DOCSLIB.ORG

PLD2 Forms a Functional Complex with Mtor/Raptor to Transduce Mitogenic Signals

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PLD2 Forms a Functional Complex with Mtor/Raptor to Transduce Mitogenic Signals Cellular Signalling 18 (2006) 2283–2291 www.elsevier.com/locate/cellsig PLD2 forms a functional complex with mTOR/raptor to transduce mitogenic signals Sang Hoon Ha a, Do-Hyung Kim b, Il-Shin Kim a, Jung Hwan Kim a, Mi Nam Lee a, Hyun Ju Lee a, Jong Heon Kim a, Sung Key Jang a, Pann-Ghill Suh a, Sung Ho Ryu a,⁎ a Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, Kyungbook 790-784, Republic of Korea b Department of Biochemistry, Molecular Biology, and Biophysics, University of Minnesota, Minneapolis, MN 55455, USA Received 26 April 2006; received in revised form 11 May 2006; accepted 11 May 2006 Available online 3 June 2006 Abstract Mammalian target-of-rapamycin (mTOR), which is a master controller of cell growth, senses a mitogenic signal in part through the lipid second messenger phosphatidic acid (PA), generated by phospholipase D (PLD). To understand further which isozymes of PLD are involved in this process, we compared the effect of PLD isozymes on mTOR activation. We found that PLD2 has an essential role in mitogen-induced mTOR activation as the siRNA-mediated knockdown of PLD2, not of PLD1, profoundly reduced the phosphorylations of S6K1 and 4EBP1, well-known mTOR effectors. Furthermore, exogenous PA-induced mTOR activation was abrogated by PLD2 knockdown, but not by PLD1 knockdown. This abrogation was found to be the result of complex formation between PLD2 and mTOR/raptor. PLD2 possesses a TOS-like motif (Phe-Glu-Val-Gln-Val, a.a. 265– 269), through which it interacts with raptor independently of the other TOS motif-containing proteins, S6K1 and 4EBP1. PLD2-dependent mTOR activation appears to require PLD2 binding to mTOR/raptor with lipase activity, since lipase-inactive PLD2 cannot trigger mTOR activation despite its ability to interact with mTOR/raptor. Abrogation of mitogen-dependent mTOR activation by PLD2 knockdown was rescued only by wild type PLD2, but not by raptor binding-deficient and lipase-inactive PLD2. Our results demonstrate the importance of localized PA generation for the mitogen-induced activation of mTOR, which is achieved by a specific interaction between PLD2 and mTOR/raptor. © 2006 Elsevier Inc. All rights reserved. Keywords: PLD2; mTOR; Raptor; Complex formation 1. Introduction based on sequence similarity of their catalytic domains [4,5]. The mTOR pathway is an emerging target for the treatment of cancer, Mammalian target-of-rapamycin (mTOR) is a serine/threonine diabetes and obesity [6–10], and recent studies have demonstrated protein kinase [1–3] and a member of a novel superfamily of its role as a mediator of lifespan control in C. elegans [11] and signaling proteins termed PI 3-kinase related kinases (PIKKs), Drosophila [12]. Despite the significance of this pathway in such diverse biological processes, the mechanism of its regulation by upstream signals remains to be addressed. Recently, significant Abbreviations: mTOR, mammalian target-of-rapamycin; PLD, phospholipase D; raptor, regulatory associated for mTOR; PIKK, phosphatidylinositol 3-kinase- progress was made in our understanding of the regulatory related protein kinase; Rheb, Ras enriched in brain; PC, phosphatidylcholine; PA, mechanisms of mTOR signaling and this revealed the participa- phosphatidic acid; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propa- tion of the mTOR complex (mTOR/raptor) containing raptor nesulfonic acid; EMEM, Dulbecco's modified Eagle's medium; EDTA, ethylene [13,14] and GβL [15] in response to upstream signals for the diamine tetraacetic acid; PMSF, phenylmethlysulfonyl fluoride; PAGE, polyacryl- appropriate control of cell growth and the other mTOR complex amide gel electrophoresis; BCS, bovine calf serum; FBS, fetal bovine serum; PBS, phosphate buffered saline; DTT, dithiothreitol. (mTOR/rictor) containing rictor [16] and GβL [15] for