specify particular cell fates can lead to physical manifestations of those fates, such as migration to a particular brain region (Chedotal and Rijli, 2009; Nobrega-Pereira and Marin, 2009). It will be interesting to examine how the environment or specified cell fate based on morphogen patterns and transcription factors affects these choices, and how committed or plastic a particular neuron can be. Future studies could take advantage of the slice overlay assay using combinations of mutants to dissect extrinsic and intrinsic mechanisms for differentiation, migration, and maturation. This will be important to examine the mechanisms of genetic control over cellular behavior, probing how transcription factor programs can affect the cytoskeletal and cellular events that are required or accompany the processes of proliferation/differentiation in neural progenitors. It will also be interesting to address the distinct contributions of multi-tasking molecules involved in multiple developmental stages in each stage and what controls the switches in function.

Coordinating Migration with Axon Extension Beyond laminar position, cellular identity is tightly linked to neuronal projections. Radially migrating cortical projection neurons appear to begin leaving behind an axon while passing through the IZ. During this time, neurons transition through a multipolar stage of migration, which appears to be particularly sensitive to disruption. Many mutations or protein disruptions that lead to disturbed migration produce cells that can reach the IZ but not travel beyond. Likely, the multipolar to bipolar transition required to exit the IZ, as well as the start of axon extension leads to a particularly large strain on cytoskeletal regulation. The IZ environment is also

179 geometrically/physically complex, with axons from numerous regions coursing through. This may lead to a larger melting pot of molecular cues that must be sorted through to make the proper decisions to migrate in a particular direction. As discussed in Chapter 1, establishing polarity in vivo will require the coordination of migration polarity with axonal polarity. Polarized structures such as the centrosome may provide some clues about how neurons determine what neurite to use as a migratory leading process, and what neurite to establish as an axon. The centrosome appears to be positioned ahead of the nucleus in migrating neurons, but there has been conflicting evidence for whether the centrosome is required for axon initiation (de Anda et al., 2005; Stiess et al., 2010). Emerging data regarding the similarities and differences between axons and migratory leading processes will be important to follow-up and study more carefully in the in vivo environment, or at least a close approximation that retains the critical microenvironment of the developing laminae, such as slice culture.

Importance and Formation of the Dilation The dilation is a morphological feature that is unique and characteristic of migrating neurons. As the physical link between leading process extension and nuclear translocation, this cytoplasmic dilation is also likely a signaling nexus for coordinating the two strokes of neuronal migration. My work describes the dilation as a “hot spot” for endocytosis. This could possibly be due to the physical constraint of having more membrane surface present in that region. But, what leads to the formation of this greater surface area and cytoplasmic volume after leading process extension and before nuclear translocation? One possibility that could be tested in the future is that the substrate in that region has been “marked” in some way, perhaps by the leading process growth cone secreting ECM proteases that loosen the substrate. This could explain why the dilation forms where the leading process appears to pause before it. A less dense substrate would permit the cytoplasm to bulge at that point. During pauses in leading process extension, there may be a signal or trigger that causes the dilation to form. It could be simply tension from the growth cone, leading to tugging on the centrosome that spurs cytoskeletal changes resulting in an expansion of the membrane

180 at that region near the Golgi, just ahead of the nucleus. Though previous work has focused on the leading edge of growth cones and the coordination of the centrosome and nucleus, membrane dynamics at the cytoplasmic dilation and the cell soma should be the next area of discovery in neuronal migration.

Future Directions The observations described in this thesis are merely a small contribution to uncovering the fundamental mechanisms that underlie how a neuron is physically able to translate a distant guidance cue into a realized directed movement. Future work should continue to examine fundamental cell biology in neurons. Finely dissecting out the events that occur during each step of the migration cycle will be aided by the development of better tools to image neuronal movements in slice culture or in vivo to get beyond the current mostly static evidence. New imaging technologies and tools that provide greater spatial and temporal control for disruption will likely also illuminate the distinct and varied roles of individual molecules.

References Asada, N., Sanada, K., and Fukada, Y. (2007). LKB1 regulates neuronal migration and neuronal differentiation in the developing neocortex through centrosomal positioning. J Neurosci 27, 11769-11775.

Barnes, A.P., Solecki, D., and Polleux, F. (2008). New insights into the molecular mechanisms specifying neuronal polarity in vivo. Curr Opin Neurobiol 18, 44-52.

181 Beadle, C., Assanah, M.C., Monzo, P., Vallee, R., Rosenfeld, S.S., and Canoll, P. (2008). The role of myosin II in glioma invasion of the brain. Molecular biology of the cell 19, 3357-3368.

