Recombinant Plasmodium Falciparum Glutathione Reductase Is Inhibited by the Antimalarial Dye Methylene Blue
Total Page：16
File Type：pdf, Size：1020Kb
FEBS 19799 FEBS Letters 422 (1998) 311^314 Recombinant Plasmodium falciparum glutathione reductase is inhibited by the antimalarial dye methylene blue P.M. Faërbera;*, L.D. Arscottb, C.H. Williams Jr.b, K. Beckera, R.H. Schirmera aBiochemie-Zentrum der Universitaët Heidelberg, 5 OG, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany bDepartment of Veterans A¡airs Medical Center and Department of Biological Chemistry, University of Michigan, Ann Arbor, MI 48105, USA Received 21 November 1997; revised version received 7 January 1998 as well as the binding mode of drugs and other ligands have Abstract Plasmodium falciparum glutathione reductase (PfGR) has emerged as a drug target against tropical malaria. been studied in great detail [4,6,7,10^12]. P. falciparum GR Here we report the expression of PfGR in Escherichia coli (PfGR) has recently come into focus as a drug target. The SG5(DE3) and isolation procedures for this protein. Recombi- enzyme was puri¢ed from parasitized red blood cells but only nant PfGR does not differ from the authentic enzyme in its in Wg quantities [13]. To promote structural and functional enzymic properties, the turnover number being 9900 min31. The studies on this protein, the gene of PfGR was isolated [14]. dimeric flavoenzyme exhibits redox-dependent absorption spec- As reported here, recombinant PfGR (rPfGR) was expressed, tra; the single tryptophan residue (per 57.2 kDa subunit) is puri¢ed and characterized, in particular as a target of meth- strongly fluorescent. PfGR can be inhibited by the antimalarial ylene blue. This antimalarial compound, the ¢rst chemother- drug methylene blue at therapeutic concentrations; the Ki for apeutic agent to be successfully used in humans [15,16], is non-competitive inhibition is 6.4 WM. The sensitivity to known to interfere with the glutathione metabolism of para- methylene blue is observed also at high ionic strength so that, by analogy to human GR, analysis of crystalline enzyme-drug sitized erythrocytes [17]. complexes can be envisaged. z 1998 Federation of European Biochemical Societies. 2. Materials and methods Key words: Malaria; Drug target; Disul¢de reductase; 2.1. Materials and assay systems Flavoenzyme; Phenothiazine; Tryptophan £uorescence E. coli SG5(DE3) was a kind gift of Dr. Sylke Muëller, Bernhard- Nocht-Institute, Hamburg. Authentic PfGR (5 Wg from 1 g erythro- cytes containing P. falciparum FBRC schizonts) was isolated as pre- viously reported [13]. Recombinant human GR was puri¢ed and as- 1. Introduction sayed as described [12]. Expression vector pET22b+ was from Novagen, Tth DNA polymerase from Boehringer Mannheim, and restriction enzymes were from New England Biolabs. Superose 12 The clinical manifestations of tropical malaria are caused and 2P,5P-ADP-Sepharose were purchased from Pharmacia and by the multiplication and di¡erentiation of the protozoan NADPH, GSSG, and IPTG from Biomol. Methylene blue (Fluka) parasite Plasmodium falciparum in human erythrocytes. Ma- was used as a 10 mM stock solution in H2O. Vivaspin concentrator larial parasites appear to be more sensitive to reactive oxygen units were from Greiner. species than their host cells [1]. Inherited or drug-induced Protein in crude fractions was estimated by absorbance measure- ments at 228.5 nm and 234.5 nm according to Ehresman et al. [18]. de¢ciency of antioxidative erythrocyte enzymes such as glu- For puri¢ed PfGR in the Eox form, a solution of 1 mg/ml was found cose-6-phosphate dehydrogenase [2,3] or glutathione reductase to have an absorbance of 0.205 at 461 nm and of 1.43 at 275 nm. [4,5] appear to protect from severe forms of falciparum ma- These calibrations were performed by correlation with the absorbance 31 31 laria. Glutathione reductase (GR), a dimeric £avoenzyme, coe¤cient of Eox which is 11.7 mM cm at 461 nm per 57.2 kDa subunit (see Section 2.5). catalyses the reduction of glutathione disul¢de using NADPH as a source of reducing equivalents: GSSG+NADPH+H = 2.2. Construction of the expression vector pG11 2GSH+NADP. In the cytosol the enzyme maintains a The fragments of the PfGR gene present in the plasmid constructs [GSH]/[GSSG] ratio of v 100. Glutathione in its reduced pG1, pG2, pG3, and pG4 described in [14] were fused by consecutive form represents the most abundant intracellular non-protein ligation into vector pT7 Blue (Novagen), taking advantage of unique restriction sites for HincII, NheI, and SpeI in the ORF, to ¢nally thiol. It is involved in a broad range of functions such as obtain construct pTG1-4. The 5P-end was obtained by 5P-RACE- protection of biomolecules from oxidative damage, detoxi¢ca- PCR on