the control ⁎ Corresponding author. Tel.: +82 54 279 2292; fax: +82 54 279 0645. of actin cytoskeleton. These upstream signals derived from E-mail address: [email protected] (S.H. Ryu). insulin, nutrients, and/or mitogens are likely to be mediated by the 0898-6568/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.cellsig.2006.05.021 2284 S.H. Ha et al. / Cellular Signalling 18 (2006) 2283–2291 tuberous sclerosis complex 1/2 [17] and Rheb [18–22]. Though 5′-UGC UCA UUG UCG UCC CAC CUU-3′, which correspond to human the functional connection between mTOR complex and these PLD1a coding nucleotides 1455–1475. All siRNA sequences were subjected to BLAST in the NCBI database and complete matches were only found for PLD2 upstream regulators is known, their physical connection is not sequences. Luciferase GL2 duplex was purchased from Dharmacon Research, completely understood [6–9]. Recently, Rheb was shown to Inc. and was used as a negative control. For add-back experiment for PLD2 interact with mTOR/raptor and activate kinase activity of mTOR silencing, three residues of human PLD2 cDNA (nucleotides 703–723 of PLD2; [23,24]. AAGAGGTGGCTGGTGGTGAAG) are substituted to AAGAGATGGCTAG wt In addition, mTOR requires the lipid second messenger TAGTGAAG for add back mutants of PLD2 [31]. This mutation is silencing mutations. This gene is subcloned into mammalian expression vector pcDNA3.1 phosphatidic acid (PA) for its activation [25,26]. PA is an enzy- (Invitrogen) and digested with restriction enzymes KpnI and XbaI. These matic product of phospholipase D (PLD) [27,28]. Mammalian mutations are confirmed through nucleotide sequence analysis. PLD isozymes identified to date, PLD1 and PLD2, sense a variety of signals, such as neurotransmitters, hormones and 2.4. Cell culture and plasmid/siRNA transfection growth factors, to regulate multiple physiological events such as proliferation, secretion, respiratory burst and actin cytoskeletal COS7 cells were maintained in a 5% CO2 humidified atmosphere at 37 °C reorganization [27,28]. Here, our effort to elucidate which iso- and fed DMEM supplemented with 10% bovine calf serum. HEK293 cells and OVCAR-3 cells were fed DMEM supplemented with 10% fetal bovine serum. zyme is mainly involved in mitogen-induced mTOR activation Cells grown on tissue culture dishes was transiently transfected using identifies that PLD2 is a major isozyme to transduce mitogenic LipofectAMINE, as described previously [31,32]. Cells were allowed to express signaling to mTOR/raptor and this is achieved by complex the recombinant proteins for 24 h after transfection and then deprived of serum formation between PLD2 and mTOR/raptor. As a result, we for additional 24 h. The cells were then subjected to co-immunoprecipitation suggest the physical/functional connections between mitogen- analysis. For knockdown with siRNA, cells were grown for 36–48 h before serum deprivation. induced PA generation and its effector mTOR and would pro- vide further insight into mTOR-related metabolic diseases such 2.5. Co-immunoprecipitation as cancer, diabetes and obesity. After harvesting COS7 cells, total extracts were prepared by brief sonication 2. Materials and methods in ice-cold lysis buffer (40 mM HEPES pH7.5, 120 mM NaCl, 1 mM EDTA, 10 mM pyrophosphate, 10 mM glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 2.1. Materials 0.5% CHAPS, 1 mM PMSF, protease inhibitor cocktails) [13]. Clarified extracts were mixed with 2 μg of the respective antibodies. Then protein A-Sepharose The enhanced chemiluminescence kit and dipalmitoylphosphatidyl beads were added to isolate the antibody complex. After four washings with lysis [methyl-3H]choline were purchased from Amersham Biosciences. Horseradish buffer, the final immunoprecipitates were washed once with wash buffer (50 mM peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgA, IgM, and HEPES pH7.5, 150 mM NaCl), and then subjected to SDS-PAGE. IgG were from Kirkegaard and Perry Laboratories, Inc. (Gaithersburg, MD). Polyclonal antibody was raised against PLD as previously described [29]. 