Chedotal, A., and Rijli, F.M. (2009). Transcriptional regulation of tangential neuronal migration in the developing forebrain. Curr Opin Neurobiol 19, 139-145.

Cukierman, E., Pankov, R., Stevens, D.R., and Yamada, K.M. (2001). Taking cell- matrix adhesions to the third dimension. Science 294, 1708-1712.

Cukierman, E., Pankov, R., and Yamada, K.M. (2002). Cell interactions with three- dimensional matrices. Curr Opin Cell Biol 14, 633-639. de Anda, F.C., Pollarolo, G., Da Silva, J.S., Camoletto, P.G., Feiguin, F., and Dotti, C.G. (2005). Centrosome localization determines neuronal polarity. Nature 436, 704- 708.

Even-Ram, S., and Yamada, K.M. (2005). Cell migration in 3D matrix. Curr Opin Cell Biol 17, 524-532.

Frank, C.L., and Tsai, L.H. (2009). Alternative functions of core cell cycle regulators in neuronal migration, neuronal maturation, and synaptic plasticity. Neuron 62, 312- 326.

Friedl, P., and Brocker, E.B. (2000). The biology of cell locomotion within three- dimensional extracellular matrix. Cell Mol Life Sci 57, 41-64.

182

Ge, W., He, F., Kim, K.J., Blanchi, B., Coskun, V., Nguyen, L., Wu, X., Zhao, J., Heng, J.I., Martinowich, K., et al. (2006). Coupling of cell migration with neurogenesis by proneural bHLH factors. Proceedings of the National Academy of Sciences of the United States of America 103, 1319-1324.

Hand, R., Bortone, D., Mattar, P., Nguyen, L., Heng, J.I., Guerrier, S., Boutt, E., Peters, E., Barnes, A.P., Parras, C., et al. (2005). Phosphorylation of Neurogenin2 specifies the migration properties and the dendritic morphology of pyramidal neurons in the neocortex. Neuron 48, 45-62.

Heng, J.I., Nguyen, L., Castro, D.S., Zimmer, C., Wildner, H., Armant, O., Skowronska-Krawczyk, D., Bedogni, F., Matter, J.M., Hevner, R., and Guillemot, F. (2008). Neurogenin 2 controls cortical neuron migration through regulation of Rnd2. Nature 455, 114-118.

Marin, O., Valdeolmillos, M., and Moya, F. (2006). Neurons in motion: same principles for different shapes? Trends Neurosci 29, 655-661.

Nguyen, L., Besson, A., Heng, J.I., Schuurmans, C., Teboul, L., Parras, C., Philpott, A., Roberts, J.M., and Guillemot, F. (2006a). p27kip1 independently promotes neuronal differentiation and migration in the cerebral cortex. Genes Dev 20, 1511- 1524.

183 Nguyen, L., Besson, A., Roberts, J.M., and Guillemot, F. (2006b). Coupling cell cycle exit, neuronal differentiation and migration in cortical neurogenesis. Cell Cycle 5, 2314-2318.

Nobrega-Pereira, S., and Marin, O. (2009). Transcriptional control of neuronal migration in the developing mouse brain. Cereb Cortex 19 Suppl 1, i107-113.

Shan, Y., Yu, L., Li, Y., Pan, Y., Zhang, Q., Wang, F., Chen, J., and Zhu, X. (2009). Nudel and FAK as antagonizing strength modulators of nascent adhesions through paxillin. PLoS Biol 7, e1000116.

Stiess, M., Maghelli, N., Kapitein, L.C., Gomis-Ruth, S., Wilsch-Brauninger, M., Hoogenraad, C.C., Tolic-Norrelykke, I.M., and Bradke, F. (2010). Axon extension occurs independently of centrosomal microtubule nucleation. Science 327, 704-707.

Tsai, J.W., Chen, Y., Kriegstein, A.R., and Vallee, R.B. (2005). LIS1 RNA interference blocks neural stem cell division, morphogenesis, and motility at multiple stages. J Cell Biol 170, 935-945.

184 Wang, X., Tsai, J.W., Imai, J.H., Lian, W.N., Vallee, R.B., and Shi, S.H. (2009). Asymmetric centrosome inheritance maintains neural progenitors in the neocortex. Nature 461, 947-955.

Yamada, M., Yoshida, Y., Mori, D., Takitoh, T., Kengaku, M., Umeshima, H., Takao, K., Miyakawa, T., Sato, M., Sorimachi, H., et al. (2009). Inhibition of calpain increases LIS1 expression and partially rescues in vivo phenotypes in a mouse model of lissencephaly. Nat Med 15, 1202-1207.

185