a Tth DNA polymerase-synthesized cDNA (T 6.1, see tion of xenobiotics, and regulation of enzyme activity [6^9]. [14]); the oligonucleotide primer G2 binds downstream the unique Both P. falciparum GR and human erythrocyte GR play HincII site (ATCGATCCAACGTTGACACACGTTC), whereas pri- mer SN5 (ACGTAGCATGCCATATGGTTTACGATTTAATTG- crucial roles for the intraerythrocytic growth of the parasite. TAATTG) introduces SphI and NdeI restriction sites juxtaposed to Human GR is a well characterized protein; the catalytic cycle the start codon. The PCR product was digested with SphI and HincII and ligated into pT1-4, resulting in the complete ORF of PfGR in the *Corresponding author. Fax: +49 (6221) 54 5586. plasmid pTG1-5. To remove the 3P-non-translated region of the E-mail: [email protected] cDNA, pTG1-5 was digested with StyI and SacI and recircularized by ligation of the hybridized oligonucleotides TGATGGATGAAAT- Abbreviations: Eox, oxidized form of glutathione reductase containing GACTCGAGGAGCT and CACCCTCGAGTCATTTCATC, there- an active site disulfide; EH2, 2-electron reduced glutathione reductase by introducing an XhoI site upstream the SacI site. From this con- containing an active site dithiol; GR, glutathione reductase (EC struct, pTG, the complete ORF was excised by a NdeI-XhoI digest 1.6.4.2); GSH, glutathione (reduced state); GSSG, glutathione and inserted into plasmid pET22b+, resulting in pG11 which encodes disulfide; IPTG, isopropyl-L-D-thiogalactopyranoside; ORF, open the protein of 500 residues (N-terminal Met+499 residues [14]) under reading frame; P. falciparum, Plasmodium falciparum; RACE, rapid the control of a T7 RNA polymerase promoter. The plasmid was then amplification of cDNA ends; rPfGR, recombinant Plasmodium introduced into E. coli SG5(DE3), a GR-de¢cient strain transformed falciparum glutathione reductase with phage DE3 to allow T7 DNA polymerase-dependent expression. 0014-5793/98/$19.00 ß 1998 Federation of European Biochemical Societies. All rights reserved. PII S0014-5793(98)00031-3 FEBS 19799 5-2-98 312 P.M. Faërber et al./FEBS Letters 422 (1998) 311^314 2.3. Puri¢cation of recombinant PfGR protein by incubation with 0.2% SDS in 50 mM sodium phosphate Plasmid-carrying SG5(DE3) cells were grown in Luria-Bertani me- bu¡er, pH 6.9, for 60 min at 45³C in the dark [20]. From 1 ml dium containing 50 Wg/ml carbenicillin to an apparent OD600 nm s 0.5. holoenzyme with an absorbance of 0.369 at 461 nm (see Section PfGR expression was then induced by 1 mM IPTG. After 12 h at 2.3) 31.5 nmol FAD was released. This corresponds to an O of 11.7 25³C the cells were harvested by centrifugation. The resulting bacterial mM31 cm31 for the holoenzyme. When determining FAD we took pellet (appr. 7 g) was resuspended in lysing solution (50 mM Tris-HCl, into account that, in the presence of 0.2% SDS, free FAD has a 150 mM NaCl, 10% glycerol, 0.03% Triton X-100, 1 mg/ml lysozyme, millimolar absorbance coe¤cient of 11.4 mM31 cm31 at 448 nm 10 WM phenylmethylsulfonyl £uoride, 10 Wg/ml DNase I, pH 7.5) and and that 3% of the released FAD is thermally destroyed during the subjected to sonication. incubation at 45³C. After clearing centrifugation, the supernatant was saturated to 80% Absorption spectroscopy of PfGR under anaerobic conditions was with ammonium sulfate and left for 12 h at 4³C. The resulting pre- carried out using the methods detailed for E. coli glutathione reduc- cipitate was collected by centrifugation, and the pellet was dialysed tase [21]. After recording the spectrum of PfGR in oxidized form exhaustively at 4³C against 25 mM potassium phosphate, 1 mM (Eox ; 9.5 nmol enzyme subunit in 1 ml 50 mM potassium phosphate, EDTA, pH 7.0. The retentate was then applied to a 5 ml 2P,5P- 2 mM EDTA, pH 7.45 at 25³C), the enzyme was converted to the ADP-Sepharose column equilibrated with the same bu¡er. This col- EH2 form using sodium borohydride (150 nmol dissolved in 2 ml 0.2 umn was washed and eluted as described for authentic PfGR [13]. M NaOH) as a reductant. NaBH4 hydrolysis (t1=2 = 20 s at pH 7.45) Fractions with PfGR activity were pooled, and 1 mM GSSG was did not interfere with the reduction of PfGR which was complete in added in order to oxidize the NADPH used for eluting the enzyme. less than 1 min. The spectra at pH 6.9 exhibited the same character- The pool was then concentrated and washed with 25 mM potassium istics as at pH 7.45. However, a 60-fold excess of sodium borohydride phosphate, 1 mM EDTA, pH 6.9, or 50 mM sodium phosphate, pH had to be used because of the 7-fold higher hydrolysis rate at pH 6.9 6.9, respectively, using Vivaspin concentrator units. As judged by [22]. silver-stained SDS-PAGE the resulting protein was s 98% pure Fluorescence measurements were conducted according to Mulroo- (data not shown).