2.6. Western blot analysis Antibodies against mTOR, pS6K1 (pThr 389), S6K1, p4EBP1(pThr 37/46), and 4EBP1 and rapamycin were from Cell Signaling. Protein A-Sepharose was from Proteins were separated by SDS-PAGE on 8–16% gradient gels, and the RepliGen (Needham, MA). CHAPS was from Sigma. Dulbecco's modified separated proteins were transferred onto nitrocellulose membranes and blocked Eagle's medium (DMEM) and LipofectAMINE were from Invitrogen. C-6 with TTBS buffer (10 mM Tris–HCl, pH 7.6, 150 mM NaCl, and 0.05% Tween- phosphatidic acid was from Avanti, and recombinant 4EBP1 was purchased from 20) containing 5% skimmed milk powder. Membranes were then incubated with Stratagen. primary antibody at the concentration recommended by the manufacturer for 4 h at room temperature. Unbound antibody was washed away with TTBS buffer. 2.2. Plasmids Membranes were subsequently incubated with horseradish peroxidase-conju- gated secondary antibody for 1 h at room temperature, washed five times with Mammalian expression vectors for PLD1wt,PLD2wt,PLD2ΔN184, TTBS buffer, and developed using an ECL system. PLD2ΔN308, and PLD2K758R were used as described previously [30–32]. Ex- pression vectors for HA–mTORwt, myc–mTORwt, myc–raptorwt, HA–raptorwt 2.7. In vivo PLD assay and HA–raptor194YDC/AAAmt were gifts from Dr. David M. Sabatini (MIT) [13]. To introduce the TOS motif mutation in PLD2, pCDNA3.1(+)/PLD2 containing In vivo PLD activity was assayed by measuring the formation of wild type PLD2 was PCR amplified using the following oligomers; sense phosphatidyl–butanol as described previously [32]. In brief, cells were loaded (5′GGC CGA GAC CAA GTT TGT TAT CGC3′), antisense (F265A:5′CCA with [3H]myristic acid (2 μCi/ml) for 8 h and then washed twice with DMEM. TCG ATC CGC ACG CCG TGC CGT GCC TCC GTG CTC CTT TTC CCC Labeled cells were incubated with 0.4% butanol for 10 min to measure basal ACT TGC ACC TCA GCG CCA GG3′), antisense (E266R: 5′CCA TCG ATC PLD activity. Total lipids were extracted with 1.2 ml of methanol:1 M NaCl: CGC ACG CCG TGC CGT GCC TCC GTG CTC CTT TTC CCC ACT TGC chloroform (1:1:1 by volume) and then separated by thin-layer chromatography ACC CTA AAG CCA GG3′).
Load more

Recommended publications
  • Novel Allosteric Modulators of the M1 Muscarinic Acetylcholine Receptor Provide New Insights Into M1-Dependent Synaptic Plasticity and Receptor Signaling
    Novel allosteric modulators of the M1 muscarinic acetylcholine receptor provide new insights into M1-dependent synaptic plasticity and receptor signaling By Sean P Moran Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Neuroscience December 14, 2019 Nashville, Tennessee Approved: Sachin Patel M.D., Ph.D. Colleen Niswender, Ph.D. Danny Winder, Ph.D. P. Jeffrey Conn, Ph.D. ACKNOWLEDGMENTS Throughout my scientific career, there have been many people instrumental in my scientific journey. I would first like to thank Jeff Conn for providing a very supportive research atmosphere, for always making me laugh, for his insight and constructive criticism in our one-on-one meetings and for occasionally getting my name correct. I would also like to thank my thesis committee of Sachin Patel, Colleen Niswender and Danny Winder for their unwavering support during my time here at Vanderbilt. Additionally, I have very much enjoyed collaborating with Jerri Rook on many projects and would like to thank her for her sage behavioral pharmacology advice over the years. Also, thanks to the many members of the VCNDD including: Zixiu, Craig, Jon Dickerson, Dan Foster, Max, Nicole, Mark and Carrie who provided intellectual contributions, technical training or research support throughout my graduate career. Thank you to the many other members of the VCNDD, past and present, that have contributed to my various projects over the years. Thanks to the better half of Shames (James). I will our miss our long winded, highly pedantic and semantic discussions that occasionally touched on pharmacology topics…and thanks for making me not homeless.
    [Show full text]
  • Role of Phospholipases in Adrenal Steroidogenesis
    229 1 W B BOLLAG Phospholipases in adrenal 229:1 R29–R41 Review steroidogenesis Role of phospholipases in adrenal steroidogenesis Wendy B Bollag Correspondence should be addressed Charlie Norwood VA Medical Center, One Freedom Way, Augusta, GA, USA to W B Bollag Department of Physiology, Medical College of Georgia, Augusta University (formerly Georgia Regents Email University), Augusta, GA, USA [email protected] Abstract Phospholipases are lipid-metabolizing enzymes that hydrolyze phospholipids. In some Key Words cases, their activity results in remodeling of lipids and/or allows the synthesis of other f adrenal cortex lipids. In other cases, however, and of interest to the topic of adrenal steroidogenesis, f angiotensin phospholipases produce second messengers that modify the function of a cell. In this f intracellular signaling review, the enzymatic reactions, products, and effectors of three phospholipases, f phospholipids phospholipase C, phospholipase D, and phospholipase A2, are discussed. Although f signal transduction much data have been obtained concerning the role of phospholipases C and D in regulating adrenal steroid hormone production, there are still many gaps in our knowledge. Furthermore, little is known about the involvement of phospholipase A2, Endocrinology perhaps, in part, because this enzyme comprises a large family of related enzymes of that are differentially regulated and with different functions. This review presents the evidence supporting the role of each of these phospholipases in steroidogenesis in the Journal Journal of Endocrinology adrenal cortex. (2016) 229, R1–R13 Introduction associated GTP-binding protein exchanges a bound GDP for a GTP. The G protein with GTP bound can then Phospholipids serve a structural function in the cell in that activate the enzyme, phospholipase C (PLC), that cleaves they form the lipid bilayer that maintains cell integrity.
    [Show full text]
  • 1H HR-MAS and Genomic Analysis of Human Tumor Biopsies Discriminate Between High and Low Grade Astrocytomas Valeria Righi A,B,C, Jose M
    Research Article Received: 16 April 2008, Revised: 22 January 2009, Accepted: 22 January 2009, Published online in Wiley InterScience: 2009 (www.interscience.wiley.com) DOI:10.1002/nbm.1377 1H HR-MAS and genomic analysis of human tumor biopsies discriminate between high and low grade astrocytomas Valeria Righi a,b,c, Jose M. Rodad, Jose´ Pazd, Adele Muccib, Vitaliano Tugnolic, Gemma Rodriguez-Tarduchya, Laura Barriose, Luisa Schenettib, Sebastia´n Cerda´na* and Marı´a L. Garcı´a-Martı´na,y We investigate the profile of choline metabolites and the expression of the genes of the Kennedy pathway in biopsies of human gliomas (n ¼ 23) using 1H High Resolution Magic Angle Spinning (HR-MAS, 11.7 Tesla, 277 K, 4000 Hz) and individual genetic assays. 1H HR-MAS spectra allowed the resolution and relative quantification by the LCModel of the resonances from choline (Cho), phosphocholine (PC) and glycerophosphorylcholine (GPC), the three main components of the combined tCho peak observed in gliomas by in vivo 1H NMR spectroscopy. All glioma biopsies depicted a prominent tCho peak. However, the relative contributions of Cho, PC, and GPC to tCho were different for low and high grade gliomas. Whereas GPC is the main component in low grade gliomas, the high grade gliomas show a dominant contribution of PC. This circumstance allowed the discrimination of high and low grade gliomas by 1H HR-MAS, a result that could not be obtained using the tCho/Cr ratio commonly used by in vivo 1H NMR spectroscopy. The expression of the genes involved in choline metabolism has been investigated in the same biopsies.
    [Show full text]
  • Cyclic Phosphatidic Acid: an Endogenous Antagonist of Pparγ
    Central Journal of Endocrinology, Diabetes & Obesity Editorial Corresponding author Tamotsu Tsukahara, Department of Hematology and Immunology, Kanazawa Medical University, 1-1 Cyclic Phosphatidic Acid: An Daigaku, Uchinada, Ishikawa 920-0293, Japan, E-mail: [email protected] Submitted: 25 August 2013 Endogenous Antagonist of Accepted: 26 August 2013 Published: 29 August 2013 PPARg Copyright © 2013 Tsukahara et al. Tamotsu Tsukahara1*, Yoshikazu Matsuda2, Hisao Haniu3 and Kimiko Murakami- Murofushi4 OPEN ACCESS 1Department of Hematology and Immunology, Kanazawa Medical University, Japan 2Clinical Pharmacology Educational Center, Nihon Pharmaceutical University, Japan 3Department of Orthopaedic Surgery, Shinshu University School of Medicine, Japan 4Endowed Research Division of Human Welfare Sciences, Ochanomizu University, Japan Lysophospholipids (LPLs) have long been recognized as phosphatidylcholine (PC) to generate choline and bioactive membrane phospholipid metabolites. LPLs are small bioactive lipid, has been implicated in signal transduction, membrane lipid molecules that are characterized by a single carbon 10]. There are two chain and a polar head group. LPLs have been implicated in a PLD isoenzymes, PLD1 and PLD2, which are expressed in a number of pathological states and human diseases. LPLs include varietytrafficking, of tissues and cytoskeletal and cells [ 11reorganization]. We labeled [ cultured cells with lysophosphatidic acid (LPA), alkyl-glycerol phosphate (AGP), [32P]-orthophosphate for 30 min and compared that to [32P]- sphingoshine-1-phosphate, and cyclic phosphatidic acid (cPA). labeled cPA from vehicle control cells using two-dimensional thin In recent years, cPA has been reported to be a target for many layer chromatography. Furthermore, we used CHO cells stably diseases, including obesity [1], atherosclerosis [2], cancer [3], expressing PLD1 or PLD2 or catalytically inactive forms of PLD1 and pain [4].
    [Show full text]
  • Phospholipase D in Cell Proliferation and Cancer
    Vol. 1, 789–800, September 2003 Molecular Cancer Research 789 Subject Review Phospholipase D in Cell Proliferation and Cancer David A. Foster and Lizhong Xu The Department of Biological Sciences, Hunter College of The City University of New York, New York, NY Abstract trafficking, cytoskeletal reorganization, receptor endocytosis, Phospholipase D (PLD) has emerged as a regulator of exocytosis, and cell migration (4, 5). A role for PLD in cell several critical aspects of cell physiology. PLD, which proliferation is indicated from reports showing that PLD catalyzes the hydrolysis of phosphatidylcholine (PC) to activity is elevated in response to platelet-derived growth factor phosphatidic acid (PA) and choline, is activated in (PDGF; 6), fibroblast growth factor (7, 8), epidermal growth response to stimulators of vesicle transport, endocyto- factor (EGF; 9), insulin (10), insulin-like growth factor 1 (11), sis, exocytosis, cell migration, and mitosis. Dysregula- growth hormone (12), and sphingosine 1-phosphate (13). PLD tion of these cell biological processes occurs in the activity is also elevated in cells transformed by a variety development of a variety of human tumors. It has now of transforming oncogenes including v-Src (14), v-Ras (15, 16), been observed that there are abnormalities in PLD v-Fps (17), and v-Raf (18). Thus, there is a growing body of expression and activity in many human cancers. In this evidence linking PLD activity with mitogenic signaling. While review, evidence is summarized implicating PLD as a PLD has been associated with many aspects of cell physiology critical regulator of cell proliferation, survival signaling, such as membrane trafficking and cytoskeletal organization cell transformation, and tumor progression.
    [Show full text]
  • The Design and Synthesis of Autotaxin Inhibitors and Analogs of Lysophosphatidic Acid
    University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 5-2011 The esiD gn and Synthesis of Autotaxin Inhibitors and Analogs of Lysophosphatidic Acid Renuka Niranjan Gupte University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Chemicals and Drugs Commons, and the Pharmaceutics and Drug Design Commons Recommended Citation Gupte, Renuka Niranjan , "The eD sign and Synthesis of Autotaxin Inhibitors and Analogs of Lysophosphatidic Acid" (2011). Theses and Dissertations (ETD). Paper 112. http://dx.doi.org/10.21007/etd.cghs.2011.0121. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. The esiD gn and Synthesis of Autotaxin Inhibitors and Analogs of Lysophosphatidic Acid Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Pharmaceutical Sciences Research Advisor Duane D. Miller, Ph.D. Committee Isaac O. Donkor, Ph.D. Richard E. Lee, Ph.D. Wei Li, Ph.D. Gabor J. Tigyi, M.D., Ph.D. DOI 10.21007/etd.cghs.2011.0121 Comments Two year embargo expired May 2013 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/112 THE DESIGN AND SYNTHESIS OF AUTOTAXIN INHIBITORS AND ANALOGS OF LYSOPHOSPHATIDIC ACID A Dissertation Presented for The Graduate Studies Council The University of Tennessee Health Science Center In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy From The University of Tennessee By Renuka Niranjan Gupte May 2011 Copyright © 2011 by Renuka N.
    [Show full text]
  • The Multifaceted Role of Extracellular Vesicles in Glioblastoma: Microrna Nanocarriers for Disease Progression and Gene Therapy
    pharmaceutics Review The Multifaceted Role of Extracellular Vesicles in Glioblastoma: microRNA Nanocarriers for Disease Progression and Gene Therapy Natalia Simionescu 1,2 , Radu Zonda 1, Anca Roxana Petrovici 1 and Adriana Georgescu 3,* 1 Center of Advanced Research in Bionanoconjugates and Biopolymers, “Petru Poni” Institute of Macromolecular Chemistry, 41A Grigore Ghica Voda Alley, 700487 Iasi, Romania; [email protected] (N.S.); [email protected] (R.Z.); [email protected] (A.R.P.) 2 “Prof. Dr. Nicolae Oblu” Emergency Clinical Hospital, 2 Ateneului Street, 700309 Iasi, Romania 3 Department of Pathophysiology and Pharmacology, Institute of Cellular Biology and Pathology “Nicolae Simionescu” of the Romanian Academy, 8 B.P. Hasdeu Street, 050568 Bucharest, Romania * Correspondence: [email protected]; Tel.: +40-21-319-45-18 Abstract: Glioblastoma (GB) is the most aggressive form of brain cancer in adults, characterized by poor survival rates and lack of effective therapies. MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression post-transcriptionally through specific pairing with target mes- senger RNAs (mRNAs). Extracellular vesicles (EVs), a heterogeneous group of cell-derived vesicles, transport miRNAs, mRNAs and intracellular proteins, and have been shown to promote horizon- tal malignancy into adjacent tissue, as well as resistance to conventional therapies. Furthermore, GB-derived EVs have distinct miRNA contents and are able to penetrate the blood–brain barrier. Numerous studies have attempted to identify EV-associated miRNA biomarkers in serum/plasma Citation: Simionescu, N.; Zonda, R.; and cerebrospinal fluid, but their collective findings fail to identify reliable biomarkers that can be Petrovici, A.R.; Georgescu, A.
    [Show full text]
  • Title Phospholipase D2 Promotes Disease Progression Of
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Kyoto University Research Information Repository Phospholipase D2 promotes disease progression of renal cell Title carcinoma through the induction of angiogenin Kandori, Shuya; Kojima, Takahiro; Matsuoka, Taeko; Yoshino, Author(s) Takayuki; Sugiyama, Aiko; Nakamura, Eijiro; Shimazui, Toru; Funakoshi, Yuji; Kanaho, Yasunori; Nishiyama, Hiroyuki Citation Cancer Science (2018), 109(6): 1865-1875 Issue Date 2018-06 URL http://hdl.handle.net/2433/233106 © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association. This is an open access article under the terms of Right the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. Type Journal Article Textversion publisher Kyoto University Received: 2 October 2017 | Revised: 1 March 2018 | Accepted: 4 April 2018 DOI: 10.1111/cas.13609 ORIGINAL ARTICLE Phospholipase D2 promotes disease progression of renal cell carcinoma through the induction of angiogenin Shuya Kandori1 | Takahiro Kojima1 | Taeko Matsuoka1 | Takayuki Yoshino1 | Aiko Sugiyama2 | Eijiro Nakamura2 | Toru Shimazui3,4 | Yuji Funakoshi5 | Yasunori Kanaho5 | Hiroyuki Nishiyama1 1Faculty of Medicine, Department of Urology, University of Tsukuba, Tsukuba, A hallmark of clear cell renal cell carcinoma (ccRCC) is the presence of intracellular Japan lipid droplets (LD) and it is assumed that phosphatidic acid (PA) produced by phos- 2 DSK Project, Medical Innovation Center, pholipase D (PLD) plays some role in the LD formation. However, little is known Kyoto University Graduate School of Medicine, Kyoto, Japan about the significance of PLD in ccRCC.
    [Show full text]
  • A Molecular Target for an Alcohol Chain-Length Cutoff
    Article A Molecular Target for an Alcohol Chain-Length Cutoff Hae-Won Chung 1,2,†, E. Nicholas Petersen 1,2,†, Cerrone Cabanos 1,2, Keith R. Murphy 2,3,4, Mahmud Arif Pavel 1,2, Andrew S. Hansen 5, William W. Ja 2,3 and Scott B. Hansen 1,2 1 - Department of Molecular Medicine, The Scripps Research Institute, Jupiter, FL 33458, USA 2 - Department of Neuroscience, The Scripps Research Institute, Jupiter, FL 33458, USA 3 - Center on Aging, The Scripps Research Institute, Jupiter, FL 33458, USA 4 - Program in Integrative Biology and Neuroscience, Florida Atlantic University, Jupiter, FL 33458, USA 5 - HBBiotech, BioInnovations Gateway, Salt Lake City, UT 84115, USA Correspondence to Scott B. Hansen: Department of Molecular Medicine, The Scripps Research Institute, Jupiter, FL 33458, USA. [email protected] https://doi.org/10.1016/j.jmb.2018.11.028 Edited by Daniel L. Minor Abstract Despite the widespread consumption of ethanol, mechanisms underlying its anesthetic effects remain uncertain. n-Alcohols induce anesthesia up to a specific chain length and then lose potency—an observation known as the “chain-length cutoff effect.” This cutoff effect is thought to be mediated by alcohol binding sites on proteins such as ion channels, but where these sites are for long-chain alcohols and how they mediate a cutoff remain poorly defined. In animals, the enzyme phospholipase D (PLD) has been shown to generate alcohol metabolites (e.g., phosphatidylethanol) with a cutoff, but no phenotype has been shown connecting PLD to an anesthetic effect. Here we show loss of PLD blocks ethanol-mediated hyperactivity in Drosophila melanogaster (fruit fly), demonstrating that PLD mediates behavioral responses to alcohol in vivo.
    [Show full text]
  • Rare Coding Variants in the Phospholipase D3 Gene Confer Risk for Alzheimer’S Disease”
    “Rare coding variants in the phospholipase D3 gene confer risk for Alzheimer’s disease” Cruchaga C, et al. Nature. 2013 December 11 online Introduction Alzheimer’s Disease (AD) • Most common form of dementia • Estimated 5.2 million in US • Estimated overall heritability is up to 80% • Progressive memory loss and cognitive deficits http://www.nia.nih.gov/sites/default/files/02_degradingbrains_lg.jpg http://www.ph.nagasaki-u.ac.jp/lab/biotech/research-e.html Early Onset AD • Rare (est >200,000 cases in US) • Symptoms appear before age 65 (30s, 40s, 50s) • Tends to cluster within families • Mutations in APP, PSEN1, PSEN2 Late Onset AD • Inheritance follows complex pattern • APOE associated with risk (ε2, ε3, ε4) • Several genes associated with increased risk: CLU, PICALM, CR1, BIN1, ABCA7, MS4A, CD33, EPHA1, CD2AP, TREM2 PLD3 • Poorly characterized • Member of phospholipase D family • Localizes to lysosomes • PLD1 implicated in APP trafficking (Cai et al, 2006) • PLD2 implicated in AD (Oliveira et al, 2010) GWAS - Issues • Common variants, not rare variants – Small effects on LOAD risk – Usually do not have obvious functional effects • Expensive • Large population needed Exome Sequencing • Sequencing of exons only • Faster and cheaper • Fewer false positives • Greater sensitivity • Exome makes up ~1% of whole genome • Deep coverage w/ relatively few reads Hypothesis Alzheimer's disease risk is heritable and exome sequencing can identify low frequency heritable risk factors that are missed in GWAS. Experimental Design Results Interpretation(s)
    [Show full text]
  • Phospholipase D2 (PLD2) Is a Guanine Nucleotide Exchange Factor (GEF) for the Gtpase Rac2
    Phospholipase D2 (PLD2) is a guanine nucleotide exchange factor (GEF) for the GTPase Rac2 Madhu Mahankalia, Hong-Juan Penga, Karen M. Henkelsa, Mary C. Dinauerb, and Julian Gomez-Cambroneroa,1 aDepartment of Biochemistry and Molecular Biology, Wright State University School of Medicine, Dayton, OH 45435; and bDepartment of Pediatrics (Division of Hematology/Oncology) and Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO 63110 Edited by Peter N. Devreotes, Johns Hopkins University School of Medicine, Baltimore, MD, and approved October 21, 2011 (received for review September 7, 2011) We have discovered that the enzyme phospholipase D2 (PLD2) binds known that PA binds directly to Sos (9). All of the mechanisms directly to the small GTPase Rac2, resulting in PLD2 functioning as a that imply translocation to the membrane or membrane traf- guanine nucleotide exchange factor (GEF), because it switches Rac2 ficking that place GEF close to its effectors are complex and rely from the GDP-bound to the GTP-bound states. This effect is large on the formation of multimeric signaling proteins. enough to be meaningful (∼72% decrease for GDP dissociation and We show here that PLD2 functions as a GEF, because it 300% increase for GTP association, both with PLD2), it has a half- switches Rac2 from the GDP-bound to the GTP-bound state. time of ∼7 min, is enhanced with increasing PLD2 concentrations, There are a number of known GEFs, but none of the three families and compares favorably with other known GEFs, such as Vav-1. The of GEFs for monomeric GTPases is a phospholipase, making this PLD2-Rac2 protein–protein interaction is sufficient for the GEF func- study unique.
    [Show full text]
  • Interface of Phospholipase Activity, Immune Cell Function, and Atherosclerosis
    biomolecules Review Interface of Phospholipase Activity, Immune Cell Function, and Atherosclerosis Robert M. Schilke y, Cassidy M. R. Blackburn y , Temitayo T. Bamgbose and Matthew D. Woolard * Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, Shreveport, LA 71130, USA; [email protected] (R.M.S.); [email protected] (C.M.R.B.); [email protected] (T.T.B.) * Correspondence: [email protected]; Tel.: +1-(318)-675-4160 These authors contributed equally to this work. y Received: 12 September 2020; Accepted: 13 October 2020; Published: 15 October 2020 Abstract: Phospholipases are a family of lipid-altering enzymes that can either reduce or increase bioactive lipid levels. Bioactive lipids elicit signaling responses, activate transcription factors, promote G-coupled-protein activity, and modulate membrane fluidity, which mediates cellular function. Phospholipases and the bioactive lipids they produce are important regulators of immune cell activity, dictating both pro-inflammatory and pro-resolving activity. During atherosclerosis, pro-inflammatory and pro-resolving activities govern atherosclerosis progression and regression, respectively. This review will look at the interface of phospholipase activity, immune cell function, and atherosclerosis. Keywords: atherosclerosis; phospholipases; macrophages; T cells; lipins 1. Introduction All cellular membranes are composed mostly of phospholipids. Phospholipids are amphiphilic compounds with a hydrophilic, negatively charged phosphate group head and two hydrophobic fatty acid tail residues [1]. The glycerophospholipids, phospholipids with glycerol backbones, are the largest group of phospholipids, which are classified by the modification of the head group [1]. The negatively charged phosphate head forms an ionic bond with an amino alcohol. This bridges the glycerol backbone to the nitrogenous functional group (amino alcohol).
    [Show full text]